CN105349551A

CN105349551A - Corn mZmDEP gene and application of expression suppression structure thereof to corn adversity-resistance breeding

Info

Publication number: CN105349551A
Application number: CN201510916723.0A
Authority: CN
Inventors: 张举仁; 李朝霞; 解光宁
Original assignee: Shandong University
Current assignee: Shandong University
Priority date: 2015-12-10
Filing date: 2015-12-10
Publication date: 2016-02-24
Anticipated expiration: 2035-12-10
Also published as: CN105349551B

Abstract

The invention discloses a corn mZmDEP gene and application of an expression suppression structure thereof to corn adversity-resistance breeding. A nucleotide sequence of the corn mZmDEP gene is shown as SEQ ID No. 1; a coded amino acid sequence is shown as SEQ ID No. 2; the expression suppression structure of the corn mZmDEP gene refers to an anti-sense expression structure of the nucleotide sequence shown as SEQ ID No. 1 and an RNAi structure of the nucleotide sequence shown as SEQ ID No. 1, wherein the RNAi structure is built by fragments in front 628 nucleotide areas of SEQ ID No. 1; the corn adversity-resistance refers to corn drought tolerance and salt tolerance. Tests verify that a transgenic line obtained by the corn mZmDEP gene shows remarkably improved drought tolerance and salt tolerance, the adaptation of corn plants to environment and corn yield under conventional cultivation conditions are improved, and a good application value is achieved in corn breeding.

Description

A kind of corn mZmDEP gene and its expression inhibiting structure application in corn breeding for stress tolerance

Technical field

The invention belongs to crop bioengineering breeding field, specifically, relate to a kind of corn mZmDEP gene and its expression inhibiting structure application in corn breeding for stress tolerance.

Background technology

DEP1 (denseerectpanicle1) gene is that first Fu Xiangdong etc. reports (Fu Xiangdong, yellow just refined to Liu before loyal money in paddy rice, 2008.06.05, vertical compact panicle gene and application thereof, application number 200810111529.5, Authorization Notice No. CN101597610B), relevant to the vertical compact panicle of paddy rice, called after is to Dep1.Patent in 2008 is the application of this gene in the transformation of paddy rice vertical compact panicle plant type, the paddy rice vertical compact panicle gene sequence of this patent requirements protection sudden change and aminoacid sequence thereof, and has other nucleotide sequence and the complementary sequence thereof of coding phase homopolypeptide; This patent is also claimed utilizes these sequence construct expression vectors and for the production of the method for transgenic plant; improving the purposes in crop plants lodging tolerance, spike number and grain number per spike, photosynthetic efficiency or raising crop plants productive phase population growth rate or Dry-matter production with these polynucleotide sequences and its construct and carrier, wherein said plant is paddy rice.After a while, Fu Xiangdong etc. pass through qtl analysis, the main effect QTL that a nitrogen efficiency utilization is relevant is detected, by its called after qNGR9 (aQTLfornitrogengrowthresponsesinchromosome9) between paddy rice Chromosome 9 SSR marker RM3700 and RM7048.Utilize the method for map based cloning, they by candidate NGR9 gene Fine Mapping in the interval of 14kb.By order-checking comparative analysis, to determine NGR9 candidate gene be known rice high yield gene DEP1,2011 they by result of study application the patent of China and U.S.A.To be this gene strengthen in lodging resistance application at the fertilizer utilization efficiency improving farm crop (paddy rice) and photosynthetic efficiency, reduction farm crop (paddy rice) plant height to this patent that (Fu becomes big Liu Xue English king bolt-lock to Wu elder brother money toe-out, 2011.01.27, the new opplication of upright dense cluster genes in improvement of utilization efficiency of nitrogen fertilizer, application number 201110029759.9, Authorization Notice No. CN102174527B).Claim is " application of vertical compact panicle gene; it is for improving the fertilizer utilization efficiency of farm crop; improve photosynthetic efficiency, reduces farm crop plant heights and strengthen lodging resistance, and described application generates transgenic crop in described farm crop by being proceeded to by vertical compact panicle gene and realizes ".In the description, contriver reports the pUbi:dep1 vector corn that will build, and obtains the corn of process LAN dep1 gene.The corn of process LAN dep1 gene shows half Dwarfing phenotypes too, leaf color becomes deep green, and photosynthetic efficiency improves 25.6% than contrast corn, and leaf angle diminishes, propose vertical compact panicle gene can be used for improving the planting density of corn and increase Canopy Apparent Photosynthesis, and then improve output.In corn, Fu Xiangdong etc. have cloned homologous gene and corn ZmDEP1-1 and ZmDEP1-2 of 2 paddy rice DEP1 genes.ZmDEP1-1 is 52.60% with the similarity of paddy rice DEP1, and the similarity with paddy rice dep1 only has 37.74%; ZmDEP1-2 is 36.07% with the similarity of paddy rice DEP1, and the similarity with paddy rice dep1 only has 31.13%.

Phylogenetic analysis draws, the group at the DEP1 place of paddy rice comprises 1 paddy gene (Os09T0441900-01, i.e. DEP1 gene), 3 corn genes (GRMZM2G001660, GRMZM2G172320 and GRMZM2G028726), 3 wheat cdnas and 2 Chinese sorghum genes.Arabidopsis gene the most close is with it AT5G20635AGG3 (ARABIDOPSISGPROTEINGAMMASUBUNIT3), and an atypical Heterotrimeric G-Protein γ subunit of encoding, the latter participates in guard cell K ⁺passages regulate and morphological development, and Abscisic Acid stimulation is responded, certain effect may be played in plant stress-resistance mechanism.According to aminoacid sequence, the similarity of paddy rice DEP1 and corn GRMZM2G001660T01 (corresponding to ZmDEP1-1) and GRMZM2G172320T01 (corresponding to ZmDEP1-2) is the highest, secondly high with the similarity of GRMZM2G028726T02.GRMZM2G001660 is positioned on corn No. 2 karyomit(e)s, and GRMZM2G172320 is positioned on corn No. 7 karyomit(e)s, and GRMZM2G028726 is positioned on corn No. 1 karyomit(e).The function of these 3 genes is still unclear at present.

(white light is red in the kernel traits in maize association analysis that Li Jianshengs in 2014 etc. report based on ZmDEP1 gene, Li Lin, Yang little Hong, Li Qing, Wu Penghao, Li Jiansheng Xinjiang Agricultural Univ journal, 2014, 37 (5): 356 ~ 361), they have cloned the homologous gene ZmDEP1 with rice grain output genes involved OsDEP1 by the method for homologous clone from corn, find two QTL (q300k20 and qgrwt6 that this gene and corn grain heavy phase are closed simultaneously, be positioned at 7.02Bin) locate altogether, supposition be one may be relevant to corn yield candidate gene.Utilize association colony to carry out candidate gene association analysis to this gene, the SNP site S182 finding this gene 3 ' UTR is heavy to grain relevant with seed volume in both environments, infers that may be one affects that corn grain weighs, the functional site of volume.But in the document of retrieval, have not been reported about corn mZmDEP gene and its expression inhibiting structure (antisense construct of mZmDEP and its RNAi structure) application in corn breeding for stress tolerance.

Summary of the invention

For current present Research, the invention provides a kind of corn mZmDEP gene and its expression inhibiting structure application in corn breeding for stress tolerance.

Corn mZmDEP gene of the present invention and its expression inhibiting structure application in corn breeding for stress tolerance:

Wherein, the nucleotide sequence of described corn mZmDEP gene is as shown in SEQIDNo.1; The aminoacid sequence of its coding is as shown in SEQIDNo.2; The expression inhibiting structure of described corn mZmDEP gene refers to the RNAi structure of nucleotide sequence shown in the antisense expression structure of nucleotide sequence shown in SEQIDNo.1 and SEQIDNo.1, and wherein said RNAi structure is built by the fragment in front 628 nucleotide region of SEQIDNo.1 to form; Degeneration-resistant drought tolerance and the salt tolerance referring to corn of described corn.

The macromethod that corn mZmDEP gene of the present invention and its expression inhibiting structure are applied in corn breeding for stress tolerance is: in plant expression vector, insert mZmDEP gene overexpression structure, mZmDEP gene antisense expression structure, ZmDEPRNAi structure respectively, utilize transgenic technology that they are imported maize cell and regeneration plant respectively, filter out resistance and high-yielding transgenic corns strain from its offspring, formulate out the corn variety with drought tolerance and salt tolerance.

Concrete, corn mZmDEP gene of the present invention and the application method of its expression inhibiting structure in corn breeding for stress tolerance comprise:

The Cloning and sequence analysis of corn mZmDEP gene

The large seed plant of a plant type without considerable change has been found from corn inbred line DH4866 colony.Be separated total serum IgE with the seed of pollination 16 days fruit ears of its self progeny, reverse transcription produces cDNA.With the known gene order relevant to plant seed and output for reference, design multipair PCR primer for clone gene.Then be that template carries out pcr amplification reaction with cDNA, in the combination of primer 5 ' GCGATATCATGGGGGAGGAGGTGGC3 ' and 5 ' GCGATATCTCAGCACAAGCATCCGG3 ', amplify the band (its nucleotide sequence is as shown in SEQIDNo.1) of about 1200bp.The latter is reclaimed rear restructuring to check order in T-easey carrier.Analysis sequencing result draws, institute's clone gene and Zeamaysclone442907keratin-associatedprotein5-4mRNA homology, but sequence has notable difference.Institute's cloned sequence is translated into polypeptide, and peptide chain length is significantly less than keratin-associatedprotein5-4's.Detect Maize genome order-checking data with this gene order, show that this gene may be a mutator gene of GRMZM2G172320.Homologous gene retrieval finds, be its homologous gene at Arabidopis thaliana AT5G20635/AGG3 gene, the latter plays in degeneration-resistant mechanism effect, infers that institute's clone gene also may participate in the response of corn to adverse circumstance.In patent retrieval, find the corn ZmDEP1-1 of the report such as Fu Xiangdong and ZmDEP1-2 gene and this DNA homolog, but in sequence with institute clone gene difference greatly, be therefore mZmDEP gene by this unnamed gene.

Plant expression vector construction

Adopting fixed point restructuring or unorganized ferment to cut recombinant technology recombinates in plant expression vector by the cDNA sequence of corn mZmDEP gene, form expression of plants structure, with constitutive promoter as corn Ubiqintin gene promoter or stress induced promoter such as the promotor of RD29B gene start, transcribe with rouge alkali synthetase gene Tnos sequence in Ti-plasmids or paddy rice GluB5 albumen TgluB5 sequence ends.MZmDEP gene can just form or anti-sense versions be inserted in gene expression frame.In suppression expression structure builds, mZmDEP gene fragment is inserted into (this carrier T-DNA district insertion fusion gene PCaMV35S::mbar-Tnos in the plant expression vector of transformation based on plasmid pFGC5941, wherein PCaMV35S is cauliflower mosaic virus 35SRNA promotor, uses the careless fourth phosphine resistant gene bar of the codon replacement of corn bias), produce the RNAi structure ZmDEPRNAi of interference ZmDEP gene.The two-arm of RNAi structure be mZmDEP gene fragment that complementary length is equal (before opening code-reading frame 631bp fragment in, the fragment that 150 ~ 628bp is long can be chosen).MZmDEP fusion gene and ZmDEPRNAi structure are recombinated respectively in plant expression vector and are transformed for maize genetic, and the maize genetic being intermediary for Agrobacterium in Mini-Ti plasmid as restructuring transforms.

Maize genetic transforms

Different transgenic methods is selected to obtain transgenic plant according to the feature of transgenic acceptor.The present invention adopts agriculture bacillus mediated heredity method and particle bombardment to carry out maize genetic conversion.

In the genetic transformation being material with corn inbred line rataria or embryo callus, get 9 ~ 15 days corn inbred line fruit ears after pollination self, peel off bract, be placed in 70% alcohol and soak 5min, under aseptic condition, the rataria of picking about 1.0 ~ 1.5mm size is inoculated on inducing culture, inducing culture 2 ~ 3 days, as the acceptor material of genetic transformation; Or from the rataria induced embryonic callus cultivated, namely after IMMATURE EMBRYOS CULTURE 4-6 week, obtaining crisp, flaxen II type callus, every 10-15 days succeeding transfer culture are once later.II type callus can be used as the acceptor material of genetic transformation.

Ordinary method is adopted to prepare particle gun bullet.Namely take the bronze of 1.0 μm of sizes, after 70% washing with alcohol, leave standstill 15 minutes, centrifugal segregation supernatant liquor; Thoroughly clean 3 times with sterilized water again, then store for subsequent use with 50% sterile glycerol suspension (final concentration is the micro-bullet of 60mg/ml).During use, vortex breaks bronze aggegation in 5 minutes, adds 5 μ l plasmid DNA (1 μ g/ μ l), 50 μ l12.5MCaCl successively ₂, 20 μ l0.1M spermidines, application of sample limit, limit vortex.Vortex left standstill 1 minute after 2 ~ 3 minutes.Centrifugal abandon supernatant liquor after, add 70% ethanol leave standstill.Then centrifugally abandon supernatant liquor, then use dehydrated alcohol resuspended, sampling is added on micro-missile-borne body.Micro-bullet consumption is for often to play 0.5mg.

In the culture dish of diameter 9cm, pour the thick substratum of 0.4cm into, then callus high-density is put into culture dish, every ware bombardment once.Bombardment parameters is got: the distance can splitting disk and carrier is 2.5cm, and the distance that carrier is netted with stop is 0.8cm, micro-bullet flying distance 6 ~ 9cm.Other parameter presses working instructions value.After bombardment, material renewal cultivation 3 days darkling, then proceeds to material in the new substratum of components unchanged and cultivates 3 weeks, the target gene proceeded to is given full expression to.Again material is proceeded to be added with selective agent (as 0.08% weedicide grass fourth phosphine ( hoechstScheringAgrEvoGmbH, containing weedicide glufosinateammonium) the enterprising row filter of substratum.Step sizing three generations, per 15 days generations.The tissue block of browning death is eliminated during subculture.Through the resistant calli of screening proceed to do not add selective agent substratum in illumination 16 hours/after renewal cultivation 1 generation of the world, proceed on division culture medium and break up seedling.The seedling that callus produces is taken root in root media, moves into flowerpot, plant large Tanaka, self-fertility when growing to about 10cm height after strong sprout.

Utilizing agrobacterium-mediated transformation to carry out in genetic transformation to maize bud point, the seed of maize elite inbred line first rocks immersion 8 minutes with 70% ethanol, then rocks immersion 8 ~ 12 minutes with 0.1% mercury chloride, then with sterilized water washing 3 ~ 5 times.After sterilizing, seed is placed in aseptic triangular flask and sprouts, and puts into a small amount of sterilized water 1-2 days under dark condition (25 ~ 28 DEG C) in bottle.After Seed sprouting (showing money or valuables one carries unintentionally), place it in modified MS medium and sprout under dark condition.When plumule elongation stops 3 ~ 4 centimetres, peel off coleoptile and 2 ~ 3 spires, emergent stem pointed tip growing tip.Infect with the agrobacterium tumefaciens (AGL1 or LBA4404) with binary vector (Mini-Ti plasmid with the fusion gene of herbicide resistance gene bar and mZmDEP mutant gene sequence, comprising justice or inverted defined gene or ZmDEPRNAi structure) being in logarithmic phase.Bacterium liquid under 3000r/min centrifugal 10 minutes, abandons supernatant liquor; Thalline 1/2MS liquid nutrient medium washing, collected by centrifugation.Again the 1/2MS liquid nutrient medium of thalline with interpolation 100 μm of ol/l Syringylethanones is suspended, be diluted to OD ₆₀₀0.2 ~ 0.4,0.5 × 10 ⁵corn transformation is carried out under Pa normal atmosphere.Bud point aseptic filter paper after dip-dye blots, then germinating seed is placed in modified MS medium and cultivates 2 ~ 3 days (culture temperature is 22-24 DEG C) in dark, cultivate 2 days under diffuse light again, then aseptic seedling is transplanted in the flowerpot being covered with upper strata vermiculite lower floor loam, and covers plant top with vermiculite.Plant grows under natural lighting, day temperature 22 ~ 28 DEG C, night, temperature 15-21 DEG C, watered 1/2 modified MS medium inorganic salt every other day.After transformed plant grows 3 leaves, spraying herbicide the aqueous solution, concentration is 9.6ml-10.8ml fall drop with plant to be advisable.Unconverted adjoining tree generally stops growing after 4 days after spraying, starts death after 7 days.After spraying, some individual changes are similar with adjoining tree, and other individual continued propagation, change not obvious for transformed plant.When the plant that survives grows to 5 leaf, by its field planting to field, artificial autocopulation pollinates.Proceed herbicide screening to T1 for plant, resistant plant carries out PCR detection.

The qualification of transformed plant

Extract Herbicid resistant seedling leaf DNA and be used for PCR detection.According to the primers of riddled basins bar and goal gene, carry out PCR detection respectively.The band of bar gene and mZmDEP gene has been amplified respectively from transfer-gen plant.Primer sequence is that transgenosis is special, in transfer-gen plant, the size of pcr amplified fragment is consistent with the amplified band (positive control) carrying these plasmids (carrying goal gene) respectively, and the object band of formed objects does not appear in not genetically modified adjoining tree (negative control).Proceed PCR to T2 for plant to detect.At some T2 in strain, foreign gene segregation ratio meets Mendelian inheritance ratio, is tentatively defined as the strain of transgenosis genetic stability.Southernbloting qualification and RT-PCR detection are carried out to selected transgenic line.Determine by Southernbloting qualification the number of sites that transgenosis is inserted, tentatively determine genetically modified expression intensity according to RT-PCR result, select the strain that transgenosis list copy inserts and expression intensity is higher to carry out subsequent detection.

Adopt the transgenic corn plant that particle bombardment obtains, general transgenosis is incorporated into the genome of corn with multiple copied form, and offspring easily produces gene silencing phenomenon.In order to obtain the transfer-gen plant that single copy inserts, the plant of the PCR positive and acceptor self-mating system being backcrossed, from backcross progeny, selecting transgenosis list to copy the plant inserted.The latter's selfing isozygoty after for Resistance detecting and yield assessment.

The drought resistance of transfer-gen plant detects

With acceptor self-mating system plant for contrast, the transgenic homozygous strain from different independent transformants is selected to carry out resistance mensuration.

Under normal growing conditions, corn turns mZmDEP gene plant, turn ZmDEPRNAi structure plant and acceptor self-mating system plant slightly difference in 3 leaf phase phenotypes, and transfer-gen plant is bigger than normal compared with acceptor self-mating system.Biomass analysis draws, under normal growing conditions, and bigger than acceptor self-mating system plant of 3 leaf phase transfer-gen plant overground parts, but underground part difference is not obvious.The transgenic plant of 3 leaf phases and acceptor self-mating system seedling are carried out arid lethal experiment simultaneously, and after 6 days Stress treatments, the little seedling leaf of acceptor self-mating system is seriously wilted, close to withered, and basal part of stem deliquescing, recovery is most plant death after watering; Process LAN mZmDEP gene seedling, turn mZmDEP inverted defined gene seedling and turn ZmDEPRNAi structure seedling drought resistance and significantly improve, although drought resisting degree because strain is different obvious difference, the drought resistance of most strain is apparently higher than acceptor self-mating system.Recover after drought stress to water, most transgenic line can comparatively fast restore normal growth.

For assessment bloom before drought stress impact that transgenic corn plant grow, start to control soil moisture content when plant grew to for 10 leaf phase, maintenance soil relative water content, at about 50%-55%, makes plant be subject to drought stress.Recovery afterwards is normally watered to process 8 days, and plant started to take out hero after one week.Observe the character mutation of transgenic corn plant and non-non-transgenic control lines in stress during drought stress, and the every physical signs of mensuration of drawing materials respectively.Under normal growing conditions, turn the strain of mZmDEP gene justice or anti-sense versions respectively or turn the strain of ZmDEPRNAi structure, plant above ground morphological specificity is not obvious with speed difference compared with acceptor self-mating system of growing.After being subject to drought stress, comparatively early there is lack of water symptom in acceptor self-mating system plant, at Continuous Drought after 5 days, blade turns yellow, withered, and turn the strain of ZmDEP gene justice or anti-sense versions respectively or turn the strain of ZmDEPRNAi structure, the blade wilting mild degree of plant, leaf look comparatively emerald green, and the strain that some of them turn ZmDEPRNAi structure is done well.Under normal growing conditions, the mda content of transgenic line and acceptor self-mating system and cytolemma Ion leakage are without significant difference.Secondly along with the prolongation of drought stress time, mda content and cytolemma Ion leakage rate obviously raise, and the elevation amplitude of its transfer mZmDEP gene strain is all less, for turning ZmDEPRNAi structure strain, again for turning the strain of mZmDEP inverted defined gene.After coercing 8 days, turn the strain of mZmDEP gene or RNAi structure, their mda content and cytolemma Ion leakage rate all remarkable in acceptor self-mating system.After recovery is watered 7 days, compared with contrast self-mating system, turn mZmDEP gene strain and still keep lower level with the mda content and Ion leakage rate turning ZmDEPRNAi structure, namely cell damage is light.

In order to study drought stress to the photosynthetic impact of milpa, determine transgenic corns strain and Net Photosynthetic Rate, the stomatal conductance of acceptor self-mating system under normal growing conditions, drought stress conditions and rehydration condition.Normally watering under water condition, turning the strain of mZmDEP justice gene, turn the strain of mZmDEP inverted defined gene, or turn the strain of ZmDEPRNAi structure, its plant Net Photosynthetic Rate is a little more than acceptor self-mating system plant.In drought stress process, along with stress time the different corn strain of prolongation between difference strengthen gradually.In whole stress during drought stress, compared to acceptor self-mating system, turn the strain of mZmDEP justice or inverted defined gene or ZmDEPRNAi structure respectively, the Decrease in Net Photosynthetic Rate of plant is comparatively slow.As when drought stress 6 days, the Net Photosynthetic Rate turning mZmDEP justice gene strain is reduced to during Stress treatment 0 day about 51.9%, is significantly higher than (being 0 day 41.3%) of acceptor self-mating system.In stress during drought stress, the variation tendency of stomatal conductance with Net Photosynthetic Rate, turns the strain of mZmDEP justice or inverted defined gene, ZmDEPRNAi structure respectively, and the stomatal conductance of plant is significantly higher than acceptor self-mating system.Stomatal conductance declines and causes CO ₂supply reduces, and this is considered to the important limiting factor that in stress during drought stress, photosynthesis declines.In addition, after recovery is watered 7 days, the Net Photosynthetic Rate of all strains and pore lead angle value to be increased all to some extent, turn respectively in the strain of mZmDEP justice or inverted defined gene or ZmDEPRNAi structure, all has the Net Photosynthetic Rate of some strains and pore to lead angle value all higher than acceptor self-mating system.After photosynthetic capacity stronger under drought stress and rehydration, recovery rate shows faster, and turn the strain of mZmDEP justice or inverted defined gene or ZmDEPRNAi structure respectively, plant drought-resistant ability is improved significantly.

In drought tests rain-proof shelter, milpa before blooming is carried out to the drought stress of continuous 6 weeks, then recover normally to water, observe transfer-gen plant during this period and contrast the character mutation of self-mating system plant under drought stress, statistics single plant yield and cell production after results.Result shows the strain turning mZmDEP justice or inverted defined gene or ZmDEPRNAi structure respectively, and growing of plant is influenced less, and grain yield is high.

The salt tolerance of transfer-gen plant detects

In salt tolerance detects, the seed of drying is sowed at sand basin (diameter 10cm of the same size, high 15cm) in, pouring is containing the aqueous solution of different concns NaCl (0,100mM, 150mM, 200mM) respectively, and 2 leaf after dates water the constant 1/2MS substratum inorganic salt solution of NaCl concentration respectively.The every concentration of each strain broadcasts 30 seeds, i.e. every 6, basin, repeats for 5 times.Be consistent between each basin of irrigation amount, observe the reguarity of seed sprouting situation and seedling every day, and avoid drenching with rain.15 days, 25 days and 35 days time add up seeding ratio (1 leaflet expose sand think emerge), 3 leaf phase surviving rates and 5 leaf phase surviving rates respectively.In salt stress treating processes, measure process plant and untreated (pouring liquid in do not add NaCl, i.e. 0 concentration NaCl process) physical signs of plant, comprise photosynthetic parameters, ion content, RWC, chlorophyll content, cytosol gesture, soluble sugar and proline content, cytolemma Ion leakage, mda content and biomass.Measurement result shows, turns the strain of mZmDEP justice gene respectively, turns the strain of mZmDEP inverted defined gene, turns the strain of ZmDEPRNAi structure, and their seed germination rate under condition of salt stress is significantly higher than wild-type, and seedling growth better.Wherein part strain germination rate under the process of 150mMNaCl concentration is about 95%, and be about 2.5 times of acceptor self-mating system, seedling injury is lighter.If carry out salt stress process to 5 leaf phase seedlings, NaCl concentration is incremented to final concentration 200mM with 50mM every day, and then once, salt concn is constant in pouring every day.Salt stress process is after 15 days, and transfer-gen plant growing way is obviously better than adjoining tree, and the seedling of acceptor self-mating system is seriously in damaged condition, and about half is dead.

Measure the change of the physiological parameter of different strain seedling under condition of salt stress, draw no matter transfer-gen plant or acceptor self-mating system plant, the Na in blade and root ⁺content all obviously raises, K ⁺content first slightly raises and then reduces.Compared with acceptor self-mating system plant, transfer-gen plant Na ⁺increasing amount is few, K ⁺reduction amplitude is little, the Na of part strain ⁺, K ⁺content is significant difference compared with acceptor self-mating system, and K ⁺/ Na ⁺ratio is also significantly higher than acceptor self-mating system plant.Under condition of salt stress, the chlorophyll content of all strains is all first have to raise by a small margin then to decline with different rates, but turn the strain of mZmDEP justice and inverted defined gene respectively or turn the strain of ZmDEPRNAi structure, the chlorophyll content of plant is significantly higher than acceptor self-mating system plant processing the after date phase.Photosynthetic rate, stomatal conductance, intercellular CO ₂the measurement result display of concentration and PS II Photochemical Efficiency, under long period NaCl Stress treatment, photosynthetic rate significantly reduces and to reduce due to stomatal conductance and PS II complex body activity suppressedly causes jointly.But in salt stress process, turn the strain of mZmDEP justice or inverted defined gene respectively or turn the strain of ZmDEPRNAi structure, plant shows obviously higher photosynthetic rate, stomatal conductance and maximal photochemistry efficiency (Fv/Fm), namely can synthesize more carbohydrate in salt stress process.

Under condition of salt stress, leaf cell solute potential reduces gradually along with the increase of stress time, but the solute potential of partial transgenic strain is significantly lower than acceptor self-mating system plant, namely has a stronger water conservation and absorbs the ability of moisture.Compared with acceptor self-mating system plant, turn the strain of mZmDEP justice or inverted defined gene or ZmDEPRNAi structure respectively, plant leaf contains more soluble sugar and proline(Pro).These results show, under condition of salt stress, the more soluble substance of transgenic line thin intracellular accumulation (comprises Na ⁺with proline(Pro) and soluble sugar etc.), the solute potential making cell remain lower, is conducive to the growth of cell eubolism and photosynthesis and plant.Under condition of salt stress, turn mZmDEP justice or the strain of inverted defined gene or the strain of ZmDEPRNAi structure respectively, plant shows lower MDA level and Ion leakage rate, shows that damaged membrane degree is less than adjoining tree, and this and transfer-gen plant have higher PS II active consistent.

In the transgenic line of beach saline land plantation and the test-results display of acceptor self-mating system, some turn the strain of mZmDEP justice or inverted defined gene or ZmDEPRNAi structure, survival and growth growth in saltings is obviously better than acceptor self-mating system, individual plant greenery number is higher than acceptor self-mating system, economic characters are significantly better than acceptor self-mating system as yield per plant and output etc., show the salt tolerance significantly improved.

Difference under comprehensive arid and high-salt stress condition in the physical signs of different strain plant and output, draw and turn mZmDEP justice or inverted defined gene or turn the strain of ZmDEPRNAi structure, plant run into coerce time cytosol content increasing degree larger, decrease the loss of cell moisture, cell membrane damage is little, photosynthetic capacity is stronger, growing of plant is influenced less, therefore grain yield is high, show the drought resistance and salt tolerance obviously improved, stressful environmental can be adapted to better compared with acceptor self-mating system plant.

The invention has the beneficial effects as follows: the invention provides a kind of corn mZmDEP gene and its expression inhibiting structure (the antisense expression structure of mZmDEP and its RNAi structure) application in corn breeding for stress tolerance.Though do not know the effect of mZmDEP gene in corn, gene disclosed by the invention with higher plant constitutive promoter (cauliflower mosaic virus CAMV35SRNA gene promoter P35S, or corn Ubiquitin1 gene promoter Pubi) merge after, corn is proceeded to respectively with the form of mZmDEP justice and inverted defined gene form or ZmDEPRNAi structure, transgenic line shows the drought resistance and salt tolerance that significantly improve, improve the adaptability of milpa to environment, the grain yield of corn can be improved under conventional cultivation condition, good using value is had in corn breeding.

Embodiment

Embodiment 1: process LAN corn mZmDEP gene creates drought-resistant maize self-mating system

1) structure of mZmDEP gene overexpression carrier adopts fixed point recombinant technology to recombinate in plant expression vector pB7WG2.0-P35S::bar-Tnos-Pubi::MCS-Tnos by restructuring to the cDNA sequence of the corn mZmDEP gene of entry vector pENTR11, produces plant conversion carrier pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP-Tnos.Utilize freeze-thaw method the latter to be imported in agrobacterium tumefaciens LBA4404, and adopt PCR method to identify.

2) foundation of receptor system with Inbred Lines used in China's agriculture production for material, as the selfed seed of Zheng 58, prosperous 7-2,6WC etc.Isolated culture induction stem apex produces grows thickly sprout tuber, carries out genetic transformation with the sprout tuber that grows thickly for acceptor.Used medium has:

A substratum: for seed germination, comprises KNO ₃1900mg/l, NH ₄nO ₃1650mg/l, CaCl ₂2H ₂o440mg/l, MgSO ₄7H ₂o370mg/l, KH ₂pO ₄h ₂o170mg/l, FeSO ₄7H ₂o27.8mg/l, ZnSO ₄7H ₂o10mg/l, MnSO ₄4H ₂o22.3mg/l, H ₃bO ₃10mg/l, KI0.83mg/l, Na ₂moO ₄2H ₂o0.5mg/l, CuSO ₄5H ₂o0.025mg/l, CoCl ₂6H ₂o0.025mg/l, vitamin 20.0mg/l, pyridoxine hydrochloride 1.0mg/l, nicotinic acid 1.0mg/l, inositol 100.0mg/l, sucrose 20g/l, agar powder 7g/l, pH5.8 ~ 6.0.

B substratum: A substratum additional bio element 0.05mg/l, casein hydrolysate 500mg/l, proline(Pro) 200mg/l, sucrose 10g/l, 6-BA4.5 ~ 9.0 μm ol/l and 2,4-D1.0 ~ 3.0 μm ol/l, produces Multiple Buds tissue block and Multiple Buds tissue block succeeding transfer culture for inducing isolated culture bud point.Liquid nutrient medium then removes agar powder.

C substratum: A substratum additional bio element 0.05mg/l, casein hydrolysate 500mg/l, proline(Pro) 200mg/l sucrose 10g/l, 6-BA4.5 μm of ol/l and IBA (indolebutyric acid) 1.8 μm of ol/l, for Multiple Buds tissue block differentiation seedling.

D substratum: A substratum adds casein hydrolysate 200mg/l, sucrose 10g/l, μm ol/l and IBA3.6 ~ 4.5,6-BA2.25 ~ 4.5 μm ol/l, for growing thickly, budlet develops into seedling.

E substratum: A substratum adds IBA2.8 ~ 5.6 μm ol/l, for the little seedling rooting of unrooted.

Substratum and plant growth regulating substance pressure sterilizing; Microbiotic and weedicide isoreactivity composition filtration sterilization, add after medium sterilization.

Seed sterilization and sprouting: corn seed 70% alcohol immersion 8 minutes, then soak 10 ~ 15 minutes with 0.1% mercury chloride, then with sterilized water washing 3 ~ 5 times.After sterilizing, seed is placed in aseptic triangular flask and sprouts, and puts into a small amount of sterilized water in bottle, is placed on 1--2 days under dark condition (23 ~ 28 DEG C) after sealing.Sprout (showing money or valuables one carries unintentionally) afterwards seed to be placed on A substratum and to continue to sprout under dark condition.

Stem tip culture and the induction of Multiple Buds tissue block, subculture, differentiation: the plumule of germinating seed extend only 3 ~ 5 centimetres time, peel off coleoptile and spire, cut the epicotyl and stem apex that are about 3 millimeter, be inoculated into (24 ~ 27 DEG C) cultivation under dark on B substratum, and cut the plumular axis of elongation in time and peel off spire.Cultivate after 6 ~ 10 days, stem apex starts irregular growth of expanding, and the meristematic tissue expanded occurs warty or digitation.After 20 days, form indefinite bud and embryoid on the surface of warty or digitation.In succeeding transfer culture, if tissue block is grown thickly, budlet is on the high side, and 2,4-D concentration get 3.0 μm of ol/l; If Multiple Buds tissue block callusization is heavier, surperficial indefinite bud is few, can by 2, and 4-D concentration reduces to 1.0 μm of ol/l, continues to cultivate then to regenerate a large amount of warty or digitation.Multiple Buds tissue block on B substratum, minority has the generation of adventive root.Exist the same with spire, what adventive root also affected tissue block expands growth and embryoid and the generation of budlet of growing thickly, and needs to remove early.

3) conversion and plant regeneration

By the agrobacterium tumefaciens LBA4404 with binary vector (Mini--Ti plasmid pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP-Tnos), at additional antibiotic YEP substratum, (often liter of substratum contains: tryptone 10g, yeast extract 5g, NaCl5g, pH7.0, autoclaving) at 28 DEG C concussion cultivate, concussion speed is 110rpm (rev/min), makes bacterium be in logarithmic phase.Then at 3,000 rpm centrifugal 10 minutes, supernatant liquor is abandoned.The thalline liquid B substratum of 1/2 concentration washs, collected by centrifugation.Again the liquid B substratum of thalline by 1/2 concentration of adding Syringylethanone (acetosyringone, As) 100 μm of ol/l being suspended, diluting 5 ~ 8 times for transforming.

The Multiple Buds tissue block of cultivating 13 ~ 20 days after getting subculture is transgene receptor.With Agrobacterium-mediated transformation 10 ~ 15 minutes.After transforming, material carries out renewal cultivation darkling.Grow thickly budlet or the Multiple Buds tissue block of agroinfection are cultivated 7 ~ 12 days on the substratum being added with cephamycin (Cefotaxime) 250mg/l or Pyocianil (Carb) 500mg/l in dark, bacteria growing inhibiting.The budlet or grow thickly sprout tuber step sizing 3 ~ 4 generation on the substratum being added with selective agent grass fourth phosphine 0.08% of growing thickly after renewal cultivation or after micro-organisms, obtains transgenic cell and budlet.In screening and culturing, absolutely large number Multiple Buds tissue block is dead gradually, the tissue block of survival is transferred to remove 2 without selective agent, and the B substratum of 4-D breaks up budlet.

Budlet is placed on seedling substratum and grows under irradiation, light intensity 2000-3000lx, illumination 14-15 hour/day.Seedling proceeds in root media when growing to 3-4 sheet leaf takes root.Cultivate about 15 days, the seedling of about 40% produces new root.For seedling of not taking root, its base portion of cut wound, transfers on new root media and cultivates, and after 10 days, most of plant produces root system.After seedling of taking root washes away substratum, be transplanted to vermiculite be cultivation medium flowerpot in grow.Plant grows under natural lighting, day temperature 22 ~ 28 DEG C, night, temperature 15 ~ 21 DEG C, watered the inorganic salts ingredients of the seed germination medium of 1/2 concentration every other day.Grow about 2 weeks, nursery transplant produces flourishing root system, is then colonizated in field.

4) Resistance detecting of transfer-gen plant and selection

The blade getting transplant survival plant carries out molecular Biological Detection determination transfer-gen plant.Then by transfer-gen plant (T0) bagging self-fertility.T1 seed from different T0 plant is broadcast in greenhouse or the field with safeguards, gets blade after emerging and adopt PCR method to detect transgenosis, and smear 0.2% careless fourth phosphine solution qualification Herbicid resistant.By PCR, the positive and plantlet of transplant of Herbicid resistant is to field, bagging self-fertility after growing up.

In transfer-gen plant progeny selection, first get T2 of uniform size for transgenic seed and acceptor self-mating system planting seed in vinyl disc of the same size, the homogeneous loam of equivalent is housed in dish, and often coil sowing 20, every strain at least plants 3 dishes.Normally water, treat that seedling grew to for 3 leaf phases, choose the consistent vinyl disc of growing way and carry out drought resistance viewing test.The method of drought stress process be disposable water sufficient moisture after stop watering, until the plant leaf of most strain is withered, basal part of stem deliquescing, recover again to water, observing each strain recovering the upgrowth situation after watering, filtering out the strain that drought resistance significantly improves than acceptor self-mating system.Then carry out transfer-gen plant bloom before drought stress process.

Corn bloom before drought stress test carry out under field conditions (factors), avoid plant to drench with rain during Stress treatment.Choose T2 for transgenic seed and acceptor self-mating system planting seed in large flowerpot of the same size, when plant grew to for 5 leaf phase, every basin stays seedling 2 strain, namely contrasts 1 strain, transgenic plant 1 strain.Plant grows to 10 leaves normally watering under water condition, then chooses the consistent milpa of growing way and is divided into two groups, one group be in drought condition under grow, soil absolute water content remains on about 15-17%, continues process one week, then recovers normally to water.Another group remains under abundance waters water condition and grows, in contrast.Often group establishes 6 repetitions.Osmotic treatment group in the pouring of control water in earlier stage, wilt by plant by day 9 ~ 18 times blades, and night, blade recovered to stretch; In the control water pouring later stage, blade continues to wilt.After recovery is normally watered one week, plant starts to take out hero.(blade the morning 8 time about start to wilt) is designated as drought stress process 0 day to control plant to water the 1st day, sampling after normally watering one week in 0,2,4,6,8 day that processes and recovery, measures RWC, cytolemma Ion leakage rate, mda content, soluble sugar content, proline content and photosynthesis index etc. respectively.Measure plant height and greenery number flowering period after Osmotic treatment, statistics is bloomed and weaves silk the timed interval (Anthesis-silkinginterval, ASI).The mensuration of Pollen Activity adopts IKI staining, in low power Microscopic observation, statistics Pollen Activity.

The milpa of experience 8 days drought stresses, recovery starts to take out hero after watering one week, and the phase is added up plant plant height and holds the green number of blade at this moment.Normally watering under water condition, the phenotypic difference growing and exist between acceptor self-mating system of transfer-gen plant is not obvious, and the measurement result of some indexs also demonstrate that observation conclusion.Determination of yield shows that the strain cell production of process LAN mZmDEP gene is 105% ~ 116% of acceptor self-mating system.Before blooming, drought stress process is after 8 days, and the average plant height of all strains all significantly reduces, but the amplitude reduced between different corn strain is different.Compared to the same strain plant normally watered under water condition, it is about 10% that the plant height of transfer-gen plant reduces amplitude, and the amplitude that reduces is lower than 15% of contrast self-mating system.After experience drought stress, hold green number of blade significant difference between different strain, the greenery number turning mZmDEP gene plant is higher than contrast self-mating system.The female tassel of drought stress before blooming to milpa is grown and is created deep effect.After Osmotic treatment, the flowering time of all corn strains is postponed, and the normal pollen quantity of plant reduces and pollen sterile quantity raises, and female tassel is grown inharmonious.To turning mZmDEP gene plant, drought stress blooms-weaves silk that the impact in the timed interval (Anthesissilkinginterval, ASI) is less than acceptor self-mating system.After drought stress, acceptor self-mating system plant pollen amount is few, and it is more to turn mZmDEP gene plant pollen amount.The flower pesticide getting different strain adopts the dyeing of IKI method to carry out cytological observation, and find out in the pollen granule of acceptor self-mating system plant and only have smaller portions to be contaminated for blueness, major part presents light tan.And the normal loose powder of tassel energy of transfer-gen plant, most POLLEN MORPHOLOGY is normal, and after pollen granule is dyeed by IKI, major part is mazarine by dye, and color is darker.Namely the pollen abortion rate of acceptor self-mating system plant is high, and transfer-gen plant is grown normal at its pollen majority after drought stress process, and vitality is strong.

5) Resistance Identification of transgenic line and utilization

Transgenic corns and acceptor self-mating system seed being sowed at drought resistance detects in canopy, controls irrigation amount, makes soil relative water content remain on about 50%-55%, carry out drought stress to plant, continue 6 weeks, then water sufficient moisture when plant to be planted grew to for 10 leaf phase.Observe the difference of growing of plant in Osmotic treatment process.After fruit ear maturation, observation statistics is carried out to Ear Characters.After drought stress, the blade turning mZmDEP plant comparatively stretches, leaf color jade green, affects little by drought stress, and the leaf rolling of acceptor self-mating system plant is serious, and indivedual Plant Leaf look shoals.After drought stress, different strain Ear Characters and volume analysis show, the average spike length that turns mZmDEP strain is obviously greater than acceptor self-mating system.From grain weight per panicle, grain weight per panicle obvious increase compared with acceptor self-mating system of mZmDEP strain, grain weight per panicle increases by 34.1%, 29.9% than (50.8 ± 9.0g) of contrast self-mating system respectively.From 100-grain weight, though variant between each transgenic line and acceptor self-mating system, do not reach significant difference degree.These results show, turn mZmDEP gene plant and have to the drought stress run into before blooming the resistance significantly improved, reproductive development is influenced less, thus make grain yield be significantly higher than acceptor self-mating system under same condition.

Embodiment 2: turn mZmDEP inverted defined gene and create corn salt-tolerant drought-resistant self-mating system

1) structure of mZmDEP gene antisense expression vector adopts fixed point recombinant technology to recombinate in plant expression vector pB7WG2.0-P35S::bar-Tnos-Pubi::MCS-Tnos by restructuring to the inverted defined gene of the corn mZmDEP of entry vector pENTR11, produces plant vector pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP (antisense)-Tnos.Adopt freeze-thaw method the latter to be imported in agrobacterium tumefaciens LBA4404 and be used for maize genetic conversion.

2) corn aseptic seedling obtains

The seed of maize elite inbred line Zheng 58, by 70% alcohol immersion 8 minutes, then soaks 8 ~ 12 minutes with 0.1% mercury chloride, then with sterilized water washing 3-5 time.Constantly seed is rocked, to ensure that surface sterilization is thorough during sterilizing.After sterilizing, seed is placed in aseptic triangular flask and sprouts, and puts into a small amount of sterilized water in bottle, places 1 ~ 2 day under dark condition (25-28 DEG C).After Seed sprouting (showing money or valuables one carries unintentionally), place it in modified MS medium and continue to sprout under dark condition.When plumule elongation stops 3 ~ 4 centimetres, peel off coleoptile and 2 ~ 3 spires, expose stem apex growing tip.

3). Agrobacterium is cultivated and activation

Will with the agrobacterium tumefaciens LBA4404 of binary vector (Mini-Ti plasmid is pB7WG2.0-P35S::bar-Tnos-Pubi::mZmDEP (antisense)-Tnos) concussion cultivation at 28 DEG C in additional antibiotic YEP substratum, concussion speed is 110r/min, makes bacterium be in logarithmic phase.Then under 3000r/min centrifugal 10 minutes, supernatant liquor is abandoned.Thalline 1/2MS liquid nutrient medium washing, collected by centrifugation.Again the 1/2MS liquid nutrient medium of thalline with interpolation 100 μm of ol/l Syringylethanones is suspended, be diluted to OD ₆₀₀0.2 ~ 0.4 for transforming.

4) corn aseptic seedling transforms

Bacterium liquid is poured in the culture dish of 4.5 cm diameters, inclination culture dish, makes the exposed stem apex growing tip of aseptic seedling be immersed in bacterium liquid, 0.5 × 10 ⁵infect 8 ~ 12 minutes under Pa normal atmosphere.Bud point aseptic filter paper after dip-dye blots, and germinating seed is placed in modified MS medium and cultivates 2-3 days in dark, and culture temperature is 22 ~ 24 DEG C.Then aseptic seedling is put and cultivate 2 days under diffuse light.Aseptic seedling after being cultivated by irradiation is transplanted in the flowerpot being covered with upper strata vermiculite lower floor loam, and covers plant top with vermiculite.Then allow plant grow under natural lighting, day temperature 22 ~ 28 DEG C, night, temperature 15 ~ 21 DEG C, watered 1/2 modified MS medium inorganic salt every other day.

5) transformed plant screening and field planting

After transformed plant grows 3 leaves, spraying herbicide (HoechstScheringAgrEvoGmbH, containing weedicide grass ammonium phosphine glufosinateammonium) aqueous solution, concentration is 9.6ml ~ 10.8ml fall drop with plant to be advisable.Unconverted acceptor self-mating system plant stops growing after 4 days after spraying, starts death after 9 days.After spraying, some individual changes are similar to acceptor self-mating system plant, and other individual continued propagation, change not obvious for transformed plant.When the plant that survives grows to 5 leaf, by its field planting to field, bagging selfing is set seeds.

6) transfer-gen plant offspring analysis

T1 grows to 3 leaf phase 10.8ml for plant aqueous solution process, observes statistics resistance and sensitive individuals ratio; Adopt round pcr to detect foreign gene, and add up the segregation ratio of foreign gene in progeny plant.Survive plantlet of transplant to land for growing field crops, bagging selfing.T2 for plant except bagging selfing is set seeds, continue to adopt round pcr to detect foreign gene, positive strain carries out Southernblotting checking, and adopting RT-PCR technology to check the change of the expression intensity of corn GRMZM2G001660 gene, GRMZM2G172320 gene and GRMZM2G028726 gene, growth selection is grown normal and that expression of target gene level declines strain and is carried out resistance mensuration and determination of yield.

7) salt tolerance of transfer-gen plant offspring detects

Because the critical porion of corn to salt stress is Their Seed Germinating Period and little seedling stage, after 5 leaf phases, plant salt tolerance is relatively strong.It is at seedling stage and germination period that salt tolerance of corn measures emphasis.

For plant, Salt resistant test and economical character selection are carried out to T2.First T2 is got for seed, (point 3 repetitions of 60, every fruit ear, each 20), use 70% ethanol sterilizing 5 minutes, 0.1% mercuric chloride solution sterilizing 6 minutes respectively, again with sterilized water washing 3 ~ 4 times, be placed on the filter paper plate of 0.8%NaCl aqueous solution soaking with 3 centimeter apart, the latter is placed in enamel tray with cover, then the SS saline soaked gauze of 0.8%NaCl (4 layers) is used to cover, with acceptor self-mating system seed for contrast.After building enamel tray, sprout at putting into 25 DEG C.By sky observation seed germination situation after 3 days, general lasting one week.Statistics germination rate, coleoptile and kind root length, judge strain salt tolerance according to germination rate and germinating energy, select the strain that salt tolerance is significantly better than acceptor self-mating system.Selected strain answers germination rate higher than acceptor self-mating system, and coleoptile growth is very fast, and root system development is better.

Selected strain seed is broadcast respectively in the sand basin of diameter 12 centimetres, every basin 8 seeds, repeat for three times.The flowerpot random alignment of same repetition, regularly placing.Flowerpot for salt choosing is in the same size, the water vent of unified specification, and the sand of filling is homogeneous, and without earth, after watering, breakthrough rate is basically identical.After planting water 0.7% or the 0.8%NaCl aqueous solution, with acceptor self-mating system seed for contrast.Different strain shows different germination rates and growing way and survival rate under salt water irrigation, and some of them strain shows the salt tolerance significantly improved than acceptor self-mating system.At T2 in strain, 5 leaf phase survival rate of plant of salt-resistance strain are generally more than 75%, and acceptor self-mating system seedling rate only has 30% ~ 50%, and plant emerges, rear lower blade becomes withered very soon, and dead before and after 3 leaf phases, 5 leaf phase surviving rates are less than 1/8.By the plantlet of transplant of salt tolerance excellence to land for growing field crops bagging selfing, results seed.Then planting seed is in the soil of 0.3% ~ 0.5% at soil salt content, statistics seedling rate (number of emerging/sowing seed number × 100%), seedling rate (7 leaf phase plant numbers/number × 100% of emerging), Heading date and plant height, single plant yield and Ear Characters (spike length, tassel row number, row grain number, Ear weight), cell production, carry out the assessment of selection of salt tolerance and utility value, these indexs are significantly better than the strain of acceptor self-mating system under same condition and are defined as good salt tolerance and have the breeding material of utility value.

8) drought resistance of transfer-gen plant measures

For the transgenic line that selected salt tolerance is significantly improved, be contrast with acceptor selfing, measure the net photosynthetic rate of plant under normal cultivation condition and under drought stress conditions, 3-7 leaf phase seedling growth velocity and biomass, single plant yield, cell production etc.Under field cultivating condition, carry out the observation of Yield Traits In Corn after selecting excellent transgenic drought-resistant strain and compare, selecting drought resisting high yield strain to enter corn breeding experiment.Specific procedure is see example 1.

8) application of transfer-gen plant

Combining ability test is carried out to selected salt-tolerant drought-resistant transgenic line, with non-salt-tolerant inbred lines be another parent's preparing hybrid combination, F1 planting seed to soil salt content be 0.3% ~ 0.5% soil and non-saltings in, record vine growth and development phase and Other Main Agronomic Characters, measure individual plant and cell production, plot area 0.01 mu, if 4 times are repeated, planting density is 4500 ~ 5000 plants/acre.By observation and the determination of yield of the Comprehensive Traits such as salt-tolerant drought-resistant, disease resistance, lodging resistance, production index, select corn salt-tolerant drought-resistant the hybrid strain with high yield.

Embodiment 3: proceed to ZmDEPRNAi structure and create corn salt-tolerant drought-resistant self-mating system

1) structure of ZmDEPRNAi structure

PCR method is adopted to amplify in mZmDEP sequence from 150 of opening code-reading frame Nucleotide to the fragment of 628bp Nucleotide, being recombinated by 2 times, (this plasmid T-DNA district inserts fusion gene PCaMV::mbar-TgluB5 to the plant expression vector pFGC5941-mbar-P35S::MCS-CHASintron-MCS-OCSPolyA this fragment being inserted into the process transformation based on plasmid pFGC5941, wherein MCS is multiple clone site or restriction site, P35S is cauliflower mosaic virus 35SRNA promotor, the careless fourth phosphine resistant gene bar of the codon replacement of mbar corn bias, TgluB5 is paddy rice GluB5 protein gene terminator) multiple clone site place, produce ZmDEPRNAi structure.The two-arm of RNAi structure is the ZmDEP gene fragment (478bp) that complementary length is equal.

2) maize genetic transforms and the selection of transfer-gen plant and offspring thereof and utilization

Implementation method is see embodiment 1 and 2.

Claims

1. a corn mZmDEP gene and its expression inhibiting structure application in corn breeding for stress tolerance.

2. apply as claimed in claim 1, it is characterized in that: the nucleotide sequence of described corn mZmDEP gene is as shown in SEQIDNo.1; The aminoacid sequence of its coding is as shown in SEQIDNo.2; The expression inhibiting structure of described corn mZmDEP gene refers to the RNAi structure of nucleotide sequence shown in the antisense expression structure of nucleotide sequence shown in SEQIDNo.1 and SEQIDNo.1, and wherein said RNAi structure is built by the fragment in front 628 nucleotide region of SEQIDNo.1 to form; Degeneration-resistant drought tolerance and the salt tolerance referring to corn of described corn.

3. apply as claimed in claim 1, it is characterized in that: the method that described corn mZmDEP gene and its expression inhibiting structure are applied in corn breeding for stress tolerance is: in plant expression vector, insert mZmDEP gene overexpression structure, mZmDEP gene antisense expression structure, ZmDEPRNAi structure respectively, utilize transgenic technology that they are imported maize cell and regeneration plant respectively, filter out resistance and high-yielding transgenic corns strain from its offspring, formulate out the corn variety with drought tolerance and salt tolerance.