CN107406844A - The transgenic rice plant of improvement - Google Patents

Abstract

The present invention relates to rice specificity Microrna, i.e. miR820, by the gene that tiller and Floral development are effectively controlled from the Gene Isolation of India's Oryza species, clone and functional verification.It is connected the present invention relates to nucleotide sequence (nucleotide fragments containing miR820) with exogenous promoter, and wherein promoter is alternatively constitutive promoter or inducible promoter, and it is introduced into long-grained nonglutinous rice cultivar.Compared with the wild-type plant cultivated under the same conditions, transgenic rice plant has the agronomic characteristics of improvement, including bigger tiller, abundant fringe and more flowers.

Description

The transgenic rice plant of improvement

Technical field

The present invention relates to Plant genetics and plant biotechnology field.Especially, the present invention, which provides to include, has coding The genetically modified plants of the improvement of the plant cell of the recombinant DNA of rna regulation, the rna regulation negative regulation intrinsic protein are changed with causing The expression of good economical character.Especially, the present invention relates to the rice specificity amiRNA (artificial micrornas using technique for gene engineering RNA overexpression), it causes rice plant to have increased height, resistance to salt stress and increased Grain Yield.

Background technology

Plant Transformation is the important tool for understanding gene various aspects and its being acted in plant., should for commercial object Information can be used for the crop varieties of generation improvement.Rice is the important cereal crops for the world population for supporting half.However, rice is quick Feel crop, and its yield is influenceed by abiotic stress, such as salinity, high temperature, drought stress, pathogen and insect.Report The several method converted in rice.However, many such methods are not in terms of the transformation efficiency of explant and power of regeneration It is predictable.

Microrna (miRNA) is the small-sized endogenous RNA for regulating and controlling gene expression in plant and animal.MiR-96 gene is transcribed Primary miRNA (pri-miRNA) transcript is produced, it is processed to relatively bob hairpin loop structure of the length for 20-60 nucleotides, Referred to as precursor miRNA (pre-miRNA).It is double containing ripe miR to produce further to handle precursor miRNA (pre-miRNA) Serobila.In plant, they are by Dicer samples (Dicer-like) enzyme from long precursor miRNA (pre-miRNA) transcript Stem-loop region processing is simultaneously loaded into silencing complex, and they typically directly cut off and (closed, switching off) there Complementary mRNA.

Therefore, Microrna (miRNA) is a kind of endogenous non-coding RNA molecule newly identified, and it is on a molecular scale Kinetically played a major role in genome.They can regulate and control expression of target gene in a manner of sequence relies on.Microrna (miRNA) three kinds of different mechanism regulating gene expressions are passed through：(a) complementary target mRNA cutting, the suppression of (b) said target mrna translation The Transcriptional Silencing of said target mrna (c).Known Microrna (miRNA) development each Main Stage (generally in gene regulatory network Core) play many key effects, targeting is the gene of regulatory factor in itself.Although Mirnas of plant, which has, extends to hair Some conservative functions beyond educating, but the importance for the gene regulation that miRNA is guided just is becoming at present in plant development process Clearly.Up to the present, it has been found that Microrna participates in development of plants, regulation and control are abiotic and biotic responds and hormone Signal transmits (Jones-Rhoades et al., 2006, Ann Rev Plant Biol 57：19-53).

By regulating and controlling development with the change in response to various environmental conditions, plant shows outstanding plasticity.This needs Quick instantaneous or stable transcription is reprogrammed to plant responding.Plant Microrna (miRNA) has become home And under stressful environmental gene expression the important regulating and controlling factor.Rice is main cereal crops, and its production is in the current whole world Greatly threatened under climate change situation.That is, due to the various abiotic stress such as salt, high temperature and arid because Element, productivity suffer damage.Rice conversion is a challenging task, because it is relatively less in compliance with genetic manipulation. Therefore, produce and be able to maintain that the cultivar of yield is important in limited cultivable land under the weather conditions of deterioration 's.Now, it is known that Microrna contributes to regulate and control for plant growth and development and the genome for tackling stressful environmental One of principal element.The cataloguing (cataloguing) of Microrna is to understand this important cereal crops in metabolism or ring in rice The important step of physiological Mechanism under the stress of border.

Therefore, it is necessary to develop the genetically modified plants with a variety of improved agronomic traits, can particularly survive and generation is high Yield and the plant that other ideal characters are expressed in Oryza species.This will go far towards to tackle continually changing weather conditions Challenge, to the rice that increases consumption some countries to demands of food product (such as Oryza).

Goal of the invention

It is an object of the invention to provide turning for the improvement of the economical character of the improvement with such as high yield and resistance to salt stress Gene rice plant.The side of the plant vigor of plant and other agronomic characteristics in Oryza species is improved present invention also offers a kind of Method.

Brief description of the drawings

Further illustrate the present invention with reference to the accompanying drawings：

Fig. 1 is the pCAMBIA1300-amiR820 constructs for including amiR820 boxes (cassette).

Fig. 2 compares the overexpression Osa-miR820's (OX-820) compared with unconverted wild type (WT) rice plant Genetically modified plants.Compared with unconverted wild type (WT) rice plant, the plant performance of overexpression go out longer plant height, With more tiller numbers.Left experimental group (Panel) 1 shows the shape of whole OX-820 rice plants and wild type (WT) rice plant State.Plant A is the OX-820 of overexpression, and it shows the increased plant height of plant.Plant B shows wild-type plant Pusa basmati 1 (general Sabah Si Madi, general husky basmati) (PB1) plant height, have compared with Ox-820 shorter Height.Right experimental group 2 shown compared with wild type (WT) rice plant, (sagging) of more grain fillings in OX-820 Fringe.Plant C shows that more nodding ears in OX-820, and plant D show wild-type plant Pusabasmati1 (PB1), with OX-820, which is compared, has less nodding ear.

Fig. 3 compares overexpression Osa-miR820 genetically modified plants (OX-820) and unconverted plant.Transgenosis Plant shows the grain filling strengthened on the more rich branch of increased spike length, fringe and single branch of the ear of grain.Experimental group 1 is shown The plant A of overexpression OX-820 with increased spike length, and plant B are the WT for having compared with OX-820 shorter spike length Pusa basmati 1(PB1).Experimental group 2 shows the plant C OX-820 with more branch of the ear of grain, and wild type (WT) plant D shows less branch of the ear of grain.Experimental group 3 shows the plant E OX-820 with more grain, and plant F Wild type (WT) shows less Number of kernels compared with OX-820.

Embodiment

The present invention relates to using recombinant DNA (DNA) be used for express can be used for assign improvement economical character and The RNA of resistance to salt stress transgenic rice plant.Especially, the invention provides transgenic rice plant, wherein osa-miR820 quilts Overexpression, thus transgenosis rice growing kind (cultivar, kind) not only moderately coerce, and obtain higher by salt tolerant Plant height, and Grain Yield is also very high.

Present invention also offers the method for developing transgenic seed, the transgenic seed can be used for produce have by The transgenic rice plant of the plant trait of improvement caused by osa-miR820 overexpression.

On the one hand, develop the construct of the mature sequence comprising osa-miR820 and be cloned into suitable carrier In.Plant cell is converted using Agrobacterium-medialed transformation and microparticle bombardment.For the Plant Transformation based on Agrobacterium, turning Change in construct and there may be additional element, including T-DNA left margins sequence and right border sequence, to promote to recombinate more nucleosides In acid incorporation Plant Genome.Generally, recombinant DNA can be randomly incorporated into, i.e., the non-spy in the genome of target plant strain Different in nature opening position.By using suitable primer (such as with SEQ ID No：7-：5'-TCGGCCTCGTGGATGG-3''s 820-Fwd and there is SEQ ID No.8-：5'-GTGCAGGGTCCGAGGT-3' 820-Rev) PCR analyze confirm turn Change.

On the other hand, the suitable plant life for promoting cell growth is used in controlled environment using tissue culture technique Long nutrient medium grows converted cell.Can as ripe by the callus growth from this tissue culture Educate genetically modified plants and harvest seed.These seeds can be used for the growth present invention to convert plant (including for selecting expression to change The hybrid plant lines of the plant of good economical character) offspring.With recombinant DNA and that expresses the economical character of improvement turn base Because plant improves plant height, more tillers, Grain Yield and resistance to salt stress.Caused genetically modified plants pass through selection The plant for expressing the particular interest of the economical character of improvement identifies.

On the one hand, the present invention relates to the important function that Osa-miR820 (rice specificity Microrna) rises.By Dicer samples Albumen (DCL1) or the Osa-miR820 of Dicer samples albumen (DCL3) processing produce the sequence of 21 nucleotides and 24 nucleotides Row.The inventors have discovered that miR820 has dual-use function, wherein the species of 21 nucleotides is in reverse leading agronaute (AGO1) worked in the cutting of DNA (DNA) transmethylase of mediation, and the species of 24 nucleotides passes through The approach of agrannute (AGO4) mediations works to establish domain rearrangment transmethylase (OsDRM2) and its own site Epigenetic modification.One of discovery of the present inventor is that miR820 overexpression generates 21 nucleotides and 24 nucleosides The variant of acid, and therefore mask the effect of PTGS (post-transcriptional gene regulation).

On the one hand, the complete benefit and effect of miR820 overexpression are by the training for callus regeneration Some changes of base are supported to realize.Common nutrient growth culture is improved using the combination of vitamin, sucrose and antibiotic Base.

In one embodiment, following culture medium supports the growth of callus regeneration thing (referring to table 1)

Table 1：Different culture media is to the influence of the callus regeneration converted with pCAMBIA1300-amiR820 constructs

The culture medium of improvement can grow regrowth within the time less than 7 days.

Compared with check plant, genetically modified plants of the invention show the yield of increase.It was found that compared with check plant, The increase of yield is more than 7-10%, and again due to osa-miR820 presence.The spike number seen by converting in plant Increase to determine the yield of increase.Compared with check plant, the increase of fringe is at least 10%, and the increase of Grain Yield per hectare 7-10%.

Effective yields screening is by using making plant growth on multiple positions turn base under Optimized Production Technology Because event filial generation and use the positive control plant in multiple positions and two planting seasons and negative control plant Come what is completed.

On the other hand, it is found that the genetically modified plants of the present invention not only show the yield of increase, but also resistance to salt stress. Resistance to salt stress is determined by short-term and long-term Stress treatment.Retain determination method prolonging as the aging of stress-inducing using chlorophyll Slow mark measures short-term Stress treatment.This is a kind of rapid test method, and it assesses the separation leaf as cell death marker The amount of the chlorophyll retained in piece.Known natural aging or the generation of the aging of stress-inducing and the loss of chlorophyll content have Close, therefore the parameter has been used for assessing performance of the transgenosis (transgenics) under salt and other abiotic stress.In order to Understand effects of the OX-820 under salinity stress, the sprouting measure of OX-820 rices is carried out under different NaCl concentrations, together When use wild type (WT) seed as control.It was observed that under the sodium chloride (NaCl) of all concentration, OX-820 sprouts and open country Raw type (WT) is suitable.

By measuring total fresh weight of the 1 week old seedling grown under normal (water) and condition of salt stress, seedling grows (shoot Length) showed with root long to analyze the growth of the OX-820 seedling under salt stress.It was observed that OX-820 seedling is normally without the side of body Being showed under the conditions of compeling must be more much better than wild type (WT) seedling.However, in the presence of 100mM and 200mM sodium chloride (NaCl), Relative to unscared plant, the performance of OX-820 seedling is similar to the performance of WT seedling, both shows stress-inducing All parameters on reduction.It is obvious, therefore, that OX-820 seedling can be resistant to as their wild type (WT) homologue Gentle Variation of Salinity Condition, but higher salinity can not be resisted.

Long-term measure is related to plant and grows to maturation in the presence of high soil salt.It has been observed that under collating condition, with open country Raw type (WT) is compared, and OX-820 plants are higher and have higher tiller number, but under condition of salt stress, OX-820 plants show Go out significantly reducing for plant height, the plant height of plant height wild type (WT) plant with not coerced now is suitable.Fringe Number is not much decline, and the compensation of fringe characteristic is less.On the other hand, wild type (WT) does not show plant height Reduce, but the quantity of primary tiller is drastically reduced.It is obvious, therefore, that OX-820 plants are in control and condition of salt stress following table Reveal more preferable vigor.

It yet still another aspect, the genetically modified plants of the present invention also have the increased branch level in plant, it, which is served as, changes The main determining factor of good plant height, root biomass and fringe vigor.Tiller in rice is an important economical character, and It is proportionate with the Grain Yield in rice.Then the OX-820 plants of control and salt stress are assessed according to various fringe correlation properties The observation result of the tillering ability of middle improvement.It was found that Grain Yield phase higher in the OX-820 plants grown under collating condition Related parameter (such as spike length, fringe sum/plant and total fringe weight/plant) is negatively affected by salt stress.However, the degree of reduction Much smaller than the degree obtained in the wild type of salt stress (WT) plant.Therefore, Phenotypic Observation result shows, Osa-miR820's Overexpression improves the overall productivity of rice and reduces the yield of salt stress induction, even if it moderately improves plant Salt stress response.

Expression of the Osa-miR820 in rice growing kind can also be determined by analyzing leaf texture and fringe tissue.It is this Analysis discloses the higher concentration of the Osa-miR820 of the species of 21 nucleotides in salt-tolerant plant.In addition, go through Osa- The expression pattern of miR820 Length variants shows that the Microrna of 21 nucleotides is lowered in genetically modified plants, causes 24 The relative up-regulation of the variant of length of nucleotides.The present inventor is it is assumed that although Osa-miR820 expression is released from because of salt stress Regulation and control, but the ratio between the variant of 21 length of nucleotides and the variant of 24 length of nucleotides plays an important role and born Duty develops resistance to salt stress.

In addition, finding out the miR820 of flowering phase in late period expression, and find high-quality small ear compared with small ear inferior With substantial amounts of miR820, and this overexpression may be responsible for extensive branch of the ear of grain.

Compared with unconverted wild seedling, the analyses of the transgenic seedlings in 14 day age also discloses very high-caliber Osa-miR820。

The present invention relates to pass through the excessive table of Mirnas of plant technology by using selective kernel acid fragments and expression vector The method that plant vigor is improved up to miR820.The rice specificity miR820 of present invention overexpression method includes following step Suddenly-

I) selection and growth of plant at optimum conditions；

Ii Plasmid Constructs) are designed；

Iii) Osa-miR820 clone and expression；

Iv) agroinfiltration；

V) RNA is separated；

Vi expressed conversion strain) is confirmed；

Vii) callus induction.

Each step has been listed below herein：

I) selection and growth of plant at optimum conditions：Ripe hulled seed rice can carry out surface with ethanol and go out Bacterium.Then seed can be thoroughly cleaned with sterile distilled water and blotted.

Ii Plasmid Constructs) are designed：The precursor Osa-miR528 for the miRNA that construct can be guarded with origin from Oryza species Skeleton formed.MiR528 mature sequence may be substituted by Osa-miR820 mature sequence.Can be by whole sequence gram It is grand into the carrier from the group including pGEMT-EASY, pUC19, pBR322, pRT101, preferably can be used pRT101.Draw The various combination of thing can be used for producing PCR fragment.These fragments can carry out gel-purified to obtain amplified production.

Iii) Osa-miR820 clone and expression：Can be from including agriculture bacillus mediated gene transfer, agriculture bacillus mediated Virus infection (Agro-infection), direct gene transfer group in convert plant cell, preferably can be used Agrobacterium The gene transfer of mediation.Whole box can be added from the group including pSOMI, pet28a, pTAG, FLAG, pCAMBIA1300 In expression vector, pCAMBIA1300 preferably can be used.

Osa-miR820 is cloned into agrobacterium tumefaciens (Agrobacterium tumefaciens) binary vector Can be by the way that the PCR primer of amplification be cloned into using EcoRI and BamHI under CaMV-35S promoters in pCAMBIA1300 Realized in pRT101.Whole box is cut out by using HindIII restrictive digestion from pRT101-Osa-miR820, and is made It is transformed into restriction enzyme in pCAMBIA1300 binary vectors.Confirm to recombinate pCAMBIA1300- by PCR and restrictive digestion amiR820.Plasmid is transformed into Agrobacterium tumefaciens strain EHA105 and LBA4404, screen and select positive bacterium colony for Rice converts.In order to confirm to convert, enter performing PCR using specific primer and restrictive digestion.

Iv) agroinfiltration (Agroinfiltration)：Agroinfiltration can be realized by pressure permeation.Agriculture bar Bacterium culture can grow overnight in the nutrient medium with suitable antibiotic.Cell can be sunk by of short duration centrifugation Form sediment, and cell suspends again in suitable culture medium.It can then dilute cell incubation (culture) and in buffer solution. Can be with the help of needleless injector, by being produced with the help of the syringe mouth on the finger and the outside of belly at the back side of leaf Vacuum penetrates into uniform culture mix in spire.After a few days, the miR820 expression in the region being infiltrated can be analyzed.

V) RNA is separated：Positive rice strain after conversion be used for by from including organic extracting method, based on filter and Spin basket method (filter-based and spin basket method), magnetic particle method, the group of Direct Pyrolysis method it is each Kind technology extraction total serum IgE, preferably passes through organic extracting method such as guanidinium isothiocyanate.Plant tissue can be homogeneous in liquid nitrogen, And GITC buffer solutions can add together with phenol and chloroform.Mixture lower can be centrifuged at a high speed.Aqueous phase can use extraction molten Liquid obtains, then precipitation.DEPC- ethanol washing RNA precipitate can be used, and stores the use for the longer time.Pass through survey Sequence can confirm miR820 presence.

Vi) the confirmation of the conversion strain of overexpression：Genomic DNA can be from transgenosis rice strain and wild rice strain Extraction.Vegetable material may be crushed down in liquid nitrogen and homogenize.The Sample storage to homogenize can be incubated.Can be with Mixture is centrifuged and by supernatant collection in new pipe.Final sediment can be dried at room temperature for and be dissolved in buffering In liquid.Performing PCR analysis can be entered, and expanded product can be checked.Vegetable material can be crushed and homogenized.Can be with Mixture is centrifuged and collects supernatant.Final sediment can be washed with alcohol, dry and be dissolved in buffer solution.It can enter Performing PCR, trace (blotting) is then carried out to confirm the expression of positive rice strain.Come the PCR positive rice for KpnI digestion of using by oneself The genomic DNA of strain can carry out trace inspection on HybondN films.Hygromycin gene may be used as probe, and can be with Hybridized.

Vii) callus induction：The rice growing kind Pusa basmati 1 (PB1) of surface sterilizing seed can be Dry on autoclaved Whatman (Whatman) paper, and be incubated in the dark on callus inducing medium (CIM). Callus can be removed and in the dark in squamous subculture on fresh CIM.For coinfection, the callus group of squamous subculture Knitting can immerse in agrobacterium suspension under continuous slowly shake.After infection, callus can be inhaled on aseptic filter paper It is dry, and can be incubated in dark with the filter paper for co-culturing culture medium (CCM) wetting.After co-cultivation, callus is washed And dried on aseptic filter paper, and cultivated in the dark on callus Selective agar medium (CSM) to select transgenosis callus Tissue.After first round selection is carried out 20 days, white callus can be transferred to fresh callus Selective agar medium (CSM) training Support in base to carry out the second selection cycle of 15 days.The callus of health can be selected to be regenerated., will after third time selects The callus of health is transferred in specific regeneration culture medium (RM1-4), and is incubated 7 days under dark in culturing room.It can see Occur to green bud from callus.Green bud can develop seedling, and can be transferred to the culture of rootage in the presence of hygromycin In in base (RoM) 20 days under light.Whole plant can be transferred in vermiculite basin, be then transferred into soil basin, and can be with Grown in greenhouse.CIM, CCM, CSM and RoM culture media composition through certain improvement can be used.As shown in Figure 2, originally The genetically modified plants (OX-820) of invention are higher than unconverted wild plant, have more tillers.Left experimental group 1 is shown Whole OX-820 and the form of wild type (WT) rice plant.Plant A is the OX-820 of overexpression, and it shows that plant is increased Plant height.Plant B shows the wild-type plant Pusa basmati 1 (PB1) with compared with low height compared with Ox-820 Plant height.Right experimental group 2 shows compared with wild type (WT) rice plant the (sagging of more grain fillings in OX-820 ) fringe.Plant C shows more nodding ears in OX-820, and plant D is shown compared with OX-820 with less The wild-type plant Pusabasmati 1 (PB1) of nodding ear.In addition, as shown in Figure 3, genetically modified plants show largely The increase of branch and spike length degree.Experimental group 1 shows that the plant A for over-expressing OX-820 has increased spike length degree, and plant B It is the WT Pusa basmati 1 (PB1) compared with OX-820 with shorter spike length degree.Experimental group 2 shows plant C OX-820 With more branch of the ear of grain, and plant D wild types (WT) show less branch of the ear of grain.Experimental group 3 shows plant E OX- 820 have more grain, and plant F wild types (WT) show less Number of kernels compared with OX-820.

Advantage

MiR820 overexpression is widely used to agricultural industry as food in Oryza species, because it is promoted perhaps The sustainable agriculture and food quality of more Oryza plantation countries.Agronomic characteristics (the work of such as every acre of high yield, plant and fringe of improvement Power, bigger tiller and improvement plant height, the abiotic stress tolerance of improvement, improvement to nutrient such as nitrogen, phosphate and its The Utilization ability of his nutrient, and harvest, storage and the crudy of improvement) it greatly strengthen Oryza species in many countries Cultivation.

Following non-limiting example illustrates some aspects of the present invention.Those skilled in the art are readily apparent that all Embodiment all thinks to fall within the scope of the present invention, regardless of whether being illustrated by embodiment.

Embodiment

Following example illustrate the structure of the plasmid for recombinant DNA being transferred in plant cell, the plant is thin Born of the same parents can be reproduced into the genetically modified plants of the present invention.

I) selection and growth of plant at optimum conditions：By using 70% Ethanol Treatment 1 minute, then it is constant slowly 30 minutes hulled seed rice by maturation are handled in the case of stirring with 10% sodium hypochlorite with Tween-20 drops to enter Row surface sterilizing.Seed is repeatedly thoroughly washed with sterile distilled water and is blotted.

Ii Plasmid Constructs) are designed：Construct by from Oryza species guard miRNA precursor Osa-miR528 bone Frame is built in carrier pRT101 to produce artificial precursor miR820.Use the designs pair of Web Micro RNA Designer 3 Osa-miR820 mature sequence has specific primer (referring to table 2), and for substituting miR528 with Osa-miR820.Make Three groups of PCR fragments are combined to produce with different primers.These fragments are subjected to gel-purified and by using sequence number 3 (Sequence ID No.3), G3468-：5'-CTGCAAGGCGATTAAGTTGGGTAACG-3' and (the Sequence of sequence number 4 ID No.4), G3469-：The over-lap PCR of 5'GCGGATAACAAT TTCACACAGGAAACAG 3' universal primers merged with Obtain amplified production.

Table 2

Sequence number	Primer	Sequence (5 ' -3 ')
			1	GFwd	CCGGAATTCCGGCAGCAGCAGCCACAGCAAA
2	GRev	CGCGGATCCGCGGCTGCTGATGCTGATGCCAT
			3	G4368	CTGCAAGGCGATTAAGTTGGGTAACG
4	G4369	GCGGATAACAAT TTCACACAGGAAACAG
			5	pRTFwd	CAGGTCAACATGGTGGAGCA
6	pRTRev	GTCACTGGATTTTGGTTTTAGG
			7	820-Fwd	TCGGCCTCGTGGATGG
8	820-Rev	GTGCAGGGTCCGAGGT
			9	Hyg-Fwd	TTCAGCTTCGATGTAGGAGG
10	Hyg-Rev	AGAAGAAGATGTTGGCGACC
			11	18S_Fw d	CTACGTCCCTGCCCTTTGTACA
12	18S_Rev	ACACTTCACCGGACCATTCAA

Iii) Osa-miR820 clone and expression：Plant cell is converted by agriculture bacillus mediated gene transfer.Agriculture Bacillus strain can be used for pCAMBIA1300 for conversion.The expression that pCAMBIA1300 carriers are used in the present invention.These are carried Body has the CaMV35S promoters of enhancing and the CaMV35S poly a-signals for termination.First (digit) of plasmid is represented The presence of antibiotic hygromycin, second represent the presence of antibiotic kanamycins.3rd represents polylinker pUC18.

It is by CaMV-35S promoters that Osa-miR820, which is cloned into Agrobacterium tumefaciens binary carrier pCAMBIA1300, What the PCR primer of amplification was cloned into pRT101 and realized by the lower EcoRI and BamHI sites using for directed cloning.With Confirm positive colony by using EcoRI/BamHI double digesteds afterwards.By using HindIII restrictive digestion from pRT101- Whole box is cut off in Osa-miR820, and is transformed into using identical restriction enzyme in pCAMBIA1300 binary vectors.Pass through Use SEQ ID No：7-：5'-TCGGCCTCGTGGATGG-3' and SEQ ID No.8：-5'-GTGCAGGGTCCGAGGT-3' PCR analyses and restrictive digestion confirm to convert.Obtain contact pCAMB1300-Osa-miR820 restructuring box.It refer to Fig. 1.

The OSA-miR820 of insertion sequence is No. 13 sequence (Sequence No.13)：5- TCGGCCTCGTGGATGGACCAG-3 ', and the recombinant precursor built is No. 14 sequence (Sequence No.14)：5'- GCAGCAGCCACAGCAAAATTTGGTTTGGGATAGGTAGGTGTTATGTTAGGTCTGGTTTTTTGGCTGTAGCAGCAGCA GTCGGCCTCGTGGATGGACCAGCAGGAGATTCAGTTTGAAGCTGGACTTCACTTTTGCCTCTCTCTGGTGCATGCAC GAGGCCGATTCCTGCTGCTAGGCTGTTCTGTGGAAGTTTGCAGAGTTTATATTATGGGTTTAATCGTCCATGGCATC AGCATCA-3'。

Iv) agroinfiltration：Agroinfiltration is realized by pressure permeation.

Agrobacterium culture is in Lu Niya meat soups (LB) culture medium with appropriate antibiotic and 20 μM of acetosyringones Growth is overnight.By of short duration centrifugation by cell precipitation, and it is resuspended in minimal medium (MMA) culture medium (MS salt, 10mM MES, pH5.6,200 μM of acetosyringones) in.Cell is incubated at least 1 hour at 28 DEG C, and then in MES buffer solutions Dilute to obtain about 0.3-0.4 OD600.With the help of needleless injector, by the finger and the outside of belly at the back side of leaf Syringe mouth with the help of produce vacuum by uniform culture mixture penetrate into spire in.Penetrate into 3 days, 5 days, After 7 days and 10 days (number of days (dpi) after infiltration), the miR820 expression in the region being saturated is analyzed.

V) RNA is separated：Total serum IgE is manually extracted from various Oryza species by guanidinium isothiocyanate scheme.Plant tissue exists It is homogeneous in liquid nitrogen, and GITC buffer solutions add together with phenol and chloroform.Mixture is set slowly to thaw, and with high speed (about 13000rpm) centrifuge 15 minutes.By using phenol:Chloroformic solution extraction obtains aqueous phase twice.Aqueous phase is preserved to utilize ethanol Precipitated.RNA precipitate is washed twice 15 minutes every time with 13000rpm speed using 70% DEPC- ethanol, and Dry at room temperature.Dry RNA precipitate is dissolved in the water of DEPC processing, and is stored in -20 DEG C.

Vi) the confirmation of the conversion strain of overexpression：Genome is extracted from transgenosis rice strain and wild rice strain DNA.1gm vegetable material is crushed down in liquid nitrogen, and homogenized in CTAB buffer solutions.By the sample to homogenize in 65 DEG C of guarantors Hold 30 minutes.Mixture is centrifuged 5 minutes with 10000rpm, and by supernatant collection in new pipe, adds isometric chlorine It is imitative:Isoamyl alcohol (24:1) and centrifuge again.Final sediment is dried at room temperature for and is dissolved in TE buffer solutions.Carry out PCR is analyzed, and detects amplified production under the amplification of 2% agarose.Vegetable material is crushed and homogenized.By mixture centrifugation simultaneously Collect supernatant.Genomic DNA is precipitated and is incubated sediment.Final sediment is washed with alcohol, is dried and is dissolved in In buffer solution.Enter performing PCR, then carry out trace to confirm the expression of positive rice strain.Trace is carried out on HypondN films to examine Look into the genomic DNA of the 20 μ g from PCR positive rice strains with KpnI digestion.Hygromycin gene is used as probe, and 62 Hybridization 12 hours is carried out at DEG C.Then it is washed and be imaged on X-ray film.

As described herein, compared with wild type rice plant, plant of the invention is higher.Plant is shown in Figure 2, and ties Fruit is listed in Table 3 below.Table 3 is the comparison of the biomass related to the rice plant of the overexpression containing OX-820.After planting 95- Measurement plant height after 110 days.The basis that plant vigor and tiller increase are used as determining plant height.In the table, p is examined Test value result show the related parameter of biomass (level tiller number, leaf be long as before, ripe plant height, phytomass dry weight, Ripe root long and ripe root dry weight) significant difference.PB-1, PB-2 and PB-3 are the plants of wild type Pusa basmati 1 (T0), and LI, L2, L3 and L4 are OX-820 genetically modified plants (T1).Detecting three independent transgenosis of every strain Event.15 T1 events are have detected altogether.The related parameter of all biomass shows significant increase by * marks, such as logical Cross in table shown in the p value of gained.

Table 3

The comparison of character related to biomass in WT OX-820

Strain number	PB-1	PB-2	PB-3	L1	L2	L3	L4	Conspicuousness	P- values
										Primary tiller number	6	5	5	8	7	8	8	*	0.007763
Leaf is grown	45	42.8	44.2	59.5	56.7	56	54	*	0.000426
										Ripe plant height	34.5	33.7	31.9	37.4	39.6	38.8	38.3	*	0.00642
Phytomass dry weight	26	25.4	25.8	21.5	18	23.5	22.2	*	0.042926
										Ripe root long	25.5	23.6	24.7	22.2	18.4	21	19.5	*	0.031234
Ripe root dry weight	4.38	4	4.25	4.7	5.02	4.8	4.28	*	0.012547

By the rice strain of the conversion with OX-820 with compared with wild type rice plant, with particular reference to fringe characteristic.Plant Thing is shown in Figure 3, and result is listed in the table below in 4.Plant vigor is also utilized as assessing the parameter of fringe vigor, and is tested Measure the quantity and weight for the spike number of each plant and the grain of each plant.In the table, p test values result shows agriculture The related parameter of skill (sum of such as fringe, spikelet number/spike number, grain sum/plant, spike length, primary branch/fringe, seed weight, Grain length and grain width) significant difference.PB-1, PB-2 and PB-3 are wild type Pusa basmati1 plants (T0), and And LI, L2, L3 and L4 are OX-820 genetically modified plants (T1).Detecting three independent transgenic events of every strain.Always 15 T1 events are have detected altogether.The related parameter of all biomass shows significant increase by * marks, as passed through institute in table Shown in the p value obtained.

Table 4

The comparison of economical character in OX-820 and WT

Strain number	PB-1	PB-2	PB-3	L1	L2	L3	L4	Conspicuousness	P value
										The sum of fringe	6	5	6	9	8	9	8	*	0.003126
Spikelet number/spike number	136	131	128	159	168	171	179	*	0.001327
										Grain sum/plant	780	647	804	1104	1206	1373	1232	*	0.00634
Spike length	24.1	24.9	23.7	28.2	29.5	26.4	29.8	*	0.003106
										1 ° of branch/fringe	6	5	6	5	8	7	8		0.348641
1000- seed weights	20.9	19.8	20.2	23.4	23.2	22.6	21.08	*	0.002323
										Grain length	10	10.1	10.9	11	11.65	10.8	11.23		0.100159
Grain width	2.1	2.2	2.2	2.1	2.4	2.32	2.26		0.327406

Vii) callus induction-：By the rice growing kind Pusa basmati 1 (PB1) of surface sterilizing seed in height Press and dry on the Whatman paper of sterilizing and incubated in the dark on callus inducing medium (CIM) at 25 DEG C to 28 DEG C Educate.Callus inducing medium (CIM) is advantageous to scultellum (scutellar) region developing into height within the time of 3 weeks The callus of regeneration.Callus is cut off and trained in the dark in subculture on fresh callus inducing medium (CIM) Support 7 days.For coinfection, the callus of squamous subculture is immersed in agrobacterium suspension 35 points under continuous slowly shake Clock.After infection, callus is blotted on aseptic filter paper, then cultivated at 26 DEG C -28 DEG C in dark with co-cultivation It is incubated two days on the filter paper of base (CCM) wetting.After co-cultivation, by callus with high pressure distillation water washing twice, 30 points every time Clock, the high pressure distillation water contain Carbenicillin and CTX (each 250mg/ml).In order to dilute the toxic action of antibiotic, Final washing 5-7 minutes are provided by N6 fluid nutrient mediums (being free of any sugar), are then saved on recovery media (RM) 7-10 days, so that it recovers multiplication capacity.Hereafter, by callus wash and on aseptic filter paper dry, and in the dark in Cultivated on callus Selective agar medium (CSM) to select transgenic calli.After first round selection is carried out 20 days, abandon brown The callus of color or black, and white callus is transferred to carried out in fresh CSM culture mediums lasting 15 days second Selection cycle.The step for allow the propagation of micro-calli, and when micro-calli is opened on parent callus When beginning to grow, each micro-calli is gently separated from parent callus and is transferred in fresh CSM culture mediums Carry out the third time selection of lasting 15 days.The callus of selection health is regenerated.After third time selects, by the callus of health Tissue is transferred in specific regeneration culture medium (RM1-4), and is incubated 7 days under dark in culturing room.Then they are turned Move on in fresh regeneration culture medium and be incubated at 26 DEG C -28 DEG C under optical condition.After 1-2 weeks, it is seen that green bud is from callus Occur.Green bud develops seedling, and is transferred in the root media (RoM) in the presence of hygromycin (50mg/l) 20 under light My god.Whole plant is transferred in vermiculite basin, is then transferred into soil basin, and grown in greenhouse.Used CIM, Row are as follows in detail for CCM, CSM and RoM culture media composition.These culture media compositions are applicable under some improvement.CIM：With dimension The raw plain B5 plant of MS salt+30g/l sucrose+0.3g caseic hydrolysate+2.0mg/l 2,4-D+0.5g proline+0.3% Gel, pH 5.8；CCM：Liquid N6 culture mediums+3mg/ml 2,4-D+100 μM of acetosyringone, pH 5.2；RM：Antibiotic-free The CIM of selection；CSM：CIM+250 CTX+50mg/l hygromycin；RM1：MS salt+500mg proline with vitamin B5 + 0.3g caseic hydrolysate+30g/l D-sorbite+1.0mg/l BAP+2.0mg/l kinetin+0.5mg/l NAA, pH 5.8；RoM：MS salt+30g sucrose+3g/l plant gels with vitamin B5, pH 5.8.

Sequence table

<110>Genetic engineering and biotechnology International Center

<120>The transgenic rice plant of improvement

<130> PCT0036

<150> 361/DEL/2015

<151> 2015-02-10

<160> 14

<170> PatentIn version 3.5

<210> 1

<211> 31

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 1

ccggaattcc ggcagcagca gccacagcaa a 31

<210> 2

<211> 32

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 2

cgcggatccg cggctgctga tgctgatgcc at 32

<210> 3

<211> 26

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 3

ctgcaaggcg attaagttgg gtaacg 26

<210> 4

<211> 28

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 4

gcggataaca atttcacaca ggaaacag 28

<210> 5

<211> 20

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 5

caggtcaaca tggtggagca 20

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 6

gtcactggat tttggtttta gg 22

<210> 7

<211> 16

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 7

tcggcctcgt ggatgg 16

<210> 8

<211> 16

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 8

gtgcagggtc cgaggt 16

<210> 9

<211> 20

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 9

ttcagcttcg atgtaggagg 20

<210> 10

<211> 20

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 10

agaagaagat gttggcgacc 20

<210> 11

<211> 22

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 11

ctacgtccct gccctttgta ca 22

<210> 12

<211> 21

<212> DNA

<213>Artificial sequence

<223>Oligonucleolide primers

<400> 12

acacttcacc ggaccattca a 21

<210> 13

<211> 21

<212> DNA

<213>Artificial sequence

<223>Composition sequence

<400> 13

tcggcctcgt ggatggacca g 21

<210> 14

<211> 238

<212> DNA

<213>Artificial sequence

<223>Composition sequence

<400> 14

gcagcagcca cagcaaaatt tggtttggga taggtaggtg ttatgttagg tctggttttt 60

tggctgtagc agcagcagtc ggcctcgtgg atggaccagc aggagattca gtttgaagct 120

ggacttcact tttgcctctc tctggtgcat gcacgaggcc gattcctgct gctaggctgt 180

tctgtggaag tttgcagagt ttatattatg ggtttaatcg tccatggcat cagcatca 238

Claims (9)

1. a kind of transgenic rice plant cell, contains recombinant DNA molecules in its genome, the DNA molecular includes coding Osa-miR820 and the DNA sequence dna being operably connected on just direction with promoter；Wherein described plant performance goes out resistance to Salt stress, plant height increase, tiller number increase and Grain Yield increase.

2. a kind of be used to increase the methods of plant products, it include with encode osa-miR820 on just direction with promoter The step of DNA sequence dna being operably connected is to convert plant cell.

3. a kind of be used to increase the method for plant vigor and agronomic characteristics in Oryza species, including by being expressed in expression vector SEQ ID NO.13 nucleotide fragments and over-express miR820 DNA construct.

4. nucleotide fragments according to claim 1, wherein, the nucleotide fragments are Osa-miR820 ripe sequences Row.

5. the rice of the overexpression comprising Osa-miR820, wherein, the basic element of cell division used in culture medium:The ratio of auxin For 6:1.

6. according to the method for claim 1, wherein, the plant comes from grass family, it is preferred from belonging to Oryza.

7. according to the method for claim 1, wherein, the plant comes from India's native species as rice variety as being used as Pusa Basmati 1.

8. the claimed construct being used to prepare in the method for the plant with overexpression, wherein, the construct bag Contain,

A) Osa-miR820 mature sequence；

B) one or more control sequences of the expression of the sequence can be driven；

C) transcription terminator sequences；

D) continuous promoter.

9. miRNA purposes is over-expressed in described rice plant in claim 1, by promoting the Oryza under stress conditions The vigor of plant and fringe in species, tiller and cause output increased.