CN105112423B - It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application - Google Patents
It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application Download PDFInfo
- Publication number
- CN105112423B CN105112423B CN201510589342.6A CN201510589342A CN105112423B CN 105112423 B CN105112423 B CN 105112423B CN 201510589342 A CN201510589342 A CN 201510589342A CN 105112423 B CN105112423 B CN 105112423B
- Authority
- CN
- China
- Prior art keywords
- mulberry tree
- mulberry
- mirn2
- disease
- mirna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to gene engineering technology fields, provide it is a kind of enhancing mulberry tree disease resistance miRNA clone and its application, the miRNA is named as mul miRn2, it is respectively provided in sequence table nucleotide sequence shown in SEQ.ID.NO.2 and SEQ.ID.NO.3 with RNA sequence shown in SEQ.ID.NO.1 in sequence table, precursor RNA and coding gene sequence.MiRNA shown in SEQ.ID.NO.1 is overexpressed in mulberry tree, can cultivate has more resistance transgenosis mulberry tree to mulberry yellow dwarf disease and mulberry epidemic disease；The mul miRn2 of the present invention provide new genetic resources to cultivate disease-resistant New Mulberry Variety, which can be used for mulberry tree or other plant disease resistance breeding research.
Description
Technical field
The present invention relates to gene engineering technology field, provide a kind of miRNA of enhancing mulberry tree disease resistance clone and
It is applied.
Background technology
Mulberry tree has thousands of years of cultivation histories in China, and feed seeds of the mulberry tree as silkworm, are the important of silk industry
Material base.Mulberry tree is outer except breeding silkworms for picking leaves, mulberry leaf, mulberry fruit, ramulus mori, mulberry skin, Sang Gen also with very high edible, medicinal and
Feeding value.In addition, mulberry tree is defending and controlling sand, Rocky Desertification Control, water and soil conservation, Saline-alkali Field Control, is conceding the land as ecology tree kind
Also woods etc. has also played important function, and economy and the ecological value are increasingly taken seriously.In order to breed silkworms in sericultural production
It needs that mulberry tree cut to cut down picking leaves, lasting cutting, which cuts down picking leaves and easily cause tree vigo(u)r, to decay, and increases the risk infected by pest and disease damage.
The mulberry tree disease that China has found has more than 100 to plant, and can cause harm about 40 kinds to cause disaster.Wherein mulberry tree yellow dwarf disease and mulberry epidemic disease
The important disease for always endangering mulberry tree has generation in each silkworm area of China, often results in the reduction of mulberry yield and quality, right
The development of sericulture there has an adverse effect, while also limiting that mulberry tree is medicinal, feeding and the ecological value realization.Due to silkworm
Sensitive to pesticide, conventional pesticide is difficult to apply in mulberry field, and therefore, it is to solve the problems, such as this root to cultivate broad-spectrum disease resistance new varieties
One of this approach.
In order to reduce the injury as caused by environment-stress, plant has developed complicated response mechanism during evolution, can
With the expression of horizontal up regulation gene after transcription, transcription and after translation, enhance self resistance.MiRNAs conducts in plant
The important regulating and controlling factor of gene expression can adjust gene expression in transcription and post-transcriptional level, and function is almost related to giving birth to
The various aspects of the life process such as long development, signal transduction and environmental response.Pathogen can lure during infecting plant
It leads host and generates a large amount of microRNAs, a portion is proved to be miRNA, and plant can also be regulated and controled certain anti-by miRNA
Key gene in sick approach resists the invasion of germ, in the defence of plant basis and biotic response has important work
With.MiR393 be first be reported in pathogenic associated molecular pattern triggering immunologic process in have effective miRNA, should
MiRNA can improve the resistivity of plant pair external source bacterial invasion by inhibiting auxin signal path.Although current state
It is inside and outside that clone obtains multiple miR-96 genes applied to molecular breeding and has multinomial achievement in research application special from various plants
Profit, but with the patent of the relevant miRNA of disease resistance of plant it is rarely seen have the inventions such as Chen Hao " blade specific expression is artificial
The method that microRNA improves Rice Resistant To Bacterial Blight " (101565701 A of Chinese patent CN), discloses a 21nt
Engineer microRNA sequences, and show the miRNA in rice leaf specifically expression can enhance transgenosis
Resistance of the rice to bacterial leaf-blight." method and its special carrier and promoter of cultivation disease resisting rice " of the inventions such as Fang Rongxiang
(Chinese patent CN103194484A) discloses a kind of method and its special carrier and promoter for cultivating disease resisting rice, will
The encoding gene of miR393 and inducible promoter importing purpose plant for driving it to express, acquisition have bacterial blight of rice
More resistance genetically modified plants." the artificial mi RNA and its structure and use of inhibition plant virus of Sun Chuanbao and He Yu sections invention
(Chinese patent CN102559666A) on the way " discloses the nucleic acid sequence according to RNA silencing suppressor in the virus for infecting plant
The excellent oligonucleotides of silencing efficiency is had devised, after these oligonucleotides are imported into plant, in virus infection plant
MiRNA can be formed in plant, is combined with the mRNA of viral gene silencing suppressor, the transcription of mRNA is influenced, to reach
To the effect for inhibiting virus.The inventions such as Wang Xingjun " using artificial microRNA improve Rice Resistance black streak dwarf method and
Its special-purpose double-chain RNA " (Chinese patent CN102676510A) discloses a kind of short using artificial mi RNA raising Rice Resistance secret note
The method and its special-purpose double-chain RNA for the disease that contracts.But about effects of the miRNA in mulberry tree breeding for disease resistance, it yet there are no report.
Invention content
The present inventor for the above-mentioned prior art the case where, provide a kind of enhancing mulberry tree disease resistance
The clone of miRNA and its application, the miRNA are named as mul-miRn2, with RNA shown in SEQ.ID.NO.1 in sequence table
Sequence, precursor RNA and coding gene sequence are respectively provided in sequence table core shown in SEQ.ID.NO.2 and SEQ.ID.NO.3
Nucleotide sequence.It is overexpressed miRNA shown in SEQ.ID.NO.1 in mulberry tree, can cultivate to mulberry yellow dwarf disease and mulberry epidemic disease
Disease has more resistance transgenosis mulberry tree；The mul-miRn2 of the present invention provides new base to cultivate disease-resistant New Mulberry Variety
Because of resource, which can be used for mulberry tree or other plant disease resistance breeding research.
Inventor provides firstly a kind of miRNA of enhancing mulberry tree disease resistance, which is named as mul-miRn2,
With RNA sequence shown in SEQ.ID.NO.1 in sequence table；
Its precursor RNA has nucleotide sequence shown in SEQ.ID.NO.2 in sequence table；
Its coding gene sequence is nucleotide sequence shown in SEQ.ID.NO.3；
Other than the nucleotide sequence as shown in SEQ.ID.NO.3, further including can be in plant interior coding
MiRNA precursor RNAs sequence shown in SEQ.ID.NO.2 and with sequence shown in SEQ.ID.NO.3 have 90% or more similarity
Nucleotide sequence；This sequence can be transcribed into miRNA precursors after being imported into plant cell, and the miRNA precursors can plant
It is sheared in object cell and is processed into ripe miRNA, therefore also in the row of protection scope of the present invention.
The present invention constructs the overexpression vector pBI121-mul-miRn2 of mulberry tree mul-miRn2 genes, which is carried
Body is transferred to Agrobacterium GV3101 competent cells, screens transformant, and mulberry tree is converted using leaf disc transformation method.To the transgenosis of acquisition
Mulberry tree plant progress Disease-resistance Analysis shows that transgenosis mulberry tree plant can significantly improve and resists to yellow dwarf disease and mulberry epidemic disease
Property, it has a good application prospect.
The present invention relates to a kind of plant expression vectors, including just like SEQ.ID.NO.1 or SEQ.ID.NO.2 or
Nucleotide sequence shown in SEQ.ID.NO.3, the resistance for improving mulberry tree to yellow dwarf disease and mulberry epidemic disease.
The present invention provides the methods that mulberry tree mul-miRn2 genes are applied in plant, and the disease resistance of plant can be improved.
Step is：
1) mul-miRn2 gene orders are placed under CaMV35S strong promoters, structure plant expression vector pBI121-
mul-miRn2；
2) the expression vector pBI121-mul-miRn2 of structure is converted into Agrobacterium competent cell, filters out transformant；
3) it utilizes the transformant 2) obtained to convert mulberry tree, obtains turning mul-miRn2 gene mulberry treies.
Based on above-mentioned discovery, inventor further by technique for gene engineering in mulberry tree overexpression mul-miRn2
Gene, can cultivate has more resistance transgenosis mulberry tree to mulberry yellow dwarf disease and mulberry epidemic disease；The mul- of the present invention
MiRn2 provides new genetic resources to cultivate disease-resistant New Mulberry Variety, which can be used for mulberry tree or other plant disease resistance
Breeding research.
Description of the drawings
Fig. 1 is the secondary structure figure of mul-miRn2 precursor sequences,
MiRNA provided by the invention derives from mulberry tree, is named as mul-miRn2, and precursor sequence can be folded into a kind of steady
Fixed loop-stem structure belongs to the typical secondary structure of miRNA precursors, meets the structure feature of miRNA precursors；
Fig. 2 is the structure figures of mulberry tree mul-miRn2 gene plant overexpression vectors pBI121mul-miRn2；
Fig. 3 is electrophoresis patterns of the overexpression vector pBI121mul-miRn2 through BamH I and Sac Ι double digestions,
M in figure：Marker DL2000；P：Digestion products,
Mulberry tree mul-miRn2 gene nucleotide series are inserted into plant expression vector pBI121 by us as seen from the figure
In, successfully construct mul-miRn2 gene plant overexpression vectors；
Fig. 4 is the PCR qualification result schematic diagrames of transfer-gen plant,
WT in figure：Wild type mulberry tree compares；L1-L5：Transgenosis mulberry tree positive strain；M：Marker DL2000；
Using the DNA of the positive plant filtered out as template, phase is carried out according to 35S promoter sequence design a pair of special primer
The PCR amplification of transgenic line is answered, as a result can expand to 530bp or so band, illustrate us successfully by mul-miRn2
Gene is transferred in mulberry tree body, and obtains transfer-gen plant；
Fig. 5 is detection of expression result block diagram of the mul-miRn2 maturation bodies in transfer-gen plant,
WT in figure：Wild type mulberry tree compares；L1-L5：Transgenosis mulberry tree positive strain,
The gene expression abundance of mul-miRn2 maturation bodies is apparently higher than WT lines in transgenosis mulberry tree plant as seen from the figure,
Illustrate that the ripe body of mul-miRn2 is able to high efficient expression in transgenosis mulberry tree.
Specific implementation mode
Further definition is of the invention in following embodiment, according to above description and these embodiments, people in the art
Member can determine the essential characteristic of the present invention, and without departing from the spirit and scope of the invention, can be to the present invention
It makes various changes and modifications, so that it is applicable in various uses and condition.In addition to special indicate, of the present invention is this
The field prior art；
The cloning process of 1. mulberry tree mul-miRn2 genes of embodiment
1, using conventional CTAB methods extraction mulberry leaf DNA.
2, the nucleotide sequence of gained mul-miRn2 genes is sequenced according to transcript profile, designs a pair of of special primer, miRn2-
5 ' (GTCTTTCAACAAAAACTGCCTTG) its nucleotide sequence are as shown in SEQ.ID.NO.4 and miRn2-3 '
(TAGGATTAGGATTTCACTCTCT) its nucleotide sequence is carried out as shown in SEQ.ID.NO.5 by template of mulberry leaf DNA
PCR amplification, system are as follows：
Response procedures are as follows：
PCR product is detected with 1% agarose gel electrophoresis after reaction, recycling target fragment is cloned and is sequenced
Analysis, sequencing result show its nucleotide sequence as shown in SEQ.ID.NO.3, and it is typical which can be folded into miRNA precursors
Loop-stem structure (as shown in Figure 1), meets the structure feature of miRNA precursors, shows that successful clone obtains mul-miRn2 bases for we
Cause.
The structure of 2. mulberry tree mul-miRn2 plant expression vectors pBI121mul-miRn2 of embodiment
1, according to the nucleotide sequence for the mulberry tree mul-miRn2 genes isolated, design primer miRn2-F
(GGATCCGTCTTTCAACAAAAACTG) its nucleotide sequence is as shown in SEQ.ID.NO.6 and miRn2-R
(GAGCTCTAGGATTAGGATTTCACTCTCT) its nucleotide sequence is as shown in SEQ.ID.NO.7, with mulberry leaf extraction
DNA is template, carries out PCR amplification.
2, PCR product is taken to be connect with pMDl8-T Simple cloning vectors, connection product converts bacillus coli DH 5 alpha impression
State cell, ampicillin (50mg/L) resistance screening positive colony extract recombinant plasmid dna, digestion mirror after bacterium solution PCR identifications
Sequencing is carried out after fixed.
3, recombinant plasmid BamH I and the Sac Ι of the correct segment of mulberry tree mul-miRn2 genes will be contained through sequencing
Digestion, recycling mul-miRn2 genetic fragments are connect with the pBI121 expression vectors of identical digestion with restriction enzyme (as schemed
Shown in 2).Connection product converts bacillus coli DH 5 alpha competent cell, and kanamycins (50mg/L) resistance screening positive colony is right
The positive colony of selection carries out bacterium solution PCR identifications and the digestion of Plasmid DNA identification (as shown in Figure 3).
4, the mulberry tree mul-miRn2 gene plant expression vectors built conversion Agrobacterium GV3101 is felt using freeze-thaw method
By state cell, kanamycins (50mg/L) resistance screening positive colony.
The acquisition of 3. transgenosis mulberry tree plant of embodiment
1, picking Agrobacterium (the Agrobacterium single bacterium colony of the carrying recombinant plasmid obtained in embodiment 2) is inoculated in mould containing that is blocked
In the LB liquid medium of plain 50mg/L, 28 DEG C, 250rpm, shaken cultivation about 48h to logarithmic growth later stage；Bacterium solution is trained with MS
10 times of nutrient solution dilution, it is spare；
2, mulberry tree tests for sterility is taken, (0.5 × 0.5cm) is cut into small pieces as explant, is placed in the pre- differential mediums of MS
In (MS+TDZ 1.0mg/L+NAA 0.2mg/L), 28 DEG C, light application time 16h/d, intensity of illumination 2000Lux, preculture 2d；
3, the explant after preculture is immersed into bacterium solution 2-l0min, then blots extra bacterium solution with the filter paper of sterilizing, accessed
MS minimal mediums；Under dim light, 28 DEG C of co-cultivation 2d；
4, explant after co-culturing is first with the sterile water washing of the 250mg/L of penicillin containing cephalo 3 times, then with containing cephalo blueness
The MS culture solutions of mycin 250mg/L are washed 1 time, are then blotted with aseptic filter paper, and 100mg/L containing kanamycins, cephalo mould are transferred to
MS Selective agar mediums (the MS+6-BA 3.0mg/L+NAA 0.2mg/L+ kanamycins 50mg/L+ cephalo penicillin of plain 250mg/L
On 250mg/L), 28 DEG C, light application time 16h/d, intensity of illumination 2000Lux cultures；Per 15d, switching is primary.
5, it when Bud Differentiation is grown to lcm or so, cuts Bud Differentiation and is transferred to MS root medias (MS+ kanamycins 50mg/L+
Cephalo penicillin 250mg/L) in, promote it and takes root.
6, when differentiation seedling is grown to 5-6 piece leaves, after root system development is good, immigration fills in the flowerpot of sterile soil, room temperature conventional tube
Reason.
The PCR of 4. transgenosis mulberry tree plant of embodiment is identified
1, the DNA of resistant plant and WT lines is extracted using CTAB methods.
2, according to 35S promoter sequence design a pair of special primer 35S-5 (GGCCATGGAGTCAAAGATTC) its nucleosides
Acid sequence is as shown in SEQ.ID.NO.8 and 35S-3 (CCGTGTTCTCCAAATG) its nucleotide sequence such as SEQ.ID.NO.9 institutes
Show, respectively using the DNA of the resistant plant of extraction and WT lines as template, carries out PCR, expand 35S promoter, reaction system
It is as follows：
Response procedures are as follows：
After reaction PCR product is detected with 1% agarose gel electrophoresis.It is detected and is tied by agarose gel electrophoresis
Fruit, as shown in figure 4, the band of 530bp or so can be amplified in resistant plant genomic DNA, and WT lines base
Because a group DNA fails to amplify the band, show that we successfully will be in mul-miRn2 channel genes mulberry tree genome.
Detection of expression of the embodiment 5.mul-miRn2 maturations body in transgenosis mulberry tree
1, the expression quantity of the ripe body of mul-miRn2 in transgenosis mulberry tree is examined using the method for quantitative fluorescent PCR
It surveys.
2, the total serum IgE that wild type and transgenosis mulberry tree are extracted with Trizol methods removes genomic DNA using DNase I, uses
The One Step of precious bioengineering Co., LtdMiRNA cDNA Synthesis Kit carry out the anti-of miRNA
Transcription.
3, using mulberry tree U6 as reference gene, using the reverse transcription product of wild type and transgenosis mulberry tree miRNAs template, instead
Answer system and reaction step referencePremix Ex TaqTMII specification is reacted, according to reaction result Excel
Mapping, analysis mulberry tree mul-miRn2 maturations body success expression and its gene expression abundance in transgenosis mulberry tree.It can be with by Fig. 5
Find out that mul-miRn2 maturations body is able to high efficient expression in transgenosis mulberry tree, shows the mulberry tree mul-miRn2 gene energy being transferred to
It is enough to be overexpressed in mulberry tree, and successfully processing forms ripe body.
Analysis of Resistance of the 6. transgenosis mulberry tree of embodiment to yellow dwarf disease
1, using the annotinous branch of transgenosis mulberry tree and wild type mulberry tree as scion, with the reality of wild type Mulberry Seeds breeding
Raw seedling is that stock is grafted respectively, obtains grafting.
2, between the 7-8 months, yellow dwarf disease disease mulberry branch is chosen, skin zone is first twisted from base portion, then above and below fringe bud
Girdling cortex obtains pipe of buddering, and then sick fringe germ tube is socketed in the grafting of above-mentioned acquisition.Graft January after Investigate incidence.
3, incidence finds that transfer-gen plant incidence is 12% by inquiry, and WT lines incidence is 85%,
And morbidity is heavier.Therefore, transgenosis mulberry tree has apparent anti-mulberry tree resisting etiolation type wasting disease ability relative to wild type mulberry tree,
With good application prospect.
The anti-mulberry epidemic disease capability analysis of 7 transgenosis mulberry tree of embodiment
1, picking pseudomonas syringae bacterial strain [Pseudomonas syringae pv.mori (Boyer et Lambert)
Young, Dye et Wikie, 1978] it is inoculated in LB liquid medium, 30 DEG C, 180rpm, shaken cultivation is about for 24 hours to logarithm
Later growth；Bacterium solution is diluted to 3 × 10 with LB culture solutions8CFU/mL, it is spare.
2, inoculation processing selection carries out at dusk in summer mulberry tree vigorous period, and it is prosperous to puncture mulberry branch apical growth with needle
The spire and tender tip contained and be not yet fully deployed, it is each to repeat to pierce 6 tender tips, miniaturised nebuliser spraying bacterium is used after thorn, with top
The positive back side of tip 2-3 piece leaves squirts to spend, and polybag moisturizing, m seq is used to remove polybag after spray.Each processing is all provided with 3 weights
It is multiple.Investigate incidence after 7 days.
3, incidence is found by inquiry, and transfer-gen plant incidence is 8%, and it is lighter to fall ill, and WT lines are sent out
Sick rate is 94%, and it is heavier to fall ill.Therefore, transgenosis mulberry tree has stronger anti-mulberry epidemic disease ability relative to wild type mulberry tree,
There is good application prospect.
Claims (2)
1. a kind of mulberry tree miR-96 gene, it is characterised in that：Its nucleotide sequence is as shown in SEQ. ID. NO.3.
Mulberry tree yellow dwarf disease and mulberry epidemic disease are resisted 2. miR-96 gene described in claim 1 enhances mulberry tree in mulberry tree
The application of property.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510589342.6A CN105112423B (en) | 2015-09-16 | 2015-09-16 | It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510589342.6A CN105112423B (en) | 2015-09-16 | 2015-09-16 | It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105112423A CN105112423A (en) | 2015-12-02 |
| CN105112423B true CN105112423B (en) | 2018-07-27 |
Family
ID=54660537
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510589342.6A Expired - Fee Related CN105112423B (en) | 2015-09-16 | 2015-09-16 | It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105112423B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111849989B (en) * | 2020-07-30 | 2021-11-23 | 山东农业大学 | Method for enhancing salt tolerance of mulberry by utilizing long-chain non-coding RNA transgenic rootstock |
| CN113136393B (en) * | 2021-06-04 | 2022-11-11 | 中国水稻研究所 | OsmiR398b interference fragment of rice cadmium-tolerant protein OsCSD2 and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320467A (en) * | 2013-06-06 | 2013-09-25 | 江苏省农业科学院 | Application of GrVe gene providing plant with verticillium wilt resistance |
-
2015
- 2015-09-16 CN CN201510589342.6A patent/CN105112423B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103320467A (en) * | 2013-06-06 | 2013-09-25 | 江苏省农业科学院 | Application of GrVe gene providing plant with verticillium wilt resistance |
Non-Patent Citations (4)
| Title |
|---|
| Genome-wide identification of abiotic stress-regulated and novel microRNAs in mulberry leaf;Ping Wu et al.;《Plant Physiology and Biochemistry》;20150709;第95卷;第77页右栏第3段，第80页左栏第1段，表3 * |
| Identification of the Conserved and Novel miRNAs in Mulberry by High-Throughput Sequencing;Ling Jia et al.;《PLOS ONE》;20140831;第9卷(第8期);e104409 * |
| miR398在植物逆境胁迫应答中的作用;丁艳菲等;《遗传》;20100228;第32卷(第2期);第132页右栏第3段 * |
| 桑树响应植原体侵染的新miRNAs的生物学功能研究;李轶群;《中国优秀硕士学位论文全文数据库 农业科技辑》;20150115(第01期);摘要 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105112423A (en) | 2015-12-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101182523B (en) | Plants flower pesticide specificity promoter and uses thereof | |
| CN110144363B (en) | Insect-resistant herbicide tolerant corn transformation events | |
| CN103201385A (en) | Down-regulating gene expression in insect pests | |
| CN111424022B (en) | Verticillium dahliae VdEG target gene fragment for pathogen-resistant bacteria, interference vector and application thereof | |
| CN105087640B (en) | Adjust gene and its application of vegetable seeds development | |
| CN113549635B (en) | Application of verticillium dahliae VdPRMT1 gene in improving disease resistance of crops or vegetables | |
| CN114752599B (en) | Verticillium dahliae VdNRPS3 gene antipathogen target gene fragment, interference vector and application thereof | |
| CN117587047A (en) | Application of GhMPK9 gene in improving verticillium wilt resistance of cotton | |
| CN103525828B (en) | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof | |
| CN104988139A (en) | Method for cultivating cotton resisting verticillium dahliae | |
| CN102943091A (en) | Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique | |
| CN105112423B (en) | It is a kind of enhancing mulberry tree disease resistance miRNA clone and its application | |
| CN107406844A (en) | The transgenic rice plant of improvement | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN103451225B (en) | Application of rice WRKY transcription factor gene OsWRKY21 in cultivation of resistant varieties of plants | |
| CN102851297B (en) | Myzuspersicae hunchback gene cDNA and application thereof | |
| CN104774869A (en) | Method for cultivating long-storage tomato plants by virtue of silent tomato gene SlNZG | |
| CN103352038B (en) | Corn disease-resistance related gene MR4, and application of the same in corn disease-resistance improvement | |
| CN103361325B (en) | A kind of albumen relevant to paddy rice bacterial leaf spot resistance and encoding gene thereof and application | |
| CN101781654B (en) | Novel cotton fungal disease-resistant gene GhMPK7 and application thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN108795942A (en) | A kind of rice external cause stress-inducing expression promoter Ps ubs3 and its application | |
| CN116926088B (en) | Verticillium dahliae VdNRPS6 gene antipathogenic target gene fragment, interference vector and application thereof | |
| CN116536347B (en) | Application of calpain gene GhCCAMK in verticillium resistance of plants | |
| CN110295192B (en) | Bivalent RNAi expression vector for constructing TYLCV and ToCV by Gateway technology and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20180727 Termination date: 20190916 |