CN112225790A

CN112225790A - Rice salt stress resistance related gene ONAC103, and coding protein and application thereof

Info

Publication number: CN112225790A
Application number: CN202011094584.5A
Authority: CN
Inventors: 陈亮; 赵立明; 李燕; 崔玉超; 郭迟鸣; 郭小玲
Original assignee: Xiamen University
Current assignee: Fujian Lingyu Technology Co ltd
Priority date: 2020-10-14
Filing date: 2020-10-14
Publication date: 2021-01-15
Anticipated expiration: 2040-10-14
Also published as: CN112225790B

Abstract

A rice salt stress resistance related gene ONAC103, a coding protein and application relate to the technical field of molecular biology and genetic engineering. Discloses a rice salt stress resistance related gene ONAC103(LOC _ Os07g48450), and the nucleic acid sequence of the gene is shown as SEQ ID 1. The ONAC103 is a related gene of salt stress resistance of rice. The relative expression of ONAC103 was significantly up-regulated upon salt stress treatment. The transgenic rice plant over expressing ONAC103 has significantly higher salt tolerance than the control group. The gene can obviously improve the salt tolerance of rice. Therefore, the gene has important application value in screening salt-resistant rice varieties and improving rice yield. The cultivation of the rice with enhanced salt stress resistance in agricultural production has important significance for saving energy and water, utilizing saline-alkali soil, increasing grain yield and the like.

Description

Rice salt stress resistance related gene ONAC103, and coding protein and application thereof

Technical Field

The invention relates to the technical field of molecular biology and genetic engineering, in particular to a salt stress resistance related gene ONAC103 of rice and application of a protein coded by the same.

Background

Rice is one of the main grain crops in the world, and the yield of the rice is very important for grain safety. Meanwhile, the rice can also be used as a model plant to be applied to the research of the plant science, and has important significance for the research of the salt stress tolerance mechanism of the plant. The research on the molecular biology mechanism of the growth and development of the rice in each period and the regulation and control of the adversity stress are not only helpful for understanding the growth and development mechanism of the rice, but also have important significance for improving the yield of the rice.

Although our country has wide breadth and vast territorial area, the shortage of the cultivated land area per capita is caused by the large population of our country, so that the usable land area of our country is seriously insufficient. Meanwhile, in arid and semiarid regions and other regions, large areas of saline-alkali soil which cannot be utilized exist. The research of the response mechanism and the resistance mechanism of rice as grain crops to salt stress is an important part in the agricultural development process. The method has very important significance for cultivating rice varieties with salt stress resistance by screening genes related to rice salt resistance and analyzing the regulation and control mechanism of the genes, and is beneficial to sustainable development of agricultural production, water resource saving and reduction of pollution and damage to the environment.

A large number of genes related to salt stress resistance regulation exist in rice, and when the regulation and control effect of the genes in the rice salt stress is researched, the regulation and control effect of a target gene in the salt stress process is observed by up-regulating or down-regulating the expression quantity of the target gene by a molecular biological means.

Disclosure of Invention

The first purpose of the invention is to provide a rice salt stress resistance related gene ONAC 103.

The second purpose of the invention is to provide a protein coded by the rice salt stress resistance related gene ONAC 103.

The third purpose of the invention is to provide the application of the rice salt stress resistance related gene ONAC103 in cultivating rice with enhanced salt stress resistance.

The nucleotide sequence of the rice salt stress resistance related gene ONAC103 is shown as SEQ ID No: 1 is shown.

The amino acid sequence of the protein coded by the rice salt stress resistance related gene ONAC103 is shown as SEQ ID No: 2, respectively.

The rice salt stress resistance related gene ONAC103 can be applied to improving the resistance of rice to salt stress and cultivating rice with enhanced salt stress resistance.

The cultivation of the rice with enhanced salt stress resistance can adopt the following method:

an overexpression vector of the rice salt stress related gene ONAC103 is constructed, the overexpression vector is transformed into rice, and the rice with enhanced salt stress resistance is obtained through screening. The transformation can adopt an agrobacterium-mediated transformation method and a gene gun-mediated transformation method, and preferably adopts the agrobacterium-mediated transformation method.

According to the invention, the expression level of the rice salt stress resistance related gene ONAC103 in rice is obviously improved by constructing an overexpression transgenic plant of the rice salt stress resistance related gene ONAC 103. Salt stress treatment is simulated by using 150mM NaCl, phenotype after salt stress is observed, the survival rate is counted, and finally the regulation and control effect of the ONAC103 in rice salt stress is determined.

After the overexpression transgenic plant line of the rice salt stress related gene ONAC103 is subjected to salt stress treatment, the survival rate is counted after rehydration, and the survival rate of the transgenic plant overexpressing ONAC103 is obviously higher than that of a control group. The over-expression transgenic plant of the gene is shown to be capable of obviously improving the resistance of the rice to salt stress. The invention provides an important way for cultivating the rice variety with enhanced salt stress resistance. The cultivation of the rice with enhanced salt stress resistance in agricultural production has important significance for saving energy and water, utilizing saline-alkali soil, increasing grain yield and the like.

Drawings

FIG. 1 is an overexpression transgenic plant of ONAC103Detecting the relative expression of ONAC103 in the strain, and extracting the T in the three-leaf one-heart stage₀After the total RNA of the transgenic seedlings and WT seedlings is reversely transcribed into cDNA, the relative expression quantity of ONAC103 is detected by utilizing a qPCR technology. In the figure, the column diagram represents the relative expression amount of the ONAC103 in the overexpression transgenic plants, the WT represents the wild type rice variety Taipei 309(TP309), and the ONAC103^OE-1、ONAC103^OE-2、ONAC103^OE-3、ONAC103^OE-4、ONAC103^OE-5、ONAC103^OE-6、ONAC103^OE-7、ONAC103^OE-8、ONAC103^OE-9、ONAC103^OE-10 represents T₀Transgenic plants are over-expressed. The bar graph represents the relative expression of ONAC103 in transgenic plants as well as WT. The number lines on the bar graph represent Standard Deviation (SD), the standard deviation of the biological replicates. Each biological replicate included three technical replicates.

FIG. 2 shows T1 generation Trifolium praecox one-heart seedling transgenic plants and corresponding concurrent TP309 salt stress treatment. The basal medium for the treatment was 1/2 MS. The treated salt concentration was 150mM NaCl, and the photographs were taken before treatment, 7 days after treatment, and then 20 days after rehydration by 1/2MS, and the survival rate was counted.

FIG. 3 shows survival rate after salt stress treatment. After 7 days of salt stress treatment, the survival rate is counted for 20 days of rehydration. The standard deviation (SD value) is the standard deviation of three replicates. Bar graph represents survival after salt stress treatment, the upper vertical line represents the standard deviation of triplicate experiments; "+" indicates that there was a very significant difference in survival between the ONAC103 overexpressing transgenic plants and the wild type plants (P < 0.05).

Detailed Description

The following examples will further illustrate the present invention with reference to the accompanying drawings.

Example 1: acquisition of target fragment of salt stress resistance related gene ONAC103

In the invention, TP309 is used as a material, total RNA is extracted by using a kit, and the RNA is reversely transcribed into cDNA by using a reverse transcription kit. The cDNA is taken as a template, high fidelity enzyme can be used for amplifying the target fragment, and Primerstar HS DNA Polymerase is used for amplifying the target fragment in the invention. The primer sequence is as follows:

OE-ONAC103-For：GATGTTTGGGTTCGGGCACC

OE-ONAC103-Rev：TCAGAATAGCTGAGGAGGAAGC

the reaction system of PCR amplification is as follows:

the PCR amplification condition is pre-denaturation at 94 ℃ for 3 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, annealing at 72 ℃ for 1min for 10s, and the cycle number is 35 cycles; extension at 72 ℃ for 5 min. Keeping the temperature at 4 ℃.

And (3) recovering the PCR product by means of glue recovery or PCR product purification and the like, and adding A tail to the recovered PCR product. Easytaq DNA Polymerase was used for A-tailing. The reaction system is as follows:

reaction procedure: keeping the temperature at 72 ℃ for 30 min.

The overexpression vector used in the invention adopts restriction enzyme XcmI, and enzyme digestion is carried out for 3h at 37 ℃. After enzyme digestion, heat inactivation is carried out at 65 ℃. Ligation was performed after heat inactivation, 50ng of PCR product, 100ng of vector after digestion, 5. mu.l of Solution I ligase, ligation at 16 ℃ for 3 h. The heat shock transformation into Escherichia coli competent cell DH5 alpha, 37 ℃ inverted culture overnight. Then, PCR identification was performed. And (4) extracting plasmid sequencing from the colony which is positive in PCR identification. After the sequencing is correct, the correct plasmid is transformed into agrobacterium-infected EHA105 for genetic transformation of rice. The strain was stored at-80 ℃ with 20% glycerol.

Example 2: transgenic rice plant obtained by agrobacterium transformation

The first step is as follows: rice callus preparation

1. Selecting TP309 rice seeds, shelling, placing in a 50mL centrifuge tube, washing with sterile water for 3 times, each time for 1 min;

2. sterilizing the seeds with 75% ethanol for three times, each time for 1min, and cleaning with sterile water;

3. adding 10% sodium hypochlorite solution, vacuumizing for 8min, placing on a turnover mixing machine for 30n/min, and shaking for 20 min;

4. washing the sodium hypochlorite solution on the surface of the rice seeds with sterile water, and placing the seeds on sterilized filter paper for drying;

5. inoculating the seeds on an NBD culture medium by using tweezers, culturing for 21 days in the dark, then performing bud pinching, completely pinching coleoptiles, aerial roots and the like during bud pinching, only leaving callus (generally orange) in a good growth state, and culturing for 3-7 days for agrobacterium infection.

The second step is that: preparation of agrobacterium-mediated dyeing liquid

1. Activating agrobacterium with a small amount of YEP culture medium, and standing at the temperature of 4 ℃ for later use at the temperature of 28 ℃ and 200rpm (adding Kan 50mg/L, Rif 50 mg/L);

2. inoculating activated bacteria liquid into 100ml YEP culture medium (added with Kan 50mg/L, Rif 50mg/L) at a ratio of 1: 1000. Shaking culture at 28 deg.C and 200rpm, and measuring OD once every 1h₆₀₀The value is obtained. To be OD₆₀₀When the concentration is 0.3-0.8, the composition can be used for infection;

3. subpackaging the activated agrobacterium tumefaciens into 50ml centrifuge tubes, centrifuging for 8min at the room temperature (about 25 ℃) of 4000rpm, discarding the supernatant, and collecting the thalli;

4. suspending thallus with proper amount of AAM-As medium (100 μ M As is added at ratio of 1: 1000), and making into OD₆₀₀Is about 0.5, and is prepared by reversing and mixing.

The third step: dip dyeing, differentiation and rooting of callus

1. Selecting callus with good growth condition and compact structure, placing in Agrobacterium tumefaciens staining solution, fully reversing, mixing, standing at room temperature, and staining for 30 min;

2. pouring out the agrobacterium infection solution, transferring the soaked callus to a dish filled with sterilized filter paper for full blow drying, transferring to an NBD-As culture medium, and culturing for 3d under the dark condition at 26 ℃;

3. and (5) callus washing. Transferring the callus after co-culture for 3d to a triangular flask, washing with sterilized water, vacuumizing for 5min under sterile condition with 125mg/L Cef and 125mg/L Carb, and oscillating at 28 deg.C and 200rpm for 20 min;

4. and (3) placing the cleaned callus on sterilized filter paper, fully drying, transferring to a screening culture medium, and culturing at 26 ℃ in the dark. Observing whether pollution exists or not in the culture process, and timely cleaning if pollution exists;

5. subculturing to a new screening culture medium every 20d, growing new positive callus from the impregnated callus in the screening culture medium, and transferring the positive callus to a differentiation culture medium;

6. after new rice plants are differentiated, transplanting the rice transgenic seedlings to a rooting culture medium;

7. after growing in rooting culture medium for a period of time, transplanting to water for acclimatization and culture, and transplanting to soil. Culturing under natural condition.

The fourth step: identification of transgenic seedlings

PCR identification is carried out by taking three-leaf first-heart-stage seedling leaves, extracting DNA of the leaves by a CTAB method, and then carrying out PCR amplification. The reverse primer is the reverse primer of the target fragment. The primer sequence is as follows:

Ubi For：TTTTAGCCCTGCCTTCATACGC

OE-ONAC103 Rev:TCAGAATAGCTGAGGAGGAAGC

in the PCR identification, the TP309 is used as a negative control, and the over-expression vector of the ONAC103 is used as a positive control. And during PCR identification, positive transgenic plants consistent with the positive control strips are identified, and false positive transgenic plants consistent with the negative control strips are identified. After the positive transgenes are identified, the relative expression quantity of the ONAC103 in the over-expression transgenic plants is detected through qPCR. Firstly, extracting total RNA of ONAC103 overexpression transgenic plants and TP309, wherein each strain takes 3 biological repeats, each biological repeat takes 3 technical repeats, and rice actin is taken as an internal reference gene. The qPCR primer sequences were:

qPCR ONAC103 For:GCACTATCCTCCTTGATTCG

qPCR ONAC103 Rev:CAGTGCTTTCCTCTGAAACC

Actin For:TGTATGCCAGTGGTCGTACCA

Actin Rev:CCAGCAAGGTCGAGACGAA

the qPCR program was: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 5s, annealing and extension at 60 ℃ for 30s, with 40 cycles. Fluorescence signal acquisition was performed at 60 ℃ extension for the last 5s per cycle. After amplification was complete, the temperature was raised from 60 ℃ and signals were collected every 0.3 ℃ until the temperature rose to 95 ℃. And exporting data for analysis after the program is completed. And analyzing the relative expression quantity of the target gene by adopting a 2-delta CT relative quantification method during data analysis. The qPCR results are shown in figure 1: relative to TP309, the relative expression of 5 overexpression lines is 40-50 times except that the expression of the 3# overexpression line is improved by about 20 times. Therefore, the expression level of the ONAC103 in the overexpression transgenic plants is obviously higher than that of the WT.

Example 3: analysis of salt stress resistance of overexpression transgenic plants

First using TP309 and T₁Salt stress treatment is carried out on the over-expression transgenic plant of the ONAC103 generation to analyze the regulation and control condition of the ONAC103 on the salt stress. The specific process is as follows: after the dehulled rice seeds were sterilized as described above, the overexpressed transgenic plants were sown in 1/2MS medium containing 50mg/L hygromycin and TP309 was sown in solid 1/2MS medium. And (3) after the seeds germinate and grow out of the main roots, moving out of the tissue culture bottle, transferring to a black tissue culture box, and carrying out water culture in 1/2MS culture medium. When the rice seedlings grow to 21 days, the seedlings with consistent growth state are selected and treated, and during treatment, liquid 1/2MS culture medium is adopted for water culture. Adding 150mM NaCl into the culture medium, simulating salt stress treatment, observing the stress phenotype after the treatment, and counting the survival rate. The statistical results are shown in fig. 3: after 150mM NaCl treatment, the survival rate of TP309 is 25%, while the survival rate of the ONAC103 over-expression plants is 75%, and the survival rate of the ONAC103 over-expression plants is significantly higher than that of TP 309. The above explanation of the ONAC103 may be mentionedHigh tolerance of rice to salt stress.

Sequence listing

<110> university of mansion

<120> rice salt stress resistance related gene ONAC103, and coding protein and application thereof

<130> ONAC103

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1041

<212> DNA

<213> Oryza sativa

<400> 1

atggagatga cgatgtcgtc ggcggcgacg tcgctgccgc cggggttccg gttccacccg 60

acggacgagg agctgatcct gcactacctc cgcagccgcg ccaccgccgg gcagtgcccc 120

gtccccatca tcgccgacgt cgacatctac aagttcgatc catgggacct gccatcgaag 180

gcggtgtacg gggagagtga gtggtatttc ttcagcccgc gagaccgcaa gtaccccaac 240

ggaatccggc cgaaccgcgc cgccgggtcg gggtactgga aggcgacggg aaccgacaag 300

cccatccacg acagcgccac cggcgagagc gtcggcgtca agaaggccct cgtcttctac 360

cgcggccgcc ctcccaaggg caccaagacc agctggatca tgcacgagta ccgcctcgcc 420

gccgaccctc tcgccgccgc cgcaaacacc tacaagccct cctcctcctc ccgattccgc 480

aacgtctcca tgaggctgga cgactgggtg ctctgccgga tctacaagaa gtccggccag 540

gcgtcgccga tgatgccgcc gctcgccgcc gactacgacc acgacgagcc gtccggagtc 600

cttgacgacg cctacagctt ctacgcgccg ccgatgatca gcaccacgct catccccaag 660

ctccccaaga tcccctccat ctccgagctc ttcgacgagc acgcgctcgc ccagatcttc 720

gacgccgccg ccgacccgcc ggccgaccac catcagcatg ccctcgccgt ccacccctcc 780

ctgaaccagc tcctcggcgt cggcgacaac ttcctcgcgg agtgctaccc gtcgacggcg 840

tccacggcca ccgttgccgg cggcaagcgc aaggcgagcc cggccggaga ctacgccggc 900

ggcggccaca cgccggcgaa gaggctcaac ggctcatgct tcgacgtggc gccgcagtcc 960

gtggtgggcg gcttgcaagc gacgccgtcg tcagtcctcg ccggactcaa ccaccagatg 1020

cttcctcctc agctattctg a 1041

<210> 2

<211> 346

<212> PRT

<213> Oryza sativa

<400> 2

Met Glu Met Thr Met Ser Ser Ala Ala Thr Ser Leu Pro Pro Gly Phe

1 5 10 15

Arg Phe His Pro Thr Asp Glu Glu Leu Ile Leu His Tyr Leu Arg Ser

20 25 30

Arg Ala Thr Ala Gly Gln Cys Pro Val Pro Ile Ile Ala Asp Val Asp

35 40 45

Ile Tyr Lys Phe Asp Pro Trp Asp Leu Pro Ser Lys Ala Val Tyr Gly

50 55 60

Glu Ser Glu Trp Tyr Phe Phe Ser Pro Arg Asp Arg Lys Tyr Pro Asn

65 70 75 80

Gly Ile Arg Pro Asn Arg Ala Ala Gly Ser Gly Tyr Trp Lys Ala Thr

85 90 95

Gly Thr Asp Lys Pro Ile His Asp Ser Ala Thr Gly Glu Ser Val Gly

100 105 110

Val Lys Lys Ala Leu Val Phe Tyr Arg Gly Arg Pro Pro Lys Gly Thr

115 120 125

Lys Thr Ser Trp Ile Met His Glu Tyr Arg Leu Ala Ala Asp Pro Leu

130 135 140

Ala Ala Ala Ala Asn Thr Tyr Lys Pro Ser Ser Ser Ser Arg Phe Arg

145 150 155 160

Asn Val Ser Met Arg Leu Asp Asp Trp Val Leu Cys Arg Ile Tyr Lys

165 170 175

Lys Ser Gly Gln Ala Ser Pro Met Met Pro Pro Leu Ala Ala Asp Tyr

180 185 190

Asp His Asp Glu Pro Ser Gly Val Leu Asp Asp Ala Tyr Ser Phe Tyr

195 200 205

Ala Pro Pro Met Ile Ser Thr Thr Leu Ile Pro Lys Leu Pro Lys Ile

210 215 220

Pro Ser Ile Ser Glu Leu Phe Asp Glu His Ala Leu Ala Gln Ile Phe

225 230 235 240

Asp Ala Ala Ala Asp Pro Pro Ala Asp His His Gln His Ala Leu Ala

245 250 255

Val His Pro Ser Leu Asn Gln Leu Leu Gly Val Gly Asp Asn Phe Leu

260 265 270

Ala Glu Cys Tyr Pro Ser Thr Ala Ser Thr Ala Thr Val Ala Gly Gly

275 280 285

Lys Arg Lys Ala Ser Pro Ala Gly Asp Tyr Ala Gly Gly Gly His Thr

290 295 300

Pro Ala Lys Arg Leu Asn Gly Ser Cys Phe Asp Val Ala Pro Gln Ser

305 310 315 320

Val Val Gly Gly Leu Gln Ala Thr Pro Ser Ser Val Leu Ala Gly Leu

325 330 335

Asn His Gln Met Leu Pro Pro Gln Leu Phe

340 345

<210> 3

<211> 22

<212> DNA

<213> Oryza sativa

<400> 3

gatatgtttg ggttcgggca cc 22

<210> 4

<211> 22

<212> DNA

<213> Oryza sativa

<400> 4

tcagaatagc tgaggaggaa gc 22

<210> 5

<211> 20

<212> DNA

<213> Oryza sativa

<400> 5

gcactatcct ccttgattcg 20

<210> 6

<211> 20

<212> DNA

<213> Oryza sativa

<400> 6

cagtgctttc ctctgaaacc 20

<210> 7

<211> 21

<212> DNA

<213> Oryza sativa

<400> 7

tgtatgccag tggtcgtacc a 21

<210> 8

<211> 19

<212> DNA

<213> Oryza sativa

<400> 8

ccagcaaggt cgagacgaa 19

Claims

1. The rice salt stress resistance related gene ONAC103 is characterized in that the nucleotide sequence is shown as SEQ ID No: 1 is shown.

2. The protein encoded by the rice salt stress resistance related gene ONAC103 as claimed in claim 1, wherein the amino acid sequence thereof is as shown in SEQ ID No: 2, respectively.

3. The use of the rice salt stress resistance-related gene ONAC103 as claimed in claim 1 in breeding rice with enhanced salt stress resistance.

4. Use according to claim 3, characterized in that the following method is used:

and (3) constructing an overexpression vector of the rice salt-resistance related gene ONAC103, transforming the overexpression vector into rice in a stable genetic transformation mode, and screening to obtain the rice with enhanced salt stress resistance.