CN103911386B - Improve the artificial fusion of the stress tolerance of plant - Google Patents

Abstract

The present invention relates to a kind of artificial fusion and application thereof of the stress tolerance that improves plant. The polynucleotide sequence that this gene has comprises: (a) polynucleotide sequence of NAD (P) the binding function domain of coding paddy rice GPDH albumen; (b) polynucleotide sequence of the NAD_Gly3P dehydrogenase function domain of coding Escherichia coli gpsA albumen. Artificial fusion of the present invention, can be used in the genetically modified plants such as preparation paddy rice, improves the ability of the anti-stress tolerance of plant.

Description

Improve the artificial fusion of the stress tolerance of plant

Technical field

The invention belongs to gene engineering technology field, be specifically related to the stress tolerance that improves plant artificial fusion andIts application.

Background technology

Plant can suffer from various abiotic stresses in growth course, such as arid, the gentle stagnant waterlogging of height etc.Natural calamity, often causes a large amount of underproduction of crops, and in addition, in China, the scarce phosphorus of ploughing is also a kind of common abiotic stress ring(China has arable land more than half to lack phosphorus, and (Li Yongfu etc., should to ensure grain yield in production, often to use in a large number phosphate fertilizer in borderWith Acta Ecologica Sinica, 2005,16 (1): 119-124)). Therefore, plant abiotic stress biology is agricultural cience and farming techniques researchsOne of important goal. For example,, when previous important breeding technique is to attempt various adversity genes to carry out gene to cropsEngineered, to obtain degeneration-resistant new crop varieties.

Scientific research discovery, for resisting coercing of bad external environment, plant soma is experienced the variation of external environmentAnd pass the signal along in cell, meeting inducing cell is expressed various response genes and is jointly resisted the wound of poor environment to plantEvil. Signal transmits molecule and brought into play key effect in the process of plant stress-resistance/stress tolerant. For example, glycerol-3-phosphate (againClaim glycerol 3-phosphate, Glycerol-3-phosphate, G-3-P) to be not only various glyceride materials (such as film fat etc.) syntheticPrecursor, be also simultaneously signal small-molecule substance in plant, in the degeneration-resistant process of plant, play key effect.

Glycerol-3-phosphate is the important as precursors thing of phosphatide in cell membrane plasma membrane, the structure of the variation confrontation membrane phospholipid of its contentOne-tenth has a significant effect. Moreover experimental study is verified, the height of the expression of the glycerol-3-phosphate in arabidopsis cellHaving reflected its resistance against diseases, proved that glycerol-3-phosphate is the strong inducer of Systemic Acquired Resistance In Plants, is that plant is exempted fromImportant member in epidemic disease system.

Due to glycerol-3-phosphate dehydrogenase, (glycerol-3-phosphatedehydrogenase claims again GPDH eggIn vain) be one of the key enzyme that plant produces glycerol-3-phosphate. It is made up of two domains, is NAD (P) in its N end structure territoryBinding function domain, its major function is in conjunction with NAD+/NADP+, its C end is NAD_Gly3P dehydrogenase hydrolysis function structureTerritory, its major function is that catalysis utilizes NADH and Dihydroxyacetone Phosphate to produce glycerol-3-phosphate.

For improving the expression of glycerol-3-phosphate in plant cell, general way be improve glycerine in plant cell-The expression of 3-phosphate dehydrogenase. Scientists attempts in plant cell, not having bacterial origin sweet of feedback effectOil-3-phosphate dehydrogenase gene carrys out arabidopsis thaliana transformation, referring to document ShenWetal, TheJournalofBiologicalChemistry, 2010,285:22957 – 22965, overexpression gpsA in arabidopsis cell^FRGene (warpThe glycerol-3-phosphoric desaturase gene of improved bacterial origin) change a large amount of phospholipid metabolism related gene expression amounts, changeHaving become aliphatic acid in membrane phospholipid forms and film fat composition. Scientists is also attempting this gene to import in the genome of rape,Find that this gene can improve the growth of rape under low-phosphorous condition under laboratory condition, and resist certain osmotic stress,But be only can realize under laboratory condition. It is limited that directly the gene of use bacterial origin carries out its effect of plant improvement.Moreover, do not find temporarily that at present this gpsAFR gene is applied to paddy rice or other industrial crops.

At present, need a kind of new resistant gene, can improve the stress tolerance of plant, and can be suitable for more widelyIn paddy rice and other industrial crops.

Summary of the invention

One aspect of the present invention provides a kind of artificial fusion of the stress tolerance that improves plant, wherein,

The polynucleotide sequence that this gene has comprises:

(a) polynucleotide sequence of NAD (P) the binding function domain of coding paddy rice GPDH albumen; (b) coding large intestineThe polynucleotide sequence of the NAD_Gly3P dehydrogenase function domain of bacillus gpsA albumen.

In a preferred embodiment of the invention, described (b) is for adopting favorite plant codon manually syntheticSequence. In a more preferred of the present invention, the polynucleotide sequence of this artificial fusion comprises as SEQSequence shown in IDNO.1. In addition, inventor is by the called after of nucleotide sequence shown in SEQIDNO.1 OEGD gene. Preferably,The amino acid sequence of this artificial fusion coding comprises sequence as shown in SEQIDNO.2.

The present invention provides the recombinant vector that contains above-mentioned artificial fusion on the other hand.

The host cell that provides above-mentioned recombinant vector to transform on the one hand more of the present invention.

The present invention provides a kind of method of genetically modified plants that produce stress tolerance on the other hand, wherein:

The method comprises the following steps:

1) artificial fusion claimed in claim 1 is operably connected to expression of plants regulating and controlling sequence, formation is plantedThing expression vector;

2) plant expression vector of step 1) gained is proceeded to plant cell;

3) transformant obtaining through screening, is regenerated as plant and offspring thereof, and described plant comprises plant cell, plantTissue or vegetable seeds.

In a preferred embodiment of the present invention, described plant be selected from paddy rice, corn, wheat, barley, broomcorn millet,In Chinese sorghum, soybean, cucumber, clover, potato, castor-oil plant, peanut, cotton, tobacco, oranges and tangerines or cucumber any one.

The transgenosis that the present invention also provides above-mentioned artificial fusion to have stress tolerance in preparation is on the other hand plantedThe purposes of object space face.

Artificial fusion of the present invention, can be used in preparation genetically modified plants, improves the energy of the anti-stress tolerance of plantThe ability of power, especially drought resisting, high temperature, low-phosphorous, resistance to osmotic stress.

Brief description of the drawings

Fig. 1 is each Plants GPDH albumen comparison chart:

Adopt ClustalW software that the wild type GPDH protein sequence of each Plants is compared; In figureGlycine represents soybean (Glycinemax), and serial ID is XP_003553315; Medicago represents clover (MedicagoTruncatula), serial ID is XP_003622291; Cucumis represents cucumber (Cucumissativus), and serial ID isXP_004156696; Citrus represents oranges and tangerines (Citrusclementina), and serial ID is XP_006446670; RicinusRepresent castor-oil plant (Ricinuscommunis), serial ID is XP_002526956; Solanum represents potato (SolanumTuberosum), serial ID is XP_006357169; Setaria represents broomcorn millet (Setariaitalic), and serial ID is XP_004971422; Zea represents corn (Zeamays), and serial ID is NP_001150493; Sorghum represents Chinese sorghum(Sorghumbicolor), serial ID is XP_002459175; Orazy represents paddy rice (Orazysativa), and serial ID isOs01g0971600; Hordeum represents barley (Hordeumvulgare), and serial ID is BAK07844; Triticum representsWheat (Triticumaestivum), serial ID is AGS79224; Underscore in figure, solid line represents NAD (P)-b domain, voidLine represents NAD_Gly3P_DH domain.

Fig. 2 is the structure schematic diagram of expression vector pCB4004-OEGD.

Fig. 3 is OEGD gene expression dose figure in transgenic paddy rice blade. Adopt real-time RT-PCR method to detect OEGDGene is expression in transgenic paddy rice blade, and wherein, the XQ of transverse axis represents the fine contrast in kind Hunan (non-transgenic paddy rice), numberingH1G072-094 represents that difference turns OEGD gene strain; The longitudinal axis represents: log₂(transgenosis with contrast XQ expression multiple).

Fig. 4 is plant height figure after the low-phosphorous processing of transgenic paddy rice. (when paddy growth is during to 4 leaf phase, bring into use without phosphorus formulaNutrient solution pouring paddy rice, the height of plant is added up in without phosphorus pouring for 10 days afterwards; Wherein, the XQ of transverse axis represents the fine contrast in Hunan (the non-base that turnsBecause of paddy rice); H1G072-78 is for turning OEGD trans-genetic hybrid rice for numbering; The longitudinal axis represents: rice seedling plant height (unit for centimetre); *Represent and t-test significance analysis P≤0.05 contrasting, * * represents P≤0.01.

Fig. 5 A is Plant Height of Rice figure after osmotic stress is processed; Fig. 5 B is paddy rice mortalogram after osmotic stress processing rehydration;When paddy growth is during to 4 leaf phase, bring into use the nutrient solution pouring paddy rice containing 20%PEG6000, processes and use normally and seek afterwards for 7 daysThe processing of nutrient solution rehydration, height and the death rate of within 3 days, adding up afterwards plant; In the transverse axis of Fig. 5 A and Fig. 5 B, XQ represents the fine contrast in Hunan, forNon-transgenic paddy rice; H1G072-78 is for turning OEGD trans-genetic hybrid rice for numbering; The longitudinal axis of Fig. 5 A represents: rice seedling plant height is (singlePosition be centimetre); The longitudinal axis of Fig. 5 B represents that dead plant number accounts for the ratio of total plant number; * represent remarkable with the t-test contrastingProperty analyze P≤0.05, * * represents P≤0.01.

Fig. 6 is Plant Height of Rice figure after high temperature stress is processed; (when paddy growth is during to 4 leaf phase, seedling is displaced to high temperature largeIn canopy, under hot environment, grow after 12 days, be transplanted to room temperature and carry out plant height statistics, unit is centimetre; In the transverse axis of Fig. 6, XQ tableShow the fine contrast in Hunan (non-transgenic paddy rice); H1G072-78 is for turning OEGD trans-genetic hybrid rice for numbering; The longitudinal axis of Fig. 6 represents rice seedlingPlant height (unit be centimetre); * represent and t-test significance analysis P≤0.05 contrasting, * * represents P≤0.01.

Fig. 7 contains spirogram for turning SOD in OEGD trans-genetic hybrid rice blade; When paddy growth is during to 4 leaf phase, 20%PEG6000 placeManage and get seedling leaves after 3 days, measure SOD content in blade; In the transverse axis of Fig. 7, XQ represents the fine contrast in Hunan (non-transgenic paddy rice),H1G072-87 is for turning OEGD trans-genetic hybrid rice for numbering; The longitudinal axis of Fig. 7 represents SOD units activity in every milligram of fresh weight blade; * representWith t-test significance analysis P≤0.05 contrasting, * * represents P≤0.01.

Fig. 8 is for turning OEGD trans-genetic hybrid rice individual plant average product figure under Hainan Datian drought stress; When paddy rice enters young fringeDifferentiation period, start to carry out the plantation of drought pipe. After maturation, copy kind of a statistics output; The fine contrast in Hunan is non-transgenic paddy rice; The transverse axis of Fig. 7In, Hunan is fine is contrast (non-transgenic paddy rice), H1G070-87 is for turning OEGD trans-genetic hybrid rice for numbering; The longitudinal axis represents average every strain productAmount, unit gram.

Fig. 9 is for turning OEGD trans-genetic hybrid rice individual plant average product figure under the booth drought stress of Shanghai; Each strain individual plant kindPlant left and right plantation contrast; When paddy rice enters ear differentiation period, start to carry out the plantation of drought pipe; After maturation, copy kind of a statistics output; TurnGene plant output and adjacent adjoining tree carry out output comparison; In the transverse axis of Fig. 9, the fine contrast in Hunan (non-transgenic paddy rice),H1G070-87 is for turning OEGD trans-genetic hybrid rice for numbering; The longitudinal axis represents every strain output, unit gram; * represent to be adjacent the t-of contrastTest significance analysis P≤0.05, * * represents P≤0.01.

Detailed description of the invention

Herein, term " separation ", " purifying " DNA or gene refer to, this DNA or genetic fragment are from natural shapeThe sequence that is arranged in its both sides under state is separated, and also refers to that this DNA or genetic fragment with under native state follow nucleic acidComponent is separated, and has separated with the protein of following it in cell.

In a specific embodiments of the present invention, a kind of artificial fusion of the stress tolerance that improves plant, shouldThe polynucleotide sequence that gene has comprises:

(a) polynucleotide sequence of NAD (P) the binding function domain of coding paddy rice GPDH albumen; (b) coding is largeThe polynucleotide sequence of the NAD_Gly3P dehydrogenase function domain of enterobacteria gpsA albumen.

Described (a) and (b) sequence comprise the change of the polynucleotide sequence of wild type and the identical function albumen of can encodingAbnormity formula, this variant form be the ORFs part generation nucleotide deletion, insertion of wild-type sequence and/or replace after obtain. These variant forms comprise, but are not limited to: several (be generally 1-90, preferably 1-60, better 1-20Individual, best 1-10) disappearance, insertion and/or the replacement of nucleotides, and 5 ' and/or 3 ' end add and severally (be generally 60In individual, be preferably in 30, better is in 10, and best is in 5) nucleotides.

In a specific embodiments of the present invention, the artificial fusion of the stress tolerance of raising plant of the present inventionBy (a) and (b) sequence form, (a) and (b) sequence be directly formed by connecting. In another specific embodiments of the present invention,The artificial fusion of the stress tolerance of raising plant of the present invention is that (a) is connected by one section of connexon sequence with (b) sequenceForm, this connexon sequence does not affect the coding of albumen, does not affect the function of the albumen of last formation.

One preferred embodiment in, described (b) is for adopting the artificial synthetic sequence of favorite plant codon.

In protein, each amino acid is corresponding to different passwords (few one, many has 6), and different plant species is usedThe frequency of different passwords is different. Plant is used secret code Preference to have common data that CodonUsageDatabase is provided(http://www.kazusa.or.jp/codon/). Use preference therefore change password, cannot in existing species, find, justMust manually synthesize. Adopting favorite plant codon artificial synthesized sequence is technology well-known to those skilled in the artMeans.

The polynucleotide sequence of this artificial fusion comprises sequence as shown in SEQIDNO.1. At one of the present inventionIn specific embodiments, the sequence of this artificial fusion sequence as shown in SEQIDNO.1. Inventor is by SEQIDNO.1Shown in nucleotide sequence called after OEGD gene.

The polynucleotide sequence of artificial fusion of the present invention also comprises encoding to have the albumen of OEGD identical functionSEQIDNO.1 in the variant form of open reading frame sequence. These variant forms comprise (but being not limited to): severalThe disappearance of (be generally 1-90, preferably 1-60, more preferably 1-20,1-10 best) nucleotides, insert and/or getGeneration, and 5 ' and/or 3 ' end add several (being generally in 60, is preferably in 30, be more preferably 10 withIn, be in 5 best) nucleotides.

At the polynucleotide sequence of artificial fusion of the present invention, also comprise and refer to that coding has OEGD identical function albumenThe degenerate sequence of SEQIDNO.1 sequence. This degenerate sequence refers in described sequence has one or more codons to be encodedThe sequence producing after the degenerate codon of same amino acid replaces. Due to the degeneracy of codon, so and SEQIDNO.1 sequence homology is low to moderate the amino acid sequence that 89% degenerate sequence also can be encoded out described in SEQIDNO.2. This artLanguage also comprises can be under the rigorous condition of moderate, better under highly rigorous condition with SEQIDNO.1 nucleotide sequence hybridizationNucleotide sequence. This term also comprises and SEQIDNO.1 nucleotide sequence homology at least 89%, preferably at least 90%,At least 95% nucleotide sequence best.

The amino acid sequence of this artificial fusion coding comprises sequence as shown in SEQIDNO.2. Of the present invention oneIn individual specific embodiments, amino acid sequence sequence as shown in SEQIDNO.2 of this artificial fusion coding, i.e. OEGD baseBecause of the albumen of coding, inventor is by this albumen called after OEGD albumen.

In the present invention, also comprise and having and variant form OEGD identical function, SEQIDNO.2 sequence. TheseVariant form comprises (but being not limited to): several (be generally 1-50, preferably 1-30, more preferably 1-20, best1-10) amino acid whose disappearance, insertion and/or replacement, and add one or several (being generally at C end and/or N endIn 20, being preferably in 10, is more preferably in 5) amino acid. For example, in the art, with performance close orWhen similar amino acid replaces, conventionally can not change the function of protein. Again such as, add at C end and/or N endOne or the common function that also can not change protein of several amino acid.

The percent homology of albumen is by GAP(Needleman and Wunsh, 1970) analyze (GCG program) reallyFixed, wherein parameter gapcreationpenalty=5, gapextensionpenalty=0.3. Analyzed sequenceWhen length is at least 15 amino acid, GAP analyzes just 15 the amino acid whose regions that are at least in two sequences that participate in testingTest. More preferably, when analyzed sequence length is at least 50 amino acid, GAP analysis is just tested in participation50 the amino acid whose regions that are at least of two sequences are tested. More preferably, analyzed sequence length is at leastWhen 100 amino acid, GAP just analyzes and surveys in 100 the amino acid whose regions that are at least of two sequences that participate in testExamination. More preferably, when analyzed sequence length is at least 250 amino acid, GAP analyzes just at two that participate in testing250 the amino acid whose regions that are at least of sequence are tested. Even more preferably, analyzed sequence length is at leastWhen 500 amino acid, GAP just analyzes and carries out in 500 the amino acid whose regions that are at least of two sequences that participate in testTest.

By methods known in the art can synthesize, separation and purifying polynucleotides (DNA or RNA), carrier, transformantAnd organism.

The present invention separates the polynucleotides of synthetic artificial fusion, includes but not limited to: SEQIDNO.1 compilesThe nucleotide sequence of code OEGD gene; Or this nucleotide sequence can with SEQIDNO.1 in from nucleotides 1-1062 positionNucleotide sequence hybridization; Or its function is equivalent to the subfragrnent of sequence shown in SEQIDNO.1.

Recombinant vector for artificial fusion of the present invention can be as bacteriophage, plasmid, clay, miniature dyeingBody, virus or retroviral vector. The carrier that can be used for clone and/or express polynucleotides of the present invention is to copy at needAnd/or express the carrier that copies and/or express polynucleotides in the host cell of polynucleotides. In general, carry the present inventionThe recombinant expression carrier of nucleotide sequence can use Ti-plasmids, plant viral vector, directly delivered DNA, microinjection, electroporationImport plant cell (Weissbach, 1998, MethodforPlantMolecular etc. conventional biological technique methodBiologyVIII,AcademyPress,NewYork,pp.411-463;GeisersonandCorey,1998,PlantMolecularBiology(2ndEdition）。

Having developed several different methods can operate polynucleotides and carrier for the cohesive end via complementary or recombinaseGround is connected. For example, can be wanting DNA segment ends in insertion vector DNA and add the same aggressiveness sequence fragment of special design.Then by the hydrogen bond connection carrier between complementary homopolymeric tail and DNA section to form recombinant DNA molecules; Or utilizeThe DNA principle of recombinating, is used specific recombinase to carry out recombining reaction, forms recombinant DNA molecules.

Term " is operationally connected " and is expressed as follows situation: some part of linear DNA sequence can affect same lineThe activity of other parts of property DNA sequence dna. For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, letter soNumber peptide (secretion targeting sequencing) DNA is operably connected to polypeptid DNA exactly; If transcribing of promoter control sequence, soIt is to be operably connected to coded sequence; If when ribosome bind site is placed in the position that can make its translation, so itTo be operably connected to coded sequence. Generally, " being operably connected to " means adjacent, for secretion targeting sequencingMean in reading frame adjacent.

Polynucleotides insert should be operably connected to compatible suitably the opening of host cell of expressing polynucleotidesOn mover, promoter can be strong promoter and/or inducible promoter. The example of some promoters of enumerating comprises bacteriophageλ PL promoter, Escherichia coli lac, trP, phoA, tac promoter, SV40 early stage and late promoter and reverse transcriptionVirus LTR promoter; Other suitable promoter is well known by persons skilled in the art. Expressing recombinant vector further contains and turnsRecord initial, termination site, and contain at transcriptional domain the ribosome bind site that is useful on translation. The transcript that recombinant vector is expressedCoded portion can comprise that the termination that is positioned at the translation initiation codon at starting point place and is suitably positioned at the end that is translated polypeptide is closeNumeral (UAA, UGA or UAG).

As mentioned above, expression vector can comprise at least one selected marker. Described mark comprises the antibiotic resistance of codingGene, for example: neomycin phosphotransferase (Neomycinphosphotransferase) gene npt II, hygromycin phosphoric acid turnMove enzyme (Hygromycinphosphotransferase) gene hpt and dihyrofolate reductase (DihydrofolateReductase) gene dhfr; Another kind of is coding herbicide resistance gene, for example, and careless fourth phosphinothricin acetyl transferase(Phosphinothricinacetyltransferase) Bar gene, 5-enol pyruvoyl oxalic acid-3-phosphate synthase (5-Enoylpyruvateshikimatr-3-phosphate) gene epsps. Suitably host's representative example comprises but does not limitIn: protoplasm somatocyte and plant cell. The appropriate culture medium of above-mentioned host cell and condition of culture are known in the art.

The method for transformation of genes of interest or polynucleotide of interest a: class is carrier mediated method for transformation, by object baseBecause being inserted on the carrier molecule such as the plasmid of Agrobacterium or the DNA of virus, along with the transfer of carrier DNA, genes of interest is ledEnter in Plant Genome; Agriculture bacillus mediated and virus-mediated method just belongs to this method. Equations of The Second Kind is gene direct guiding method,Refer to by the method for physics or chemistry and directly external source genes of interest is imported in the genome of plant. Physical method comprises geneRifle conversion method, Electroporation method, supercritical ultrasonics technology, microinjection and laser microbeam method etc.; Chemical method has PEG mediated transformation sideMethod and liposome method etc. The 3rd class is germplasm systems approach, and this comprises pollen tube passage method, reproduction cell dip method, blastular and sonRoom injection etc. In the present invention, the term of use " transformant " (transformant), with the host of allogeneic dna sequence DNA moleculeCell or organism.

The present invention also comprises the host cell that contains nucleotide sequence of the present invention, and described nucleotide sequence through this areaThe technology of knowing can operate and be connected with one or more allos control zone (as promoter and/or enhancer). Can select to regulate and insertThe expression of the gene order entering, or can be according to required particular form modification and the host strain of processed gene product. At someUnder the existence of inducer, the expression that some promoter starts can raise.

Can identify the cell successfully being transformed by well-known technology, contain nucleotides sequence of the present inventionCell or the organism of the recombinant vector of row.

In a specific embodiments of the present invention, a kind of method of genetically modified plants that produce stress tolerance, the partyMethod comprises the following steps:

1) artificial fusion claimed in claim 1 is operably connected to expression of plants regulating and controlling sequence, formation is plantedThing expression vector;

2) plant expression vector of step 1) gained is proceeded to plant cell;

3) transformant obtaining through screening, is regenerated as plant and offspring thereof, and described plant comprises plant cell, plantTissue or vegetable seeds.

Above-mentioned " artificial fusion is operably connected to expression of plants regulating and controlling sequence ", refers to artificial fusionSequence is effectively connected to plant constructive expression or stress-inducing is expressed promoter.

Described plant be selected from paddy rice, corn, wheat, barley, broomcorn millet, Chinese sorghum, soybean, cucumber, clover, potato, castor-oil plant,In peanut, cotton, tobacco, oranges and tangerines or cucumber any one. In a specific embodiment of the present invention, by carrying of OEGD geneBody proceeds in rice cell and obtains and turn OEGD trans-genetic hybrid rice.

Due to paddy rice, corn, wheat, barley, broomcorn millet, Chinese sorghum, soybean, cucumber, clover, potato, castor-oil plant, peanut, cotton,The homology of the height of the GPDH protein sequence of tobacco, oranges and tangerines and cucumber, referring to following embodiment 1, therefore, can be applicable toThe artificial fusion of rice cell, also can be applicable to corn, wheat, barley, broomcorn millet, Chinese sorghum, soybean, cucumber, clover, Ma LingPotato, castor-oil plant, peanut, cotton, tobacco, oranges and tangerines and cucumber, this is persons skilled in the art according to general knowledge known in this field instituteCan infer.

Below in conjunction with specific embodiment, further illustrate the present invention. Should be understood that these embodiment are only for illustrating the present inventionLimit the scope of the invention and be not used in. The experimental technique of unreceipted actual conditions in the following example, conventionally according to conventional barPart, or the condition of advising according to manufacturer.

Embodiment 1: plant GPDH protein sequence comparison

From NCBI gene database platform (http://www.ncbi.nlm.nih.gov/) download paddy rice, corn, wheat,Amino acid sequence (its of the GPDH albumen of the species such as barley, broomcorn millet, Chinese sorghum, soybean, cucumber, clover, potato, oranges and tangerines, castor-oil plantIn, the amino acid sequence of the GPDH albumen of paddy rice is SEQIDNO.7), adopt ClustalW software by plant GPDH albumen orderRow compare, and concrete outcome is shown in Fig. 1. As can be seen from Figure 1, these derive from dicotyledonous and GPDH unifacial leaf speciesAlbumen is very conservative, no matter is NAD (P) binding function domain or NAD_Gly3P dehydrogenase structure domain, its sequence similarityVery high, and function between these albumen is also extremely similar.

Therefore,, in genetic manipulation, the domain gene of identical function is exchanged base in these above-mentioned plant speciesBecause of function effect very little.

Certainly, the gpsA albumen homology in the GPDH albumen of plant origin and Escherichia coli source is very low, for example, and paddy riceThe uniformity of GPDH albumen and Escherichia coli gpsA albumen (IDaccession:P37606) is only 21.4%, considers congenialityAmino acid factor, its similitude is only also 35.1%. By the NAD of plant origin (P) binding function domain and bacterial originNAD_Gly3P_DH domain manually merges, and no matter uses which kind of plant sequence, and it is to artificial fusion function effectTo be very little. Be the sequence that NAD in the present invention (P) binding function domain can use different plant origins, and NAD_Gly3P_DH domain carrys out source sequence with Escherichia coli, does not affect the performance of fusion function.

The present invention is using paddy rice as the plant origin of embodiment below.

Embodiment 2: the synthetic clone OEGD gene that separates

From ncbi database platform (http://www.ncbi.nlm.nih.gov/) download rice Os 01g0971600 andBacterium P37606 sequence. First separate cloning rice GPDH gene. Adopt TRIzol reagent (GIBCOBRL, USA) extractingThe total RNA of rice leaf. Utilize reverse transcriptase MLV(Tiangen, China) its reverse transcription is become to cDNA. With primer GPDF (5 '-Atggagaacggacacgccaagaatc-3 ') and primer GGR(5 '-Gctggactccaatgaagtcctctacaacagaaaccagg-3 '), amplification is containing gene NAD (P) binding function domainThe PCR product of cDNA. PCR reaction condition is: 94 DEG C of denaturation 3min; 94 DEG C of 30sec, 60 DEG C of 30sec, 72 DEG C of 90sec totally 35Individual circulation; 72 DEG C are extended 5min. The PCR product that amplification is obtained is connected into pGEM-T carrier (Promega, USA), and screening is positiveClone and check order, obtaining the Partial cDNA Sequence (SEQIDNO.3) of OsGPDH gene. Then with reference to bacterium gpsA albumen orderRow (SEQIDNO.5), de-according to the NAD_Gly3P of paddy rice codon preference artificial synthetic bacterium gpsA on DNA synthesizerHydrogen enzymatic structure territory (SEQIDNO.4). Taking composition sequence as template, use primer GGF (5 '-Cctggtttctgttgtagaggacttcattggagtccagc-3 ') and primer gpsAR (5 '-Cagtgactggagcgctcgtcc-3 '), amplification is containing the PCR product of synthetic DNA fragment. PCR reaction condition is the same. Subsequently by twoIndividual PCR product mixes, and carries out 94 DEG C of sex change 3min, then makes temperature be reduced to gradually 60 DEG C with 1 DEG C of reduction per second, adds Taq enzymeExtend 5min at 72 DEG C. Finally add primer GPDF and gpsAR, amplification comprises paddy rice NAD (P) binding function domain and large intestineThe synthetic gene of bacillus NAD_Gly3P dehydrogenase structure domain. PCR reaction condition is the same. Packing PCR product into pGEM-T carriesBody (Promega, USA), screening positive clone order-checking, the cDNA sequence (SEQIDNO.1) of acquisition OEGD gene.

Structure and the genetic transformation of embodiment 3:OEGD gene overexpression vector

3.1 structures containing destination gene expression carrier:

According to the full length sequence of OEGD gene (SEQIDNO.1), design amplifies the primer of complete coding reading frame,And on upstream primer and downstream primer, introduce respectively BPClonase enzyme recombination sequence site, to pass through GATEWAYTechnique construction expression vector. Taking in embodiment 1 obtain amplified production as template, through high-fidelity Taq enzyme pfu enzyme (Tiangen,China) carry out after pcr amplification, OEGD gene cDNA clone, to intermediate carrier (as pDONR207), is further transformed to large intestineBacillus DH5 α, is ensureing to identify intermediate carrier under the correct prerequisite of reading frame, and then extracting plasmid, uses pCB4004 plantExpression plasmid carries out the restructuring of LRClonase enzyme, so just gene two has been added respectively CAMV35S transcripting promoter andTerminator, has formed in a plant expression vector pCB4004::OEGD who comprises OEGD gene complete expression unit, transforms agricultureBacillus EHA105, finally carries out Rice Callus transformation experiment.

3.2 rice transformation

3.2.1 seed disinfection

After shelling, the ripe fine rice paddy seed in Hunan puts into aseptic triangular flask, with 75% alcohol-pickled 1-2min, sterilized waterRinse 2 times; With the 30%NaClO 30min that sterilizes, need frequent shake therebetween again, then with aseptic washing 3-4 time, inhale with aseptic filter paperDry unnecessary moisture, is inoculated into callus inducing medium (MS+2,4-D2.0mg/L) by seed upper, every ware approximately 30Grain, in 28 DEG C of dark cultivations.

3.2.2 subculture is cultivated

Through the induction in nearly January, paddy rice grows the callus that yellow is expanded, and removes its scultellum, callus is gone to freshOn callus inducing medium (MS+2,4-D2.0mg/L), carry out subculture. Every 2 weeks subcultures once, general subculture 2-4 timeCan obtain and be applicable to genetically modified bright yellow, granular embryo callus. Cultivate after 2 weeks at subculture, select embryo particleFor genetic transformation.

3.2.3 the cultivation of Agrobacterium

On conversion flat board, picking list bacterium colony is cultivated in 1ml Agrobacterium culture medium. (contain phase at 50ml Agrobacterium culture mediumAnswer antibiotic) in add the above-mentioned culture of 1ml, 200rpm, 28 DEG C cultivate 5-6hr to OD600 be 0.6-1.0, cultivate finish before2hr adds acetosyringone (AS, final concentration 100uM). Get above-mentioned bacterium liquid at room temperature, 4000rpm, 10min, abandons supernatant, addsEnter the resuspended thalline of MS fluid nutrient medium (containing AS100uM), with on cultivate 2hr under identical condition, make the OD600=of bacterium liquid0.5-1, now can be used to transformed calli. AS=acetosringone acetosyringone.

3.2.4 cultivate altogether

EMBRYO IN RICE callus is immersed to Agrobacterium bacterium liquid 20-30min, then use aseptic blotting paper suck dry moisture, will invadeIt is upper that the callus dying is placed in common culture medium (MS+2,4-D2.0mg/L+AS100uM), 28 DEG C of dark cultivations threeMy god.

3.2.5 wash bacterium

The callus of cultivating altogether is first used aseptic water washing 3 times, then is immersed in the MS liquid training containing Cef/CN400mg/LIn foster base, after 20-30min, callus is proceeded on aseptic filter paper and blotted.

3.2.6 select to cultivate

The callus of suck dry moisture is inoculated in and selects culture medium (MS+2,4-D2.0mg/L+Hyg30mg/L+Cef400mg/L) on. After 3 weeks, select the callus newly growing and be inoculated in selection culture medium (MS+2,4-D2.0mg/L+Hyg50mg/L+Cef250mg/L) upper, then select 2 weeks.

3.2.7 differentiation is cultivated

To select the resistant calli obtaining to be transferred to pre-differential medium (N6+KT2.0mg/L+ through 2 timesNAA0.2mg/L+6-BA2.0mg/L+Hyg30mg/L+Cef200mg/L+ agar 9g/L+ sucrose45g/L) upper dark cultivation about 10 days, then forward differential medium (N6+KT2.0mg/L+NAA0.2mg/L+6-toBA2.0mg/L+Hyg30mg/L+ agar 4.5g/L+ sucrose 30g/L) upper illumination cultivation.

3.2.8 culture of rootage

About 1-2 month, forward seedling high 2cm left and right to root media (1/2MS+Hyg15mg/L+ agar4.5g/L+ sucrose 20g/L) the above generation of inducing adventitious root.

3.2.9 the transplanting of transgenic seedling

When seedling grows to 10cm when high, seedling is taken out, clean the solid medium adhering to sterilized water, move into earthIn, just start, with cloche cover several days, after plant to be planted stalwartness, to take off again cloche, in greenhouse, cultivate.

3.3 the genetic transformation of tobacco

3.3.1 tobacco aseptic seedling is numerous soon

First by 75% alcohol immersion 0.5min for tobacco seed, then soak 10min with 2%NaClO, aseptic water washing 3-4 time,With aseptic blotting paper suck dry moisture, be inoculated on MS culture medium, illumination cultivation at 25 DEG C, can obtain tobacco in vitro cuttings.Cut the blade of tobacco in vitro cuttings, remove its main lobe arteries and veins and leaf margin, be cut into about 1cm²Square vanelets, is inoculated inIn bud differential medium MS1, after treating that bud grows, cut single bud and be inoculated in MS culture medium, about 20 days, can grow up to and plantStrain.

3.3.2 the cultivation of Agrobacterium

On conversion flat board, picking list bacterium colony is cultivated in 1ml Agrobacterium culture medium. (contain phase at 50ml Agrobacterium culture mediumAnswer antibiotic) in add the above-mentioned culture of 1ml, 200rpm, 28 DEG C of shaken cultivation are spent the night; 4000rpm under room temperature, 10min, abandonsSupernatant, thalline suspends with 1/2MS fluid nutrient medium, is diluted to the 5-20 of original volume doubly, with on cultivate under identical condition2hr, makes about the OD600=0.5 of bacterium liquid.

3.3.3 Agrobacterium is infected

The aseptic blade of getting the tobacco of growth about two weeks, removes its main lobe arteries and veins and leaf margin, is cut into about 1cm²SquareVanelets. Blade is put into the bacterium liquid preparing, soaked 2-5min190rpm, on aseptic filter paper, blot unnecessary bacteriumLiquid.

3.3.4 cultivate altogether

The leaf explant blotting is placed on to callus induction or differential medium MS1(MS+6-BA1.0mg/L+ NAA0.1mg/L), 25 DEG C of dark 48hr that cultivate.

3.3.5 select to cultivate

Be added with by proceeding to through the leaf explant of cultivating altogether de-bacterium differentiation or the callus inducing medium of selecting pressureMS29MS+6-BA1.0mg/L+NAA0.1mg/L+Hpt50mg/L+Cb250mg/L) upper, vacuum side of bladeDownwards, edge is pressed in culture medium, under 25 DEG C of illumination, cultivates. Cultivate the formation of 7-15 days visible callus, can after approximately 20 daysSee that Bud Differentiation grows.

3.3.6 culture of rootage

After bud is grown up, cut, be placed in and contain the root media MS3 (1/2MS+NAA0.5mg/L+ that selects pressureHpt25mg/L) on, carry out culture of rootage, within about 2-7 days, grow adventitious root.

3.3.7 the transplanting of transgene tobacco

After well developed root system, plant is taken out, clean the solid medium adhering to sterilized water, move in soil, just openBegin, with cloche cover several days, after plant to be planted stalwartness, to take off again cloche, in greenhouse, cultivate.

Embodiment 4:OEGD gene overexpression transfer-gen plant expression analysis

4.1 materials are prepared

The transgenic rice plant T2 that embodiment 3.2 is obtained for the fine germination of seed and check variety Hunan after, transplantIn fluid nutrient medium (international paddy rice institute water-culturing rice nutrient solution, formula is shown in http://irri.org/). After growth of seedling 15d,Clip blade drops into fast liquid nitrogen and preserves, for the extracting of RNA.

The 4.2 total RNA preparations without DNA

The leaves of plants RNA providing by Shanghai Hua Shun Bioisystech Co., Ltd in a small amount extraction agent box operation instructions takes outCarry. Use BeckmanCoulter DU 640 ultraviolet specrophotometers to measure RNA concentration. Remain in RNA for removingDNA, each total RNA sample is got 5 μ g, adds 1 μ LDNAase(American I nvitrogen company) and 1 μ L10 × reactionBuffer solution, supplies volume to 10 μ L, normal-temperature reaction 30min, and then every pipe adds 1 μ L2mmolL-1EDTA to stop insteadShould, finally make DNAase at 70 DEG C of heating 10minInactivation.

4.3 first chain cDNA's is synthetic

Above-mentioned RNA sample is respectively got to 2 μ L, and the reagent providing by Promega company of U.S. reverse transcription kit adds successively4 μ L25mmolL-1MgCl2,2 μ L10 × RT buffer solutions, the mixed liquid of 2 μ LdNTP and 1 μ Loligo (dT) 15, addWater is supplied volume to 18.5 μ L, at 70 DEG C of heat denatured 10min, fast in cooled on ice. Then add 0.5 μ LRNaseInhibitor and 1 μ LAMVRTase, at 42 DEG C of water-bath 60min, heat 10min cessation reaction at 70 DEG C.

4.4 quantitative PCR

According to sequences Design Auele Specific Primer RF:5 '-agcttgcccaccgcttcggag-3 ' of gene OEGD, RR:5 '-cagtgactggagcgctcgtcc-3 ' is for quantitative fluorescent PCR, according to Actin(GenBankaccessionNo.AY212324) cDNA sequences Design Auele Specific Primer the AF:5 '-cttcctcatgccatcctgc-3 ' of gene, ar:5 '-Gcaagcttctccttgatgtcc-3 ' is for the quantitative fluorescent PCR of reference gene. PCR uses American AB IPRISM7000 quantitative PCR instrument, each PCR arranges once and repeats. Reaction system comprises SYBRPremixExTaq (2 ×) 10 μL, the each 0.5 μ L of forward and reverse primer, the cDNA template 1 μ L of various processing, adds water and supplies volume to 25 μ L. Response procedures is: 95DEG C 30s, then at 95 DEG C of 10s, circulates 40 times under 61 DEG C of 34s, reads fluorescence while being set in each circulation 60 DEG C of 34sValue, carries out ROX value simultaneously and proofreaies and correct, and finally adds the analysis of fluorescence PCR products melt curve analysis, and other operations refer to instrument operation instructionBook. In order to detect the pollution that whether has DNA in RNA sample, choose at random 3 samples, respectively get 1 μ LRNA and enter as templatePerforming PCR, method is the same.

4.5 analytical method

Ct is defined as by craft in the fluorescence thresholding of PCR by 7000systemSDSVersion1.2.3 software0.2 rear generation, enter data into EXCEL and carry out computational analysis. Data analysis employing method is 2^-ΔΔCT, then utilizeEXCEL table is made differential expression block diagram (Δ Δ CT).

4.6 analysis result

As can be seen from Figure 3, OEGD gene all obtains high expressed in transgenic paddy rice strain H1G072-094, its expressionAmount compared with the control, all exceedes 100 times, and high expressed amount even exceedes 500(2⁹) doubly, show OEGD in these transfer-gen plantsGene high expressed normally in paddy rice, can further carry out next step and detect test.

Embodiment 5:OEGD gene overexpression transfer-gen plant is resistance to contrary test under laboratory condition

5.1 materials are prepared

The transgenic paddy rice T2 that embodiment 3.2 is obtained for the fine germination of seed and check variety Hunan after, transplant in liquidBody culture medium (international paddy rice institute water-culturing rice nutrient solution, formula is shown in http://irri.org/). Growth of seedling during to 4 leaf, is openedBeginning is carried out resistance to osmotic stress, resistance to low-phosphorous and hot test.

5.2 Stress treatment

For low-phosphorous processing, by the NaH in former nutrient solution prescription₂PO₄?2H₂O does not add in the time again preparing nutrient solution, soAfter changed one time of nutrition liquid every 3 days, observed growth of seedling height at the 10th day.

For osmotic stress processing, will in nutrient solution, add every liter of 200 grams of PEG6000, PEG6000 processes after 10 days and just changesNormal nutrient solution, observes growth of seedling and death condition.

For high-temperature process, during summer high temperature, transplant seedlings in airtight glasshouse, its diurnal temperature scope existsBetween 30-55 DEG C, nutrient solution water temperature is the highest exceedes 52 DEG C, cultivates and observes seedling growth after 12 days.

Improve the Physiology and biochemistry reason of plant stress tolerance ability in order to understand these transfer-gen plants, by 20%PEG6000The seedling of processing 3 days is got blade, measures SOD(superoxide dismutase in blade) content. Liquid nitrogen grinding blade, gets 0.05g sampleProduct powder, adds 1ml physiological saline (0.86%), homogenate, and 3500-4000 rev/min of centrifugal 10min, gets supernatant and measures. KitAdopt Nanjing to build up the total superoxide dismutase (T-SOD) of biological study institute and measure kit (article No.: A001-1 hydroxylamine assay).

5.3 analysis result

Use low-phosphorous nutrient solution pouring rice seedling after 10 days, in 4 transgenic lines, have 3 transgenic linesH1G072,073 and 074 its plant height highly significant or extremely remarkable height and adjoining tree, show that these 3 transgenic lines tolerances are low-phosphorousAbility, apparently higher than contrast, is shown in Fig. 4. Illustrate that in paddy rice, after overexpression OEGD gene, obviously having improved paddy rice tolerates low phosphorus nutritionAbility, can promote plant normal growth on the barren soil of phosphorus nutrition.

Use PEG6000 to process seedling, find between transfer-gen plant and adjoining tree, to present notable difference after 3 days, locateWhen 7 days reason time to the, adjoining tree starts death. Within the 10th day, after rehydration, add up survival rate and the upgrowth situation of plant, numberingThe H1G072-74 transfer-gen plant not only plant height utmost point is significantly higher than contrast, and its death rate is lower than 5%, exceedes and contrast the death rate30%(is shown in Fig. 5). After this gene of overexpression is described, obviously improve the Osmotic Stress Tolerance ability of paddy rice, and after rehydration, recovered rawLong ability.

In between high-temperature cultivation, the growth of adjoining tree starts to be suppressed, along with the prolongation of time, and adjoining tree growthSlowly even stop, still can growing preferably but contrast transfer-gen plant, its plant height is significantly obviously better than contrast and (sees figure6), illustrate that transfer-gen plant has good repair function under hot conditions, can ensure that plant is having certain day and night temperatureUnder condition, maintain the normal growth of plant.

After PEG6000 processes, check SOD content in rice plant blade, find that in transfer-gen plant, content is all significantly higher thanAdjoining tree (see figure 7), illustrates that transfer-gen plant actively changes the biochemical reactions in plant body after coercing, and supportsAnti-bad external environment.

Embodiment 5:OEGD gene overexpression transgenic paddy rice is at field Drought resistant experiment

Chosen the gene overexpression transgenosis T2 that obtains in embodiment 3.2 for family plant (numbering H1G070,71,72,81,83,85 and 87) carried out the drought stress test of fringe phase, this experiment is carried out in Hainan and Shanghai respectively. First will turnGene plant T2 for the fine presprouting of seeds of seed and check variety Hunan after at field sowing. After 3 week by seedling replanting. Hainan ProvinceIt is as follows that winter drying is coerced test: every part of material is planted 3 row, and every row 7 strains, in the time that in colony, most of material enters ear differentiationPhase (paddy rice to moisture tricky time), starts emptying field moisture, and after about 2 week, field starts to occur that part plantsStrain leaf roll, shows to start drought stress symptom. Solid and ripe when most of plant, results seed is weighed, statistics individual plantAverage product. Result shows, under drought stress, the fine single plant yield in check variety Hunan is only 7.27 grams/strain, the present invention clone'sThe transfer-gen plant single plant yield major part of OEGD gene overexpression exceedes 9 grams/strain, the highest reaches 10.3 grams/strain, illustratesAfter Drought Stress Stress treatment, its output performance will be better than contrasting (see figure 8) significantly.

In order to improve the precision of test, in the booth of Shanghai, carry out drought stress test. Seedling replanting is arrived to booth waterIn mud sump, each transgenic line is planted 5 strains, in field random distribution, plants 2 strain contrasts simultaneously plant in transfer-gen plant left and rightStrain. When most of material in colony enters ear differentiation period, emptied of water is divided and is carried out arid and process. After about 3 week, fieldBetween start to occur part plant leaf roll, show to start drought stress symptom. Along with increasing the weight of of the degree of coercing, part Plant LeafSheet starts withered and yellow dying, but there is part transfer-gen plant, still blade maintenance is green. Solid and ripe when most of plant, gather in the cropsSeed is weighed, statistics individual plant average product. The average of transfer-gen plant and adjacent adjoining tree output is compared, send outUnder drought stress, transfer-gen plant single plant yield is obviously better than the fine single plant yield (see figure 9) in check variety Hunan now, wherein contrastThe Hunan average per unit area yield of fine plant is 6.2-10.8 gram/strain, and the transfer-gen plant of the present invention clone's OEGD gene overexpressionH1G072,73,74,87 average per unit area yields, between 17.6-22.6 gram/strain, are significantly better than contrast, but plant height statistics does not have difference.The expression that OEGD gene after Drought Stress Stress treatment is described can alleviate paddy rice and entering reproductive growth after drought stress makeThe plant strain growth becoming is obstructed, and can effectively protect paddy rice to avoid the damage of abiotic stress, has improved setting percentage and the seed of plantGrouting, strengthens the resistance of transgenic paddy rice to abiotic stress and reduces the loss of output.

Embodiment 6:OEGD gene overexpression transgene tobacco is at field Drought resistant experiment

By the transgene tobacco extracting DNA obtaining, PCR is detected to positive tobacco plant and further breed acquisition T2 for kindSon. Positive transgene tobacco T2 is directly seeded in nutritive cube for seed and contrast non-transgenic tobacco seed. Work as tobacco seedlingWhile growing into 5 leaves, stop moisture and irrigate. After 7 days, contrast the tobacco plant blade wrinkle that starts to wither, and transgenic tobacco plant bladeStill extremely unfold. After fortnight, contrast tobacco stops growing, and has a half vane withered, and adjoining tree bladeJust start the wrinkle of withering. After one month, adjoining tree is completely withered, and transgene tobacco still has 2 leaves to keep green. After rehydration three days,Contrast tobacco cannot survive, and transgene tobacco starts to bring back to life, and blade is unfolded and come, and grows young leaves. Can from above resultTo find out, overexpression OEGD gene in tobacco, can significantly improve the tolerance of tobacco to drought stress, improves surviving of tobaccoRate. Illustrating that this modifying gene can be applied to improves the resistance of plant to environment stress in various plants.

Scope of the present invention is not subject to the restriction of described specific embodiments, and described embodiment is only each as illustrating the present inventionThe single example of individual aspect, also comprises method and the component of functional equivalent in the scope of the invention. In fact, except as herein describedOutside content, those skilled in the art can easily grasp multiple improvement of the present invention with reference to description and accompanying drawing above. InstituteWithin stating the scope that improvement also falls into appended claims. Every section of bibliography mentioned above is listed conduct herein all in full inReference.

<110>Shanghai City Agricultural biological Gene Center

<120>the artificial fusion of the stress tolerance of raising plant

<160>7

<170>PatentInversion3.3

<210>1

<211>1062

<212>DNA

<213>manually synthetic

<220>

<221>CDS

<222>(1)..(1062)

<400>1

atggagaacggacacgccaagaatcttgtggccgtcatcggcagcggcaactggggcagc60

gtcgcctcccgcctcatcgcttctaacaccgctaagttgccctcctttcatgatgaagta120

aggatgtgggtgtttgaagaaatattaccaacaggcaagaagctctctgagtccattaac180

caagcaaatgagaattgcaaatacttacctggtataaagctcggagctaatgtaattgct240

gatcctgatttggagaatgcagtgaaagatgcaaatatgcttgtttttgtgactccccat300

caatttgtggagggtatatgtaagaagcttgtgggtaaactaaggccaggaactgagggt360

atctccctcatcaagggcatggaggtcaagatggaaggaccatgcatgatatctaaatta420

attacaaacatacttggaatcaattgctgtgtccttatgggtgctaacattgcaaatgag480

attgctgttgagaaattcagtgaagcgacaattggatataagaaagacaaggaagtggca540

acccgatgggctaaactttttacaacaccttacttcctggtttctgttgtagaggacttc600

attggagtccagctcggaggagccgtcaagaacgtcattgccattggagccggaatgagt660

gacggaattggattcggagccaacgcccgcacagccctcattacacgcggactcgccgag720

atgtcccgcctcggagccgccctcggagccgacccggccacattcatgggaatggccgga780

ctcggagacctcgtcctcacatgcacagagaaccagagtcgcaaccgccgcttcggaatg840

atgctcggacagggaatggacgtccagtccgcccaggagaagattggacaggtcgtcgag900

ggatatcgcaacacaaaggaggtccgcgagcttgcccaccgcttcggagtcgagatgccg960

attacagaggagatttatcaggtcctctattgcggaaagaacgcccgcgaggccgccctc1020

acactcctcggacgcgcccgcaaggacgagcgctccagtcac1062

<210>2

<211>354

<212>PRT

<213>manually synthetic

<400>2

MetGluAsnGlyHisAlaLysAsnLeuValAlaValIleGlySerGly

151015

AsnTrpGlySerValAlaSerArgLeuIleAlaSerAsnThrAlaLys

202530

LeuProSerPheHisAspGluValArgMetTrpValPheGluGluIle

354045

LeuProThrGlyLysLysLeuSerGluSerIleAsnGlnAlaAsnGlu

505560

AsnCysLysTyrLeuProGlyIleLysLeuGlyAlaAsnValIleAla

65707580

AspProAspLeuGluAsnAlaValLysAspAlaAsnMetLeuValPhe

859095

ValThrProHisGlnPheValGluGlyIleCysLysLysLeuValGly

100105110

LysLeuArgProGlyThrGluGlyIleSerLeuIleLysGlyMetGlu

115120125

ValLysMetGluGlyProCysMetIleSerLysLeuIleThrAsnIle

130135140

LeuGlyIleAsnCysCysValLeuMetGlyAlaAsnIleAlaAsnGlu

145150155160

IleAlaValGluLysPheSerGluAlaThrIleGlyTyrLysLysAsp

165170175

LysGluValAlaThrArgTrpAlaLysLeuPheThrThrProTyrPhe

180185190

LeuValSerValValGluAspPheIleGlyValGlnLeuGlyGlyAla

195200205

ValLysAsnValIleAlaIleGlyAlaGlyMetSerAspGlyIleGly

210215220

PheGlyAlaAsnAlaArgThrAlaLeuIleThrArgGlyLeuAlaGlu

225230235240

MetSerArgLeuGlyAlaAlaLeuGlyAlaAspProAlaThrPheMet

245250255

GlyMetAlaGlyLeuGlyAspLeuValLeuThrCysThrGluAsnGln

260265270

SerArgAsnArgArgPheGlyMetMetLeuGlyGlnGlyMetAspVal

275280285

GlnSerAlaGlnGluLysIleGlyGlnValValGluGlyTyrArgAsn

290295300

ThrLysGluValArgGluLeuAlaHisArgPheGlyValGluMetPro

305310315320

IleThrGluGluIleTyrGlnValLeuTyrCysGlyLysAsnAlaArg

325330335

GluAlaAlaLeuThrLeuLeuGlyArgAlaArgLysAspGluArgSer

340345350

SerHis

354

<210>3

<211>614

<212>DNA

<213>Oryzasativa

<220>

<221>misc_feature

<222>(1)..(614)

<400>3

atggagaacggacacgccaagaatcttgtggccgtcatcggcagcggcaactggggcagc60

gtcgcctcccgcctcatcgcttctaacaccgctaagttgccctcctttcatgatgaagta120

aggatgtgggtgtttgaagaaatattaccaacaggcaagaagctctctgagtccattaac180

caagcaaatgagaattgcaaatacttacctggtataaagctcggagctaatgtaattgct240

gatcctgatttggagaatgcagtgaaagatgcaaatatgcttgtttttgtgactccccat300

caatttgtggagggtatatgtaagaagcttgtgggtaaactaaggccaggaactgagggt360

atctccctcatcaagggcatggaggtcaagatggaaggaccatgcatgatatctaaatta420

attacaaacatacttggaatcaattgctgtgtccttatgggtgctaacattgcaaatgag480

attgctgttgagaaattcagtgaagcgacaattggatataagaaagacaaggaagtggca540

acccgatgggctaaactttttacaacaccttacttcctggtttctgttgtagaggatatt600

gaaggagttgaatt614

<210>4

<211>447

<212>DNA

<213>manually synthetic

<220>

<221>misc_feature

<222>(1)..(447)

<400>4

ggagccgtcaagaacgtcattgccattggagccggaatgagtgacggaattggattcgga60

gccaacgcccgcacagccctcattacacgcggactcgccgagatgtcccgcctcggagcc120

gccctcggagccgacccggccacattcatgggaatggccggactcggagacctcgtcctc180

acatgcacagagaaccagagtcgcaaccgccgcttcggaatgatgctcggacagggaatg240

gacgtccagtccgcccaggagaagattggacaggtcgtcgagggatatcgcaacacaaag300

gaggtccgcgagcttgcccaccgcttcggagtcgagatgccgattacagaggagatttat360

caggtcctctattgcggaaagaacgcccgcgaggccgccctcacactcctcggacgcgcc420

cgcaaggacgagcgctccagtcactga447

<210>5

<211>339

<212>PRT

<213>E.coli

<220>

<221>PEPTIDE

<222>(1)..(339)

<400>5

MetAsnGlnArgAsnAlaSerMetThrValIleGlyAlaGlySerTyr

151015

GlyThrAlaLeuAlaIleThrLeuAlaArgAsnGlyHisGluValVal

202530

LeuTrpGlyHisAspProGluHisIleAlaThrLeuGluArgAspArg

354045

CysAsnAlaAlaPheLeuProAspValProPheProAspThrLeuHis

505560

LeuGluSerAspLeuAlaThrAlaLeuAlaAlaSerArgAsnIleLeu

65707580

ValValValProSerHisValPheGlyGluValLeuArgGlnIleLys

859095

ProLeuMetArgProAspAlaArgLeuValTrpAlaThrLysGlyLeu

100105110

GluAlaGluThrGlyArgLeuLeuGlnAspValAlaArgGluAlaLeu

115120125

GlyAspGlnIleProLeuAlaValIleSerGlyProThrPheAlaLys

130135140

GluLeuAlaAlaGlyLeuProThrAlaIleSerLeuAlaSerThrAsp

145150155160

GlnThrPheAlaAspAspLeuGlnGlnLeuLeuHisCysGlyLysSer

165170175

PheArgValTyrSerAsnProAspPheIleGlyValGlnLeuGlyGly

180185190

AlaValLysAsnValIleAlaIleGlyAlaGlyMetSerAspGlyIle

195200205

GlyPheGlyAlaAsnAlaArgThrAlaLeuIleThrArgGlyLeuAla

210215220

GluMetSerArgLeuGlyAlaAlaLeuGlyAlaAspProAlaThrPhe

225230235240

MetGlyMetAlaGlyLeuGlyAspLeuValLeuThrCysThrGluAsn

245250255

GlnSerArgAsnArgArgPheGlyMetMetLeuGlyGlnGlyMetAsp

260265270

ValGlnSerAlaGlnGluLysIleGlyGlnValValGluGlyTyrArg

275280285

AsnThrLysGluValArgGluLeuAlaHisArgPheGlyValGluMet

290295300

ProIleThrGluGluIleTyrGlnValLeuTyrCysGlyLysAsnAla

305310315320

ArgGluAlaAlaLeuThrLeuLeuGlyArgAlaArgLysAspGluArg

325330335

SerSerHis

339

<210>6

<211>1056

<212>DNA

<213>Oryzasativa

<220>

<221>CDS

<222>(1)..(1053)

<400>6

atggagaacggacacgccaagaatcttgtggccgtcatcggcagcggcaactggggcagc60

gtcgcctcccgcctcatcgcttctaacaccgctaagttgccctcctttcatgatgaagta120

aggatgtgggtgtttgaagaaatattaccaacaggcaagaagctctctgagtccattaac180

caagcaaatgagaattgcaaatacttacctggtataaagctcggagctaatgtaattgct240

gatcctgatttggagaatgcagtgaaagatgcaaatatgcttgtttttgtgactccccat300

caatttgtggagggtatatgtaagaagcttgtgggtaaactaaggccaggaactgagggt360

atctccctcatcaagggcatggaggtcaagatggaaggaccatgcatgatatctaaatta420

attacaaacatacttggaatcaattgctgtgtccttatgggtgctaacattgcaaatgag480

attgctgttgagaaattcagtgaagcgacaattggatataagaaagacaaggaagtggca540

acccgatgggctaaactttttacaacaccttacttcctggtttctgttgtagaggatatt600

gaaggagttgaattatgtggaacactgaaaaatgtcgtggccattgcagcaggtcttgtt660

gatggtttggatatggggaacaataccaaggctgcaataatgaggattggtttgcgggaa720

atgcgtgctttctctaagcttctatcccctacagtcagggacaacactttctttgagagc780

tgtggtgtggctgacctaataactacatgccttggtgggagaaacagaagagtcgctgag840

gcctttgcacgaaatggtggcaaaaggtcttttgatgagttggaggccgagatgctacat900

ggccaaaaacttcagggagtgtccacagcaaaagaagtttatgaagtcttgacttatcga960

gggtggcaagaattgtttcctcttctgtccacagtgcatgagatttgtattggtcagcta1020

cctcctacatcaatagttgaatacagaatccactga1056

<210>7

<211>351

<212>PRT

<213>Oryzasativa

<400>7

MetGluAsnGlyHisAlaLysAsnLeuValAlaValIleGlySerGly

151015

AsnTrpGlySerValAlaSerArgLeuIleAlaSerAsnThrAlaLys

202530

LeuProSerPheHisAspGluValArgMetTrpValPheGluGluIle

354045

LeuProThrGlyLysLysLeuSerGluSerIleAsnGlnAlaAsnGlu

505560

AsnCysLysTyrLeuProGlyIleLysLeuGlyAlaAsnValIleAla

65707580

AspProAspLeuGluAsnAlaValLysAspAlaAsnMetLeuValPhe

859095

ValThrProHisGlnPheValGluGlyIleCysLysLysLeuValGly

100105110

LysLeuArgProGlyThrGluGlyIleSerLeuIleLysGlyMetGlu

115120125

ValLysMetGluGlyProCysMetIleSerLysLeuIleThrAsnIle

130135140

LeuGlyIleAsnCysCysValLeuMetGlyAlaAsnIleAlaAsnGlu

145150155160

IleAlaValGluLysPheSerGluAlaThrIleGlyTyrLysLysAsp

165170175

LysGluValAlaThrArgTrpAlaLysLeuPheThrThrProTyrPhe

180185190

LeuValSerValValGluAspIleGluGlyValGluLeuCysGlyThr

195200205

LeuLysAsnValValAlaIleAlaAlaGlyLeuValAspGlyLeuAsp

210215220

MetGlyAsnAsnThrLysAlaAlaIleMetArgIleGlyLeuArgGlu

225230235240

MetArgAlaPheSerLysLeuLeuSerProThrValArgAspAsnThr

245250255

PhePheGluSerCysGlyValAlaAspLeuIleThrThrCysLeuGly

260265270

GlyArgAsnArgArgValAlaGluAlaPheAlaArgAsnGlyGlyLys

275280285

ArgSerPheAspGluLeuGluAlaGluMetLeuHisGlyGlnLysLeu

290295300

GlnGlyValSerThrAlaLysGluValTyrGluValLeuThrTyrArg

305310315320

GlyTrpGlnGluLeuPheProLeuLeuSerThrValHisGluIleCys

325330335

IleGlyGlnLeuProProThrSerIleValGluTyrArgIleHis

340345350

Claims (6)

1. an artificial fusion that improves the stress tolerance of plant, is characterized in that: the polynucleotide sequence of described geneBe selected from:

Sequence as shown in SEQIDNO.1.

2. the albumen of artificial fusion coding claimed in claim 1, is characterized in that: the ammonia of this artificial fusion codingBase acid sequence is selected from sequence as shown in SEQIDNO.2.

3. contain the recombinant vector of artificial fusion claimed in claim 1.

4. a method of producing the genetically modified plants of stress tolerance, is characterized in that:

The method comprises the following steps:

1) artificial fusion claimed in claim 1 is operably connected to expression of plants regulating and controlling sequence, forms plant tableReach carrier;

2) plant expression vector of step 1) gained is proceeded to plant cell;

3) transformant obtaining through screening, is regenerated as plant and offspring thereof, and described plant comprises plant cell, plant tissueOr vegetable seeds.

5. method claimed in claim 4, is characterized in that: described plant is selected from paddy rice, corn, wheat, barley, broomcorn millet, heightIn fine strain of millet, soybean, cucumber, clover, potato, castor-oil plant, peanut, cotton, tobacco, oranges and tangerines any one.

6. artificial fusion claimed in claim 1 has the purposes aspect the genetically modified plants of stress tolerance in preparation.