CN101319221A - Glycerol-3- phosphoric desaturase gene relating with glycerol synthesis and uses thereof - Google Patents

Abstract

The invention relate to a cDNA sequence of glycerol-3-phosphate dehydrogenase genes DvGPH1 and DvGPDH2 associated with glycerol synthesis, and an amino acid sequence of an encoding protein. The expression vector of the DvGPH1 or DvGPDH2 gene is translated into a yeast gpd1delta cell. The yeast cell shows a salt resistant phenotype on a culture medium containing salts, thereby verifying that the two genes can strengthen glycerol synthesis in the yeast cell and improve the salt resistance of the yeast cell, and simultaneously verifying that the two genes have good application value on improving the glycerol synthesis amount in organisms such as the yeast through genetic engineering means and strengthening the salt resistance of the organisms. As the invention further improves the glycerol-3-phosphate dehydrogenase activity and the capability of catalyzing and synthesizing the glycerol of the two gene products and the salt resistance of a corresponding yeast transformant through the deletion of part of sequences of the DvGPH1 or DvGPDH2 genes, the two deletion type gene derivatives have better prospect in the application fields. In addition, the invention verifies that the expression of the DvGPH1 and DvGPDH2 genes in a dunaliella is subjected to the induction of salt stress, thereby showing that the two genes are the key enzymes for dunaliella synthetic glycerol and further providing the theoretical base for the application of the two genes to the fields.

Description

With synthetic relevant glycerol-3-phosphate dehydrogenase gene and the application thereof of glycerine

Technical field

The present invention relates to synthetic relevant glycerol-3-phosphate dehydrogenase gene and the application thereof of a kind of and glycerine.

Background technology

World population constantly increases, and anticipates the year two thousand fifty end, and world population can reach 6,000,000,000.On the other hand, the salinification that the soil ploughed in the world 20% is serious has had a strong impact on the output of grain.The supply of food crop just is being subjected to the saliferous threat in soil.Understanding biological anti-salt mechanism is crucial for utilizing breeding and engineered method improvement salt tolerance of crop.

Glycerine is important light industry raw material, and supply falls short of demand in glycerine market.Along with petroleum-based energy with can plough the soil and constantly reduce, chemical method is produced glycerine and is met with bottleneck, and output also constantly reduces.The economic benefit that chemical synthesis is produced glycerine (glycerol) constantly descends.Therefore the competitive power of fermentative Production glycerine is constantly outstanding.Fermentation method has that security is good, and abundant raw material is easy to get, the simple advantage of equipment requirements.Therefore utilize the improvement fermentation strain to improve glycerine output and have important economic value.

Salt algae (Dunaliella) is distributed widely in the environment of high salinity such as salt lake, ocean, solonchak, especially is main population in the haline water territory.The salt algae is the eukaryote of salt tolerant, has very surprising osmotic adjustment ability, can 50mM is high to survive to the environment near saturated salt concn being low to moderate, can change by disposable tolerance 3-4 osmotic pressure doubly.

The salt algae can be kept osmotic pressure balance inside and outside the cell with the salt stress in the opposing environment by the concentration of regulating glycerine in the cell.Generally, glycerine is unique permeate agent in the salt frond.The intravital glycerol concentration of salt algae is along with the variation that is proportionate of extracellular salt concn.When the salt frustule is subjected to moment of high-salt stress concussion, cell starts glycerine route of synthesis synthetic glycerine rapidly keeping the balance of the osmotic pressure inside and outside the cell, and just can finish adjusting in 90min.The a large amount of glycerine of accumulation in the salt frond, and when high salt concn (＞3.5M NaCl), the concentration of glycerine can be up to 50% in the cell.

Salt algae glycerine pathways metabolism Study of Mechanism is to understand one of the key of the salt resistance ability of salt algae uniqueness.The synthetic main place of salt algae glycerine is a chloroplast(id).Known salts frustule glycerine route of synthesis is the approach that phosphodihydroxyacetone (DHAP) catalysis generates glycerine.Two enzymes participate in the conversion of catalysis DHAP to glycerine, and promptly DHAP at first is catalytically conveted to glycerol-3-phosphate (G3P) by glycerol-3-phosphate dehydrogenase (GPDH), and G3P becomes glycerine by the catalyzed conversion of phospho-glycerol Phosphoric acid esterase (GPP) again.

Studies confirm that in yeast, GPDH is the key enzyme in the glycerine building-up process.Discover in the salt algae that glycerol-3-phosphate dehydrogenase in the salt algae (GPDH) is the key enzyme that control DHAP is converted into glycerine equally, and the GPDH activity is the target spot of salt algae regulation and control glycerine route of synthesis.Therefore the GPDH gene is the deep key of understanding anti-salt mechanism of salt algae and high accumulation glycerine ability in the clonal analysis salt algae, also can provide the important function of gene resource for biological resistant gene of salt engineering with by fermentative Production glycerine simultaneously.

Summary of the invention

One of purpose of the present invention is to provide a kind of and synthesizes relevant glycerol-3-phosphate dehydrogenase gene with glycerine.

Two of purpose of the present invention is to provide the proteins encoded of this gene.

Three of purpose of the present invention is to provide the recombinant vectors that comprises this gene.

Four of purpose of the present invention is to provide the transformant that comprises this gene.

Five of purpose of the present invention is to provide the application of this gene in improving the glycerine synthesis capability.

Six of purpose of the present invention is to provide the application of this gene in improving salt resistance ability.

For achieving the above object, the present invention adopts following technical scheme:

The synthetic relevant glycerol-3-phosphate dehydrogenase gene of a kind of and glycerine is characterized in that this gene has one of following nucleotide sequences:

(1). have the dna sequence dna shown in the SEQ NO 1-2;

(2). the nucleotide sequence that limits with sequence 1-2 in the sequence table has the homology 95% or more, and the identical function protein DNA sequence of encoding.

The proteins encoded of the above-mentioned glycerol-3-phosphate dehydrogenase gene synthetic relevant with glycerine, it is characterized in that this proteins encoded has the amino acid residue sequence of sequence 3-4 in the sequence table or with the amino acid residue sequence of sequence 3-4 through replacement, disappearance or the interpolation of one or several amino-acid residue and have identical active by sequence 3-4 deutero-protein with the amino acid residue sequence of sequence 3-4.

A kind of recombinant vectors that contains above-mentioned glycerol-3-phosphate dehydrogenase gene.

A kind of transformant that contains above-mentioned glycerol-3-phosphate dehydrogenase gene.

A kind of above-mentioned application of glycerol-3-phosphate dehydrogenase gene in improving the glycerine synthesis capability.

A kind of above-mentioned application of glycerol-3-phosphate dehydrogenase gene in improving salt resistance ability.

The present invention is separated to two glycerine synthetic key gene DvGPDH1 and DvGPDH2 first from salt algae (Dunaliella viridis), and proved the function of these two genes and improved organism salt resistance ability and the glycerine using value aspect synthetic that these two genes have good application prospects first in genetically engineered improvement and industrial production glycerine by transformed yeast cell.

Description of drawings

Fig. 1 has SERB-GPDH geminus territory for the proteins encoded of glycerol-3-phosphate dehydrogenase gene DvGPH1 of the present invention and DvGPDH2, and contains conservative chloroplast(id) transfer peptide.

Fig. 2 is glycerol-3-phosphate dehydrogenase gene DvGPH1 of the present invention and the analysis of DvGPDH2 dna homolog.Wherein A is a GPDH homologous gene analysis chart, and B is a SERB homologous gene analysis chart.

Fig. 3 is glycerol-3-phosphate dehydrogenase gene DvGPH1 of the present invention and the functional analysis of DvGPDH2 gene in yeast mutants gpd1 Δ.Wherein Yeast expression carrier pAJ401 has been used in the functional analysis of A, and Yeast expression carrier pYES2 has been used in the functional analysis of B.

Fig. 4 is glycerol-3-phosphate dehydrogenase gene DvGPH1 of the present invention and the expression pattern of DvGPDH2 gene under different salt stresses.The A glycerine synthetic pattern that is the salt algae in salt vibration lower body wherein, B is the expression pattern of DvGPH1 and DvGPDH2 in the salt frond of stable growth under different salt concn environment, C is that DvGPH1 and DvGPDH2 are at the intravital expression pattern of salt algae after the salt oscillation treatment.

Embodiment:

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these examples only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted concrete experiment condition in the following example, usually according to normal condition, molecular cloning (Molecular Cloning:A Laboratory Manual, 3rded.) or yeast heredity method experiment guide (Methods in Yeast Genetics:A Cold Spring HarborLaboratory Course Manual, Adams A et al compiles, Cold Spring Harbor Laboratory, 1998 publish) described in condition, or the condition of advising according to manufacturer.

Embodiment one: the clone and the analysis of DvGPDH1 and DvGPDH2 full length coding region

Extract the total RNA of salt algae, reverse transcription cDNA first chain is a template with cDNA first chain, by PCR, utilizes primer GPDH15 ' p and GPDH13 ' p to be cloned into DvGPDH1, is cloned into DvGPDH2 by primer GPDH25 ' p and GPDH23 ' p.For the further function and the application (embodiment three) of these two genes of proof in yeast, add clone enzyme point EcoRI and eukaryotic translation conserved sequence Kozak at the gene 5 ' end by primer GPDH15 ' p and GPDH25 ' p; Add clone's enzyme point Xho I by primer GPDH13 ' p and GPDH23 ' p at gene 3 ' end.

Primer sequence is as follows:

(1) GPDH15 ' p (introducing EcoR I restriction enzyme site and Kozak sequence):

5 '-AGAATTC AGCATGGTCCTAGGGTCATCACC-3 ' runic is an EcoR I recognition site, and underscore is depicted as the Kozak sequence;

(2) GPDH13 ' p (introducing Xho I restriction enzyme site):

5 '-ATCTCGAGCCAGTGCATGCTCTTTAAATGAC-3 ' runic is an Xho I recognition site;

(3) GPDH25 ' p (introducing EcoR I restriction enzyme site and Kozak sequence):

5 '-AGAATTC ACAATGGTTCTCAAGGGAGGGAG-3 ' runic is an EcoR I recognition site, and underscore is depicted as the Kozak sequence;

(4) GPDH23 ' p (introducing Xho I restriction enzyme site):

5 '-ATCTCGAGTGTTCAAATTGCTTAAATGCAC-3 ' runic is an Xho I recognition site;

The gene that obtains is analyzed: the cDNA total length 2525bp of DvGPH1, wherein ORF is 2088bp, and the 73nt place is ATG, and the 2158nt place is terminator TAG.The analytical results of Vector NTI9.1.0 software shows: the longest reading frame has been encoded one and has been contained 695 amino acid whose albumen, and the molecular weight of albumen size is 76.2kDa, and iso-electric point is 6.42.The cDNA total length 2759bp of DvGPH2, wherein ORF is 2106bp, and the 74nt place is ATG, and the 2177nt place is terminator TAA, and the longest reading frame has been encoded one and has been contained 701 amino acid whose albumen, and the molecular weight of albumen size is 77.2kDa, and iso-electric point is 6.73.Have at 59nt place, DvGPDH2 upstream one with the terminator TGA of predicted protein preface reading frame with frame.Show that by homology compare of analysis (Fig. 2) this experiment has obtained the DvGPDH1 complete encoding sequence.

Embodiment two DvGPDH1 and DvGPDH2 protein structure and homology analysis

Utilize NCBI (http://www.ncbi.nlm.nih.gov/structure/cdd/cdd.shtml) conserved domain analytical system that DvGPDH1 and the coded albumen of DvGPDH2 are analyzed, the result shows that the albumen of two genes encodings has unique SERB-GPDH geminus territory (Fig. 1).DvGPDH1 and DvGPDH2 have about 400 amino acid whose GPDH structural domains at the C end, and compare homologous GPDH protein structure in the animals and plants, and they also have an extra length at the N end is 300 amino acid whose SERB structural domains.

Utilize Vector NTI9.1.0 program that DvGPH1 and DvGPDH2 are carried out the homology compare of analysis.Analytical results shows, they have higher homology with homologous gene in the algae, as: with chlamydomonas CrGPDH1 homology be respectively 45.7% and 45.3%.Then lower with the homology in animal or the higher plant, as: yeast ScGpd1p homology is respectively 19.8% and 20.8%, and homology segment is positioned at the C end of DvGPH1 and DvGPDH2.DvGPH1 and DvGPDH2 have conservative class GXGXXG motif (motif), and this motif is the binding site (Fig. 2 A is with shown in the square frame) of the coenzyme NAD H of GPDH.DvGPH1 and DvGPDH2 encoded protein and serine phosphorylation esterase (SERB/PSP) have certain homology in addition, be respectively 24.4% and 26.6% as people source phosphoserine esterase HsPSP homology, and homology segment is positioned at the N end (Fig. 2 B) of DvGPH1 and DvGPDH2.DvGPH1 and DvGPDH2 have conservative class DXDX (T/V) motif (motif), and this motif is the avtive spot that the phosphoryl intermediate forms in the SERB catalyzed reaction (Fig. 2 B is with shown in the square frame).

The protein signal peptide prediction ( Http:// www.cbs.dtu.dk/services/) disclosed DvGPDH1 and locate that conservative chloroplast(id) transfer peptide sequence feature is arranged being positioned at the about 1-30 of amino acid position being positioned at place, the about 1-47 of amino acid position and DvGPDH2.Further albumen location prediction (Http:// wolfpsort.org/ )The result shows that DvGPDH1 and DvGPDH2 albumen are positioned in the chloroplast(id) of cell.These two predict the outcome and have shown that DvGPDH1 and DvGPDH2 are the GPDH of two chloroplast(id) types of salt algae.

Embodiment three DvGPDH1 and the functional analysis of DvGPDH2 in yeast mutants

(1) structure of Yeast expression carrier

DvGPDH1 that embodiment one is cloned into and DvGPDH2 utilize clone's enzyme of introducing to select EcoR I and XhoI is building up to respectively among Yeast expression carrier pAJ401 (composing type strongly expressed carrier) or the pYES2 (semi-lactosi inducible expression vector).We have also made up the carrier cloning that only contains GPDH structural domain section (respectively called after DvGPDH1 Δ N and DvGPDH2 Δ N) respectively in addition, analyze the function behind this genetically deficient SERB section.DvGPDH1 Δ N is increased by primer GPDH1-GPD5 ' p and GPDH13 ' p; DvGPDH2 Δ N is increased by primer GPDH2-GPD5 ' p and GPDH23 ' p.Utilize primer GPDH1-GPD5 ' p and GPDH2-GPD5 ' p to add clone enzyme point EcoR I and eukaryotic translation conserved sequence Kozak at the target gene 5 ' end; Primer GPDH13 ' p and GPDH23 ' p add clone's enzyme point Xho I at goal gene 3 ' end.With pcr amplification obtain product utilization enzyme site EcoR I and Xho I respectively directed cloning to Yeast expression carrier pAJ401 or pYES2.

Primer sequence is as follows:

(1) GPDH1-GPD5 ' p (introducing EcoR I restriction enzyme site and Kozak sequence):

5 '-AGAATTC ACAATGGTGAAGCGTTACAAGGT-3 ' runic is an EcoR I recognition site, and underscore is depicted as the Kozak sequence;

(2) GPDH2-GPD5 ' p (introducing EcoR I restriction enzyme site and Kozak sequence):

5 '-AGAATTC ACAATGGGCTACAAGGTGACCA-3 ' runic is an EcoR I recognition site, and underscore is depicted as the Kozak sequence.

The primer of GPDH13 ' p and GPDH23 ' p is seen embodiment one.

(2) transformed yeast

Use LiAc heat shock conversion method: the clone that will contain DvGPDH1, DvGPDH2, DvGPDH1 Δ N, DvGPDH2 Δ N is transformed in the yeast salt sensitive mutant gpd1 Δ.

(3) phenotypic evaluation of yeast transformant

Used minimum medium is AP, and adds amino acid needed.Selection markers is the uridylic auxotrophy.The transformant phenotypic evaluation substratum that changes carrier over to and be pAJ401 adds 2% glucose as carbon source.The transformant phenotypic evaluation substratum that changes carrier over to and be pYES2 adds 2% raffinose as carbon source.

Used phenotype is showed substratum: with the AP substratum that does not contain NaCl is the contrast growth conditions, and the AP substratum that contains 700mM NaCl is anti-salt phenotype analytical growth conditions.If use expression vector pYES2 then to add of the expression of 2% semi-lactosi in addition as the inductor induction exogenous gene.

At first yeast transformant is cultured to OD in the AP substratum ₆₀₀=0.6, be a titre with 5 μ L, and be the serial dilution titre with five times of extent of dilution, show in phenotype and show the anti-salt phenotype of yeast transformant on the substratum.The result is as shown in Figure 3: under 1) the composing type strongly expressed promotor (PGK promotor) in pAJ401 drives, DvGPDH1, DvGPDH2, DvGPDH1 Δ N, DvGPDH2 Δ N can both improve the salt resistance ability of yeast gpd1 Δ cell, this glycerine that shows that total length or absence type DvGPDH1 and DvGPDH2 gene can increase in the yeast cell synthesizes, and then improve the salt resistance ability (Fig. 3 A) of yeast cell, so DvGPDH1 and DvGPDH2 have good using value aspect these biological salt resistance abilities improving biological intravital glycerine resultant quantity such as yeast by genetically engineered and strengthen.2) under inducible promoter (GAL1 promotor) drives in pYES2, DvGPDH1 Δ N and DvGPDH2 Δ N can improve the salt resistance ability of yeast cell to a greater degree than their corresponding full-length genes, show that DvGPDH1 Δ N and DvGPDH2 Δ N have the enzyme (Fig. 3 B) alive of stronger glycerol-3-phosphate dehydrogenase than full-length gene, the glycerine that can increase greatly in the yeast cell is synthetic, thereby improve the salt resistance ability of yeast cell, so the DvGPDH1 Δ N of absence type and DvGPDH2 Δ N has the better application prospect in above-mentioned Application Areas biglyyer.

The embodiment four-way is crossed the expression pattern under different salt stresses of Realtime-PCR methods analyst salt algae DvGPDH1 and DvGPDH2

(1) design of primers

Be used for the Realtime-PCR detection with Primer Premier software at the suitable Auele Specific Primer of 3 ' UTR zone design of DvGPDH1 and DvGPDH2.The expression the primer that detects DvGPDH1 is DvGPDH1RTF and DvGPDH1RTR; The expression the primer that detects DvGPDH2 is DvGPDH2RTF and DvGPDH2RTR; Housekeeping gene DvACTIN is confidential reference items, and the primer is DvACTINRTF and DvACTINRTR.

Primer sequence is as follows:

(1)DvGPDH1RTF：5’-GTGGCGTTGCTGATGTGA-3’

(2)DvGPDH1RTR：5’-CTCGCGGAACCTGAGAAT-3’

(3)DvGPDH2RTF：5’-CAGCATAAGGCAAGGAGATAG-3’

(4)DvGPDH2RTR：5’-TCTTCACAAACCACCACCC-3’

(5)DvACTINRTF：5’-GCCACTGCTTTAGCTGTTTGC-3’

(6)DvACTINRTR：5’-CCTCATGCTCCCAGATGTTCTA-3’

(2) preparation of template

We have extracted the salt frustule total RNA of long term growth under different N aCl concentration culture condition and the total RNA of salt frustule that stands the high salt concussion of 0.5M NaCl → 1.5M NaCl back different time points, are cDNA with extractive total RNA reverse transcription.With these cDNA is that template is carried out the Real-time pcr analysis.

(3) Real-time PCR method detects DvGPDH1 and DvGPDH2 expression pattern

The Real-time pcr analysis uses SYBR Green dye method, DNA Engine Option2System (MJResearch) analytical system, typical curve quantitative analysis.

Under the high salt concussion environment, the salt algae by in the born of the same parents fast accumulation glycerine come osmotic potential difference (Fig. 4 A) inside and outside the statocyte.By the Real-time PCR method analyze DvGPDH1 and DvGPDH2 under different salt stresses in transcriptional level control glycerine synthetic pattern.At first analyzed gene transcription level (Fig. 4 B) under different salt concn (0.5M, 1M, 2M, 3M, 4M, 5M NaCl) stable growth condition, find under 0.5M to the 2M NaCl growing environment, along with the raising of salt concn and the increase of the required amounts of glycerol of cell, the mRNA expression level amount of gene rises thereupon; When NaCl concentration was higher than 3M in the environment, the mRNA expression level of gene had been subjected to the feedback inhibition regulation and control of product glycerine, decline to a certain degree occurred.We find simultaneously that under the NaCl with high concentration environment DvGPDH2 regulates and control the more insensitive of performance than DvGPDH1 for the glycerine feedback inhibition.We have analyzed the changing pattern (Fig. 4 C) of different time sections genetic expression under 0.5M → 1.5M salt concussion condition again then: (DvGPDH1 is at 1hr in a short time for DvGPDH1 and DvGPDH2 expression of gene, DvGPDH2 is at 1.5hr) be subjected to high salt and induce, then be subjected to the feedback inhibition of product glycerine mid-term, the later stage (behind the 72hr) begins to recover to raise.We find equally, and DvGPDH2 regulates and control the more insensitive of performance than DvGPDH1 for the glycerine feedback inhibition.The expression of gene analysis shows: DvGPDH1 and DvGPDH2 have regulated and control the synthetic of glycerine; DvGPDH2 has the glycerine feedback inhibition is regulated and control insensitive feature, and this specific character is favourable for a large amount of glycerine of cell accumulation.

The present invention is gene constructed in yeast universal expression vector pAJ401 and pYES2 with these two by directed cloning, transformed yeast mutant gpd1 Δ, this mutant can not synthesize the glycerine of capacity as osmoregulation thing in the born of the same parents, causes it not grow in hypersaline environment.The yeast transformant that obtains is analyzed its salt resistance ability containing on the 700mM NaCl substratum, the result shows the salt resistance ability of yeast cell be improved significantly (Fig. 3).This experimental verification the function of DvGPH1 and DvGPDH2, and prove that these two genes can improve the ability of biosynthesizing glycerine such as yeast and the ability of salt tolerant, also prove that these two genes have using value aspect synthetic output of glycerine that improves biology by genetically engineered and the salt resistance ability simultaneously.The present invention also by analyzing two proteinic conserved domains of coded by said gene, finds that they have SERB-GPDH geminus territory (Fig. 1); And further two genes are transformed by the functional domain disappearance, after promptly removing SERB structural domain section, the derivative of two genes that obtain can be bigger the intravital glycerine resultant quantity of raising yeast and the tolerance of salt stress to external world, this shows that the protein product of these two gene derivatives has stronger enzyme and lives, and therefore also has the better application prospect.

The present invention has also measured the pattern of salt algae glycerine accumulation under the salt oscillating condition, and utilize the real-time round pcr to analyze DvGPH1 and the transcriptional profile of DvGPDH2 under different salt stresses in the salt algae, disclose the gene expression regulation pattern (Fig. 4) of these two genes in the fast a large amount of synthetic glycerines opposing of salt algae high-salt stress processes, for improving biological intravital glycerine salt resistance ability synthetic and that improve organism theoretical foundation is provided by improving these two gene transcription.

Sequence table

＜110〉Shanghai University

＜120〉with synthetic relevant glycerol-3-phosphate dehydrogenase gene and the application thereof of glycerine

<160>16

<210>1

<211>2525

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>1

1 GGCACGAGAT?TAAGTCGACA?CAAAGATTTC?CCTTGCCCCT?TAAAAGCACA?CACCCCTCCC

61 GCAAGACCAA?GCATGATCCT?AGGGTCATCA?CCCACACTCC?CTCACGCATC?GCACCCTGCC

121 AGGCCTGGCC?CAGCACGGCC?TGATAGGGCA?GCTGCTCTTG?CTGGCAGCAC?CAGGCAGCTG

181 CTGCGAGGGA?CCTTTCGCCC?AAACCCCGCT?CCTTGCTCCG?CCAAGGGCAC?AGCAAAGGAC

241 CCTTTCCAGC?TGAGCAACCC?CCGCTTCAGC?AGCAGCAGCA?ACAGCAGCAC?CAGCAGCAGC

301 AGCAGTGTCA?CCCGCGTCCT?TCAGCCCCTG?CGAGCTGCGT?CCCTGGAGCA?GGGAGTCACG

361 GCTCCCCTTC?CACCTCGCCC?GCAAGGACCC?ACTGACACGG?TGCTTGAGCT?GTGGCAGGCA

421 GCAGATGCCG?TGGTGTTTGA?TGTGGACAGC?ACGATCACCC?GTGATGATAC?GCTCGATTCA

481 CTGGGCAAGT?TCATGGGTCT?CAAGGATGAG?GTGCTGAGGC?ATGAGGCAAT?GGATGGGACA

541 ATGAACCTGC?CTGATACAAT?GGCCGAGCGT?CTTGCCATCA?TGAACTGCTC?CCCAGAAGAC

601 ATCCAGCAGT?TTCTGCTTGA?ACACCCTCCC?AAAGAGCGGC?TGGTGCCTGG?TGTGGAGGAG

661 CTGGTGAGTG?CCCTGCGCAC?CAGGGGCAAA?GAGGTGTTTT?TGACGGGTGG?TTTCAGGGAA

721 GTGGTGCTGC?CCATTGCTGA?GCACCTGGGC?ATTCCTGCAA?AAAACGTTTT?TGCGAACAGC

781 ATGTCTTGGG?AGCTGGATGA?CAAGGGTCAG?CCTGTGCGCC?TGAAGGAGTT?TGACATGACT

841 CACCCTGCAA?CCCACAGCCA?GGGCAAACCT?CAGGCACTTG?CTCGCATCCG?ACGCCAGTAT

901 CCATATAACA?ACGTTGTCAT?GATCGGTGAT?GGCATCAGTG?ACCTGGAGGC?TGTAAACACT

961 ACAGGAGGTG?CAGACCTGTT?CATCCACTAC?GGTGGAGTCG?CAGAGCACCC?TCAGGTGGCA

1021?AGTCGGTCTG?ACTGGTTTGT?GCGCTCGTTC?GATGAGCTCA?TGCGGTGCCT?GAAGCGTTAC

1081?AAGGTGGTCA?TGATCGGGTC?TGGAGCTTGG?GCGTGTGCTG?CTGTGCGCAT?GGTGGCACAG

1141?AGCACCGCTG?AGGCTTCGCG?GTCTCCAGCC?TCCTCCTTTG?TGAAAGACGT?CACGATGTGG

1201?GTCCACGAGG?AGAAGCACAG?TGGAAGGAAC?CTTACAGAGT?ACATAAACGA?GCACCATGAC

1261?AATCCCATCT?ACCTGCCTGG?AGTGAGCCTC?GGAGAGAACG?TGGTCGCAAA?CAACAACCTC

1321?ATTGACGCGG?CCCGTGATGC?CGATCTGCTC?ATCTTCTGCG?CCCCCCACCA?GTTCATGCAC

1381?GGCATCTGCA?AGCAGCTGGC?AGCAGCTCGC?GTGGTCAAAC?GGGACGCCAA?GGCCATCAGC

1441?TTGACCAAGG?GCATGCGTGT?GCGTGCGGAG?GGGCCACAGC?TGATCAGTCA?GATGATCTCA

1501?CGCATCCTTG?GCATTGACTG?CTCCGTGCTC?ATGGGCGCCA?ACATTGCTGC?AGACATCGGT

1561?CGTGAAGAGC?TTTCGGAGGC?TGTGGTGGCG?TACTCCAGCC?GCGATGCCGG?CATCCTCTGG

1621?CAGCAGCTGT?TCCAGCGCCC?CTACTTTGCC?ATTAACCTGC?TGCCGGACGT?GCCTGGAGCT

1681?GAAATCAGTG?GTACCCTGAA?GAACATAGTG?GCAGTCGGTG?CGGGGATCGG?CGACGGCTTG

1741?GGTATAGGGT?CGAACAGCAA?AGCCACCATC?CTCCGCCAGG?GACTGAGTGA?GATGAGGAAG

1801?TTCTGCAAGA?ACCTTTACCC?AAGCGTGCGA?GATGACACCT?TTTTTGAGTC?ATGTGGCGTT

1861?GCTGATGTGA?TCGCGTCTAG?CTATGGCGGC?CGCAACAGGC?GTGTGTCAGA?GGCGTGGTGC

1921?AAGAGGCGCA?TGAGTGGAGA?CACACAGATC?ACCTTCGATG?ACCTGGAGAG?GGAGATGTTG

1981?AACGGCCAGA?AGCTTCAAGG?AGTACTGACC?AGCGACGAGG?TCCAGGAAAT?CTTGATTGAG

2041?CGTGGCTGGG?AGCTGGACTT?CCCCCTGTTC?ACCACCATCC?ACCGCATCAT?CCATGGAGAA

2101?GTCTCTCCAG?ACATGATTCT?CAGGTTCCGC?GAGGCAGTTT?CAATGAAGTC?ATTAAAGTAG

2161?ATCGACATCT?GCGAGTGAGA?TGGGCCAAGG?ACGTGGCAAA?TCTCGTGCCT?TCTGAATGAA

2221?TGCCCAGAGG?AGAGCTGTAT?GCACAGGTTC?TGTATGATTA?GTGGCTTTCG?TCCAGCAGCT

2281?GCAGCACTGG?GTTTCATCAT?TGCATGTGGG?GCCTGGTGGT?GAGGCTCAGA?TGAACTACCA

2341?GTATGAGTTG?TTTGATATAT?TTGATTCCTG?TCAGATTGTG?CATTTCGATT?CATTTGATTG

2401?TTCATTCTTG?CTTCATTTTG?TGTGCTGTAC?ATGCGACTTG?TTCCACTGTG?TCGTTGTGCT

2461?GTATGAATAA?GCGTCTGATA?AAAGTCATTT?AAAGAGCATG?CACTGGAAAA?AAAAAAAAAA

2521?AAAAA

<210>2

<211>2759

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>2

1 GGCACGAGGT?ATTAGTTGGC?TGGCTCTTGA?ACAACCTACC?ACTCTGGCCC?TGCTCGCCTG

61 AACCACGGAC?GCAATGCTTC?TCAAGGGAGG?GAGCGTGAAC?CCCCTGCCCT?GCGCGCCCCA

121 GCGCCCCAGG?GCTGCAGCAG?CTCAGCCGAG?GGCTGCATGC?AGGGCAGTGG?GCAGGCCCCA

181 GGCGCCGCTG?CTGGGCGCGC?GCAAGCAGCT?CCTGTCCTCG?CCCTGCTTCG?CGAAGGAGCA

241 GAGCCCCCTG?CTCCGCAGCG?GCCAGCAGCA?CGCCCGTGGC?GATGCGCTCG?TGGCACACGC

301 AGCGGAGGTT?GGCCAGCGCC?CCACTATTCC?CGCGGGCGAT?TCGTGGGCCA?ACCACCCTCC

361 TCCCCCCACC?ACGCCCTCTG?AGCAAGTCCT?GGACCTGTGG?CAGCAGGCGG?ATGCCGTCTG

421 CTTCGATGTG?GACCGCACTG?TGACCACGGA?CGCTTCCGTG?GGCCTGCTGG?CCAAGTTCAT

481 GGGCATCGAG?CATGAGGCGC?AGACCCTGAT?GGAGCAGGCA?AACCGGGGTG?AGATTAACCT

541 GACCAAGGCC?TTCGAGGAGC?GCCTGGCCAA?CCTGAACTTC?TCCCCTGCTG?ACATTGACCG

601 CTTCCTGGAG?CAGCACCCCC?CTGCAACCCG?TCTTGTGCCT?GGTGTGCAAG?AGCTGATCGC

661 AGCACTGAAG?GCACGCGGCG?TGGAGGTGTT?CCTGATCTCC?GGTGGCTTCA?GGGAGATGGC

721 ACTGCCCATT?GCTTCCCACC?TGCAAATTCC?AGCCAAGAAC?GTCTTCTGCA?ACACCATGTC

781 CTGGCAGCTA?GACGACAATG?GCGAGCCCAT?CCGCCTGCAG?GGCCTGGACA?TGACTCGTGC

841 AGCAGAGAGC?CACTTCAAGT?CGCGTGCCAT?TGAGCGCATC?AGGAGGAAGT?ACCCCTACAA

901 CAACATCATC?ATGGTCGGCG?ATGGCTTCAG?TGACCTGGAG?GCCATGCAGG?GCTCCCCTGA

961 TGGAGCTGAT?GCCTTCATCT?GCTTCGGCGG?TGTGATGGAG?CGCCCTGCGG?TGGCAAGCCA

1021?GGCAGACTGG?TTCATTCGCT?CATACGACGA?GCTCATGAAG?AGCCTGAAGC?GCTACAAGGT

1081?GACCATGGTG?GGCTCTGGCG?CATGGGCATG?CACTGCAGTC?CGCATGGTGG?GACAGAGCAC

1141?TGCCGAGGCA?TCTCAGCAGC?CTGGCTCCAT?GTTCGACAAG?AATGTGACCA?TGTGGGTGCA

1201?CGAGGACAAG?AACAGCGAAC?GCAACCTGAT?TCAGTACATC?AACGAGAACC?ACGAGAACTA

1261?CATCTACCTG?CCCGGCATTG?ACCTGGGTGA?GAACGTCATT?GCTGACAACG?ATCTGATCAG

1321?GGCGTGCAAG?GACGCTGACC?TGCTCATCTT?CTGCGCCCCC?CACCAGTTCA?TGCACGGCAT

1381?CTGCAAGCAG?CTTGCTGCAG?CCCGTGTGAT?CAAGAGGGAT?GCCAAGGCCA?TTAGCTTGAC

1441?CAAGGGCATG?CGCGTGCGTG?CTGAGGGACC?TCAGATGATC?AGTCAGATGA?TCACCCGTGT

1501?GCTGGGCATT?GATTGCTCTG?TGCTGATGGG?TGCCAACATT?GCTGGTGACA?TTGCAAGGGA

1561?GGAGCTGTCT?GAGGCCGTCA?TCGCGTATGC?AAACCGCGAG?TCTGGCCTGC?TCTGGCAGCA

1621?GCTGTTCCAG?CGCCCCTACT?TTGCCATCAA?CCTGCTGGCA?GATGTGCCTG?GCGCTGAGAT

1681?GTGCGGCACT?CTGAAGAACA?TCGTGGCTGT?GGGCGCTGGC?ATGGGCGATG?GCCTGGGATG

1741?CGGATCCAAC?AGTAAAGCTT?CCATCCTGCG?CCAGGGCCTG?AGCGAGATGA?GGAAGTTCTG

1801?CAAGTTCATC?TCGCCGACCG?TGCGTGACGA?CACCTTCTTC?GAGTCCTGCG?GCGTGGCTGA

1861?CCTGATTGCC?AGCAGCTACG?GCGGCCGCAA?CAGGAAGGTG?GCCGAGGAGT?GGGCCAGGAG

1921?AAGGAACGAG?GGCGATGAGG?TCGTGACCTT?CGAGACCCTT?GAGAGGGACA?TGCTGTCCGG

1981?CCAGAAGCTG?CAGGGCGTGC?TGACCTCCGA?TGAGGTGCAG?GAGATCCTGC?ACGCGCGCGG

2041?CTGGGAGCTG?GAGTTCCCTC?TGTTCACCAC?CATCAACCGC?ATCATCCACG?GCGAGGTGCC

2101?CGTCAACATG?CTGCTACGGT?ACCGTGAGGC?CTGCAAGATG?CCCGGTTCCA?AGAAGAAGAG

2161?GCAGGCAAGC?CCAGCATAAG?GCAAGGAGAT?AGAGCTGTAA?CTCAACTGGA?GGATGTGCTA

2221?CGCCCCGCAT?GCCCACAGGT?ATAGGACCGC?ATGCTCCATG?CCTAGCCTGC?CACCCACCCG

2281?AAGAGTAGTG?AATGACTACT?ACTGATCAGG?TTTAGTTCCA?TGGCAATGGC?ATGTGTAGTT

2341?GGTTCCTAAT?GTTCACGTTG?TGAGACGTGT?GTGTGTTTTC?TTGGTTCTTG?GATTGGCTGT

2401?GTCGATTCCG?GGGCGCTCGG?GTGGTGGTTT?GTGAAGAGAG?GGGAAAAAGG?GGTACGAGAG

2461?CAGGGAGACC?TGTATGTTTT?TTGTACCTCG?CTGCGGTCGG?CATCTGAAAC?TGTTCATATA

2521?TGGTTGATGC?CAGACCTCGA?TTGCGCACTG?AGCTGTATTT?CTAGCAGAAC?TGCTGTTCAA

2581?TCATACCTAT?GATTCATTCT?GTGTCGTCCA?TCATCCCAGA?ACGCAACCTG?TAGTTTCAAA

2641?GAAATGCTAC?TGTAGTTTCT?GGCCTGAGAG?GCGCCACATA?ATTCGCTTTG?TGCATTTAAG

2701?CAATTTGAAC?AGCCAAAAAA?AAAAAAAAAA?AAAAAAAAAA?AAAAAAAAAA?AAAAAAAAA

<210>3

<211>695

<212>PRT

＜213〉Halophila (Dunaliella viridis)

<400>3

1 MILGSSPTLP?HASHPARPGP?ARPDRAAALA?GSTRQLLRGT?FRPNPAPCSA?KGTAKDPFQL

61 SNPRFSSSSN?SSTSSSSSVT?RVLQPLRAAS?LEQGVTAPLP?PRPQGPTDTV?LELWQAADAV

121?VFDVDSTITR?DDTLDSLGKF?MGLKDEVLRH?EAMDGTMNLP?DTMAERLAIM?NCSPEDIQQF

181?LLEHPPKERL?VPGVEELVSA?LRTRGKEVFL?TGGFREVVLP?IAEHLGIPAK?NVFANSMSWE

241?LDDKGQPVRL?KEFDMTHPAT?HSQGKPQALA?RIRRQYPYNN?VVMIGDGISD?LEAVNTTGGA

301?DLFIHYGGVA?EHPQVASRSD?WFVRSFDELM?RCLKRYKVVM?IGSGAWACAA?VRMVAQSTAE

361?ASRSPASSFV?KDVTMWVHEE?KHSGRNLTEY?INEHHDNPIY?LPGVSLGENV?VANNNLIDAA

421?RDADLLIFCA?PHQFMHGICK?QLAAARVVKR?DAKAISLTKG?MRVRAEGPQL?ISQMISRILG

481?IDCSVLMGAN?IAADIGREEL?SEAVVAYSSR?DAGILWQQLF?QRPYFAINLL?PDVPGAEISG

541?TLKNIVAVGA?GIGDGLGIGS?NSKATILRQG?LSEMRKFCKN?LYPSVRDDTF?FESCGVADVI

601?ASSYGGRNRR?VSEAWCKRRM?SGDTQITFDD?LEREMLNGQK?LQGVLTSDEV?QEILIERGWE

661?LDFPLFTTIH?RIIHGEVSPD?MILRFREAVS?MKSLK*

<210>4

<211>701

<212>PRT

＜213〉Halophila (Dunaliella viridis)

<400>4

1 MLLKGGSVNP?LPCAPQRPRA?AAAQPRAACR?AVGRPQAPLL?GARKQLLSSP?CFAKEQSPLL

61 RSGQQHARGD?ALVAHAAEVG?QRPTIPAGDS?WANHPPPPTT?PSEQVLDLWQ?QADAVCFDVD

121?RTVTTDASVG?LLAKFMGIEH?EAQTLMEQAN?RGEINLTKAF?EERLANLNFS?PADIDRFLEQ

181?HPPATRLVPG?VQELIAALKA?RGVEVFLISG?GFREMALPIA?SHLQIPAKNV?FCNTMSWQLD

241?DNGEPIRLQG?LDMTRAAESH?FKSRAIERIR?RKYPYNNIIM?VGDGFSDLEA?MQGSPDGADA

301?FICFGGVMER?PAVASQADWF?IRSYDELMKS?LKRYKVTMVG?SGAWACTAVR?MVGQSTAEAS

361?QQPGSMFDKN?VTMWVHEDKN?SERNLIQYIN?ENHENYIYLP?GIDLGENVIA?DNDLIRACKD

421?ADLLIFCAPH?QFMHGICKQL?AAARVIKRDA?KAISLTKGMR?VRAEGPQMIS?QMITRVLGID

481?CSVLMGANIA?GDIAREELSE?AVIAYANRES?GLLWQQLFQR?PYFAINLLAD?VPGAEMCGTL

541?KNIVAVGAGM?GDGLGCGSNS?KASILRQGLS?EMRKFCKFIS?PTVRDDTFFE?SCGVADLIAS

601?SYGGRNRKVA?EEWARRRNEG?DEVVTFETLE?RDMLSGQKLQ?GVLTSDEVQE?ILHARGWELE

661?FPLFTTINRI?IHGEVPVNML?LRYREACKMP?GSKKKRQASP?A*

<210>5

<211>30

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>5

AGAATTC AGCATGGTCCTAGGGTCATCACC

<210>6

<211>31

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>6

ATCTCGAGCCAGTGCATGCTCTTTAAATGAC

<210>7

<211>30

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>7

AGAATTC ACAATGGTGAAGCGTTACAAGGT

<210>8

<211>30

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>8

AGAATTC ACAATGGTTCTCAAGGGAGGGAG

<210>9

<211>30

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>9

ATCTCGAGTGTTCAAATTGCTTAAATGCAC

<210>10

<211>29

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>10

AGAATTC ACAATGGGCTACAAGGTGACCA

<210>11

<211>18

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>11

GTGGCGTTGCTGATGTGA

<210>12

<211>18

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>12

CTCGCGGAACCTGAGAAT

<210>13

<211>21

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>13

CAGCATAAGGCAAGGAGATAG

<210>14

<211>19

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>14

TCTTCACAAACCACCACCC

<210>15

<211>21

<212>DNA

＜213〉Halophila (Dunalliella viridis)

<400>15

GCCACTGCTTTAGCTGTTTGC

<210>16

<211>22

<212>DNA

＜213〉Halophila (Dunaliella viridis)

<400>16

CCTCATGCTCCCAGATGTTCTA

Claims (6)

1. One kind with the synthetic relevant glycerol-3-phosphate dehydrogenase gene of glycerine, it is characterized in that this gene has one of following nucleotide sequences:

   (1). have the dna sequence dna shown in the SEQ NO 1-2;

   (2). the nucleotide sequence that limits with sequence 1-2 in the sequence table has the homology 95% or more, and the identical function protein DNA sequence of encoding.
2. 2. the proteins encoded of the synthetic relevant glycerol-3-phosphate dehydrogenase gene of according to claim 1 and glycerine, it is characterized in that this proteins encoded has the amino acid residue sequence of sequence 3-4 in the sequence table or with the amino acid residue sequence of sequence 3-4 through replacement, disappearance or the interpolation of one or several amino-acid residue and have identical active by sequence 3-4 deutero-protein with the amino acid residue sequence of sequence 3-4.
3. 3. recombinant vectors that contains glycerol-3-phosphate dehydrogenase gene according to claim 1.
4. 4. transformant that contains glycerol-3-phosphate dehydrogenase gene according to claim 1.
5. 5. the application of glycerol-3-phosphate dehydrogenase gene according to claim 1 in improving the glycerine synthesis capability.
6. 6. the application of glycerol-3-phosphate dehydrogenase gene according to claim 1 in improving salt resistance ability.

Images