WO2010111344A2 - Methods and microorganisms for production of c4-dicarboxylic acids - Google Patents

Methods and microorganisms for production of c4-dicarboxylic acids Download PDF

Info

Publication number
WO2010111344A2
WO2010111344A2 PCT/US2010/028429 US2010028429W WO2010111344A2 WO 2010111344 A2 WO2010111344 A2 WO 2010111344A2 US 2010028429 W US2010028429 W US 2010028429W WO 2010111344 A2 WO2010111344 A2 WO 2010111344A2
Authority
WO
WIPO (PCT)
Prior art keywords
activity
genetic modification
increases
polypeptide
decreases
Prior art date
Application number
PCT/US2010/028429
Other languages
French (fr)
Other versions
WO2010111344A3 (en
Inventor
Adam Lawrence
Jacobus Thomas Pronk
Antonius Jeroen Adriaan Van Maris
Rintze Meindert Zelle
Kevin T. Madden
Jacob C. Harrison
Joshua Trueheart
Carlos Gancedo Rodriguez
Carmen-Lisset Flores Mauriz
Stanley Bower
Original Assignee
Microbia, Inc.
Tate & Lyle Ingredients America, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Microbia, Inc., Tate & Lyle Ingredients America, Inc. filed Critical Microbia, Inc.
Publication of WO2010111344A2 publication Critical patent/WO2010111344A2/en
Publication of WO2010111344A3 publication Critical patent/WO2010111344A3/en
Priority to IL215376A priority Critical patent/IL215376A0/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/38—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from Aspergillus
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C12P7/44—Polycarboxylic acids
    • C12P7/46—Dicarboxylic acids having four or less carbon atoms, e.g. fumaric acid, maleic acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01037—Malate dehydrogenase (1.1.1.37)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/0104—Pyruvate kinase (2.7.1.40)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01001—Pyruvate decarboxylase (4.1.1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01031—Phosphoenolpyruvate carboxylase (4.1.1.31)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y401/00—Carbon-carbon lyases (4.1)
    • C12Y401/01—Carboxy-lyases (4.1.1)
    • C12Y401/01032—Phosphoenolpyruvate carboxykinase (GTP) (4.1.1.32)

Definitions

  • Oxaloacetate is an important precursor to many commercially valuable compounds produced by microorganisms, including 3-hydroxypropionic acid (3 -HPA) and C4- dicarboxylic acids such as malic acid, fumaric acid, and succinic acid.
  • C4-dicarboxylic acids are organic compounds that include two carboxylic acid groups. Such compounds find utility in a variety of commercial settings including, for example, in areas relating to food additives, polymer plasticizers, solvents, lubricants, engineered plastics, epoxy curing agents, adhesive and powder coatings, corrosion inhibitors, cosmetics, pharmaceuticals, electrolytes, etc.
  • Carboxylic acid groups including those in C4-dicarboxylic acids, are readily convertible into their ester forms.
  • Such carboxylic acid esters are commonly employed in a variety of settings.
  • lower chain esters are often used as flavouring base materials, plasticizers, solvent carriers and/or coupling agents.
  • Higher chain compounds are commonly used as components in metalworking fluids, surfactants, lubricants, detergents, oiling agents, emulsifiers, wetting agents textile treatments and emollients.
  • Carboxylic acid esters are also used as intermediates for the manufacture of a variety of target compounds.
  • a wide range of physical properties e.g., viscosities, specific gravities, vapor pressures, boiling points, etc.
  • reduction of C4-dicarboxylic acids provides diols which are intermediates for further synthesis including polymerizations. It is therefore desirable to develop production systems for C4-dicarboxylic acid compounds and/or their esters and/or anhydrides.
  • C4-dicarboxylic acids can be produced either by chemical synthesis or by fermentation.
  • commercial scale production is typically performed by chemical synthesis or by extraction from biological sources (e.g. grape skins).
  • biological sources e.g. grape skins
  • chemical synthesis processes can generate large amounts of harmful wastes.
  • biological systems for achieving such production.
  • biological system allowing production at low pH is desirable. Tight metabolic regulation of carbon can make it difficult to generate microorganisms that produce a high level of oxaloacetate suitable for commercial scale production of C4-dicarboxylic acids.
  • microorganisms for the biological production of C4- dicarboxylic acids are described herein (see Figure IA for a biological pathway for the production of OAA and C4-dicarboxylic acids as described herein).
  • the modified microorganisms have increased production of OAA as compared to unmodified microorganisms.
  • the recombinant microorganisms have been modified to reduce production of pyruvate and/or reduce conversion of pyruvate to acetaldehyde.
  • the microorganisms are modified to reduce the activity of pyruvate kinase and/or pyruvate decarboxylase.
  • the recombinant organisms can also be modified to increase the level of phosphenolpyruvate carboxykinase expression and/or activity. Because phosphenolpyruvate carboxykinase utilizes CO 2 , a potentially abundant substrate, to generate oxaloacetate from phospoenolpyruvate, and because this reaction generates ATP, oxaloacetate production can be quite efficient, particularly when the microorganism is grown anaerobically at relatively low pH. In addition, or alternatively, organisms can be modified to increase the level of phosphoenolpyruvate carboxylase activity. In some cases, the unmodified microorganism does not naturally express a phosphoenolpyruvate carboxylase activity.
  • the microorganism expresses a heterologous phosphoenolpyruvate carboxylase activity.
  • Both phosphoenolpyruvate carboxylase and phosphenolpyruvate carboxykinase use a phosphoenolpyruvate-intermediate to produce OAA.
  • these phosphoenolpyruvate-intermediate OAA production routes bypass pyruvate and thereby avoid competition with other high activity enzymes for which pyruvate is a substrate.
  • the activity of one or more of: phospoenolpyruvate carboxykinase, phosphoenolpyruvate carboxylase, pyruvate carboxylase, pyruvate decarboxylase, malate dehydrogenase, MTHl and certain other polypeptides is increased or decreased.
  • the increase or decrease in activity may arise from altered polypeptide expression or altered polypeptide activity.
  • the microorganism can have a modification to increase anaplerotic activity.
  • the microorganism may comprise at least one genetic modification selected from the group consisting of a genetic modification that: (a) increases or decreases pyruvate carboxylase activity; (b) increases or decreases phosphoenolpyruvate carboxylase activity; (c) increases or decreases phosphoenolpyruvate carboxykinase activity; (d) decreases pyruvate kinase activity; (e) increases malate dehydrogenase activity; (f) decreases pyruvate decarboxylase (e.g. is "PDC-reduced") activity; and (g) increases MTHl activity.
  • the microorganism may also have a genetic modification that increases or decreases organic acid transporter polypeptide activity.
  • the microorganism may also have at least one modification selected from the group consisting of a modification that: (a) increases biotin protein ligase activity; (b) increases vitamin H transport protein activity; (c) increases or decreases bicarbonate transport activity; (d) increases or decreases hexose transporter activity; (e) increases glucose sensing and regulatory polypeptide activity; (f) increases carbonic anhydrase activity; (g) increases or decreases ATP-citrate lyase activity; (h) increases or decreases fumarase activity; (i) increases or decreases fumarate reductase activity; (j) increases or decreases isocitrate lyase activity; (k) increases or decreases malate synthase activity; (1) increases or decreases malic enzyme activity; (m) increases or decreases succinate dehydrogenase activity; and (n) decreases citrate synthase activity.
  • a modification that: (a) increases biotin protein ligase activity; (b) increases
  • a recombinant microbial cell comprising at least one (e.g., at least 2, 3, 4, 5, 6 or 7) genetic modification selected from:
  • the genetic modification that increases activity can do so by increasing expression of the enzyme or by increasing the inherent activity of the enzyme or both.
  • the genetic modification that decreases activity can do so by decreasing expression of the enzyme or by decreasing inherent activity of the enzyme or both.
  • the cell comprises a genetic modification that increases pyruvate carboxylase activity and a genetic modification that decreases PDC activity; the cell comprises a genetic modification that decreases PYK activity and a genetic modification that increases phosphoenolpyruvate carboxylase activity; the cell comprises a genetic modification that decreases pyruvate kinase activity and a genetic modification that increases phosphoenolpyruvate carboxykinase activity; the cell further comprises a genetic modification that increases phosphoenolpyruvate carboxylase activity; the cell further comprises a genetic modification that decreases pyruvate carboxylase activity; the cell further comprises a genetic modification that increases pyruvate carboxylase activity; the cell further comprises a genetic modification that decreases PDC activity; the recombinant microbial cell comprises a genetic modification that increases MTHl activity; the recombinant microbial cell comprises a genetic modification that increases malate dehydrogenase activity; the recombinant m
  • the pyruvate carboxylase is at least 80% identical to any of SEQ ID NOs: 1-8 or a polypeptide represented by a Genbank Accession number in Figure 2; the phosphoenolpyruvate carboxylase is at least 80% identical to any of SEQ ID NOs: 9-16 or a polypeptide represented by a Genbank Accession number in Figure 3; the phosphoenolpyruvate carboxykinase is at least 80% identical to any of SEQ ID NOs: 17-22 or a polypeptide represented by a Genbank Accession number in Figure 4; the pyruvate kinase is at least 80% identical to any of SEQ ID NOs: 23-40 or a polypeptide represented by a Genbank Accession number in Figure 5; the genetic modification that decreases PDC activity is decreased activity of at least one polypeptide that is at least 80% identical to any of SEQ ID NOs: 41-44 or a polypeptide represented by a Genbank Accession number in
  • the malate dehydrogenase is either: at least 80% identical to any of SEQ ID NOs: 47-52, or 78 or a polypeptide represented by a Genbank Accession number in Figure 6; or at least 90, 95, 100% identical to SEQ ID NO: 78 (MDH3 ⁇ SKL);
  • the organic acid transporter polypeptide is at least 80% identical to any of SEQ ID NOs: 92-105, 109 and 110 or a polypeptide represented by a Genbank Accession number in Figure 25; the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 101 (S.
  • the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 105 (A. oryzae OAT); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 104 (A.flavus OAT); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 109 ( Figure Ic); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 110.
  • the cell is a fungus; the fungus is from a genus selected from Aspergillus, Saccharomyces, Yarrowia, and Zygosaccharomyces; the fungus is of the species Aspergillus niger; the fungus is of the species Aspergillus terreus; the fungus is of the species Yarrowia lipolytica; the fungus is of the species Zygosaccharomyces bailii; the fungus is of the species Saccharomyces cerevisiae; and the Saccharomyces cerevisiae is TAM, Lp4f, m850, RWB837, MY2928, MY3825, MY3826 or derivatives thereof.
  • a method of producing a C4-dicarboxylic acid comprising: cultivating a recombinant microbial cell described herein under conditions that achieve C4-dicarboxylic acid production.
  • the method includes a step of isolating the C4-dicarboxylic acid; the C4-dicarboxylic acid is malic acid; the C4-dicarboxylic acid is fumaric acid; the C4- dicarboxylic acid is succinic acid.
  • Also described is a method of preparing a C4-dicarboxylic acid derivative comprising steps of: cultivating a recombinant microbial described herein under conditions that allow production of a C4-dicarboxylic acid; and converting the C4- dicarboxylic acid into a C4-dicarboxylic acid derivative.
  • the method further comprises the step of isolating a C4-dicarboxylic acid or the C4-dicarboxylic acid derivative.
  • the C4-dicarboxylic acid is chosen from one or more of malic acid, fumaric acid and succinic acid; the C4-dicarboxylic acid is malic acid; the C4-dicarboxylic acid is fumaric acid; the said C4-dicarboxylic acid is succinic acid; the C4- dicarboxylic acid derivative is chosen from one or more of: tetrahydrofuran (THF), butane diol (e.g.
  • THF tetrahydrofuran
  • butane diol e.g.
  • nucleic acid which encodes a pyruvate kinase polypeptide whose amino acid sequence comprises a nucleotide sequence having at least 80% (85%, 90%, 95%, 98%) overall sequence identity to n nucleotide sequence selected from SEQ ID NOs: 25- 40.
  • nucleotide sequence of the nucleic acid comprises the nucleotide sequence selected from SEQ ID NOs: 25-40.
  • Nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form of DNA, including, for example, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • the nucleic acids may be in the form of RNA/DNA hybrids.
  • Single-stranded DNA or RNA can be the coding strand, also referred to as the sense strand, or the non-coding strand, also known as the anti-sense strand.
  • the nucleic acid molecule can be inserted in a vector capable of expression, e.g., an expression vector.
  • the vector nucleic acid may be a bacteriophage DNA such as bacteriophage lambda or M 13 and derivatives thereof.
  • the vector may be either RNA or DNA, single- or double- stranded, either prokaryotic, eukaryotic, or viral.
  • Vectors can include transposons, viral vectors, episomes, (e.g. plasmids), chromosomes inserts, and artificial chromosomes (e.g. BACs or YACs). Construction of a vector containing a nucleic acid described herein can be followed by transformation of a host cell such as a bacterium.
  • Suitable bacterial hosts include, but are not limited to, E. coli.
  • Suitable eukaryotic hosts include yeast such as S.
  • the vector nucleic acid can be used to generate a virus such as vaccinia or baculo virus.
  • the nucleic acid can be designed for polypeptide expression.
  • the genetic construct also includes, in addition to the encoding nucleic acid molecule, elements that allow expression, such as a promoter and regulatory sequences.
  • the expression vectors may contain transcriptional control sequences that control transcriptional initiation, such as promoter, enhancer, operator, and repressor sequences.
  • transcriptional control sequences are well known to those in the art and may be functional in, for example, a bacterium, yeast, plant, or animal cell.
  • the expression vector can also include a translation regulatory sequence (e.g., an untranslated 5' sequence, an untranslated 3' sequence, a poly A addition site, or an internal ribosome entry site), a splicing sequence or splicing regulatory sequence, and a transcription termination sequence.
  • the vector can be capable of autonomous replication or it can integrate into host DNA.
  • the microorganism has a genetic modification that decreases pyruvate kinase (PYK) activity, for example, by decreasing the level of PYK overall, decreasing the level of PYK in the relevant cell compartment or decreasing the intrinsic activity of PYK.
  • PYK pyruvate kinase
  • the genetic modification decreases expression of a PYK polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a PYK polypeptide or the disruption of a gene encoding a PYK polypeptide or one or more point mutations in a gene encoding a PYK polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a PYK coding or regulatory sequence that results in decreased PYK expression or activity;
  • the genetic modification is deletion of all or part of the PYK coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PYK polypeptide. Decreasing PYK activity may increase phosphoenolpyruvate substrate for phosphoenolpyruvate carboxykinase (PEPCK) and/or phosphoenolpyruvate carboxylase (PPC), thereby increasing one or both of PEPCK and PPC activities. In some cases, when the host organism is S.
  • cerevisiae a PYK with decreased activity has an amino acid sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to that of any of SEQ ID NOs: 25-40.
  • the host organism's PYK may have an amino acid change that corresponds to the amino acid change found in any of SEQ ID NOs: 25-40 as compared to the wild-type 5.
  • cerevisiae PYK (SEQ ID NO: 23).
  • a corresponding amino acid change is an amino acid change at a position in the non-5 * , cerevisiae polypeptide that is aligned with the altered S. cerevisiae amino acid when the S.
  • cerevisiae polypeptide and the non-5 * , cerevisiae polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods.
  • the amino acid change in the non-5 * , cerevisiae PYK enzyme need not be identical to the change in S. cerevisiae PYK.
  • the change in the non-5 * , cerevisiae host PYK can change a basic amino acid to a different neutral amino acid, e.g., GIy.
  • the PYK polypeptide represented by any of SEQ ID NOs: 25-40 exhibits reduced allosteric activation by fructose 1,6- bisphosphate as compared to the corresponding wild-type polypeptide (SEQ ID NO: 23).
  • the PYK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 23-40 or the polypeptides represented by the Genbank Accession numbers in Figure 5.
  • the microorganism has a genetic modification that increases pyruvate carboxylase (PYC) activity, for example, by increasing the level of PYC polypeptide overall, increasing the level of PYC in the relevant cell compartment or increasing the intrinsic activity of PYC.
  • PYC pyruvate carboxylase
  • the genetic modification is the addition of a gene encoding a PYC polypeptide; the genetic modification increases the transcription or translation of a gene encoding a PYC polypeptide; the genetic modification increases activity by increasing expression of the PYC polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the PYC polypeptide is active in the cytosol; the PYC polypeptide is heterologous to the microorganism; the PYC polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases PYC activity, for example, by decreasing the level of PYC overall, decreasing the level of PYC in the relevant cell compartment or decreasing the intrinsic activity of PYC.
  • the genetic modification decreases expression of a PYC polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a PYC polypeptide or the disruption of a gene encoding a PYC polypeptide or one or more point mutations in a gene encoding a PYC polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a PYC coding or regulatory sequence that results in decreased PYC expression or activity;
  • the genetic modification is deletion of all or part of the PYC coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PYC polypeptide.
  • the PYC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 1-8 or the PYC polypeptides represented by the Genbank Accession numbers in Figure 2.
  • Phosphoenolpyruvate carboxylase PPC
  • the microorganism has a genetic modification that increases the activity of a phosphoenolpyruvate carboxylase (PPC) polypeptide, for example, by increasing the level of PPC overall, increasing the level of PPC in the relevant cell compartment or increasing the intrinsic activity of PPC.
  • PPC phosphoenolpyruvate carboxylase
  • the genetic modification increases activity of PPC by increasing its expression; the genetic modification is the addition of a gene encoding a PPC polypeptide; the genetic modification increases the transcription of a gene encoding a PPC polypeptide or increases translation of a gene encoding a PPC polypeptide; the microorganism contains a modification to decrease sensitivity of the PPC polypeptide to inhibition by one more of malate, aspartate, and oxaloacetate; the PPC polypeptide is heterologous to the microorganism; the PPC polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases PPC activity, for example, by decreasing the level of PPC overall, decreasing the level of PPC in the relevant cell compartment or decreasing the intrinsic activity of PPC.
  • the genetic modification decreases expression of a PPC polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a PPC polypeptide or the disruption of a gene encoding a PPC polypeptide or one or more point mutations in a gene encoding a PPC polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a PPC coding or regulatory sequence that results in decreased PPC expression or activity;
  • the genetic modification is deletion of all or part of the PPC coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PPC polypeptide.
  • the PPC may have an amino acid change that corresponds to the amino acid change found in SEQ ID NOs: 11 or 12 as compared to the wild-type C. glutamicum PPC (SEQ ID NO: 10).
  • a corresponding amino acid change is an amino acid change at a position in the non-C. glutamicum polypeptide that is aligned with the altered C. glutamicum amino acid when the C. glutamicum polypeptide and the non-C.
  • glutamicum polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods.
  • the amino acid change in the non-C. glutamicum PPC enzyme need not be identical to the change in C. glutamicum PPC.
  • the change in the non-C. glutamicum PPC can change a basic amino acid to a different neutral amino acid, e.g., GIy.
  • the PPC may have an amino acid change that corresponds to the amino acid change found in SEQ ID NO: 15 or 16 as compared to the wild-type E. coli PPC (SEQ ID NO: 14).
  • a corresponding amino acid change is an amino acid change at a position in the non-E. coli polypeptide that is aligned with the altered E. coli amino acid when the E. coli polypeptide and the non-E. coli polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods.
  • the amino acid change in the non- E. coli PPC enzyme need not be identical to the change in E. coli PPC. For example, if the amino acid change in the E. coli PPC changes a basic amino acid to a neutral amino acid, e.g., Ala, the change in the non-E coli PPC can change a basic amino acid to a different neutral amino acid, e.g., GIy.
  • PPC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of S ⁇ Q ID NOs: 9-16 or the polypeptides represented by the Genbank Accession numbers in Figure 3.
  • P ⁇ PCK Phosphoenolpyruvate carboxykinase
  • the microorganism has a genetic modification that increases the activity of a phosphoenolpyruvate carboxykinase (P ⁇ PCK) polypeptide, for example, by increasing the level of PEPCK overall, increasing the level of PEPCK in the relevant cell compartment or increasing the intrinsic activity of PEPCK.
  • P ⁇ PCK phosphoenolpyruvate carboxykinase
  • the genetic modification increases activity of PEPCK by increasing its expression; the genetic modification is the addition of a gene encoding a PEPCK polypeptide; the genetic modification increases the transcription of a gene encoding a PEPCK polypeptide or increases translation of a gene encoding a PEPCK polypeptide; the PEPCK polypeptide is heterologous to the microorganism; the PEPCK polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases PEPCK activity, for example, by decreasing the level of PEPCK overall, decreasing the level of PEPCK in the relevant cell compartment or decreasing the intrinsic activity of PEPCK.
  • the genetic modification decreases expression of a PEPCK polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a PEPCK polypeptide or the disruption of a gene encoding a PEPCK polypeptide or one or more point mutations in a gene encoding a PEPCK polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a PEPCK coding or regulatory sequence that results in decreased PEPCK expression or activity;
  • the genetic modification is deletion of all or part of the PEPCK coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PEPCK polypeptide.
  • the PEPCK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 17-22 or the polypeptides represented by the Genbank Accession numbers in Figure 4.
  • the microorganism has a genetic modification that increases the activity of a malate dehydrogenase (MDH) polypeptide, for example, by increasing the level of MDH overall, increasing the level of MDH in the relevant cell compartment or increasing the intrinsic activity of MDH, or reducing allosteric inhibition by one or more allosteric inhibitors.
  • MDH malate dehydrogenase
  • the genetic modification increases activity of MDH by increasing its expression; the genetic modification is the addition of a gene encoding a MDH polypeptide; the genetic modification increases the transcription of a gene encoding a MDH polypeptide or increases translation of a gene encoding a MDH polypeptide; the MDH polypeptide is heterologous to the microorganism; the MDH polypeptide is homologous to the microorganism.
  • the MDH polypeptide contains a signaling sequence or sequences capable of targeting the MDH polypeptide to the cytosol, or the MDH polypeptide lacks a signaling sequence or sequences capable of targeting the MDH polypeptide to an intracellular region other than the cytosol.
  • the MDH polypeptide is S. cerevisiae MDH3 ⁇ SKL (SEQ ID NO: 78), in which the coding region encoding the MDH has been altered to delete the carboxy-terminal SKL residues of wild type S. cerevisiae MDH3 (SEQ ID NO: 51), which normally target MDH3 to the peroxisome.
  • the MDH polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 47-52 or 78 or the polypeptides represented by the Genbank Accession numbers in Figure 6. [023] Pyruvate Decarboxylase (PDC)
  • the microorganism has a genetic modification that decreases pyruvate decarboxylase (PDC) activity, for example, by decreasing the level of PDC overall, decreasing the level of PDC in the relevant cell compartment or decreasing the intrinsic activity of PDC.
  • PDC pyruvate decarboxylase
  • the genetic modification decreases expression of a PDC polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a PDC polypeptide or the disruption of a gene encoding a PDC polypeptide or one or more point mutations in a gene encoding a PDC polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a PDC coding or regulatory sequence that results in decreased PDC expression or activity;
  • the genetic modification is deletion of all or part of a PDC coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PDC polypeptide.
  • the genetic modification comprises at least one modification selected from the group consisting of a modification to decrease one or more of PDCl, PDC2, PDC5, or PDC6 activities; the modification comprises modifications to decrease each of PDCl, PDC5, and PDC6 activities; the modification comprises modifications to decrease each of PDCl and PDC5 activities; the modification comprises modifications to decrease each of PDCl and PDC6 activities; the modification comprises modifications to decrease each of PDC5 and PDC6 activities; the modification is a modification to decrease PDCl activity; the modification is a modification to decrease PDC5 activity; the modification is a modification to decrease PDC6 activity; the modification is a modification to decrease PDC2 activity; the modification comprises a modification to decrease PDC2 activity and one or more of PDCl, PDC5 and/or PDC6 activities; the modification comprises a modification to decrease PDCl activity
  • the PDCl, PDC2, PDC5, or PDC6 polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 41-44 or the polypeptides represented by the Genbank Accession numbers in Figure 7. [024] MTHl
  • the microorganism has a genetic modification that alters the activity of a MTHl polypeptide.
  • MTHl activity is increased by increasing the expression of MTHl or reducing the degradation of MTHl (e.g., reducing the glucose induced degradation of MTHl).
  • MTH1 ⁇ T a deletion mutant of MTHl that is less subject to glucose induced degradation.
  • the genetic modification increases MTHl or MTH 1 ⁇ T expression; the genetic modification is the addition of a gene encoding a MTHl or MTH 1 ⁇ T polypeptide; the genetic modification increases the transcription of a gene encoding a MTHl or MTH 1 ⁇ T polypeptide or increases translation of a gene encoding a MTHl or MTH 1 ⁇ T polypeptide; the MTHl or MTH 1 ⁇ T polypeptide is heterologous to the microorganism; the MTHl or MTH 1 ⁇ T polypeptide is homologous to the microorganism; the MTHl polypeptide has a sequence modification that increases stability, e.g., stability in the presence of glucose.
  • the MTHl or MTH 1 ⁇ T polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either SEQ ID NO: 45 or 46 or the polypeptides represented by the Genbank Accession numbers in Figure 8. [025] Host Cells
  • the host cell is a fungal cell.
  • the fungal cell is of a genus selected from the group consisting of Aspergillus, Saccharomyces, Yarrowia, Zygosaccharomyces; the fungal cell is an Aspergillus niger cell; the fungal cell is an Aspergillus terreus cell; the fungal cell is a Yarrowia lipolytica cell; the fungal cell is a Zygosaccharomyces bailii cell; the fungal cell is a Saccharomyces cerevisiae cell; the Saccharomyces cerevisiae is TAM, Lp4f, m850, RWB837, MY2928, MY3825, MY3826 or derivatives thereof. TAM, Lp4f, m850 and MY2928 are described in patent application publication WO/2009/011974. MY3825 and MY3826 are described herein. RWB837 is described in patent application publication WO/
  • Also disclosed is a method of producing a C4-dicarboxylic acid comprising: culturing a recombinant microbial cell described herein under conditions that achieve C4-dicarboxylic acid production.
  • the method further includes isolating a produced C4-dicarboxylic acid; the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid; the C4-dicarboxylic acid is malic acid; the C4-dicarboxylic acid is fumaric acid; the C4-dicarboxylic acid is succinic acid; the step of culturing under conditions that achieve C4- dicarboxylic acid production comprises culturing at a pH within the range of 1.5 to 7; the pH is lower than 5.0; the pH is lower than 4.5; the pH is lower than 4.0; the pH is lower than 3.5; the pH is lower than 3.0; the pH is lower than 2.5; the pH is lower than 2.0; the step of culturing under conditions that achieve C4-dicarboxylic acid production comprises culturing under conditions and for a time sufficient for C4-dicarboxylic acid to accumulate to a level within the range of 10
  • the step of culturing under conditions that achieve C4-dicarboxylic acid production comprises culturing under conditions and for a time sufficient for C4-dicarboxylic acid to accumulate to a level within a range of about 0.3 moles of C4-dicarboxylic acid per mole of substrate to about 1.75 moles of C4-dicarboxylic acid per mole of substrate;
  • the C4- dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid;
  • the C4-dicarboxylic acid accumulates to greater than about 0.3 moles of C4-dicarboxylic acid per mole of substrate;
  • the C4-dicarboxylic acid accumulates to greater than about 0.5 moles of C4-dicarboxylic acid per mole of substrate;
  • the C4-dicarboxylic acid accumulates to greater than about 0.75 moles of C4-dicarboxylic acid per mole of substrate;
  • Also disclosed is a method of preparing a food or feed additive containing a C4-dicarboxylic acid comprising steps of: a) cultivating a recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4- dicarboxylic acid; and c) combining the isolated C4-dicarboxylic acid with one or more other food or feed additive components.
  • the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid.
  • the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated.
  • products are produced from one or more C4- dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid.
  • Also disclosed is a method of preparing a cosmetic containing a C4-dicarboxylic acid comprising steps of: a) cultivating a recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4-dicarboxylic acid; and c) combining the C4-dicarboxylic acid with one or more cosmetic components.
  • the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid.
  • the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated.
  • products are produced from one or more C4-dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid.
  • Also described is a method of preparing an industrial chemical containing a C4-dicarboxylic acid comprising steps of: a) cultivating the recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4- dicarboxylic acid; and c) combining the isolated C4-dicarboxylic acid with one or more industrial chemical components.
  • the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid.
  • the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated.
  • products are produced from one or more C4- dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid.
  • Also disclosed is a method of preparing a biodegradable polymer containing a C4-dicarboxylic acid comprising steps of: a) cultivating a recombinant microbial cell described here under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4- dicarboxylic acid; and c) combining the isolated C4-dicarboxylic acid with one or more biodegradable polymer components.
  • the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid.
  • the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated.
  • products are produced from one or more C4- dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid.
  • Also disclosed is a method of preparing a C4-dicarboxylic acid derivative comprising steps of: a) cultivating a recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4-dicarboxylic acid; and c) converting the isolated C4-dicarboxylic acid into a C4-dicarboxylic acid derivative.
  • the C4-dicarboxylic acid is chosen from one or more of malic acid, fumaric acid and succinic acid
  • the C4 dicarboxylic acid derivative is chosen from one or more of: tetrahydrofuran (THF), butane diol (e.g.
  • 1,4-butanediol 1,4-butanediol
  • ⁇ -butyrolactone pyrrolidinones (e.g. N- methyl-2-Pyrrolidone)
  • esters diamines, 4,4-Bionelle, hydroxybutyric acid, dibasic ester (DBE), succindiamide, 1,4-diaminobutane, succinonitrile, maleic anhydride, a hydroxybutyrolactone derivative, a hydroxysuccinate derivative and an unsaturated succinate derivative
  • the converting comprises one or more of physical treatments, fermentation, biocatalysis, and chemical transformation
  • the converting comprises one or more physical treatments
  • the converting comprises fermentation
  • the converting comprises one or more chemical transformations
  • the converting comprises one or more biocatalyses.
  • the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated.
  • products are produced from one or more C4-dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid [029]
  • the fermentation methods can include liquid fermentation and solid state fermentation (Krishna 2005 Crit Rev Biotechnol 25:1).
  • accumulation of one or more C4-dicarboxylic acids above background levels refers to accumulation to detectable levels. In some cases, “accumulation” refers to accumulation above a pre-determined level (e.g., above a level achieved under otherwise identical conditions with a microbial cell that has not been modified as described herein). In other cases, “accumulation” refers to titer of one or more C4-dicarboxylic acids, i.e. grams per liter of one or more C4-dicarboxylic acids in the broth of a cultured cell. Any available assay, including those explicitly set forth herein, may be used to detect and/or quantify accumulation of one or more C4-dicarboxylic acids. In some cases increased production of a compound leads to increased accumulation. In other cases it does not, for example, when the compound is consumed in different reaction.
  • Amplification refers to increasing the number of copies of a desired nucleic acid molecule in a cell. Typically, amplification results in an increased level of activity of polypeptide (e.g., an enzyme) encoded by the nucleic acid molecule, and/or to an increased level of activity of the encoded polypeptide in a desirable location (e.g., in the cytosol).
  • polypeptide e.g., an enzyme
  • Anaplerotic polypeptides "Anaplerotic polypeptides" provide activities that function in the carboxylation of the three carbon (C3) metabolic intermediates phosphoenolpyruvate and pyruvate to oxaloacetate.
  • anaplerotic polypeptides are enzymes that catalyze particular steps in a synthesis pathway that ultimately produces oxaloacetate.
  • anaplerotic polypeptides may be polypeptides that do not themselves catalyze synthetic reactions, but that regulate expression and/or activity of other polypeptides that do so.
  • anaplerotic polypeptides include, among others, pyruvate carboxylase (PYC) polypeptides, phosphoenolpyruvate carboxylase (PPC) polypeptides, phosphoenolpyruvate carboxykinase (PEPCK) polypeptides, pyruvate kinase (PYK) polypeptides, biotin protein ligase (BPL) polypeptides, vitamin H transport protein (VHT) polypeptides, bicarbonate transport (BCT) polypeptides, and carbonic anhydrase (CA) polypeptides.
  • Anaplerotic polypeptides include PYC, PPC, PEPCK, and PYK polypeptides.
  • a modification that increases the activity of an anaplerotic polypeptide is one which increases the enzymatic, transport or other functional activity of the polypeptide or one which increases the amount of the polypeptide present in a cell or a cell compartment.
  • Polypeptides that do not catalyze a biosynthetic reaction yet function in the carboxylation of the C3 metabolic intermediates phosphoenolpyruvate and pyruvate to oxaloacetate include: BPL, VHT, BCT, and CA polypeptides.
  • a modification that increases or decreases the activity of one of these polypeptides may also modify the level of carboxylation of C3 metabolic intermediates.
  • Example anaplerotic polypeptides are represented by the pyruvate carboxylase polypeptides, phosphoenolpyruvate carboxylase polypeptides, phosphoenolpyruvate carboxykinase polypeptides, pyruvate kinase polypeptides, biotin protein ligase polypeptides, vitamin H transport protein polypeptides, bicarbonate transport polypeptides, and carbonic anhydrase polypeptides represented by SEQ ID NOS: 1-40, 53-57, and 77; polypeptides that have at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75% identity to pyruvate carboxylase polypeptides, phosphoenolpyruvate carboxylase polypeptides, phosphoenolpyruvate carboxykinase polypeptides, pyruvate kinase polypeptides, bio
  • ATP-citrate lyase polypeptides "ATP-citrate lyase polypeptides" catalyze the cytosolic, reversible reaction:
  • acetyl-CoA often serves as a substrate for fatty acid synthesis or the malate synthase reaction of the glyoxylate cycle.
  • the microorganism has a genetic modification that increases ATP-citrate lyase activity, for example, by increasing the level of ATP-citrate lyase polypeptide overall, increasing the level of ATP-citrate lyase in the relevant cell compartment or increasing the intrinsic activity of ATP-citrate lyase.
  • the genetic modification is the addition of a gene encoding an ATP-citrate lyase polypeptide; the genetic modification increases the transcription or translation of a gene encoding an ATP-citrate lyase polypeptide; the genetic modification increases activity by increasing expression of an ATP-citrate lyase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the ATP-citrate lyase polypeptide is heterologous to the microorganism; the ATP-citrate lyase polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases ATP-citrate lyase activity, for example, by decreasing the level of ATP-citrate lyase overall, decreasing the level of ATP-citrate lyase in the relevant cell compartment or decreasing the intrinsic activity of ATP-citrate lyase.
  • the genetic modification decreases expression of an ATP-citrate lyase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding an ATP-citrate lyase polypeptide or the disruption of a gene encoding an ATP-citrate lyase polypeptide or one or more point mutations in a gene encoding an ATP-citrate lyase polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of an ATP-citrate lyase coding or regulatory sequence that results in decreased ATP-citrate lyase expression or activity;
  • the genetic modification is deletion of all or part of the ATP-citrate lyase coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type ATP-citrate lyase polypeptide.
  • an ATP-citrate lyase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either of SEQ ID NOs: 79 or 80 or the polypeptides represented by the Genbank Accession numbers in Figures 28 and 29.
  • Bicarbonate transport (BCT) polypeptides facilitate the (reversible) movement of membrane impcrmcant HCO ⁇ across biological membranes.
  • Classes of BCT polypeptides include, but are not limited to, CFVHCOi " exchange, NaVl-ICQ 3 " co-transport, and Na ' -dependent CF/HCO; " exchange polypeptides.
  • BCT polypeptides are critical for the physiological processes Of HCO 3 " metabolism and excretion, the regulation of pH, and the regulation of ceil volume, In some cases the microorganism has a genetic modification that increases BCT activity, for example, by increasing the level of BCT overall, increasing the level of BCT in the relevant cell compartment or increasing the intrinsic activity of BCT.
  • the genetic modification is the addition of a gene encoding a BCT polypeptide; the genetic modification increases the transcription or translation of a gene encoding a BCT polypeptide; the genetic modification increases expression of a BCT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the BCT polypeptide is heterologous to the microorganism; the BCT polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases BCT activity, for example, by decreasing the level of BCT overall, decreasing the level of BCT in the relevant cell compartment or decreasing the intrinsic activity of BCT.
  • the genetic modification decreases expression of a BCT polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a BCT polypeptide or the disruption of a gene encoding a BCT polypeptide or one or more point mutations in a gene encoding a BCT polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a BCT coding or regulatory sequence that results in decreased BCT expression or activity;
  • the genetic modification is deletion of all or part of the BCT coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type BCT polypeptide.
  • the BCT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 53- 55 or the polypeptides represented by the Genbank Accession numbers in Figure 9.
  • Biotin protein ligase (BPL) polypeptides Biotin protein ligase (BPL) polypeptides catalyze the site-specific and ATP-dependent covalent transfer of biotin to the lysine side chain of the recognition sequence of an acceptor polypeptide.
  • Acceptor polypeptides include, but are not limited to, pyruvate carboxylase polypeptides. In many instances there is a single BPL polypeptide activity in a given source organism. In some cases, a BPL polypeptide also catalyzes the biotinylation of heterologous polypeptides that are expressed in a host system. Certain BPL polypeptides are multi-functional proteins. In some embodiments, such multifunctional BPL polypeptides have functional domains that are involved in transcriptional repression. To give but one example, the BirA BPL polypeptide from E. coli has a functional domain that is involved in transcriptional repression.
  • the microorganism has a genetic modification that increases biotin ligase (BPL) activity, for example, by increasing the level of BPL overall, increasing the level of BPL in the relevant cell compartment or increasing the intrinsic activity of BPL.
  • BPL biotin ligase
  • the genetic modification is the addition of a gene encoding a BPL polypeptide; the genetic modification increases the transcription or translation of a gene encoding a BPL polypeptide; the genetic modification increases expression of a BPL polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the BPL polypeptide is heterologous to the microorganism; the BPL polypeptide is homologous to the microorganism.
  • the BPL has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 56 or the polypeptides represented by the Genbank Accession numbers in Figure 12.
  • C4-dicarboxylic acid The term "C4-dicarboxylic acid” and names of specific C4- dicarboxylic acids such as malic acid, fumaric acid, and succinic acid are intended to refer to the acid, salt, and anion forms of the compound as are the terms malate, succinate and fumarate, unless otherwise specified.
  • C4-dicarboxylic acid derivatives Succinic acid, malic acid and other four carbon (C4)- dicarboxylic acids are building blocks for numerous applications including surfactants, solvents, fibers, and biodegradable polymers (see Zeikus et al. (1999) Appl Microbiol Biotechnol 51 :545- 552 which is hereby incorporated by reference in its entirety). Hydroxybutyrolactone and hydroxysuccinate derivatives are particular derivatives of malic acid that are of considerable commercial interest. Additional commodity chemicals that can be produced from malic acid or other C4-dicarboxylic acids (e.g.
  • fumaric acid, succinic acid, maleic acid include adipic acid, tetrahydrofuran (THF), butane diol (e.g. 1,4-butanediol), ⁇ -butyrolactone, maleic anhydride, pyrrolidinones (e.g. N-methyl-2-Pyrrolidone), diamines, 4,4-Bionelle, hydroxybutyric acid, dibasic ester (DBE), succindiamide, 1 ,4-diaminobutane, succinonitrile, and unsaturated succinate derivatives.
  • THF tetrahydrofuran
  • butane diol e.g. 1,4-butanediol
  • ⁇ -butyrolactone e.g. N-methyl-2-Pyrrolidone
  • diamines e.g. N-methyl-2-Pyrrolidone
  • DBE dibasic ester
  • succindiamide 1
  • C4-dicarboxylic acid derivatives also include esters, for example linear aliphatic ester derivatives of C4-dicarboxylic acids.
  • the ester can be a C1-C3 or C1-C6 ester.
  • the ester moiety can replace one or both of the carboxylic acid groups on a C4- dicarboxylic acid.
  • the C4-dicarboxylic acid derivatives may be produced by any number of processes including physical treatments, fermentation, biocatalysis, chemical transformation and combinations thereof.
  • C4-dicarboxylic acid biosynthetic polypeptides are proteins of primary metabolism, which are not “anaplerotic polypeptides", whose expression and/or activity can be modified to promote the production of one or more C4- dicarboxylic acids.
  • C4-dicarboxylic acid biosynthetic polypeptides include, but are not limited to ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and/or succinate dehydrogenase polypeptides.
  • C4-dicarboxylic acid biosynthetic polypeptides are represented by the ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and succinate dehydrogenase polypeptides in SEQ ID NOs: 47-52 and 78-91; polypeptides that have at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75% identity to the ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase
  • CA polypeptides designated ⁇ , ⁇ and ⁇
  • Mammalian CA polypeptides belong to the ⁇ class, together with limited representatives from bacteria and archaea.
  • ⁇ class CA polypeptides includes enzymes from the chloroplasts of both monocotyledonous and dicotyledonous plants as well as enzymes from phylogenetically diverse archaeal and bacterial species.
  • the CA polypeptide from the methanoarchaeon Methanosarcina thermophila is a representative of ⁇ class CA polypeptides. Distinct CA polypeptide activities have been detected extracellularly, in the cytosol, and within multiple organelles. CA polypeptides are involved in several important physiological functions, including transport of CO;/ HCCh , pH and CO;, homeostasis, biosynthetic reactions, such as anaplerosis and gluconeogenesis, and CO 2 fixation (in plants and algae). In some cases the microorganism has a genetic modification that increases CA activity, for example, by increasing the level of CA overall, increasing the level of CA in the relevant cell compartment or increasing the intrinsic activity of CA.
  • the genetic modification is the addition of a gene encoding a CA polypeptide; the genetic modification increases the transcription or translation of a gene encoding a CA polypeptide; the genetic modification increases expression of a CA polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the CA polypeptide is heterologous to the microorganism; the CA polypeptide is homologous to the microorganism.
  • the CA polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 57 or the polypeptides represented by the Genbank Accession numbers in Figure 10.
  • Citrate Synthase (CS) polypeptides "Citrate Synthase (CS) polypeptides" catalyze the condensation of acetyl coenzyme A and oxaloacetate to form citrate and are the rate-limiting enzymes of the tricarboxylic acid (TCA) cycle.
  • TCA tricarboxylic acid
  • carbon is completely oxidized to carbon dioxide; thus, flux to the TCA cycle reduces the yield of other compounds derived from oxaloacetate.
  • the microorganism has a genetic modification that decreases citrate synthase (CS) activity, for example, by decreasing the level of CS overall, decreasing the level of CS in the relevant cell compartment or decreasing the intrinsic activity of CS.
  • the genetic modification decreases expression of a CS polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a CS polypeptide or the disruption of a gene encoding a CS polypeptide or one or more point mutations in a gene encoding a CS polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a CS coding or regulatory sequence that results in decreased CS expression or activity;
  • the genetic modification is deletion of all or part of the CS coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than
  • the genetic modification comprises a modification that decreases in vivo flux through a CS polypeptide by decreasing channeling of oxaloacetate between MDH polypeptides and CS polypeptides, for example, by replacing the sequence GHAVLR in the wild-type S. cerevisiae
  • CS polypeptide SEQ ID NO: 106 with the sequence AIGFE (SEQ ID NO: 107) or by expression of an inert carrier protein such as GFP fused to a peptide with an amino acid sequence
  • VPGYGHAVLRKTDPR which functions as a dominant inhibitor of channeling
  • the CS polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 106-108 or the polypeptides represented by the Genbank Accession numbers in Figure 34.
  • Codon As is known in the art, the term “codon” refers to a sequence of three nucleotides that specify a particular amino acid.
  • amino acid that is "corresponding" to an amino acid in a reference sequence occupies a site that is homologous to the site in the reference sequence.
  • Corresponding amino acids can be identified by alignment of related sequences. Amino acid sequences can be compared to protein sequences available in public databases using algorithms such as BLAST,
  • DNA ligase refers to an enzyme that covalently joins two pieces of double-stranded DNA.
  • Electroporation refers to a method of introducing foreign
  • Endonuclease refers to an enzyme that hydro lyzes double stranded DNA at internal locations.
  • Expression refers to the production of a gene product (i.e., RNA or protein).
  • expression includes transcription of a gene to produce a corresponding mRNA, and translation of such an mRNA to produce the corresponding peptide, polypeptide, or protein.
  • Fumarase polypeptides are polypeptides that catalyze the reversible hydration of fumarate to malate (EC 4.2.1.2). In the mitochondrial matrix, fumarase polypeptides function in the tricarboxylic acid cycle to convert fumarate to malate. Fumarase activities often are present in the cytosol as well as the mitochondria. In S.
  • the cytosolic and mitochondrial fumarase isoenzymes are encoded by one gene, FUMl .
  • Fumarase polypeptides are synthesized as precursors and are targeted to and processed in mitochondria prior to distribution between the cytosol and mitochondria. Deletion of the amino terminal mitochondrial-targeting sequence and signal peptide of FUMl results in exclusive cytosolic localization. It is likely that functional FUMl polypeptide variants that preferentially localize to the mitochondria can also be identified.
  • the microorganism has a genetic modification that increases fumarase activity, for example, by increasing the level of fumarase polypeptide overall, increasing the level of fumarase in the relevant cell compartment or increasing the intrinsic activity of fumarase.
  • the genetic modification is the addition of a gene encoding a fumarase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a fumarase polypeptide; the genetic modification increases activity by increasing expression of the fumarase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the fumarase polypeptide is active in the cytosol; the fumarase polypeptide is heterologous to the microorganism; the fumarase polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases fumarase activity, for example, by decreasing the level of fumarase overall, decreasing the level of fumarase in the relevant cell compartment or decreasing the intrinsic activity of fumarase.
  • the genetic modification decreases expression of a fumarase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a fumarase polypeptide or the disruption of a gene encoding a fumarase polypeptide or one or more point mutations in a gene encoding a fumarase polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a fumarase coding or regulatory sequence that results in decreased fumarase expression or activity;
  • the genetic modification is deletion of all or part of the fumarase coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type fumarase polypeptide.
  • the fumarase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 81 or the polypeptides represented by the Genbank Accession numbers in Figure 31.
  • Fumarate reductase polypeptides are a set of FAD- binding proteins that catalyze, to different extents, the interconversion of fumarate and succinate. Fumarate reductase polypeptides are generally active in anaerobic or facultative microbes that live a portion of their life cycle in a reduced oxygen environment. The S.
  • cerevisiae fumarate reductase similar to the flavocytochrome C from Shewanella species, is a soluble protein that binds FAD non-covalently and catalyzes the irreversible reduction of fumarate to succinate, which is required for the reoxidation of intracellular NADH under anaerobic conditions.
  • the S. cerevisiae fumarate reductase polypeptide activities are encoded by the OSMl (mitochondria) and FRDSl (at least partially cytosolic) genes.
  • a distinct class of fumarate reductases is membrane-bound, possesses covalently-linked FAD, and is more structurally related to succinate dehydrogenases; these fumarate reductase polypeptides display some extent of oxidation of succinate to fumarate.
  • the microorganism has a genetic modification that increases fumarate reductase activity, for example, by increasing the level of fumarate reductase polypeptide overall, increasing the level of fumarate reductase in the relevant cell compartment or increasing the intrinsic activity of fumarate reductase.
  • the genetic modification is the addition of a gene encoding a fumarate reductase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a fumarate reductase polypeptide; the genetic modification increases activity by increasing expression of the fumarate reductase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the fumarate reductase polypeptide is heterologous to the microorganism; the fumarate reductase polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases fumarate reductase activity, for example, by decreasing the level of fumarate reductase overall, decreasing the level of fumarate reductase in the relevant cell compartment or decreasing the intrinsic activity of fumarate reductase.
  • the genetic modification decreases expression of a fumarate reductase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a fumarate reductase polypeptide or the disruption of a gene encoding a fumarate reductase polypeptide or one or more point mutations in a gene encoding a fumarate reductase polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a fumarate reductase coding or regulatory sequence that results in decreased fumarate reductase expression or activity;
  • the genetic modification is deletion of all or part of the fumarate reductase coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type fumarate reductase polypeptide.
  • the fumarate reductase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either of SEQ ID NOs: 82 or 83 or the polypeptides represented by the Genbank Accession numbers in Figure 30.
  • Functionally linked refers to a promoter or promoter region and a coding or structural sequence in such an orientation and distance that transcription of the coding or structural sequence may be directed by the promoter or promoter region.
  • functionally linked or “operably linked” in the context of a terminator refers to a terminator or terminator region and a coding or structural sequence in such an orientation and distance that transcription of the coding or structural sequence may be directed by the terminator or terminator region.
  • Functionally transformed refers to a host cell that has been caused to express one or more polypeptides as described herein, such that the expressed polypeptide is functional and is active at a level higher than is observed with an otherwise identical cell (i.e., a parental cell or an unmodified cell) that has not been so transformed.
  • functional transformation involves introduction of a nucleic acid encoding the polypeptide(s) such that the polypeptide(s) is/are produced in an active form and/or appropriate location.
  • functional transformation involves introduction of a nucleic acid that regulates expression of such an encoding nucleic acid.
  • Gene generally refers to a nucleic acid encoding a polypeptide, optionally including certain regulatory elements that may affect expression of one or more gene products (i.e., RNA or protein).
  • a gene may be in chromosomal DNA, plasmid DNA, cDNA, synthetic DNA, or other DNA that encodes a peptide, polypeptide, protein, or RNA molecule, and may include regions flanking the coding sequence involved in the regulation of expression.
  • Genome encompasses both the chromosomes and plasmids within a host cell.
  • encoding nucleic acids of the present disclosure that are introduced into host cells can be part of the genome whether they are chromosomally integrated or plasmid- localized.
  • Glucose sensing and regulatory (GSR) polypeptides are polypeptides that govern the complex physiological responses required for a microbial cell to utilize glucose efficiently and to the exclusion of other available carbon sources. GSR polypeptides include, among others, SNFl, MIGl, MIG2, MTHl, HXK2, RGTl, SNF3, RGT2, STDl, GRRl, YCKl, HXKl, and GLKl polypeptides. Three regulatory systems appear to control most aspects of the glucose sensing response. S. cerevisiae and other fungi naturally produce GSR polypeptides. For example, the S.
  • SNF1/MIG1 system functions to repress (high glucose) or derepress (low glucose) expression of a broad set of genes involved in the utilization of alternative carbon sources and in gluconeogenesis.
  • phosphorylation of the MIGl transcriptional repressor by the SNFl kinase prevents both nuclear localization of the repressor and its binding to recognition sequences.
  • MI G2 which binds to a recognition site similar to that of MIGl and HXK2 are additional proteins implicated in controlling the expression of this set of genes.
  • a second regulatory system which functions primarily to regulate expression of hexose tranporter (HXT) polypeptides, impinges on the action of the RGTl transcriptional repressor.
  • HXT hexose tranporter
  • SNF3 and RGT2 glucose sensing proteins that are homologues of glucose transporters initiate a signal that is relayed to the paralogous MTHl and STDl proteins, which are necessary for RGTl- mediated repression.
  • MTHl and STDl proteins are phosphorylated by the YCKl kinase, and this phosphorylation targets the MTHl and STDl proteins for GRRl mediated ubiquitination and degradation.
  • MTHl gene expression is controlled by the MIGl and MIG2 repressor proteins.
  • a third glucose sensing system which requires proteins such as, but not limited to, the GPRl G-protein coupled receptor and hexokinases (e.g. HXKl, HXK2, and GLKl), regulates transcriptional and other cellular responses that result from glucose-mediated activation of cAMP synthesis.
  • the microorganism has a genetic modification that increases GSR activity, for example, by increasing the level of GSR overall, increasing the level of GSR in the relevant cell compartment or increasing the intrinsic activity of GSR.
  • the genetic modification that increases expression is the addition of a gene encoding a GSR polypeptide; the genetic modification increases the transcription or translation of a gene encoding a GSR polypeptide; the genetic modification increases activity by increasing expression of the GSR polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the GSR polypeptide is heterologous to the microorganism; the GSR polypeptide is homologous to the microorganism.
  • the GSR polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 58-69 or the polypeptides represented by the Genbank Accession numbers in any of Figures 14-24.
  • Heterologous means from a source organism other than the host cell.
  • heterologous refers to genetic material or polypeptide that does not naturally occur in the species in which it is present and/or being expressed. It will be understood that, in general, when heterologous genetic material or polypeptide is selected for introduction into and/or expression by a host cell, the particular source organism from which the heterologous genetic material or polypeptide may be selected is not critical to the practice of the present disclosure. Relevant considerations may include, for example, how closely related the potential source and host organisms are in evolution, or how related the source organism is with other source organisms from which sequences of other relevant polypeptides have been selected.
  • polypeptides or nucleic acids may be from different source organisms, or from the same source organism.
  • individual polypeptides may represent individual subunits of a complex protein activity and/or may be required to work in concert with other polypeptides in order to achieve the goals of the present disclosure.
  • such polypeptides may be from different, even unrelated source organisms.
  • heterologous polypeptide is to be expressed in a host cell
  • nucleic acids whose sequences encode the polypeptide that have been adjusted to accommodate codon preferences of the host cell and/or to link the encoding sequences with regulatory elements active in the host cell.
  • Hexose transporter (HXT) polypeptides are proteins that belong to the major facilitator superfamily (MFS) of transporters. HXT polypeptides transport their substrates by passive, energy-independent facilitated diffusion, with glucose moving down a concentration gradient. Many prokaryotic and eukaryotic, including mammalian, sugar transporters are of the MFS superfamily. The genome of the yeast S. cerevisiae encodes at least 20 candidate HXT polypeptides, while seven (encoded by the HXTl through HXT7 genes) have been demonstrated to encode functional glucose transporters.
  • MFS major facilitator superfamily
  • HXT2 HXT6, and HXT7 polypeptides are believed to be high-affinity glucose transporters, whereas HXT3 and HXT4 polypeptides are low-affinity glucose transporters.
  • the microorganism has a genetic modification that increases HXT activity, for example, by increasing the level of HXT overall, increasing the level of HXT in the relevant cell compartment or increasing the intrinsic activity of HXT.
  • the genetic modification that increases expression is the addition of a gene encoding a HXT polypeptide; the genetic modification increases the transcription or translation of a gene encoding a HXT polypeptide; the genetic modification increases activity by increasing expression of the HXT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the HXT polypeptide is heterologous to the microorganism; the HXT polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases HXT activity, for example, by decreasing the level of HXT overall, decreasing the level of HXT in the relevant cell compartment or decreasing the intrinsic activity of HXT.
  • the genetic modification decreases expression of a HXT polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a HXT polypeptide or the disruption of a gene encoding a HXT polypeptide or one or more point mutations in a gene encoding a HXT polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a HXT coding or regulatory sequence that results in decreased HXT expression or activity;
  • the genetic modification is deletion of all or part of the HXT coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type HXT polypeptide.
  • the HXT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs:70- 76 or the polypeptides represented by the Genbank Accession numbers in Figure 11.
  • Homologous The term "homologous", as used herein, means from the same source organism as the host cell.
  • homologous refers to genetic material or polypeptides that naturally occurs in the organism in which it is present and/or being expressed, although optionally at different activity levels and/or in different amounts.
  • Host cell As used herein, the "host cell” is a cell that is manipulated to increase production of OAA and/or one or more C4-dicarboxylic acids as described herein.
  • a "modified host cell”, as used herein, is any host cell which has been modified, engineered, or manipulated in accordance with the present disclosure as compared with a parental cell.
  • the parental cell is a naturally occurring parental cell.
  • the host cell is a microbial cell such as a bacterial cell, a fungal cell or a yeast cell.
  • Hybridization refers to the ability of a strand of nucleic acid to join with a complementary strand via base pairing. Hybridization occurs when complementary sequences in the two nucleic acid strands bind to one another.
  • Isocitrate lyase polypeptides are polypeptides that catalyze the formation of succinate and glyoxylate from isocitrate (EC 4.1.3.1), a key reaction of the glyoxylate cycle.
  • the microorganism has a genetic modification that increases isocitrate lyase activity, for example, by increasing the level of isocitrate lyase polypeptide overall, increasing the level of isocitrate lyase in the relevant cell compartment or increasing the intrinsic activity of isocitrate lyase.
  • the genetic modification is the addition of a gene encoding an isocitrate lyase polypeptide; the genetic modification increases the transcription or translation of a gene encoding an isocitrate lyase polypeptide; the genetic modification increases activity by increasing expression of the isocitrate lyase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the isocitrate lyase polypeptide is heterologous to the microorganism; the isocitrate lyase polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases isocitrate lyase activity, for example, by decreasing the level of isocitrate lyase overall, decreasing the level of isocitrate lyase in the relevant cell compartment or decreasing the intrinsic activity of isocitrate lyase.
  • the genetic modification decreases expression of an isocitrate lyase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding an isocitrate lyase polypeptide or the disruption of a gene encoding a isocitrate lyase polypeptide or one or more point mutations in a gene encoding a isocitrate lyase polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of an isocitrate lyase coding or regulatory sequence that results in decreased isocitrate lyase expression or activity;
  • the genetic modification is deletion of all or part of the isocitrate lyase coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type isocitrate lyase polypeptide.
  • the isocitrate lyase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 84 or the polypeptides represented by the Genbank Accession numbers in Figure 33.
  • Isolated The term "isolated", as used herein, means that the isolated entity has been separated from at least one component with which it was previously associated.
  • Malate dehydrogenase polypeptide A malate dehydrogenase (MDH) polypeptide is an enzyme capable of catalyzing the interconversion of oxaloacetate to malate (using NAD(P)H) and vice versa (EC 1.1.1.37). Malate dehydrogenase polypeptides can be localized to the mitochondria or to the cystosol.
  • the malate dehydrogenase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs:47-52 or 78, or the polypeptides represented by the Genbank Accession numbers in Figure 6.
  • Malate synthase polypeptides are enzymes of the glyoxylate cycle that catalyze the irreversible condensation of acetyl-CoA and glyoxylate to yield malate and CoA (EC 2.3.3.9). Malate synthase polypeptide activities, like those of isocitrate lyase polypeptides, are typically elevated when a non-fermentable carbon source is provided.
  • the microorganism has a genetic modification that increases malate synthase activity, for example, by increasing the level of malate synthase polypeptide overall, increasing the level of malate synthase in the relevant cell compartment or increasing the intrinsic activity of malate synthase.
  • the genetic modification is the addition of a gene encoding a malate synthase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a malate synthase polypeptide; the genetic modification increases activity by increasing expression of the malate synthase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the malate synthase polypeptide is heterologous to the microorganism; the malate synthase polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases malate synthase activity, for example, by decreasing the level of malate synthase overall, decreasing the level of malate synthase in the relevant cell compartment or decreasing the intrinsic activity of malate synthase.
  • the genetic modification decreases expression of a malate synthase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a malate synthase polypeptide or the disruption of a gene encoding a malate synthase polypeptide or one or more point mutations in a gene encoding a malate synthase polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a malate synthase coding or regulatory sequence that results in decreased malate synthase expression or activity;
  • the genetic modification is deletion of all or part of the malate synthase coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type malate synthase polypeptide.
  • the malate synthase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either of SEQ ID NOs: 85 or 86, or the polypeptides represented by the Genbank Accession numbers in Figure 26.
  • Medium refers to a chemical environment in which a host cell, such as a microbial cell (e.g., a yeast or fungal cell) is cultivated.
  • a medium contains components required for the growth of the cell, and one or more precursors for the production of OAA or one or more C4-dicarboxylic acids.
  • Components for growth of host cells and precursors for the production of OAA or one or more C4-dicarboxylic acids may or may be not identical.
  • Malic enzyme polypeptides are polypeptides that catalyze the reversible NAD-dependent or NADP-dependent (EC 1.1.1.40) oxidative decarboxylation of (EC 1.1.1.38 or 1.1.1.39) malate to carbon dioxide and pyruvate, with the concomitant reduction of NAD(P)+.
  • the enzyme is found in most living organisms, because the products of the reaction are used as a source of carbon and reductive power in different cell compartments. Most fungi encode a NADP-dependent malic enzyme. In S. cerevisiae, the malic enzyme polypeptide is encoded by the MAEl gene.
  • the microorganism has a genetic modification that increases malic enzyme activity, for example, by increasing the level of malic enzyme polypeptide overall, increasing the level of malic enzyme in the relevant cell compartment or increasing the intrinsic activity of malic enzyme.
  • the genetic modification is the addition of a gene encoding a malic enzyme polypeptide; the genetic modification increases the transcription or translation of a gene encoding a malic enzyme polypeptide; the genetic modification increases activity by increasing expression of the malic enzyme polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the malic enzyme polypeptide is heterologous to the microorganism; the malic enzyme polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases malic enzyme activity, for example, by decreasing the level of malic enzyme overall, decreasing the level of malic enzyme in the relevant cell compartment or decreasing the intrinsic activity of malic enzyme.
  • the genetic modification decreases expression of a malic enzyme polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a malic enzyme polypeptide or the disruption of a gene encoding a malic enzyme polypeptide or one or more point mutations in a gene encoding a malic enzyme polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a malic enzyme coding or regulatory sequence that results in decreased malic enzyme expression or activity;
  • the genetic modification is deletion of all or part of the malic enzyme coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type malic enzyme polypeptide.
  • the malic enzyme polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 87, or the polypeptides represented by the Genbank Accession numbers in Figure 27.
  • Modified refers to a host cell that has been modified to increase production of OAA or one or more C4-dicarboxylic acids, as compared with an otherwise identical host organism that has not been so modified.
  • modification in accordance with the present disclosure may comprise any chemical, physiological, genetic, or other modification that appropriately alters production of OAA and/or one or more C4-dicarboxylic acids in a host organism as compared with such production in an otherwise identical cell not subject to the same modification. In most embodiments, however, the modification will comprise a genetic modification.
  • a genetic modification can entail: the addition of all or a portion of a gene or polypeptide coding sequence that is not naturally present in the host cell, the addition of all or a portion of a gene that is already present in the host cell, the deletion of all or a portion of a gene or polypeptide coding sequence that is naturally in the host cell, an alteration in (e.g., a sequence change in) a gene or polypeptide coding sequence that is naturally present in the host cell (e.g., a sequence change that increases expression, a sequence change that decreases expression, a sequence change that increases enzymatic, transport or other activity of a polypeptide, a sequence change that decreases enzymatic, transport or other activity of a polypeptide) and combinations thereof.
  • an alteration in e.g., a sequence change in
  • a sequence change that increases expression e.g., a sequence change that decreases expression, a sequence change that increases enzymatic, transport or other activity of a polypeptide
  • a modification comprises at least one chemical, physiological, genetic, or other modification; in other cases, a modification comprises more than one chemical, physiological, genetic, or other modification. In certain aspects where more than one modification is utilized, such modifications can comprise any combination of chemical, physiological, genetic, or other modifications (e.g., one or more genetic, chemical and/or physiological modification(s)).
  • the genetic modification entails providing the host cell with a nucleic acid molecule that encodes a desired polypeptide. In many cases the nucleic acid molecule will also include a functionally linked promoter or promoter region that allows for expression of the encoded polypeptide.
  • a nucleic acid molecule provided to the host cell e.g., by transformation, can encode two or more desired polypeptides.
  • each of the two or more polypeptides is accompanied by a functionally linked promoter or promoter region.
  • the functionally linked promoter or promoter regions can be all the same, all different, or may include some which are the same and others which are different.
  • the nucleic acid molecule(s) will also include a functionally linked terminator region that allows for proper expression of the encoded polypeptide.
  • the functionally linked terminator regions can be all the same, all different, or may include some which are the same and others which are different.
  • a nucleic acid molecule can encode a recombinant chimeric polypeptide having two or more of the desirable activities, e.g., two or more of the enzymatic activities, described herein. Some naturally- occurring polypeptides may have two or more of the desirable activities described herein.
  • MTHl An MTHl polypeptide is a negative regulator of the glucose-sensing signal transduction pathway. MTHl plays a role in the regulation of genes encoding hexose transporter polypeptides. MTHl also plays a role in the regulation of glucose sensing and regulatory polypeptides and is itself a glucose sensing and regulatory polypeptide. MTHl is subject to glucose induced degradation.
  • MTHl variant that is not subject to this regulation.
  • One such useful variant is the S. cerevisiae MTH 1 ⁇ T, a deletion mutant (SEQ ID NO: 46).
  • the MTHl may have an amino acid deletion that corresponds to the amino acid deletion found in SEQ ID NO: 46 as compared to the wild- type S. cerevisiae MTHl (SEQ ID NO: 45).
  • a corresponding amino acid deletion is an amino acid deletion at a position in the non-5 * , cerevisiae polypeptide that is aligned with the altered S. cerevisiae amino acid when the S.
  • cerevisiae polypeptide and the non-5 * , cerevisiae polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods.
  • the amino acid deletion in the non-5 * , cerevisiae MTHl enzyme need not be identical to the change in S. cerevisiae MTHl .
  • a deletion that is larger or smaller than that which corresponds to that present in S. cerevisiae MTH 1 ⁇ T can be useful.
  • Open reading frame As is known in the art, the term “open reading frame (ORF)" refers to a region of DNA or RNA encoding a peptide, polypeptide, or protein.
  • Organic acid transporter (OAT) polypeptides “Organic acid transporter (OAT) polypeptides” are proteins whose expression and/or activities can be modified to catalyze the net efflux of one or more dicarboxylic acids from microbial cells, e.g., C -4 dicarboxylic acids. OAT polypeptides are a diverse set of proteins that catalyze carboxylic acid transport via several distinct mechanisms.
  • the activity of a particular OAT polypeptide may be either increased or reduced, depending on the substrate(s) for a given OAT polypeptide and the desired dicarboxylic acid product. Furthermore, it may be possible to modify the subcellular localization of an OAT polypeptide to promote the efflux of a specific dicarboxylic acid product. As an example, a vacuolar or tonoplast dicarboxylate transporter may be targeted to the cytoplasmic membrane in order to facilitate the efflux of a dicarboxylic acid product such as malic acid.
  • Representative OAT polypeptides include the A.flavus C4-dicarboxylate transporter/malic acid transport protein, S. pombe malate transporter MAEl, aluminum activated malate transporters (e.g.
  • ALMTl plant tonoplast dicarboxylate transporters (e.g. A. thaliana AttDT), mammalian sodium/dicarboxylate co-transporters, mono- and dicarboxylic acid transporters related to the K. lactis JENl and JEN2 proteins, respectively; and proteins related to the E. coli DcuC succinate efflux polypeptide.
  • the microorganism has a genetic modification that increases OAT activity, for example, by increasing the level of OAT polypeptide overall, increasing the level of OAT in the relevant cell compartment or increasing the intrinsic activity of OAT.
  • the genetic modification is the addition of a gene encoding an OAT polypeptide; the genetic modification increases the transcription or translation of a gene encoding an OAT polypeptide; the genetic modification increases activity by increasing expression of the OAT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the OAT polypeptide is heterologous to the microorganism; the OAT polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases OAT activity, for example, by decreasing the level of OAT polypeptide overall, decreasing the level of OAT in the relevant cell compartment or decreasing the intrinsic activity of OAT.
  • the genetic modification decreases OAT activity by decreasing expression of an OAT polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification
  • the genetic modification is a deletion of all or part of a gene encoding an OAT polypeptide or the disruption of a gene encoding an OAT polypeptide
  • the genetic modification that decreases OAT activity is a nucleotide substitution in one or more nucleotides of an OAT coding or regulatory sequence that results in decreased OAT expression or activity.
  • the OAT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 92-105, 109 and 110, or the polypeptides represented by the Genbank Accession numbers in Figure 25.
  • PDC-reduced refers to a cell containing a modification (e.g., a genetic modification that deletes all or a portion of a PDC gene or a genetic modification that alters the activity or expression of PDC) that reduces pyruvate decarboxylase activity as compared with an otherwise identical cell that is not modified.
  • a PDC-reduced cell has reduced activity of one or more pyruvate decarboxylase polypeptides relative to the unmodified cell (e.g., an otherwise identical cell lacking the modification).
  • a PDC-reduced cell has reduced or substantially eliminated Pdcl polypeptide activity.
  • the PDC-reduced cell further comprises reduced or substantially eliminated Pdc2, Pdc5, and/or Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced or substantially eliminated Pdc2 polypeptide activity. In certain embodiments thereof, the PDC-reduced cell further comprises reduced or substantially eliminated Pdcl, Pdc5, and/or Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced or substantially eliminated Pdc5 polypeptide activity. In certain cases thereof, the PDC-reduced cell further comprises reduced and/or substantially eliminated Pdcl, Pdc2, and/or Pdc6 polypeptide activity.
  • the PDC-reduced cell has reduced or substantially eliminated Pdc6 polypeptide activity. In certain cases, the PDC-reduced cell further comprises reduced and/or substantially eliminated Pdcl, Pdc2, and/or Pdc5 polypeptide activity. In some cases the PDC-reduced cell has reduced and/or substantially eliminated Pdcl and Pdc5 polypeptide activity. In some cases, a PDC-reduced cell has reduced and/or substantially eliminated Pdcl and Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced and/or substantially eliminated Pdc5 and Pdc6 polypeptide activity.
  • a PDC-reduced cell has reduced and/or substantially eliminated Pdcl, Pdc5 and Pdc6 polypeptide activity. In some embodiments, a PDC-reduced cell has 3-fold, 5-fold, 10-fold, 50-fold less pyruvate decarboxylase activity as compared with an otherwise identical parental cell not containing the modification.
  • a PDC-reduced cell has pyruvate decarboxylase activity below at least about 0.075 micromol/min mg protein "1 , at least about 0.045 micromol/min mg protein "1 , at least about 0.025 micromol/min mg protein "1 ; in some embodiments, a PDC-reduced cell has pyruvate decarboxylase activity below about 0.005 micromol/min mg protein "1 when using the methods described by van Maris et al. (2003) (Appl. Environ. Microbiol. 69:2094-2099, 2003). In some cases, a PDC-reduced cell has no detectable pyruvate decarboxylase activity.
  • a cell with no detectable pyruvate decarboxylase activity is referred to as "PDC-negative".
  • a PDC-negative cell lacks Pdcl, Pdc5 and Pdc6 polypeptide activity.
  • a PDC-negative cell has pyruvate decarboxylase activity below about 0.005 micromol/min mg protein "1 .
  • the pyruvate decarboxylase polypeptide is chosen from an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 41-44 or the polypeptides represented by the Genbank Accession numbers in Figure 7.
  • Phosphoenolpyruvate carboxykinase (PEPCK) polypeptide A "phosphoenolpyruvate carboxykinase (PEPCK) polypeptide” is a polypeptide that catalyzes the reversible formation of oxaloacetate and ATP from phosphoenolpyruvate, ADP, and carbon dioxide (EC 4.1.1.49). Under physiological conditions such as glucose limitation, PEPCK acts to catalyze the formation of phosphoenolpyruvate from OAA (for gluconeogenesis), thereby reversing the anaplerotic flux provided by PYC and PPC.
  • Phosphoenolpyruvate carboxylase (PPC) polypeptide A "phosphoenolpyruvate carboxylase (PPC) polypeptide" is a polypeptide catalyzes the addition of carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate (EC 4.1.1.31). E. coli PPC has been observed to be negatively regulated by downstream products, including by malate.
  • the PPC polypeptide is modified to be less sensitive to inhibition by one or more of malate, aspartate, and/or oxaloacetate.
  • the PPC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs:9-16 or the polypeptides represented by the Genbank Accession numbers in Figure 3.
  • Plasmid As is known in the art, the term "plasmid" refers to a circular or linear, extra- chromosomal, replicatable piece of DNA.
  • PCR polymerase chain reaction
  • Polypeptide generally has its art-recognized meaning of a polymer of at least three amino acids. However, the term is also used to refer to specific functional classes of polypeptides, such as, for example, anaplerotic polypeptides (e.g.
  • pyruvate carboxylase polypeptides phosphoenolpyruvate carboxylase polypeptides, phosphoenolpyruvate carboxykinase polypeptides, pyruvate kinase polypeptides, biotin protein ligase polypeptides, vitamin H transport protein polypeptides, bicarbonate transport polypeptides, and carbonic anhydrase polypeptides), MTHl polypeptides, glucose sensing and regulatory polypeptides (e.g.
  • hexose transporter polypeptides e.g. HXTl, HXT2, HXT3, HXT4, HXT5, HXT6, and HXT7
  • C4-dicarboxylic acid biosynthetic polypeptides e.g.
  • ATP-citrate lyase polypeptides fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and succinate dehydrogenase polypeptides), pyruvate decarboxylase polypeptides, citrate synthase polypeptides).
  • the present specification provides several examples of known sequences of such polypeptides.
  • polypeptide is intended to be sufficiently general as to encompass not only polypeptides having the complete sequence recited herein (or in a reference or database specifically mentioned herein), but also to encompass polypeptides that represent functional fragments (i.e., fragments retaining at least one activity) of such complete polypeptides.
  • polypeptides generally tolerate some substitution without destroying activity.
  • Other regions of similarity and/or identity can be determined by those of ordinary skill in the art by analysis of the sequences of various polypeptides presented in SEQ ID NOS: 1-108 and Figures IB and 2-34 herein.
  • polypeptide has an amino acid sequence that differs from the amino acid sequence of a polypeptide presented in SEQ ID NOS: 1-108 and Figures IB and 2-34 herein by fewer than 20, 15, 10 or 5 amino acids. In some cases the amino acid changes are conservative changes.
  • promoter refers to a DNA sequence, usually found upstream (5') to a coding sequence, that controls expression of the coding sequence by controlling production of messenger RNA (mRNA) by providing the recognition site for RNA polymerase and/or other factors necessary for start of transcription at the correct site.
  • mRNA messenger RNA
  • Pyruvate carboxylase enzyme (PYC) polypeptide can be any enzyme that uses a HCO3 " substrate to catalyze an ATP-dependent conversion of pyruvate to oxaloacetate (EC 6.4.1.1).
  • PYC polypeptides contain a covalently attached biotin prosthetic group, which serves as a carrier of activated CO 2 . In most instances, the activity of PYC polypeptides depends on the presence of acetyl-CoA. Biotin is not carboxylated (on PYC) unless acetyl-CoA (or a closely related acyl-CoA) is bound to the enzyme.
  • PYC polypeptides are generally active in a tetrameric form.
  • the PYC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 1-8 or the polypeptides represented by the Genbank Accession numbers in Figure 2.
  • Pyruvate decarboxylase (PDC) polypeptide A "pyruvate decarboxylase polypeptide" can be any thiamin diphosphate-dependent enzyme that catalyses the decarboxylation of pyruvic acid to acetaldehyde and carbon dioxide (EC 4.1.1.1).
  • the PDC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 41-43 or the polypeptides represented by the Genbank Accession numbers in Figure 7.
  • Pyruvate kinase catalyses the irreversible conversion of phosphoenolpyruvate (PEP) to pyruvate (EC 2.7.1.40), the final step in glycolysis.
  • PYK enzymes are tetrameric complexes of identical subunits.
  • PYK polypeptides play a key role in regulating glycolytic flux.
  • PYK polypeptides from Saccharomyces cerevisiae have an absolute requirement for both monovalent and divalent cations, undergo homotropic activation by PEP and Mn 2+ , and heterotropic activation by fructose 1 ,6-bisphosphate (FBP).
  • Potassium is the physiologically important monovalent activator, but several other monovalent cations can also activate PYK polypeptides.
  • the PYK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 23-40 or the polypeptides represented by the Genbank Accession numbers in Figure 5.
  • Recombinant A "recombinant" host cell, as that term is used herein, is a host cell that has been genetically modified.
  • a "recombinant cell” can be a cell that contains a nucleic acid sequence not naturally occurring in the cell, or an additional copy or copies of an endogenous nucleic acid sequence, wherein the nucleic acid sequence is introduced into the cell or an ancestor thereof by human action.
  • a recombinant cell includes, but is not limited to: a cell which has been genetically modified by deletion of all or a portion of a gene, a cell that has had a mutation introduced into a gene, a cell that has had a nucleic acid sequence inserted either to add a functional gene or disrupt a functional gene, and a cell that has a gene that has been modified by both removing and adding a nucleic acid sequence.
  • a "recombinant vector” or “recombinant DNA or RNA construct” refers to any nucleic acid molecule generated by the hand of man.
  • a recombinant construct may be a vector such as a plasmid, cosmid, virus, autonomously replicating sequence, phage, or linear or circular single-stranded or double- stranded DNA or RNA molecule.
  • a recombinant nucleic acid may be derived from any source and/or capable of genomic integration or autonomous replication where it includes two or more sequences that have been linked together by the hand of man.
  • Recombinant constructs may, for example, be capable of introducing a 5' regulatory sequence or promoter region and a DNA sequence for a selected gene product into a cell in such a manner that the DNA sequence is transcribed into a functional mRNA, which may or may not be translated and therefore expressed.
  • a polypeptide with "reduced inhibition” includes a polypeptide that is less inhibited by the presence of an inhibitory factor as compared to a wild-type form of the polypeptide or a polypeptide that is less inhibited by the presence of an inhibitory factor as compared to the corresponding endogenous polypeptide expressed in the organism into which the polypeptide has been introduced.
  • the inhibitory factor is an allosteric inhibitor.
  • the inhibitory factor may be a product or an intermediate of a C4- dicarboxylic acid biosynthetic pathway, e.g., a product produced by the polypeptide that is inhibited.
  • a wild-type PPC from E. coli may have 10-fold less activity in the presence of a given concentration of one or more of malate, aspartate, and oxaloacetate, respectively.
  • a PPC with reduced inhibition may have, for example, 5-fold less, 2-fold less, or wild-type levels of activity in the presence of the same concentration of one or more of malate, aspartate, and oxaloacetate.
  • a variant enzyme having one or more amino acid changes which result in reduced inhibition can be used as a model by those skilled in the art to create variants of a heterologous enzyme by making the same or a similar amino acid change(s) at the corresponding position(s) in the heterologous enzyme.
  • the amino acid change in the heterologous enzyme need not be identical to the change in the model enzyme. For example, if the amino acid change in the model enzyme changes a basic amino acid to a neutral amino acid, e.g., Ala, the change in the heterologous enzyme can change a basic amino acid to a different neutral amino acid, e.g., GIy.
  • Restriction enzyme refers to an enzyme that recognizes a specific sequence of nucleotides in double stranded DNA and cleaves both strands; also called a restriction endonuclease. Cleavage typically occurs within the restriction site or close to it.
  • Screenable is used to refer to a marker whose expression confers a phenotype facilitating identification, optionally without facilitating survival, of cells containing the marker.
  • a screenable marker imparts a visually or otherwise distinguishing characteristic (e.g. color changes, fluorescence).
  • Selectable is used to refer to a marker whose expression confers a phenotype facilitating identification, and specifically facilitating survival, of cells containing the marker. Selectable markers include those, which confer resistance to toxic chemicals (e.g. ampicillin, kanamycin) or complement a nutritional deficiency (e.g. uracil, histidine, leucine).
  • Sequence Identity refers to a comparison between two sequences (e.g., two nucleic acid sequences or two amino acid sequences) and assessment of the degree to which they contain the same residue at the same position.
  • an assessment of sequence identity includes an assessment of which positions in different sequences should be considered to be corresponding positions; adjustment for gaps, etc. is permitted.
  • an assessment of residue identity can include an assessment of degree of identity such that consideration can be given to positions in which the identical residue (e.g., nucleotide or amino acid) is not observed, but a residue sharing one or more structural, chemical, or functional features is found.
  • Identity can be determined by a sequence alignment. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Any of a variety of algorithms or approaches may be utilized to calculate sequence identity.
  • the Needleman and Wunsch (1970) J. MoI. Biol. 48:444-453 algorithm can be utilized. This algorithm has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com).
  • the Neddleman and Wunsch algorithim is employed using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • sequence alignment is performed using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
  • a particularly preferred set of parameters are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • a sequence alignment is performed using the algorithm of Meyers and Miller ((1989) CABIOS, 4:11-17).
  • Pairwise scores are calculated as the number of identities in the best alignment divided by the number of residues compared (gap positions are excluded). Both of these scores are initially calculated as percent identity scores and are converted to distances by dividing by 100 and subtracting from 1.0 to give number of differences per site.
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% of the length of the reference sequence.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • Small Molecule In general, a small molecule is understood in the art to be an organic molecule that is less than about 5 kilodaltons (Kd) in size. In some embodiments, the small molecule is less than about 3 Kd, 2 Kd, or 1 Kd. In some embodiments, the small molecule is less than about 800 daltons (D), 600 D, 500 D, 400 D, 300 D, 200 D, or 100 D. In some embodiments, small molecules are non-polymeric. In some embodiments, small molecules are not proteins, peptides, or amino acids. In some embodiments, small molecules are not nucleic acids or nucleotides. In some embodiments, small molecules are not saccharides or polysaccharides.
  • Source organism refers to the organism in which a particular polypeptide or genetic sequence can be found in nature. Thus, for example, if one or more homologous or heterologous polypeptides or genetic sequences is/are being expressed in a host organism, the organism in which the polypeptides or sequences are expressed in nature (and/or from which their genes were originally cloned) is referred to as the "source organism”. Where multiple homologous or heterologous polypeptides and/or genetic sequences are being expressed in a host organism, one or more source organism(s) may be utilized for independent selection of each of the heterologous polypeptide(s) or genetic sequences.
  • source organisms include, for example, animal, mammalian, insect, plant, fungal, yeast, algal, bacterial, archaebacterial, cyanobacterial, and protozoal source organisms.
  • a source organism may be a fungus, including yeasts, of the genus Aspergillus, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Yarrowia, or Zygosaccharomyces.
  • the source organism may be of the species Aspergillus niger, Aspergillus terreus, Kluyveromyces lactis, S. cerevisiae, S. pombe, Y. lipolytica, or Zygosaccharomyces bailii.
  • a source organism may be a bacterium, including a bacterium of the genus Actinobacillus, Alcaligenes, Bacteroides, Brevibacteria, Capnocytophaga, Corynebacteria, Erwinia, Escherichia, Haemophilus, Lactobacillus, Lactococcus, Methanococcus, Methanothermobacter, Nocardia, Propionibacterium, Pseudomonas, Staphylococcus, (Thermo) synechococcus, or Zymomonas.
  • a bacterium including a bacterium of the genus Actinobacillus, Alcaligenes, Bacteroides, Brevibacteria, Capnocytophaga, Corynebacteria, Erwinia, Escherichia, Haemophilus, Lactobacillus, Lactococcus, Methanococcus, Methanothermobacter, Nocardia
  • the source organism may be of the species Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Alcaligenes faecalis, Bacteroides fragilis, C. glutamicum, Capnocytophaga ochracea, E. carotovora, E. coli, E. chrysanthemi, Haemophilus influenzae, Lactobacillus plantarum, Lactococcus lactis, Lactococcus lactis cremoris MGl 363, Lactococcus lactis NIZO Bl 157, Lactococcus lactis NIZO Bl 157, Lactococcus lactis subsp.
  • Lactis strain Lactococcus lactis subsp. lactis strain IFPL730, Lactococcus lactis subsp. lactis strain IFPL730, Methanococcus jannaschii, Methanothermobacter thermautotrophicus str. Delta H Nocardia sp.
  • JS614 Pseudomonas aeruginosa PAOl, Pseudomonas fluorescens PfO-I, Pseudomonas putida, Pseudomonas putida (ATCC 12633), Pseudomonas sp., Staphylococcus epidermidis RP62A, (Thermo) synechococcus vulcanus, or Zymomonas mobilis subsp. mobilis ZM4 (ATCC 31821).
  • a source organism may be a plant of the genus Arabidopsis, Brassica or Triticum.
  • the source organism may be of the species Arabidopsis thaliana, Brassica napus or Triticum secale.
  • a source organism may be a mammal of the genus Oryctolagus, Rattus, Mus or Homo.
  • the source organism may be of the species Oryctolagus cuniculus, Rattus norvegicus, Mus musculus or Homo sapiens.
  • a source organism may be a protozoa of the genus Trypanosoma.
  • the source organism may be of the species Trypanosoma cruzi.
  • the source organism can be the organism from which any of the polypeptides represented by the Genbank Accession and/or Genbank GI numbers in Figures 2-34 are derived.
  • Succinate dehydrogenase (SDH) polypeptides are polypeptides that participate in the aerobic mitochondrial electron transport chain and tricarboxylic acid (TCA) cycle by oxidizing succinate to fumarate and transferring the electrons to ubiquinone (EC 1.3.5.1). Two electrons from succinate are transferred one at a time through a flavin cofactor and a chain of iron-sulfur clusters to reduce ubiquinone to an ubisemiquinone intermediate and to ubiquinol.
  • TCA tricarboxylic acid
  • a complex of SDH polypeptides is composed of a catalytic heterodimer and a membrane domain, comprising two smaller hydrophobic subunits that anchor the enzyme to the mitochondrial inner membrane.
  • Succinate dehydrogenase (SDH) of Saccharomyces cerevisiae consists of four subunits encoded by the SDHl, SDH2, SDH3, and SDH4 genes.
  • the microorganism has a genetic modification that increases succinate dehydrogenase activity, for example, by increasing the level of succinate dehydrogenase polypeptide overall, increasing the level of succinate dehydrogenase in the relevant cell compartment or increasing the intrinsic activity of succinate dehydrogenase.
  • the genetic modification is the addition of a gene encoding a succinate dehydrogenase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a succinate dehydrogenase polypeptide; the genetic modification increases activity by increasing expression of the succinate dehydrogenase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the succinate dehydrogenase polypeptide is heterologous to the microorganism; the succinate dehydrogenase polypeptide is homologous to the microorganism.
  • the microorganism has a genetic modification that decreases succinate dehydrogenase activity, for example, by decreasing the level of succinate dehydrogenase overall, decreasing the level of succinate dehydrogenase in the relevant cell compartment or decreasing the intrinsic activity of succinate dehydrogenase.
  • the genetic modification decreases expression of a succinate dehydrogenase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification;
  • the genetic modification is a deletion of all or part of a gene encoding a succinate dehydrogenase polypeptide or the disruption of a gene encoding a succinate dehydrogenase polypeptide or one or more point mutations in a gene encoding a succinate dehydrogenase polypeptide;
  • the genetic modification is a nucleotide substitution in one or more nucleotides of a succinate dehydrogenase coding or regulatory sequence that results in decreased succinate dehydrogenase expression or activity;
  • the genetic modification is deletion of all or part of the succinate dehydrogenase coding sequence.
  • the deletion, insertion or point mutation(s) can be in the promoter or the coding sequence.
  • the deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type succinate dehydrogenase polypeptide.
  • the succinate dehydrogenase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 88-91, or the polypeptides represented by the Genbank Accession numbers in Figure 32.
  • Transcription refers to the process of producing an RNA copy from a DNA template.
  • Transformation typically refers to a process of introducing a nucleic acid molecule into a host cell. Transformation typically achieves a genetic modification of the cell.
  • the introduced nucleic acid may integrate into a chromosome of a cell, or may replicate autonomously.
  • a cell that has undergone transformation, or a descendant of such a cell is “transformed” and is a “recombinant” cell. Recombinant cells are modified cells as described herein.
  • the nucleic acid that is introduced into the cell comprises a coding region encoding a desired protein, and the desired protein is produced in the transformed microbial cell and is substantially functional, such a transformed microbial cell is "functionally transformed.”
  • Cells herein may be transformed with, for example, one or more of a vector, a plasmid or a linear piece (eg., a linear piece of DNA created by linearizing a vector) of DNA to become functionally transformed.
  • the plasmid or linear piece of DNA may or may not comprise a selectable or screenable marker.
  • Translation refers to the production of protein from messenger RNA.
  • yield refers to the amount of a desired product (e.g.,
  • OAA and/or one or more C4-dicarboxylic acids produced (molar or weight/volume) divided by the amount of carbon source (e.g., glucose, dextrose) consumed (molar or weight/volume) multiplied by 100.
  • carbon source e.g., glucose, dextrose
  • Unit The term "unit”, when used to refer to an amount of an enzyme, refers to the enzymatic activity and indicates the amount of micromoles of substrate converted per mg of total cell proteins per minute.
  • Vector refers to a DNA or RNA molecule (such as a plasmid, linear piece of DNA, cosmid, bacteriophage, yeast artificial chromosome, or virus, among others) that carries nucleic acid sequences into a host cell.
  • the vector or a portion of it can be inserted into the genome of the host cell.
  • Vitamin H transport (VHT) polypeptides are polypeptides that mediate biotin uptake through a carrier-mediated and energy-requiring mechanism. Many microbes species are biotin auxotrophs; VHT polypeptide activity may be essential for growth in such strains. VHT polypeptides are members of a major facilitator superfamily. In some cases the microorganism has a genetic modification that increases VHT activity, for example, by increasing the level of VHT overall, increasing the level of VHT in the relevant cell compartment or increasing the intrinsic activity of VHT.
  • the genetic modification is the addition of a gene encoding a VHT polypeptide; the genetic modification increases the transcription or translation of a gene encoding a VHT polypeptide; the genetic modification increases expression of a VHT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the VHT polypeptide is heterologous to the microorganism; the VHT polypeptide is homologous to the microorganism.
  • the VHT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO:77 or the polypeptides represented by the Genbank Accession numbers in Figure 13.
  • FIGURE IA depicts a biological pathway for the production of OAA and C4- dicarboxylic acids.
  • FIGURE IB is a table providing information about polypeptides useful in the production OAA and C4-dicarboxylic acids respectively.
  • DNA sequences are not provided for each protein, but any suitable degenerate sequences, including codon optimized sequences, can be used to encode the disclosed polypeptides.
  • FIGURE 1C is a table providing information about organic acid transporter polypeptides useful in the production OAA and C4-dicarboxylic acids respectively.
  • DNA sequences are not provided for each protein, but any suitable degenerate sequences, including codon optimized sequences, can be used to encode the disclosed polypeptides.
  • FIGURES 2-34 are tables disclosing lists of some of the candidate polypeptides that may be applicable to the OAA and C4-dicarboxylic pathways described herein.
  • FIGURES 2-34 are referenced throughout the description.
  • Each reference and information designated by each of the Genbank Accession numbers and/or Genbank GI numbers are hereby incorporated by reference in their entirety.
  • the order of Genbank Accession and/or Genbank GI numbers, genes, polypeptides and sequences presented in Figures 2-34 is not indicative of their relative importance and/or suitability to any of the embodiments disclosed herein.
  • Any of a variety of host cells may be genetically engineered to increase the production of OAA and C4-dicarboxylic acids. It will often be desirable to utilize cells that are amenable to manipulation, particularly genetic manipulation, as well as to growth on large scale and under a variety of conditions. In certain cases, it will be desirable to utilize host cells that are amenable to growth under anaerobic conditions, microaerobic conditions, and/or under conditions of relatively low pH.
  • yeast or fungal host cells Any fungus known in the art for use in industrial processes can be used as a matter of routine experimentation by the skilled artisan having the benefit of the present disclosure.
  • the yeast to be modified e.g., transformed
  • yeast to be modified can be selected from any known genus and species of yeast.
  • Yeasts are described by N. J. W. Kreger-van Rij, "The Yeasts,” Vol. 1 of Biology of Yeasts, Ch. 2, A. H. Rose and J. S. Harrison, Eds. Academic Press, London, 1987.
  • the fungus can be of the genus Aspergillus, Saccharomyces, Yarrowia, or Zygosaccharomyces among others. In some embodiments, the fungus is of the species Aspergillus niger, Aspergillus terreus, S. cerevisiae, Y. lipolytica, or Zygosaccharomyces bailii.
  • bacterial host organisms include Corynebacterium glutamicum and E. coli.
  • Other useful bacteria for example, gram positive, gram negative or archaebacteria, can be used as a host organism, e.g., the genus can be Actinobacillus, Alcaligenes, Bacteroides, Brevibacteria, Capnocytophaga, Corynebacteria, Erwinia, Escherichia, Haemophilus, Lactobacillus, Lactococcus, Methanococcus, Methanothermobacter, Nocardia, Propionibacterium, Pseudomonas , Staphylococcus, (Thermo) synechococcus, or Zymomonas.
  • the host organism may be of the species Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Alcaligenes faecalis, Bacteroides fragilis, C. glutamicum, C. glutamicum (ATCC 13032), Capnocytophaga ochracea, E. carotovora, E. coli, Haemophilus influenzae, Lactobacillus plantarum, Lactococcus lactis NIZO Bl 157, Lactococcus lactis subsp. lactis strain IFPL730, Methanococcus jannaschii, Methanothertnobacter thertnautotrophicus str.
  • the unmodified host cell naturally produces one or more C4-dicarboxylic acids and is modified to increase production and/or accumulation of one or more C4- dicarboxylic acids. In some cases, the unmodified host cell does not naturally produce one or more C4-dicarboxylic acids.
  • any modification may be applied to a cell to increase or impart production and/or accumulation of one or more C4-dicarboxylic acids.
  • the modification comprises a genetic modification.
  • genetic modifications may be introduced into cells by any available means including chemical mutation and/or transfer (e.g., via transformation or mating) of nucleic acids.
  • a nucleic acid to be introduced into a cell according to the present disclosure may be prepared by any available means. For example, it may be extracted from an organism's nucleic acids or synthesized by chemical means. Nucleic acids to be introduced into a cell may be, but need not be, in the context of a vector.
  • Genetic modifications that increase activity of a polypeptide include, but are not limited to: introducing one or more copies of a gene encoding the polypeptide (which may differ from any gene already present in the host cell encoding a polypeptide having the same activity); altering a gene present in the cell to increase transcription or translation of the gene (e.g., altering, adding additional sequence to, deleting sequence from, replacement of one or more nucleotides, or swapping for example, a promoter, regulatory or other sequence); and altering the sequence (e.g.
  • Genetic modifications that decrease activity of a polypeptide include, but are not limited to: deleting all or a portion of a gene encoding the polypeptide; inserting a nucleic acid sequence that disrupts a gene encoding the polypeptide; altering a gene present in the cell to decrease transcription or translation of the gene or stability of the mRNA or polypeptide encoded by the gene (for example, by altering, adding additional sequence to, deleting sequence from, replacement of one or more nucleotides, or swapping for example, a promoter, regulatory or other sequence) and altering the sequence (e.g. coding or non-coding) of a gene encoding the polypeptide to decrease activity (e.g., by decreasing catalytic activity, increasing feedback inhibition, mislocalizing to a non
  • a vector for use in accordance with the present methods can be a plasmid, linear piece of DNA, a cosmid, or a yeast artificial chromosome, among others known in the art to be appropriate for use in microorganisms (e.g. fungi, bacteria).
  • a vector can comprise an origin of replication, which allows the vector to be passed on to progeny cells of a parent cell comprising the vector.
  • the vector can comprise sequences that direct such integration (e.g., specific sequences or regions of homology, etc.).
  • Nucleic acids to be introduced into a cell may be so introduced together with at least one detectable marker (e.g., a screenable or selectable marker).
  • a single nucleic acid molecule to be introduced may include both a sequence of interest (e.g., a gene encoding a polypeptide of interest as described herein) and a detectable marker.
  • a detectable marker allows cells that have received an introduced nucleic acid to be distinguished from those that have not.
  • a selectable marker may allow transformed cells to survive on a medium comprising an antibiotic fatal to untransformed cells, or may allow transformed cells to metabolize a component of the medium into a product not produced by untransformed cells, among other phenotypes.
  • nucleic acids can be introduced into cells by any available means including, for example, chemical-mediated transformation, particle bombardment, electroporation, etc.
  • Nucleic acids to be expressed in a cell are typically in operative association with one or more expression sequences such as, for example, promoters, terminators, and/or other regulatory sequences. Any such regulatory sequences that are active in the host cell (including, for example, homologous or heterologous host sequences, constitutive, inducible, or repressible host sequences, etc.) can be used.
  • a promoter is a DNA sequence that can direct the transcription of a nearby coding region.
  • a promoter can be constitutive, inducible or repressible. Constitutive promoters continually direct the transcription of a nearby coding region.
  • Inducible promoters can be induced by the addition to the medium of an appropriate inducer molecule, which will be determined by the identity of the promoter.
  • Repressible promoters can be repressed by the addition to the medium of an appropriate repressor molecule, which will be determined by the identity of the promoter.
  • Representative useful promoters for fungal expression include, for example, the constitutive promoter S. cerevisiae triosephosphate isomerase (TPI) promoter, the S. cerevisiae glyceraldehyde-3 -phosphate dehydrogenase (isozyme 3) TDH3 promoter, the S. cerevisiae TEFl promoter and the S. cerevisiae ADHl promoter.
  • Representative terminators for use in accordance with the present disclosure include, for example, S. cerevisiae CYCl.
  • Representative promoters for bacterial expression include, for example, the lac, trc, trcRBS, phoA, tac, or XP L AP R promoter from E. coli (or derivatives thereof) or the phoA, gpd, rplM, or rpsJ promoter from a coryneform bacteria.
  • a genetic modification is one that involves disruption of one or more nucleic acid sequences present in a cell. Such disruption may be achieved by any desired means including, for example, chemical disruption and/or integration of disrupting nucleic acid sequences, etc.
  • a genetic modification may comprise introduction of one or more new nucleic acids into a cell.
  • the introduced nucleic acid sequences may be from a heterologous source; in some embodiments, introduced nucleic acid sequences may represent additional or alternative copies of sequences already present in the cell.
  • nucleic acid sequences originating from a source heterologous to the host cell may be modified, for example, to adjust for codon preferences and/or other expression-related aspects (e.g., linkage to promoters and/or other regulatory sequences active in the host cell, etc.) of the host cell system.
  • the microorganism can be cultured in a medium.
  • the medium can be any medium known in the art to be suitable for this purpose. Culturing techniques and media are known in the art. In one embodiment, culturing can be performed by aqueous fermentation in an appropriate vessel. Examples for a typical vessel for fermentation comprise a shake flask or a bioreactor.
  • the medium can comprise a carbon source such as glucose, sucrose, fructose, lactose, galactose, or hydrolysates of vegetable matter, among others.
  • the medium can also comprise a nitrogen source as either an organic or an inorganic molecule.
  • the medium can comprise components such as amino acids; purines; pyrimidines; corn steep liquor; yeast extract; protein hydrolysates; water-soluble vitamins, such as B complex vitamins; inorganic salts such as chlorides, hydrochlorides, phosphates, or sulfates of Ca, Mg, Na, K, Fe, Ni, Co, Cu, Mn, Mo, or Zn, among others.
  • the medium can be buffered but need not be. Considerations for selection of medium components include, but are not limited, to productivity, cost, and impact on the ability to recover one or more C4-dicarboxylic acids.
  • the carbon dioxide source can be gaseous carbon dioxide (which can be introduced to a headspace over the medium or sparged through the medium) or a carbonate salt (for example, calcium carbonate), for example, incorporated into the medium.
  • a carbonate salt for example, calcium carbonate
  • a host cell is modified to increase its production of one or more C4-dicarboxylic acids.
  • the modified cell can be cultured under conditions and for a time sufficient for one or more C4- dicarboxylic acids to accumulate.
  • such modification allows one or more C4- dicarboxylic acids to be produced when it was not produced previously.
  • the modification increases production of one or more C4-dicarboxylic acids in a cell that already produces one or more C4-dicarboxylic acids at some level.
  • a modification or modifications can increase production of one or more C4-dicarboxylic acids at least about 1.1- fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 35 -fold, at least about 50-fold as compared with an otherwise identical host cell lacking the modification(s).
  • the one or more C4-dicarboxylic acids is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, pure or more.
  • any available technique can be utilized to isolate the accumulated one or more C4- dicarboxylic acids.
  • the isolation can comprise purifying the one or more C4- dicarboxylic acids from the medium by known techniques, such as the use of an ion exchange resin, activated carbon, microfiltration, ultrafiltration, nanof ⁇ ltration, liquid-liquid extraction, crystallization, electrodialysis, or chromatography, among others.
  • Saccharomyces cerevisiae has been engineered for increased production of oxaloacetate by overexpression of pyruvate carboxylase (PYC), an approach that has proved useful for generation of strains that produce high levels of malic acid (WO/2009/011974).
  • PYC pyruvate carboxylase
  • the carboxylation reaction catalyzed by pyruvate carboxylase consumes ATP so that the production of oxaloacetate from glucose yields no ATP by substrate level phosphorylation.
  • pyruvate decarboxylase and pyruvate dehydrogenase also use pyruvate as a substrate, and the reactions catalyzed by these two enzymes are much more thermodynamically favorable than that catalyzed by pyruvate carboxylase.
  • PPCK phosphoenolpyruvate carboxykinase
  • PPC phosphoenolpyruvate carboxylase
  • PEPCK phosphoenolpyruvate carboxykinase
  • Example 1 Initial selection for anaplerosis via PEPCK
  • CEN.JB27 (Bauer et al. (1999) FEMS Microbiol Lett. 179:107-13) as follows.
  • CEN.JB27 (Table 1) was grown on 5-FOA agar plates, prepared with synthetic medium (SM: demineralized water, 3 g/1 KH 2 PCK 0.5 g/lMgSC>4 * 7 H2O, 6.6 g/1 K 2 SO 4 , vitamins and trace elements (Verduyn et al.
  • IMY002 was constructed by transformation of IMKl 57 with the plasmid MB4917 (WO/2009/011974) which harbored the PEPCK gene from A. succinogenes on a CEN plasmid under the strong TDH3 promoter. IMY002 was tested for growth on glucose in SM supplemented with 20 g/1 glucose, with ammonium sulfate (1 g/1) as the nitrogen source. No growth was observed under atmospheres of air, 20% CO 2 or 100% CO 2 .
  • IMY002 was grown in a pH-controlled nitrogen-limited chemostat in continuous cultivation medium with aspartate at a dilution rate of 0.1 /h. Pre-cultures for continuous fermentations were grown overnight in shake flasks in SM ASP. Chemostat fermentations were performed anaerobically at 30 0 C in 2 1 fermentors (Applikon, Schiedam, the Netherlands) with a working volume of 1 1. The pH was controlled at 5.0 by automated addition of 2 M KOH, while medium addition was controlled by a peristaltic pump.
  • the culture volume was kept constant using an electrical level sensor.
  • Medium for continuous cultivation consisted of demineralized water with 3 g/1 KH 2 PO 4 , 6.6 g/1 K 2 SO 4 , 0.5 g/1 MgSO 4 * 7 H 2 O, 0.15 ml/1 silicon antifoam (BDH, Poole, UK) and 1 ml/1 trace element solution according to Verduyn et al. supra.
  • Ammonia as the nitrogen source 1 g/1 (NH 4 ) 2 SO 4 was added. After heat sterilization for 20 min at 120 0 C, solutions of vitamins (filter-sterilized, according to Verduyn et al.
  • IMY050 and IMY051 were grown on non-selective YPD medium to stimulate plasmid loss. After several serial transfers, culture broth was plated on YPD. Single colonies were then transferred to agar plates made with SM ASP (without uracil) or YPD to check for uracil auxotrophy. Colonies which only grew on the YPD plate were restreaked to confirm the phenotype and subsequently stored as IMWOOl and IMW002.
  • plasmids from IMY050 and IMY051 were isolated with a Zymoprep II Yeast Plasmid Miniprep Kit (Zymo Research Corp., Orange CA), transformed to competent Escherichia coli TOPlO cells (Invitrogen, Carlsbad, CA) and isolated with a GenElute Plasmid Miniprep Kit (Sigma Aldrich, St. Louis, MO).
  • IMY002, IMWOOl and IMW002 were then transformed with MB4917, MB4917*1 (IMWOOl only), MB4917*2 (IMW002 only) and pUDC 1 , an empty vector obtained by introducing an additional Xbal site after the stop codon of the PEPCK gene in MB4917 by PCR using primers MB4917 EV Forward and MB4917 EV Reverse (Table 2), followed by Xbal digestion and self ligation of the gel isolated vector fragment. The resulting set of strains was tested for growth under 100% CO 2 atmosphere on SM ammonia or SM ASP.
  • Example 2 Further selection for anaplerosis via PEPCK and characterization of strains. Based on the success of this preliminary work in selecting for anaplerotic PEPCK activity, we sought mutants with the ability to produce malic acid.
  • the strain MY2888 (MTH1 ⁇ T, Ieu2, ura3, trpl, pycl::LEU2, pyc2::HIS3, canl::TDH3p-Spmael::TRPl::TDH3p-MDH3delSKL, pdc5::loxP; described in WO/2009/011974) has been developed as an optimized host for production of malic acid, when pyruvate carboxylase activity is reintroduced.
  • MY2888 was transformed to prototrophy with MB4914, MB4917 or MB4922, encoding respectively, the PEPCK from Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, and Erwinia carotovora to yield the strains MY3272, MY3273, and MY3274, described in WO/2009/011974. As with IMY002, these strains are incapable of growth on minimal medium with ammonium sulfate in air or 20% CO 2 .
  • the strains were first grown overnight in YNB ASP (1.7 g/1 yeast nitrogen base, Difco, 20 g/1 glucose, 5.3 g/1 aspartate adjusted to pH 6.0 with KOH). The strains were then plated (6 x 10 6 cfu/plate) on YNB ammonia (20 g/1 glucose, 5 g/1 NH 4 SO 4 ) and exposed to 1 J/m 2 ultraviolet light (U/V) in a GS Gene Linker (Biorad, Hercules, CA) to induce mutation. Plates were transferred in the dark to an incubation chamber with 20% CO 2 and incubated 5-7 days.
  • YNB ASP 1.7 g/1 yeast nitrogen base, Difco, 20 g/1 glucose, 5.3 g/1 aspartate adjusted to pH 6.0 with KOH.
  • the strains were then plated (6 x 10 6 cfu/plate) on YNB ammonia (20 g/1 glucose, 5 g/1 NH 4 SO 4 ) and exposed to 1 J/m 2 ultraviolet light (
  • Strains selected by the above method were fermented to produce malic acid as follows. To adapt cells prior to malate producing shake flask fermentations, strains were passaged at least twice on YNB ammonia agar in 20% CO 2 in air. Adapted cells were used to inoculate seed fermentations in 10 ml SM-M media (as SM media except without K 2 SO 4 and having 3.0 g/1 MgSO 4 *7H 2 O) supplemented with 1 g/1 urea, 10 g/1 glucose. Liquid cultivations in 20% CO 2 were grown in 125 ml baffled flasks with shaking at 150 rpm on a Labotron shaker (Infors, Bottmingen, Switzerland).
  • Example 3 Pyruvate kinase activity assays
  • PYK pyruvate kinase
  • PYK activity was assayed in 0.1 M cacodylic acid (pH 6.2), 0.1 M KCl, 10 mM ADP, 1 mM fructose- 1 ,6-bisphosphate, 25 mM MgCl 2 , 0.15 mM NADH, 10 U/ml lactate dehydrogenase.
  • the reaction was started by the addition of 2 rnM phosphoenolpyruvate and followed by the change in absorbance at 340 nm. Enzyme measurements showed a 5 -fold decrease in PYK activity after selection, from 10 to 2 ⁇ mol/min/mg protein.
  • ⁇ pck gene encoded by plasmid in each strain As, Actinobacillus succinogenes pck; Ap, Actinobacillus pleuropneumoniae pck; Ec, Erwinia carotovora pck b Strains fermented on SM-M with 1 g/1 urea, 100 g/1 dextrose, 5 g/1 CaCO 3 in 20% CO 2 c not determined
  • Example 5 Mutation to PYKl is sufficient to enable anaplerosis via PEPCK
  • a strain was constructed as follows. PYKl was deleted from a malate producing strain (MY2928) that harbored an episomal construct encoding the pyruvate carboxylase from Yarrowia lipolytica (MB5094) by transformation with a PCR product amplified from the Saccharomyces cerevisiae heterozygous deletion diploid collection (ATCC, Cat #GSA-6, Manassas, VA).
  • the PCR product obtained using oligos MO6194 and MO6196, consisted of the kanMX ORF, conferring G418 resistance, flanked by -300 bp of sequence 5' and 3' of the pyklr.kanMX cassette. G418 resistant colonies were selected and streaked to YNB agar supplemented with 5-FOA (1 mg/ml), ethanol (10 g/1), glycerol (10 g/1), aspartate (5.3 g/1), uracil (50 mg/1) and casamino acids (2 g/1) to yield pykl ::kanMXPyc- strains lacking episomal Y. lipolytica PYC. These strains were incapable of growth on glucose.
  • the pykl:: kanMX Py c- strain is transformed with a PCR product from the MY3898 pykl locus, which contains a C -> T substitution at nucleotide 1211 of the PYKl sequence, resulting in the mutation S404F, obtained using oligos MO6354 and MO6197. Transformants are selected for the ability to grow on glucose by plating to YPD, and the presence of the mutation is confirmed by sequencing as described above.
  • This strain is transformed to prototrophy with the episome MB4917, encoding /?c£ from Actinobacillus succinogenes. Growth of this strain on YNB ammonia medium in 20% CO 2 atmosphere demonstrates the pykl mutation is sufficient to enable PEPCK anaplerotic activity.
  • Example 6 Anaplerosis via phosphoenolpyruvate carboxykinase (PEPCK) from Capnocytophaga ochracea and Bactericides fragilis
  • PEPCK phosphoenolpyruvate carboxykinase
  • MY3825 was cured of plasmid on YNB ASP with 5-FOA (1 mg/ml) and transformed to prototrophy with MB5534 and MB5535, yielding MY4114 and MY4115. Both were capable of growth on YNB ammonia in 20% CO 2 , and when fermented as in Example 3, produced 6 and 4.5 g/1 malate respectively.
  • Example 7 Anaplerosis via a heterologous PPC
  • the plasmid MB5060 encoding the Corynebacterium glutamicum ppc was constructed as follows. DNA was amplified with primers CgPPC-fr and CgPPC-rv using proofreading polymerase Pfu under reaction conditions specified by the manufacturer (Stratagene, La Jolla, CA) and C. glutamicum genomic DNA as a template. The fragment obtained was digested with Accl and Dral, and end-filled with Klenow before being gel purified and ligated into pDB20 (Becker, et al, PNAS, 1991. 88: 1968-1972.) which had been digested with Notl, end-filled with Klenow and gel purified.
  • pDB20 Becker, et al, PNAS, 1991. 88: 1968-1972.
  • Example 8 Anaplerosis via a heterologous PPC in pykl mutant strains In order to increase yield of malate via phosphoenolpyruvate carboxylase catalyzed anaplerosis, C glutamicum ppc was overexpressed in strains with mutations in the pykl gene described above.
  • Strains MY4246, MY4247, and MY4248 were constructed from MY3683, MY3826 and MY3827, respectively. First, these strains were cured of their episome by streaking to YNB ASP agar plates supplemented with 1 g/1 5-FOA to yield Ura " strains without an episome. Strains were transformed to prototrophy with MB5060 to yield MY4246, MY4247 and MY4248. When fermented in SM-M with 10% glucose and 5% CaCO 3 , these strains produced 45, 60, and 40 g/1 malic acid.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Methods and recombinant microorganisms for the biological production of C4-dicarboxylic acids are described. The recombinant microorganisms have increased production of OAA as compared to unmodified microorganisms. In some cases, the recombinant microorganisms have been modified to reduce production of pyruvate and/or reduce conversion of pyruvate to acetaldehyde. Thus, the microorganisms are modified to reduce the activity of pyruvate kinase and/or pyruvate decarboxylase.

Description

METHODS AND MICROORGANISMS FOR PRODUCTION OF C4-DICARBOXYLIC ACIDS
Background
[001] Oxaloacetate (OAA) is an important precursor to many commercially valuable compounds produced by microorganisms, including 3-hydroxypropionic acid (3 -HPA) and C4- dicarboxylic acids such as malic acid, fumaric acid, and succinic acid. C4-dicarboxylic acids are organic compounds that include two carboxylic acid groups. Such compounds find utility in a variety of commercial settings including, for example, in areas relating to food additives, polymer plasticizers, solvents, lubricants, engineered plastics, epoxy curing agents, adhesive and powder coatings, corrosion inhibitors, cosmetics, pharmaceuticals, electrolytes, etc. [002] Carboxylic acid groups, including those in C4-dicarboxylic acids, are readily convertible into their ester forms. Such carboxylic acid esters are commonly employed in a variety of settings. For example, lower chain esters are often used as flavouring base materials, plasticizers, solvent carriers and/or coupling agents. Higher chain compounds are commonly used as components in metalworking fluids, surfactants, lubricants, detergents, oiling agents, emulsifiers, wetting agents textile treatments and emollients.
[003] Carboxylic acid esters are also used as intermediates for the manufacture of a variety of target compounds. A wide range of physical properties (e.g., viscosities, specific gravities, vapor pressures, boiling points, etc.) can be achieved with different esters of the same carboxylic acid. In addition, reduction of C4-dicarboxylic acids provides diols which are intermediates for further synthesis including polymerizations. It is therefore desirable to develop production systems for C4-dicarboxylic acid compounds and/or their esters and/or anhydrides.
[004] C4-dicarboxylic acids can be produced either by chemical synthesis or by fermentation. Currently, commercial scale production is typically performed by chemical synthesis or by extraction from biological sources (e.g. grape skins). Among other things, such chemical synthesis processes can generate large amounts of harmful wastes. There remains a need for the development of improved systems for producing C4-dicarboxylic acids. There is a particular need for the development of biological systems for achieving such production. In some cases, a biological system allowing production at low pH is desirable. Tight metabolic regulation of carbon can make it difficult to generate microorganisms that produce a high level of oxaloacetate suitable for commercial scale production of C4-dicarboxylic acids.
Summary
[005] Methods and recombinant microorganisms for the biological production of C4- dicarboxylic acids are described herein (see Figure IA for a biological pathway for the production of OAA and C4-dicarboxylic acids as described herein). The modified microorganisms have increased production of OAA as compared to unmodified microorganisms. In some cases, the recombinant microorganisms have been modified to reduce production of pyruvate and/or reduce conversion of pyruvate to acetaldehyde. Thus, the microorganisms are modified to reduce the activity of pyruvate kinase and/or pyruvate decarboxylase. The recombinant organisms can also be modified to increase the level of phosphenolpyruvate carboxykinase expression and/or activity. Because phosphenolpyruvate carboxykinase utilizes CO2, a potentially abundant substrate, to generate oxaloacetate from phospoenolpyruvate, and because this reaction generates ATP, oxaloacetate production can be quite efficient, particularly when the microorganism is grown anaerobically at relatively low pH. In addition, or alternatively, organisms can be modified to increase the level of phosphoenolpyruvate carboxylase activity. In some cases, the unmodified microorganism does not naturally express a phosphoenolpyruvate carboxylase activity. In some cases, the microorganism expresses a heterologous phosphoenolpyruvate carboxylase activity. Both phosphoenolpyruvate carboxylase and phosphenolpyruvate carboxykinase use a phosphoenolpyruvate-intermediate to produce OAA. Thus, these phosphoenolpyruvate-intermediate OAA production routes bypass pyruvate and thereby avoid competition with other high activity enzymes for which pyruvate is a substrate. In some cases the activity of one or more of: phospoenolpyruvate carboxykinase, phosphoenolpyruvate carboxylase, pyruvate carboxylase, pyruvate decarboxylase, malate dehydrogenase, MTHl and certain other polypeptides is increased or decreased. In some cases, the increase or decrease in activity may arise from altered polypeptide expression or altered polypeptide activity.
[006] In order to increase OAA production the microorganism can have a modification to increase anaplerotic activity. For example, the microorganism may comprise at least one genetic modification selected from the group consisting of a genetic modification that: (a) increases or decreases pyruvate carboxylase activity; (b) increases or decreases phosphoenolpyruvate carboxylase activity; (c) increases or decreases phosphoenolpyruvate carboxykinase activity; (d) decreases pyruvate kinase activity; (e) increases malate dehydrogenase activity; (f) decreases pyruvate decarboxylase (e.g. is "PDC-reduced") activity; and (g) increases MTHl activity. The microorganism may also have a genetic modification that increases or decreases organic acid transporter polypeptide activity.
[007] In some cases, the microorganism may also have at least one modification selected from the group consisting of a modification that: (a) increases biotin protein ligase activity; (b) increases vitamin H transport protein activity; (c) increases or decreases bicarbonate transport activity; (d) increases or decreases hexose transporter activity; (e) increases glucose sensing and regulatory polypeptide activity; (f) increases carbonic anhydrase activity; (g) increases or decreases ATP-citrate lyase activity; (h) increases or decreases fumarase activity; (i) increases or decreases fumarate reductase activity; (j) increases or decreases isocitrate lyase activity; (k) increases or decreases malate synthase activity; (1) increases or decreases malic enzyme activity; (m) increases or decreases succinate dehydrogenase activity; and (n) decreases citrate synthase activity.
[008] It should be noted that fungal generally do not naturally express phosphoenolpyruvate carboxylase (PPC). Thus, fungal cells which express a new pathway for production of OAA are created. Although fungal cells commonly express phosphoenolpyruvate carboxykinase (PEPCK), it generally acts to convert OAA to phosphoenolpyruvate (PEP). In certain of the recombinant fungal cells described herein PEPCK acts to convert PEP to OAA. [009] Described herein is a recombinant microbial cell comprising at least one (e.g., at least 2, 3, 4, 5, 6 or 7) genetic modification selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity; (f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
[010] The genetic modification that increases activity can do so by increasing expression of the enzyme or by increasing the inherent activity of the enzyme or both. The genetic modification that decreases activity can do so by decreasing expression of the enzyme or by decreasing inherent activity of the enzyme or both.
[Oil] In some cases: the cell comprises a genetic modification that increases pyruvate carboxylase activity and a genetic modification that decreases PDC activity; the cell comprises a genetic modification that decreases PYK activity and a genetic modification that increases phosphoenolpyruvate carboxylase activity; the cell comprises a genetic modification that decreases pyruvate kinase activity and a genetic modification that increases phosphoenolpyruvate carboxykinase activity; the cell further comprises a genetic modification that increases phosphoenolpyruvate carboxylase activity; the cell further comprises a genetic modification that decreases pyruvate carboxylase activity; the cell further comprises a genetic modification that increases pyruvate carboxylase activity; the cell further comprises a genetic modification that decreases PDC activity; the recombinant microbial cell comprises a genetic modification that increases MTHl activity; the recombinant microbial cell comprises a genetic modification that increases malate dehydrogenase activity; the recombinant microbial cell comprises a genetic modification that increases organic acid transporter polypeptide activity. [012] In various cases: the pyruvate carboxylase is at least 80% identical to any of SEQ ID NOs: 1-8 or a polypeptide represented by a Genbank Accession number in Figure 2; the phosphoenolpyruvate carboxylase is at least 80% identical to any of SEQ ID NOs: 9-16 or a polypeptide represented by a Genbank Accession number in Figure 3; the phosphoenolpyruvate carboxykinase is at least 80% identical to any of SEQ ID NOs: 17-22 or a polypeptide represented by a Genbank Accession number in Figure 4; the pyruvate kinase is at least 80% identical to any of SEQ ID NOs: 23-40 or a polypeptide represented by a Genbank Accession number in Figure 5; the genetic modification that decreases PDC activity is decreased activity of at least one polypeptide that is at least 80% identical to any of SEQ ID NOs: 41-44 or a polypeptide represented by a Genbank Accession number in Figure 7; the genetic modification that increases MTHl activity is increased activity or expression of an MTHl or MTH 1ΔT polypeptide that is either a) at least 80% identical to either of SEQ ID NOs: 45-46 or a polypeptide represented by a Genbank Accession number in Figure 8; or b) at least 90, 95, 100% identical to SEQ ID NO: 46 (S. cerevisiae MTH 1ΔT); the malate dehydrogenase is either: at least 80% identical to any of SEQ ID NOs: 47-52, or 78 or a polypeptide represented by a Genbank Accession number in Figure 6; or at least 90, 95, 100% identical to SEQ ID NO: 78 (MDH3ΔSKL); the organic acid transporter polypeptide is at least 80% identical to any of SEQ ID NOs: 92-105, 109 and 110 or a polypeptide represented by a Genbank Accession number in Figure 25; the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 101 (S. pombe MAEl); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 105 (A. oryzae OAT); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 104 (A.flavus OAT); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 109 (Figure Ic); the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 110. (Figure Ic) [013] In certain cases: the cell is a fungus; the fungus is from a genus selected from Aspergillus, Saccharomyces, Yarrowia, and Zygosaccharomyces; the fungus is of the species Aspergillus niger; the fungus is of the species Aspergillus terreus; the fungus is of the species Yarrowia lipolytica; the fungus is of the species Zygosaccharomyces bailii; the fungus is of the species Saccharomyces cerevisiae; and the Saccharomyces cerevisiae is TAM, Lp4f, m850, RWB837, MY2928, MY3825, MY3826 or derivatives thereof.
[014] Also disclosed is a method of producing a C4-dicarboxylic acid comprising: cultivating a recombinant microbial cell described herein under conditions that achieve C4-dicarboxylic acid production. In various cases: the method includes a step of isolating the C4-dicarboxylic acid; the C4-dicarboxylic acid is malic acid; the C4-dicarboxylic acid is fumaric acid; the C4- dicarboxylic acid is succinic acid. Also described is a method of preparing a C4-dicarboxylic acid derivative, the method comprising steps of: cultivating a recombinant microbial described herein under conditions that allow production of a C4-dicarboxylic acid; and converting the C4- dicarboxylic acid into a C4-dicarboxylic acid derivative.
[015] In various cases the method further comprises the step of isolating a C4-dicarboxylic acid or the C4-dicarboxylic acid derivative. In certain cases: the C4-dicarboxylic acid is chosen from one or more of malic acid, fumaric acid and succinic acid; the C4-dicarboxylic acid is malic acid; the C4-dicarboxylic acid is fumaric acid; the said C4-dicarboxylic acid is succinic acid; the C4- dicarboxylic acid derivative is chosen from one or more of: tetrahydrofuran (THF), butane diol (e.g. 1 ,4-butanediol), γ-butyrolactone, pyrrolidinones (e.g. N-methyl-2-Pyrrolidone), adipic acid, esters, linear aliphatic esters, diamines, 4,4-Bionelle, hydroxybutyric acid, dibasic ester (DBE), succindiamide, 1 ,4-diaminobutane, maleic anhydride, succinonitrile, a hydroxybutyrolactone derivative, a hydroxysuccinate derivative and an unsaturated succinate derivative; the C4- dicarboxylic acid derivative is 1 ,4-butanediol; the C4-dicarboxylic acid derivative is THF; the C4-dicarboxylic acid derivative is a polymer; the C4-dicarboxylic acid derivative is N-methyl-2- pyrrolidone; the C4-dicarboxylic acid derivative is γ-butyrolactone; the C4-dicarboxylic acid derivative is adipic acid; the C4 -dicarboxylic acid derivative is a linear aliphatic ester; the C4- dicarboxylic acid derivative is a hydroxysuccinate derivative; the C4-dicarboxylic acid derivative is a hydroxybutyrolactone derivative; the C4-dicarboxylic acid derivative is a maleic anhydride; the converting comprises one or more of physical treatments, fermentation, biocatalysis, and chemical transformation; the converting comprises one or more physical treatments; the converting comprises fermentation; the converting comprises one or more chemical transformations; the converting comprises one or more biocatalyses.
[016] Also described is an isolated nucleic acid which encodes a pyruvate kinase polypeptide whose amino acid sequence comprises a nucleotide sequence having at least 80% (85%, 90%, 95%, 98%) overall sequence identity to n nucleotide sequence selected from SEQ ID NOs: 25- 40. In some cases: the nucleotide sequence of the nucleic acid comprises the nucleotide sequence selected from SEQ ID NOs: 25-40.
[017] Nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form of DNA, including, for example, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. The nucleic acids may be in the form of RNA/DNA hybrids. Single-stranded DNA or RNA can be the coding strand, also referred to as the sense strand, or the non-coding strand, also known as the anti-sense strand. The nucleic acid molecule can be inserted in a vector capable of expression, e.g., an expression vector. The vector nucleic acid may be a bacteriophage DNA such as bacteriophage lambda or M 13 and derivatives thereof. The vector may be either RNA or DNA, single- or double- stranded, either prokaryotic, eukaryotic, or viral. Vectors can include transposons, viral vectors, episomes, (e.g. plasmids), chromosomes inserts, and artificial chromosomes (e.g. BACs or YACs). Construction of a vector containing a nucleic acid described herein can be followed by transformation of a host cell such as a bacterium. Suitable bacterial hosts include, but are not limited to, E. coli. Suitable eukaryotic hosts include yeast such as S. cerevisiae, other fungi, vertebrate cells, invertebrate cells (e.g., insect cells), plant cells, human cells, human tissue cells, and whole eukaryotic organisms (e.g., a transgenic plant or a transgenic animal). Further, the vector nucleic acid can be used to generate a virus such as vaccinia or baculo virus. The nucleic acid can be designed for polypeptide expression. Generally, the genetic construct also includes, in addition to the encoding nucleic acid molecule, elements that allow expression, such as a promoter and regulatory sequences. The expression vectors may contain transcriptional control sequences that control transcriptional initiation, such as promoter, enhancer, operator, and repressor sequences. A variety of transcriptional control sequences are well known to those in the art and may be functional in, for example, a bacterium, yeast, plant, or animal cell. The expression vector can also include a translation regulatory sequence (e.g., an untranslated 5' sequence, an untranslated 3' sequence, a poly A addition site, or an internal ribosome entry site), a splicing sequence or splicing regulatory sequence, and a transcription termination sequence. The vector can be capable of autonomous replication or it can integrate into host DNA.
Increasing production of OAA [018] Pyruvate Kinase (PYK)
In some cases the microorganism has a genetic modification that decreases pyruvate kinase (PYK) activity, for example, by decreasing the level of PYK overall, decreasing the level of PYK in the relevant cell compartment or decreasing the intrinsic activity of PYK. For example: the genetic modification decreases expression of a PYK polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a PYK polypeptide or the disruption of a gene encoding a PYK polypeptide or one or more point mutations in a gene encoding a PYK polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a PYK coding or regulatory sequence that results in decreased PYK expression or activity; the genetic modification is deletion of all or part of the PYK coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PYK polypeptide. Decreasing PYK activity may increase phosphoenolpyruvate substrate for phosphoenolpyruvate carboxykinase (PEPCK) and/or phosphoenolpyruvate carboxylase (PPC), thereby increasing one or both of PEPCK and PPC activities. In some cases, when the host organism is S. cerevisiae a PYK with decreased activity has an amino acid sequence that is at least about 95%, 96%, 97%, 98%, 99% or 100% identical to that of any of SEQ ID NOs: 25-40. When the host is other than S. cerevisiae, the host organism's PYK may have an amino acid change that corresponds to the amino acid change found in any of SEQ ID NOs: 25-40 as compared to the wild-type 5. cerevisiae PYK (SEQ ID NO: 23). A corresponding amino acid change is an amino acid change at a position in the non-5*, cerevisiae polypeptide that is aligned with the altered S. cerevisiae amino acid when the S. cerevisiae polypeptide and the non-5*, cerevisiae polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods. The amino acid change in the non-5*, cerevisiae PYK enzyme need not be identical to the change in S. cerevisiae PYK. For example, if the amino acid change in the S. cerevisiae PYK changes a basic amino acid to a neutral amino acid, e.g., Ala, the change in the non-5*, cerevisiae host PYK can change a basic amino acid to a different neutral amino acid, e.g., GIy. In some cases, the PYK polypeptide represented by any of SEQ ID NOs: 25-40 exhibits reduced allosteric activation by fructose 1,6- bisphosphate as compared to the corresponding wild-type polypeptide (SEQ ID NO: 23). In some cases the PYK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 23-40 or the polypeptides represented by the Genbank Accession numbers in Figure 5. [019] Pyruvate Carboxylase (PYC) Activity
In some cases the microorganism has a genetic modification that increases pyruvate carboxylase (PYC) activity, for example, by increasing the level of PYC polypeptide overall, increasing the level of PYC in the relevant cell compartment or increasing the intrinsic activity of PYC. For example, the genetic modification is the addition of a gene encoding a PYC polypeptide; the genetic modification increases the transcription or translation of a gene encoding a PYC polypeptide; the genetic modification increases activity by increasing expression of the PYC polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the PYC polypeptide is active in the cytosol; the PYC polypeptide is heterologous to the microorganism; the PYC polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases PYC activity, for example, by decreasing the level of PYC overall, decreasing the level of PYC in the relevant cell compartment or decreasing the intrinsic activity of PYC. For example: the genetic modification decreases expression of a PYC polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a PYC polypeptide or the disruption of a gene encoding a PYC polypeptide or one or more point mutations in a gene encoding a PYC polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a PYC coding or regulatory sequence that results in decreased PYC expression or activity; the genetic modification is deletion of all or part of the PYC coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PYC polypeptide. In some cases the PYC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 1-8 or the PYC polypeptides represented by the Genbank Accession numbers in Figure 2.
[020] Phosphoenolpyruvate carboxylase (PPC)
In some cases the microorganism has a genetic modification that increases the activity of a phosphoenolpyruvate carboxylase (PPC) polypeptide, for example, by increasing the level of PPC overall, increasing the level of PPC in the relevant cell compartment or increasing the intrinsic activity of PPC. For example: the genetic modification increases activity of PPC by increasing its expression; the genetic modification is the addition of a gene encoding a PPC polypeptide; the genetic modification increases the transcription of a gene encoding a PPC polypeptide or increases translation of a gene encoding a PPC polypeptide; the microorganism contains a modification to decrease sensitivity of the PPC polypeptide to inhibition by one more of malate, aspartate, and oxaloacetate; the PPC polypeptide is heterologous to the microorganism; the PPC polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases PPC activity, for example, by decreasing the level of PPC overall, decreasing the level of PPC in the relevant cell compartment or decreasing the intrinsic activity of PPC. For example: the genetic modification decreases expression of a PPC polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a PPC polypeptide or the disruption of a gene encoding a PPC polypeptide or one or more point mutations in a gene encoding a PPC polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a PPC coding or regulatory sequence that results in decreased PPC expression or activity; the genetic modification is deletion of all or part of the PPC coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PPC polypeptide. The PPC may have an amino acid change that corresponds to the amino acid change found in SEQ ID NOs: 11 or 12 as compared to the wild-type C. glutamicum PPC (SEQ ID NO: 10). A corresponding amino acid change is an amino acid change at a position in the non-C. glutamicum polypeptide that is aligned with the altered C. glutamicum amino acid when the C. glutamicum polypeptide and the non-C. glutamicum polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods. The amino acid change in the non-C. glutamicum PPC enzyme need not be identical to the change in C. glutamicum PPC. For example, if the amino acid change in the C. glutamicum PPC changes a basic amino acid to a neutral amino acid, e.g., Ala, the change in the non-C. glutamicum PPC can change a basic amino acid to a different neutral amino acid, e.g., GIy. The PPC may have an amino acid change that corresponds to the amino acid change found in SEQ ID NO: 15 or 16 as compared to the wild-type E. coli PPC (SEQ ID NO: 14). A corresponding amino acid change is an amino acid change at a position in the non-E. coli polypeptide that is aligned with the altered E. coli amino acid when the E. coli polypeptide and the non-E. coli polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods. The amino acid change in the non- E. coli PPC enzyme need not be identical to the change in E. coli PPC. For example, if the amino acid change in the E. coli PPC changes a basic amino acid to a neutral amino acid, e.g., Ala, the change in the non-E coli PPC can change a basic amino acid to a different neutral amino acid, e.g., GIy. In some cases the PPC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SΕQ ID NOs: 9-16 or the polypeptides represented by the Genbank Accession numbers in Figure 3. [021] Phosphoenolpyruvate carboxykinase (PΕPCK)
In some cases the microorganism has a genetic modification that increases the activity of a phosphoenolpyruvate carboxykinase (PΕPCK) polypeptide, for example, by increasing the level of PEPCK overall, increasing the level of PEPCK in the relevant cell compartment or increasing the intrinsic activity of PEPCK. For example: the genetic modification increases activity of PEPCK by increasing its expression; the genetic modification is the addition of a gene encoding a PEPCK polypeptide; the genetic modification increases the transcription of a gene encoding a PEPCK polypeptide or increases translation of a gene encoding a PEPCK polypeptide; the PEPCK polypeptide is heterologous to the microorganism; the PEPCK polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases PEPCK activity, for example, by decreasing the level of PEPCK overall, decreasing the level of PEPCK in the relevant cell compartment or decreasing the intrinsic activity of PEPCK. For example: the genetic modification decreases expression of a PEPCK polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a PEPCK polypeptide or the disruption of a gene encoding a PEPCK polypeptide or one or more point mutations in a gene encoding a PEPCK polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a PEPCK coding or regulatory sequence that results in decreased PEPCK expression or activity; the genetic modification is deletion of all or part of the PEPCK coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PEPCK polypeptide. In some cases the PEPCK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 17-22 or the polypeptides represented by the Genbank Accession numbers in Figure 4. [022] Malate dehydrogenase (MDH)
In some cases the microorganism has a genetic modification that increases the activity of a malate dehydrogenase (MDH) polypeptide, for example, by increasing the level of MDH overall, increasing the level of MDH in the relevant cell compartment or increasing the intrinsic activity of MDH, or reducing allosteric inhibition by one or more allosteric inhibitors. For example: the genetic modification increases activity of MDH by increasing its expression; the genetic modification is the addition of a gene encoding a MDH polypeptide; the genetic modification increases the transcription of a gene encoding a MDH polypeptide or increases translation of a gene encoding a MDH polypeptide; the MDH polypeptide is heterologous to the microorganism; the MDH polypeptide is homologous to the microorganism. In some cases the MDH polypeptide contains a signaling sequence or sequences capable of targeting the MDH polypeptide to the cytosol, or the MDH polypeptide lacks a signaling sequence or sequences capable of targeting the MDH polypeptide to an intracellular region other than the cytosol. In some cases, the MDH polypeptide is S. cerevisiae MDH3ΔSKL (SEQ ID NO: 78), in which the coding region encoding the MDH has been altered to delete the carboxy-terminal SKL residues of wild type S. cerevisiae MDH3 (SEQ ID NO: 51), which normally target MDH3 to the peroxisome. In some cases the MDH polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 47-52 or 78 or the polypeptides represented by the Genbank Accession numbers in Figure 6. [023] Pyruvate Decarboxylase (PDC)
In some cases the microorganism has a genetic modification that decreases pyruvate decarboxylase (PDC) activity, for example, by decreasing the level of PDC overall, decreasing the level of PDC in the relevant cell compartment or decreasing the intrinsic activity of PDC. For example: the genetic modification decreases expression of a PDC polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a PDC polypeptide or the disruption of a gene encoding a PDC polypeptide or one or more point mutations in a gene encoding a PDC polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a PDC coding or regulatory sequence that results in decreased PDC expression or activity; the genetic modification is deletion of all or part of a PDC coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type PDC polypeptide. For example: the genetic modification comprises at least one modification selected from the group consisting of a modification to decrease one or more of PDCl, PDC2, PDC5, or PDC6 activities; the modification comprises modifications to decrease each of PDCl, PDC5, and PDC6 activities; the modification comprises modifications to decrease each of PDCl and PDC5 activities; the modification comprises modifications to decrease each of PDCl and PDC6 activities; the modification comprises modifications to decrease each of PDC5 and PDC6 activities; the modification is a modification to decrease PDCl activity; the modification is a modification to decrease PDC5 activity; the modification is a modification to decrease PDC6 activity; the modification is a modification to decrease PDC2 activity; the modification comprises a modification to decrease PDC2 activity and one or more of PDCl, PDC5 and/or PDC6 activities; the modification comprises a modification to decrease PDCl activity and one or more of PDC2, PDC5 and/or PDC6 activities; the modification comprises a modification to decrease PDC5 activity and one or more of PDCl, PDC2 and/or PDC6 activities; the modification comprises a modification to decrease PDC6 activity and one or more of PDCl, PDC2 and/or PDC5 activities. In some cases the PDCl, PDC2, PDC5, or PDC6 polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 41-44 or the polypeptides represented by the Genbank Accession numbers in Figure 7. [024] MTHl
In some cases the microorganism has a genetic modification that alters the activity of a MTHl polypeptide. In some cases MTHl activity is increased by increasing the expression of MTHl or reducing the degradation of MTHl (e.g., reducing the glucose induced degradation of MTHl). In some cases it might be possible to increase the inherent activity of MTHl by, for example, increasing its binding affinity for a polypeptide with which it normally interacts. In some cases it is useful to express MTH1ΔT, a deletion mutant of MTHl that is less subject to glucose induced degradation. Thus, in various cases: the genetic modification increases MTHl or MTH 1ΔT expression; the genetic modification is the addition of a gene encoding a MTHl or MTH 1ΔT polypeptide; the genetic modification increases the transcription of a gene encoding a MTHl or MTH 1ΔT polypeptide or increases translation of a gene encoding a MTHl or MTH 1ΔT polypeptide; the MTHl or MTH 1ΔT polypeptide is heterologous to the microorganism; the MTHl or MTH 1ΔT polypeptide is homologous to the microorganism; the MTHl polypeptide has a sequence modification that increases stability, e.g., stability in the presence of glucose. In some cases the MTHl or MTH 1ΔT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either SEQ ID NO: 45 or 46 or the polypeptides represented by the Genbank Accession numbers in Figure 8. [025] Host Cells
In some cases the host cell is a fungal cell. For example: the fungal cell is of a genus selected from the group consisting of Aspergillus, Saccharomyces, Yarrowia, Zygosaccharomyces; the fungal cell is an Aspergillus niger cell; the fungal cell is an Aspergillus terreus cell; the fungal cell is a Yarrowia lipolytica cell; the fungal cell is a Zygosaccharomyces bailii cell; the fungal cell is a Saccharomyces cerevisiae cell; the Saccharomyces cerevisiae is TAM, Lp4f, m850, RWB837, MY2928, MY3825, MY3826 or derivatives thereof. TAM, Lp4f, m850 and MY2928 are described in patent application publication WO/2009/011974. MY3825 and MY3826 are described herein. RWB837 is described in patent application WO/2004/099425.
Production of C4-dicarboxylic acids
[026] Also disclosed is a method of producing a C4-dicarboxylic acid, comprising: culturing a recombinant microbial cell described herein under conditions that achieve C4-dicarboxylic acid production.
[027] In various cases: the method further includes isolating a produced C4-dicarboxylic acid; the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid; the C4-dicarboxylic acid is malic acid; the C4-dicarboxylic acid is fumaric acid; the C4-dicarboxylic acid is succinic acid; the step of culturing under conditions that achieve C4- dicarboxylic acid production comprises culturing at a pH within the range of 1.5 to 7; the pH is lower than 5.0; the pH is lower than 4.5; the pH is lower than 4.0; the pH is lower than 3.5; the pH is lower than 3.0; the pH is lower than 2.5; the pH is lower than 2.0; the step of culturing under conditions that achieve C4-dicarboxylic acid production comprises culturing under conditions and for a time sufficient for C4-dicarboxylic acid to accumulate to a level within the range of 10 to 200 g/L; the C4-dicarboxylic acid accumulates to greater than 30 g/L (greater than 50 g/L; greater than 75 g/L; greater than 100 g/L; greater than 125 g/L; or greater than 150 g/L). In other cases the pH is allowed to decrease by at least 1, at least 2, at least 3 pH units during culturing. Thus, the pH can decrease below 5, below 4 or below 3 during culturing after starting at a higher pH.
[028] In various cases: the step of culturing under conditions that achieve C4-dicarboxylic acid production comprises culturing under conditions and for a time sufficient for C4-dicarboxylic acid to accumulate to a level within a range of about 0.3 moles of C4-dicarboxylic acid per mole of substrate to about 1.75 moles of C4-dicarboxylic acid per mole of substrate; the C4- dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid; the C4-dicarboxylic acid accumulates to greater than about 0.3 moles of C4-dicarboxylic acid per mole of substrate; the C4-dicarboxylic acid accumulates to greater than about 0.5 moles of C4-dicarboxylic acid per mole of substrate; the C4-dicarboxylic acid accumulates to greater than about 0.75 moles of C4-dicarboxylic acid per mole of substrate; the C4-dicarboxylic acid accumulates to greater than about 1.0 mole of C4-dicarboxylic acid per mole of substrate; the C4-dicarboxylic acid accumulates to greater than about 1.25 moles of C4-dicarboxylic acid per mole of substrate; the C4-dicarboxylic acid accumulates to greater than about 1.5 moles of C4- dicarboxylic acid per mole of substrate; the C4-dicarboxylic acid accumulates to greater than about 1.75 moles of C4-dicarboxylic acid per mole of substrate; the substrate is glucose; the step of culturing under conditions that achieve C4-dicarboxylic acid production comprises culturing in a medium comprising a carbon source; the carbon source is one or more carbon sources selected from the group consisting of glucose, glycerol, sucrose, fructose, maltose, lactose, galactose, hydrolyzed starch, corn syrup, high fructose corn syrup, and hydrolyzed lignocelluloses; the carbon source is glucose; the medium further comprises a carbon dioxide source; the carbon dioxide source comprises calcium carbonate or carbon dioxide gas; the carbon dioxide source is calcium carbonate; the carbon dioxide source is carbon dioxide gas. Also disclosed is a method of preparing a food or feed additive containing a C4-dicarboxylic acid, the method comprising steps of: a) cultivating a recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4- dicarboxylic acid; and c) combining the isolated C4-dicarboxylic acid with one or more other food or feed additive components. In various cases: the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid. In some cases the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated. In some cases products are produced from one or more C4- dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid. Also disclosed is a method of preparing a cosmetic containing a C4-dicarboxylic acid, the method comprising steps of: a) cultivating a recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4-dicarboxylic acid; and c) combining the C4-dicarboxylic acid with one or more cosmetic components. In various cases, the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid. In some cases the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated. In some cases products are produced from one or more C4-dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid.
Also described is a method of preparing an industrial chemical containing a C4-dicarboxylic acid, the method comprising steps of: a) cultivating the recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4- dicarboxylic acid; and c) combining the isolated C4-dicarboxylic acid with one or more industrial chemical components. In various cases, the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid. In some cases the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated. In some cases products are produced from one or more C4- dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid. Also disclosed is a method of preparing a biodegradable polymer containing a C4-dicarboxylic acid, the method comprising steps of: a) cultivating a recombinant microbial cell described here under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4- dicarboxylic acid; and c) combining the isolated C4-dicarboxylic acid with one or more biodegradable polymer components. In various cases, the C4-dicarboxylic acid is selected from the group consisting of malic acid, fumaric acid and succinic acid. In some cases the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated. In some cases products are produced from one or more C4- dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid. Also disclosed is a method of preparing a C4-dicarboxylic acid derivative, the method comprising steps of: a) cultivating a recombinant microbial cell described herein under conditions that allow production of a C4-dicarboxylic acid; b) isolating the C4-dicarboxylic acid; and c) converting the isolated C4-dicarboxylic acid into a C4-dicarboxylic acid derivative. In various cases: the C4-dicarboxylic acid is chosen from one or more of malic acid, fumaric acid and succinic acid; the C4 dicarboxylic acid derivative is chosen from one or more of: tetrahydrofuran (THF), butane diol (e.g. 1,4-butanediol), γ-butyrolactone, pyrrolidinones (e.g. N- methyl-2-Pyrrolidone), esters, diamines, 4,4-Bionelle, hydroxybutyric acid, dibasic ester (DBE), succindiamide, 1,4-diaminobutane, succinonitrile, maleic anhydride, a hydroxybutyrolactone derivative, a hydroxysuccinate derivative and an unsaturated succinate derivative; the converting comprises one or more of physical treatments, fermentation, biocatalysis, and chemical transformation; the converting comprises one or more physical treatments; the converting comprises fermentation; the converting comprises one or more chemical transformations; the converting comprises one or more biocatalyses. In some cases the isolation of a C4-dicarboxylic acid entails isolating a mixture of different C4-dicarboxylic acids that may or may not be subsequently separated. In some cases products are produced from one or more C4-dicarboxylic acids without first completely purifying or isolating the C4-dicarboxylic acid [029] The fermentation methods can include liquid fermentation and solid state fermentation (Krishna 2005 Crit Rev Biotechnol 25:1).
Definitions
[030] Accumulation: As used herein, "accumulation" of one or more C4-dicarboxylic acids above background levels refers to accumulation to detectable levels. In some cases, "accumulation" refers to accumulation above a pre-determined level (e.g., above a level achieved under otherwise identical conditions with a microbial cell that has not been modified as described herein). In other cases, "accumulation" refers to titer of one or more C4-dicarboxylic acids, i.e. grams per liter of one or more C4-dicarboxylic acids in the broth of a cultured cell. Any available assay, including those explicitly set forth herein, may be used to detect and/or quantify accumulation of one or more C4-dicarboxylic acids. In some cases increased production of a compound leads to increased accumulation. In other cases it does not, for example, when the compound is consumed in different reaction.
[031] Amplification: The term "amplification" refers to increasing the number of copies of a desired nucleic acid molecule in a cell. Typically, amplification results in an increased level of activity of polypeptide (e.g., an enzyme) encoded by the nucleic acid molecule, and/or to an increased level of activity of the encoded polypeptide in a desirable location (e.g., in the cytosol). [032] Anaplerotic polypeptides: "Anaplerotic polypeptides" provide activities that function in the carboxylation of the three carbon (C3) metabolic intermediates phosphoenolpyruvate and pyruvate to oxaloacetate. In some cases, anaplerotic polypeptides are enzymes that catalyze particular steps in a synthesis pathway that ultimately produces oxaloacetate. In some embodiments, anaplerotic polypeptides may be polypeptides that do not themselves catalyze synthetic reactions, but that regulate expression and/or activity of other polypeptides that do so. For example, anaplerotic polypeptides include, among others, pyruvate carboxylase (PYC) polypeptides, phosphoenolpyruvate carboxylase (PPC) polypeptides, phosphoenolpyruvate carboxykinase (PEPCK) polypeptides, pyruvate kinase (PYK) polypeptides, biotin protein ligase (BPL) polypeptides, vitamin H transport protein (VHT) polypeptides, bicarbonate transport (BCT) polypeptides, and carbonic anhydrase (CA) polypeptides. Anaplerotic polypeptides include PYC, PPC, PEPCK, and PYK polypeptides. A modification that increases the activity of an anaplerotic polypeptide is one which increases the enzymatic, transport or other functional activity of the polypeptide or one which increases the amount of the polypeptide present in a cell or a cell compartment. Polypeptides that do not catalyze a biosynthetic reaction yet function in the carboxylation of the C3 metabolic intermediates phosphoenolpyruvate and pyruvate to oxaloacetate include: BPL, VHT, BCT, and CA polypeptides. Thus, a modification that increases or decreases the activity of one of these polypeptides may also modify the level of carboxylation of C3 metabolic intermediates. Example anaplerotic polypeptides are represented by the pyruvate carboxylase polypeptides, phosphoenolpyruvate carboxylase polypeptides, phosphoenolpyruvate carboxykinase polypeptides, pyruvate kinase polypeptides, biotin protein ligase polypeptides, vitamin H transport protein polypeptides, bicarbonate transport polypeptides, and carbonic anhydrase polypeptides represented by SEQ ID NOS: 1-40, 53-57, and 77; polypeptides that have at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75% identity to pyruvate carboxylase polypeptides, phosphoenolpyruvate carboxylase polypeptides, phosphoenolpyruvate carboxykinase polypeptides, pyruvate kinase polypeptides, biotin protein ligase polypeptides, vitamin H transport protein polypeptides, bicarbonate transport polypeptides, and carbonic anhydrase polypeptides represented by SEQ ID NOS: 1-40, 53-57, and 77; polypeptides represented by the Genbank Accession numbers in Figures 2-5, 9, 10, 12, and 13; and polypeptides that have at least 100%, 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75% identity to a polypeptide represented by the Genbank Accession numbers in Figures 2-5, 9, 10, 12, and 13.
[033] ATP-citrate lyase polypeptides: "ATP-citrate lyase polypeptides" catalyze the cytosolic, reversible reaction:
citrate + CoA + ATP → acetyl-CoA + oxaloacetate + ADP + P,.(EC 2.3.3.8) The resulting acetyl-CoA often serves as a substrate for fatty acid synthesis or the malate synthase reaction of the glyoxylate cycle. In some cases the microorganism has a genetic modification that increases ATP-citrate lyase activity, for example, by increasing the level of ATP-citrate lyase polypeptide overall, increasing the level of ATP-citrate lyase in the relevant cell compartment or increasing the intrinsic activity of ATP-citrate lyase. For example, the genetic modification is the addition of a gene encoding an ATP-citrate lyase polypeptide; the genetic modification increases the transcription or translation of a gene encoding an ATP-citrate lyase polypeptide; the genetic modification increases activity by increasing expression of an ATP-citrate lyase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the ATP-citrate lyase polypeptide is heterologous to the microorganism; the ATP-citrate lyase polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases ATP-citrate lyase activity, for example, by decreasing the level of ATP-citrate lyase overall, decreasing the level of ATP-citrate lyase in the relevant cell compartment or decreasing the intrinsic activity of ATP-citrate lyase. For example: the genetic modification decreases expression of an ATP-citrate lyase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding an ATP-citrate lyase polypeptide or the disruption of a gene encoding an ATP-citrate lyase polypeptide or one or more point mutations in a gene encoding an ATP-citrate lyase polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of an ATP-citrate lyase coding or regulatory sequence that results in decreased ATP-citrate lyase expression or activity; the genetic modification is deletion of all or part of the ATP-citrate lyase coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type ATP-citrate lyase polypeptide. In some cases, an ATP-citrate lyase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either of SEQ ID NOs: 79 or 80 or the polypeptides represented by the Genbank Accession numbers in Figures 28 and 29.
[034] Bicarbonate transport (BCT) polypeptides: "Bicarbonate transport (BCT) polypeptides" facilitate the (reversible) movement of membrane impcrmcant HCO^ across biological membranes. Classes of BCT polypeptides include, but are not limited to, CFVHCOi" exchange, NaVl-ICQ3 " co-transport, and Na '-dependent CF/HCO;" exchange polypeptides. BCT polypeptides are critical for the physiological processes Of HCO3 " metabolism and excretion, the regulation of pH, and the regulation of ceil volume, In some cases the microorganism has a genetic modification that increases BCT activity, for example, by increasing the level of BCT overall, increasing the level of BCT in the relevant cell compartment or increasing the intrinsic activity of BCT. For example, the genetic modification is the addition of a gene encoding a BCT polypeptide; the genetic modification increases the transcription or translation of a gene encoding a BCT polypeptide; the genetic modification increases expression of a BCT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the BCT polypeptide is heterologous to the microorganism; the BCT polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases BCT activity, for example, by decreasing the level of BCT overall, decreasing the level of BCT in the relevant cell compartment or decreasing the intrinsic activity of BCT. For example: the genetic modification decreases expression of a BCT polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a BCT polypeptide or the disruption of a gene encoding a BCT polypeptide or one or more point mutations in a gene encoding a BCT polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a BCT coding or regulatory sequence that results in decreased BCT expression or activity; the genetic modification is deletion of all or part of the BCT coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type BCT polypeptide. In some cases the BCT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 53- 55 or the polypeptides represented by the Genbank Accession numbers in Figure 9. [035] Biotin protein ligase (BPL) polypeptides: Biotin protein ligase (BPL) polypeptides catalyze the site-specific and ATP-dependent covalent transfer of biotin to the lysine side chain of the recognition sequence of an acceptor polypeptide. Acceptor polypeptides include, but are not limited to, pyruvate carboxylase polypeptides. In many instances there is a single BPL polypeptide activity in a given source organism. In some cases, a BPL polypeptide also catalyzes the biotinylation of heterologous polypeptides that are expressed in a host system. Certain BPL polypeptides are multi-functional proteins. In some embodiments, such multifunctional BPL polypeptides have functional domains that are involved in transcriptional repression. To give but one example, the BirA BPL polypeptide from E. coli has a functional domain that is involved in transcriptional repression. In some cases the microorganism has a genetic modification that increases biotin ligase (BPL) activity, for example, by increasing the level of BPL overall, increasing the level of BPL in the relevant cell compartment or increasing the intrinsic activity of BPL. For example, the genetic modification is the addition of a gene encoding a BPL polypeptide; the genetic modification increases the transcription or translation of a gene encoding a BPL polypeptide; the genetic modification increases expression of a BPL polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the BPL polypeptide is heterologous to the microorganism; the BPL polypeptide is homologous to the microorganism. In some cases the BPL has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 56 or the polypeptides represented by the Genbank Accession numbers in Figure 12. [036] C4-dicarboxylic acid: The term "C4-dicarboxylic acid" and names of specific C4- dicarboxylic acids such as malic acid, fumaric acid, and succinic acid are intended to refer to the acid, salt, and anion forms of the compound as are the terms malate, succinate and fumarate, unless otherwise specified.
[037] C4-dicarboxylic acid derivatives: Succinic acid, malic acid and other four carbon (C4)- dicarboxylic acids are building blocks for numerous applications including surfactants, solvents, fibers, and biodegradable polymers (see Zeikus et al. (1999) Appl Microbiol Biotechnol 51 :545- 552 which is hereby incorporated by reference in its entirety). Hydroxybutyrolactone and hydroxysuccinate derivatives are particular derivatives of malic acid that are of considerable commercial interest. Additional commodity chemicals that can be produced from malic acid or other C4-dicarboxylic acids (e.g. fumaric acid, succinic acid, maleic acid) include adipic acid, tetrahydrofuran (THF), butane diol (e.g. 1,4-butanediol), γ-butyrolactone, maleic anhydride, pyrrolidinones (e.g. N-methyl-2-Pyrrolidone), diamines, 4,4-Bionelle, hydroxybutyric acid, dibasic ester (DBE), succindiamide, 1 ,4-diaminobutane, succinonitrile, and unsaturated succinate derivatives. C4-dicarboxylic acid derivatives also include esters, for example linear aliphatic ester derivatives of C4-dicarboxylic acids. For example, the ester can be a C1-C3 or C1-C6 ester. The ester moiety can replace one or both of the carboxylic acid groups on a C4- dicarboxylic acid. The C4-dicarboxylic acid derivatives may be produced by any number of processes including physical treatments, fermentation, biocatalysis, chemical transformation and combinations thereof.
[038] C4-dicarboxylic acid biosynthetic polypeptides: "C4-dicarboxylic acid biosynthetic polypeptides" are proteins of primary metabolism, which are not "anaplerotic polypeptides", whose expression and/or activity can be modified to promote the production of one or more C4- dicarboxylic acids. C4-dicarboxylic acid biosynthetic polypeptides include, but are not limited to ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and/or succinate dehydrogenase polypeptides. C4-dicarboxylic acid biosynthetic polypeptides are represented by the ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and succinate dehydrogenase polypeptides in SEQ ID NOs: 47-52 and 78-91; polypeptides that have at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75% identity to the ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and succinate dehydrogenase polypeptides in SEQ ID NOs: 47-52 and 78-91; polypeptides represented by the Genbank GI and/or Accession numbers in Figures 26-33; and polypeptides that have at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, 90%, 85%, 80%, 75% identity to a polypeptide represented by the Genbank GI and/or Accession numbers in Figures 26-33.
[039] Carbonic anhydrase (CA) polypeptides: "Carbonic anhydrase (CA) polypeptides" are zinc metalloenzymes enzymes that catalyze the reaction COrHH ;>O <=> H^CO^ (EC 4.2.1.1). At least three distinct classes of CA polypeptides (designated α, β and γ) exist that have no significant sequence identity. Mammalian CA polypeptides belong to the α class, together with limited representatives from bacteria and archaea. β class CA polypeptides includes enzymes from the chloroplasts of both monocotyledonous and dicotyledonous plants as well as enzymes from phylogenetically diverse archaeal and bacterial species. The CA polypeptide from the methanoarchaeon Methanosarcina thermophila is a representative of γ class CA polypeptides. Distinct CA polypeptide activities have been detected extracellularly, in the cytosol, and within multiple organelles. CA polypeptides are involved in several important physiological functions, including transport of CO;/ HCCh , pH and CO;, homeostasis, biosynthetic reactions, such as anaplerosis and gluconeogenesis, and CO2 fixation (in plants and algae). In some cases the microorganism has a genetic modification that increases CA activity, for example, by increasing the level of CA overall, increasing the level of CA in the relevant cell compartment or increasing the intrinsic activity of CA. For example, the genetic modification is the addition of a gene encoding a CA polypeptide; the genetic modification increases the transcription or translation of a gene encoding a CA polypeptide; the genetic modification increases expression of a CA polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the CA polypeptide is heterologous to the microorganism; the CA polypeptide is homologous to the microorganism. In some cases the CA polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 57 or the polypeptides represented by the Genbank Accession numbers in Figure 10.
[040] Citrate Synthase (CS) polypeptides: "Citrate Synthase (CS) polypeptides" catalyze the condensation of acetyl coenzyme A and oxaloacetate to form citrate and are the rate-limiting enzymes of the tricarboxylic acid (TCA) cycle. During the TCA cycle, carbon is completely oxidized to carbon dioxide; thus, flux to the TCA cycle reduces the yield of other compounds derived from oxaloacetate. In some cases the microorganism has a genetic modification that decreases citrate synthase (CS) activity, for example, by decreasing the level of CS overall, decreasing the level of CS in the relevant cell compartment or decreasing the intrinsic activity of CS. For example: the genetic modification decreases expression of a CS polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a CS polypeptide or the disruption of a gene encoding a CS polypeptide or one or more point mutations in a gene encoding a CS polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a CS coding or regulatory sequence that results in decreased CS expression or activity; the genetic modification is deletion of all or part of the CS coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than
90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type CS polypeptide. In some cases the genetic modification comprises a modification that decreases in vivo flux through a CS polypeptide by decreasing channeling of oxaloacetate between MDH polypeptides and CS polypeptides, for example, by replacing the sequence GHAVLR in the wild-type S. cerevisiae
CS polypeptide (SEQ ID NO: 106) with the sequence AIGFE (SEQ ID NO: 107) or by expression of an inert carrier protein such as GFP fused to a peptide with an amino acid sequence
VPGYGHAVLRKTDPR which functions as a dominant inhibitor of channeling (SEQ ID NO:
108) (Velot and Srere (2000) J Biol Chem 275:12926-33). In some cases the CS polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 106-108 or the polypeptides represented by the Genbank Accession numbers in Figure 34.
[041] Codon: As is known in the art, the term "codon" refers to a sequence of three nucleotides that specify a particular amino acid.
[042] Corresponding: An amino acid that is "corresponding" to an amino acid in a reference sequence occupies a site that is homologous to the site in the reference sequence. Corresponding amino acids can be identified by alignment of related sequences. Amino acid sequences can be compared to protein sequences available in public databases using algorithms such as BLAST,
FASTA, ClustalW, which are well known to those skilled in the art.
[043] DNA ligase: The term "DNA ligase" refers to an enzyme that covalently joins two pieces of double-stranded DNA.
[044] Electroporation: The term "electroporation" refers to a method of introducing foreign
DNA into cells that uses a brief, high voltage DC charge to permeabilize the host cells, causing them to take up extra-chromosomal DNA.
[045] Endonuclease: The term "endonuclease" refers to an enzyme that hydro lyzes double stranded DNA at internal locations.
[046] Expression: The term "expression" refers to the production of a gene product (i.e., RNA or protein). For example, "expression" includes transcription of a gene to produce a corresponding mRNA, and translation of such an mRNA to produce the corresponding peptide, polypeptide, or protein. [047] Fumarase polypeptides: "Fumarase polypeptides" are polypeptides that catalyze the reversible hydration of fumarate to malate (EC 4.2.1.2). In the mitochondrial matrix, fumarase polypeptides function in the tricarboxylic acid cycle to convert fumarate to malate. Fumarase activities often are present in the cytosol as well as the mitochondria. In S. cerevisiae, the cytosolic and mitochondrial fumarase isoenzymes are encoded by one gene, FUMl . Fumarase polypeptides are synthesized as precursors and are targeted to and processed in mitochondria prior to distribution between the cytosol and mitochondria. Deletion of the amino terminal mitochondrial-targeting sequence and signal peptide of FUMl results in exclusive cytosolic localization. It is likely that functional FUMl polypeptide variants that preferentially localize to the mitochondria can also be identified. In some cases the microorganism has a genetic modification that increases fumarase activity, for example, by increasing the level of fumarase polypeptide overall, increasing the level of fumarase in the relevant cell compartment or increasing the intrinsic activity of fumarase. For example, the genetic modification is the addition of a gene encoding a fumarase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a fumarase polypeptide; the genetic modification increases activity by increasing expression of the fumarase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the fumarase polypeptide is active in the cytosol; the fumarase polypeptide is heterologous to the microorganism; the fumarase polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases fumarase activity, for example, by decreasing the level of fumarase overall, decreasing the level of fumarase in the relevant cell compartment or decreasing the intrinsic activity of fumarase. For example: the genetic modification decreases expression of a fumarase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a fumarase polypeptide or the disruption of a gene encoding a fumarase polypeptide or one or more point mutations in a gene encoding a fumarase polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a fumarase coding or regulatory sequence that results in decreased fumarase expression or activity; the genetic modification is deletion of all or part of the fumarase coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type fumarase polypeptide. In some cases the fumarase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 81 or the polypeptides represented by the Genbank Accession numbers in Figure 31.
[048] Fumarate reductase polypeptides: "Fumarate reductase polypeptides" are a set of FAD- binding proteins that catalyze, to different extents, the interconversion of fumarate and succinate. Fumarate reductase polypeptides are generally active in anaerobic or facultative microbes that live a portion of their life cycle in a reduced oxygen environment. The S. cerevisiae fumarate reductase, similar to the flavocytochrome C from Shewanella species, is a soluble protein that binds FAD non-covalently and catalyzes the irreversible reduction of fumarate to succinate, which is required for the reoxidation of intracellular NADH under anaerobic conditions. The S. cerevisiae fumarate reductase polypeptide activities are encoded by the OSMl (mitochondria) and FRDSl (at least partially cytosolic) genes. A distinct class of fumarate reductases is membrane-bound, possesses covalently-linked FAD, and is more structurally related to succinate dehydrogenases; these fumarate reductase polypeptides display some extent of oxidation of succinate to fumarate. In some cases the microorganism has a genetic modification that increases fumarate reductase activity, for example, by increasing the level of fumarate reductase polypeptide overall, increasing the level of fumarate reductase in the relevant cell compartment or increasing the intrinsic activity of fumarate reductase. For example, the genetic modification is the addition of a gene encoding a fumarate reductase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a fumarate reductase polypeptide; the genetic modification increases activity by increasing expression of the fumarate reductase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the fumarate reductase polypeptide is heterologous to the microorganism; the fumarate reductase polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases fumarate reductase activity, for example, by decreasing the level of fumarate reductase overall, decreasing the level of fumarate reductase in the relevant cell compartment or decreasing the intrinsic activity of fumarate reductase. For example: the genetic modification decreases expression of a fumarate reductase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a fumarate reductase polypeptide or the disruption of a gene encoding a fumarate reductase polypeptide or one or more point mutations in a gene encoding a fumarate reductase polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a fumarate reductase coding or regulatory sequence that results in decreased fumarate reductase expression or activity; the genetic modification is deletion of all or part of the fumarate reductase coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type fumarate reductase polypeptide. In some cases the fumarate reductase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either of SEQ ID NOs: 82 or 83 or the polypeptides represented by the Genbank Accession numbers in Figure 30.
[049] Functionally linked: : The phrase "functionally linked" or "operably linked" in the context of a promoter or promoter region refers to a promoter or promoter region and a coding or structural sequence in such an orientation and distance that transcription of the coding or structural sequence may be directed by the promoter or promoter region. The phrase "functionally linked" or "operably linked" in the context of a terminator refers to a terminator or terminator region and a coding or structural sequence in such an orientation and distance that transcription of the coding or structural sequence may be directed by the terminator or terminator region.
[050] Functionally transformed: As used herein, the term "functionally transformed" refers to a host cell that has been caused to express one or more polypeptides as described herein, such that the expressed polypeptide is functional and is active at a level higher than is observed with an otherwise identical cell (i.e., a parental cell or an unmodified cell) that has not been so transformed. In many embodiments, functional transformation involves introduction of a nucleic acid encoding the polypeptide(s) such that the polypeptide(s) is/are produced in an active form and/or appropriate location. Alternatively or additionally, in some embodiments, functional transformation involves introduction of a nucleic acid that regulates expression of such an encoding nucleic acid.
[051] Gene: The term "gene", as used herein, generally refers to a nucleic acid encoding a polypeptide, optionally including certain regulatory elements that may affect expression of one or more gene products (i.e., RNA or protein). A gene may be in chromosomal DNA, plasmid DNA, cDNA, synthetic DNA, or other DNA that encodes a peptide, polypeptide, protein, or RNA molecule, and may include regions flanking the coding sequence involved in the regulation of expression.
[052] Genome: The term "genome" encompasses both the chromosomes and plasmids within a host cell. For example, encoding nucleic acids of the present disclosure that are introduced into host cells can be part of the genome whether they are chromosomally integrated or plasmid- localized.
[053] Glucose sensing and regulatory (GSR) polypeptides: "Glucose sensing and regulatory (GSR) polypeptides" are polypeptides that govern the complex physiological responses required for a microbial cell to utilize glucose efficiently and to the exclusion of other available carbon sources. GSR polypeptides include, among others, SNFl, MIGl, MIG2, MTHl, HXK2, RGTl, SNF3, RGT2, STDl, GRRl, YCKl, HXKl, and GLKl polypeptides. Three regulatory systems appear to control most aspects of the glucose sensing response. S. cerevisiae and other fungi naturally produce GSR polypeptides. For example, the S. cerevisiae SNF1/MIG1 system functions to repress (high glucose) or derepress (low glucose) expression of a broad set of genes involved in the utilization of alternative carbon sources and in gluconeogenesis. In response to glucose depletion, phosphorylation of the MIGl transcriptional repressor by the SNFl kinase prevents both nuclear localization of the repressor and its binding to recognition sequences. MI G2, which binds to a recognition site similar to that of MIGl and HXK2 are additional proteins implicated in controlling the expression of this set of genes. A second regulatory system, which functions primarily to regulate expression of hexose tranporter (HXT) polypeptides, impinges on the action of the RGTl transcriptional repressor. In brief, glucose sensing proteins (SNF3 and RGT2) that are homologues of glucose transporters initiate a signal that is relayed to the paralogous MTHl and STDl proteins, which are necessary for RGTl- mediated repression. When glucose binds sensors, the MTHl and STDl proteins are phosphorylated by the YCKl kinase, and this phosphorylation targets the MTHl and STDl proteins for GRRl mediated ubiquitination and degradation. Significant cross-talk is also exhibited between these first two glucose sensing systems. For example, MTHl gene expression is controlled by the MIGl and MIG2 repressor proteins. A third glucose sensing system, which requires proteins such as, but not limited to, the GPRl G-protein coupled receptor and hexokinases (e.g. HXKl, HXK2, and GLKl), regulates transcriptional and other cellular responses that result from glucose-mediated activation of cAMP synthesis. In some cases the microorganism has a genetic modification that increases GSR activity, for example, by increasing the level of GSR overall, increasing the level of GSR in the relevant cell compartment or increasing the intrinsic activity of GSR. For example, the genetic modification that increases expression is the addition of a gene encoding a GSR polypeptide; the genetic modification increases the transcription or translation of a gene encoding a GSR polypeptide; the genetic modification increases activity by increasing expression of the GSR polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the GSR polypeptide is heterologous to the microorganism; the GSR polypeptide is homologous to the microorganism. In some cases the GSR polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 58-69 or the polypeptides represented by the Genbank Accession numbers in any of Figures 14-24.
[054] Heterologous: The term "heterologous", means from a source organism other than the host cell. For example, "heterologous" as used herein refers to genetic material or polypeptide that does not naturally occur in the species in which it is present and/or being expressed. It will be understood that, in general, when heterologous genetic material or polypeptide is selected for introduction into and/or expression by a host cell, the particular source organism from which the heterologous genetic material or polypeptide may be selected is not critical to the practice of the present disclosure. Relevant considerations may include, for example, how closely related the potential source and host organisms are in evolution, or how related the source organism is with other source organisms from which sequences of other relevant polypeptides have been selected. Where a plurality of different heterologous polypeptides and/or nucleic acids are to be introduced into and/or expressed by a host cell, different polypeptides or nucleic acids may be from different source organisms, or from the same source organism. To give but one example, in some cases, individual polypeptides may represent individual subunits of a complex protein activity and/or may be required to work in concert with other polypeptides in order to achieve the goals of the present disclosure. In some embodiments, it will often be desirable for such polypeptides to be from the same source organism, and/or to be sufficiently related to function appropriately when expressed together in a host cell. In some embodiments, such polypeptides may be from different, even unrelated source organisms. It will further be understood that, where a heterologous polypeptide is to be expressed in a host cell, it will often be desirable to utilize nucleic acids whose sequences encode the polypeptide that have been adjusted to accommodate codon preferences of the host cell and/or to link the encoding sequences with regulatory elements active in the host cell.
[055] Hexose transporter (HXT) polypeptides: "Hexose transporter (HXT) polypeptides" are proteins that belong to the major facilitator superfamily (MFS) of transporters. HXT polypeptides transport their substrates by passive, energy-independent facilitated diffusion, with glucose moving down a concentration gradient. Many prokaryotic and eukaryotic, including mammalian, sugar transporters are of the MFS superfamily. The genome of the yeast S. cerevisiae encodes at least 20 candidate HXT polypeptides, while seven (encoded by the HXTl through HXT7 genes) have been demonstrated to encode functional glucose transporters. Expression of any one of these HXT polypeptides in a parent strain otherwise lacking the HXTl through HXT7 genes is sufficient to facilitate growth on a medium with glucose as the sole carbon source. HXT2, HXT6, and HXT7 polypeptides are believed to be high-affinity glucose transporters, whereas HXT3 and HXT4 polypeptides are low-affinity glucose transporters. In some cases the microorganism has a genetic modification that increases HXT activity, for example, by increasing the level of HXT overall, increasing the level of HXT in the relevant cell compartment or increasing the intrinsic activity of HXT. For example, the genetic modification that increases expression is the addition of a gene encoding a HXT polypeptide; the genetic modification increases the transcription or translation of a gene encoding a HXT polypeptide; the genetic modification increases activity by increasing expression of the HXT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the HXT polypeptide is heterologous to the microorganism; the HXT polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases HXT activity, for example, by decreasing the level of HXT overall, decreasing the level of HXT in the relevant cell compartment or decreasing the intrinsic activity of HXT. For example: the genetic modification decreases expression of a HXT polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a HXT polypeptide or the disruption of a gene encoding a HXT polypeptide or one or more point mutations in a gene encoding a HXT polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a HXT coding or regulatory sequence that results in decreased HXT expression or activity; the genetic modification is deletion of all or part of the HXT coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type HXT polypeptide. In some cases the HXT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs:70- 76 or the polypeptides represented by the Genbank Accession numbers in Figure 11. [056] Homologous: The term "homologous", as used herein, means from the same source organism as the host cell. For example, as used here to refer to genetic material or to polypeptides, the term "homologous" refers to genetic material or polypeptides that naturally occurs in the organism in which it is present and/or being expressed, although optionally at different activity levels and/or in different amounts.
[057] Host cell: As used herein, the "host cell" is a cell that is manipulated to increase production of OAA and/or one or more C4-dicarboxylic acids as described herein. A "modified host cell", as used herein, is any host cell which has been modified, engineered, or manipulated in accordance with the present disclosure as compared with a parental cell. In some embodiments, the parental cell is a naturally occurring parental cell. Typically, the host cell is a microbial cell such as a bacterial cell, a fungal cell or a yeast cell.
[058] Hybridization: "Hybridization" refers to the ability of a strand of nucleic acid to join with a complementary strand via base pairing. Hybridization occurs when complementary sequences in the two nucleic acid strands bind to one another.
[059] Isocitrate lyase polypeptides: "Isocitrate lyase polypeptides" are polypeptides that catalyze the formation of succinate and glyoxylate from isocitrate (EC 4.1.3.1), a key reaction of the glyoxylate cycle. In some cases the microorganism has a genetic modification that increases isocitrate lyase activity, for example, by increasing the level of isocitrate lyase polypeptide overall, increasing the level of isocitrate lyase in the relevant cell compartment or increasing the intrinsic activity of isocitrate lyase. For example, the genetic modification is the addition of a gene encoding an isocitrate lyase polypeptide; the genetic modification increases the transcription or translation of a gene encoding an isocitrate lyase polypeptide; the genetic modification increases activity by increasing expression of the isocitrate lyase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the isocitrate lyase polypeptide is heterologous to the microorganism; the isocitrate lyase polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases isocitrate lyase activity, for example, by decreasing the level of isocitrate lyase overall, decreasing the level of isocitrate lyase in the relevant cell compartment or decreasing the intrinsic activity of isocitrate lyase. For example: the genetic modification decreases expression of an isocitrate lyase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding an isocitrate lyase polypeptide or the disruption of a gene encoding a isocitrate lyase polypeptide or one or more point mutations in a gene encoding a isocitrate lyase polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of an isocitrate lyase coding or regulatory sequence that results in decreased isocitrate lyase expression or activity; the genetic modification is deletion of all or part of the isocitrate lyase coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type isocitrate lyase polypeptide. In some cases the isocitrate lyase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 84 or the polypeptides represented by the Genbank Accession numbers in Figure 33. [060] Isolated: The term "isolated", as used herein, means that the isolated entity has been separated from at least one component with which it was previously associated. When most other components have been removed, the isolated entity is "purified" or "concentrated". Isolation and/or purification and/or concentration may be performed using any techniques known in the art including, for example, fractionation, extraction, precipitation, or other separation. [061] Malate dehydrogenase polypeptide: A malate dehydrogenase (MDH) polypeptide is an enzyme capable of catalyzing the interconversion of oxaloacetate to malate (using NAD(P)H) and vice versa (EC 1.1.1.37). Malate dehydrogenase polypeptides can be localized to the mitochondria or to the cystosol. In some cases the malate dehydrogenase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs:47-52 or 78, or the polypeptides represented by the Genbank Accession numbers in Figure 6.
[062] Malate synthase polypeptides: "Malate synthase polypeptides" are enzymes of the glyoxylate cycle that catalyze the irreversible condensation of acetyl-CoA and glyoxylate to yield malate and CoA (EC 2.3.3.9). Malate synthase polypeptide activities, like those of isocitrate lyase polypeptides, are typically elevated when a non-fermentable carbon source is provided. In some cases the microorganism has a genetic modification that increases malate synthase activity, for example, by increasing the level of malate synthase polypeptide overall, increasing the level of malate synthase in the relevant cell compartment or increasing the intrinsic activity of malate synthase. For example, the genetic modification is the addition of a gene encoding a malate synthase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a malate synthase polypeptide; the genetic modification increases activity by increasing expression of the malate synthase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the malate synthase polypeptide is heterologous to the microorganism; the malate synthase polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases malate synthase activity, for example, by decreasing the level of malate synthase overall, decreasing the level of malate synthase in the relevant cell compartment or decreasing the intrinsic activity of malate synthase. For example: the genetic modification decreases expression of a malate synthase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a malate synthase polypeptide or the disruption of a gene encoding a malate synthase polypeptide or one or more point mutations in a gene encoding a malate synthase polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a malate synthase coding or regulatory sequence that results in decreased malate synthase expression or activity; the genetic modification is deletion of all or part of the malate synthase coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type malate synthase polypeptide. In some cases the malate synthase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of either of SEQ ID NOs: 85 or 86, or the polypeptides represented by the Genbank Accession numbers in Figure 26.
[063] Medium: As is known in the art, the term "medium" refers to a chemical environment in which a host cell, such as a microbial cell (e.g., a yeast or fungal cell) is cultivated. Typically, a medium contains components required for the growth of the cell, and one or more precursors for the production of OAA or one or more C4-dicarboxylic acids. Components for growth of host cells and precursors for the production of OAA or one or more C4-dicarboxylic acids may or may be not identical.
[064] Malic enzyme polypeptides: "Malic enzyme polypeptides" are polypeptides that catalyze the reversible NAD-dependent or NADP-dependent (EC 1.1.1.40) oxidative decarboxylation of (EC 1.1.1.38 or 1.1.1.39) malate to carbon dioxide and pyruvate, with the concomitant reduction of NAD(P)+. The enzyme is found in most living organisms, because the products of the reaction are used as a source of carbon and reductive power in different cell compartments. Most fungi encode a NADP-dependent malic enzyme. In S. cerevisiae, the malic enzyme polypeptide is encoded by the MAEl gene. In some cases the microorganism has a genetic modification that increases malic enzyme activity, for example, by increasing the level of malic enzyme polypeptide overall, increasing the level of malic enzyme in the relevant cell compartment or increasing the intrinsic activity of malic enzyme. For example, the genetic modification is the addition of a gene encoding a malic enzyme polypeptide; the genetic modification increases the transcription or translation of a gene encoding a malic enzyme polypeptide; the genetic modification increases activity by increasing expression of the malic enzyme polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the malic enzyme polypeptide is heterologous to the microorganism; the malic enzyme polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases malic enzyme activity, for example, by decreasing the level of malic enzyme overall, decreasing the level of malic enzyme in the relevant cell compartment or decreasing the intrinsic activity of malic enzyme. For example: the genetic modification decreases expression of a malic enzyme polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a malic enzyme polypeptide or the disruption of a gene encoding a malic enzyme polypeptide or one or more point mutations in a gene encoding a malic enzyme polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a malic enzyme coding or regulatory sequence that results in decreased malic enzyme expression or activity; the genetic modification is deletion of all or part of the malic enzyme coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type malic enzyme polypeptide. In some cases the malic enzyme polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO: 87, or the polypeptides represented by the Genbank Accession numbers in Figure 27. [065] Modified: The term "modified", as used herein, refers to a host cell that has been modified to increase production of OAA or one or more C4-dicarboxylic acids, as compared with an otherwise identical host organism that has not been so modified. In principle, such "modification" in accordance with the present disclosure may comprise any chemical, physiological, genetic, or other modification that appropriately alters production of OAA and/or one or more C4-dicarboxylic acids in a host organism as compared with such production in an otherwise identical cell not subject to the same modification. In most embodiments, however, the modification will comprise a genetic modification. For example, a genetic modification can entail: the addition of all or a portion of a gene or polypeptide coding sequence that is not naturally present in the host cell, the addition of all or a portion of a gene that is already present in the host cell, the deletion of all or a portion of a gene or polypeptide coding sequence that is naturally in the host cell, an alteration in (e.g., a sequence change in) a gene or polypeptide coding sequence that is naturally present in the host cell (e.g., a sequence change that increases expression, a sequence change that decreases expression, a sequence change that increases enzymatic, transport or other activity of a polypeptide, a sequence change that decreases enzymatic, transport or other activity of a polypeptide) and combinations thereof. In some cases, a modification comprises at least one chemical, physiological, genetic, or other modification; in other cases, a modification comprises more than one chemical, physiological, genetic, or other modification. In certain aspects where more than one modification is utilized, such modifications can comprise any combination of chemical, physiological, genetic, or other modifications (e.g., one or more genetic, chemical and/or physiological modification(s)). In many cases the genetic modification entails providing the host cell with a nucleic acid molecule that encodes a desired polypeptide. In many cases the nucleic acid molecule will also include a functionally linked promoter or promoter region that allows for expression of the encoded polypeptide. A nucleic acid molecule provided to the host cell, e.g., by transformation, can encode two or more desired polypeptides. In some such cases, each of the two or more polypeptides is accompanied by a functionally linked promoter or promoter region. In these cases, the functionally linked promoter or promoter regions can be all the same, all different, or may include some which are the same and others which are different. In many cases, the nucleic acid molecule(s) will also include a functionally linked terminator region that allows for proper expression of the encoded polypeptide. When the nucleic acid molecule encodes two or more polypeptides, the functionally linked terminator regions can be all the same, all different, or may include some which are the same and others which are different. In some cases a nucleic acid molecule can encode a recombinant chimeric polypeptide having two or more of the desirable activities, e.g., two or more of the enzymatic activities, described herein. Some naturally- occurring polypeptides may have two or more of the desirable activities described herein. [066] MTHl: An MTHl polypeptide is a negative regulator of the glucose-sensing signal transduction pathway. MTHl plays a role in the regulation of genes encoding hexose transporter polypeptides. MTHl also plays a role in the regulation of glucose sensing and regulatory polypeptides and is itself a glucose sensing and regulatory polypeptide. MTHl is subject to glucose induced degradation. To increase MTHl activity, it may be useful to express an MTHl variant that is not subject to this regulation. One such useful variant is the S. cerevisiae MTH 1ΔT, a deletion mutant (SEQ ID NO: 46). The MTHl may have an amino acid deletion that corresponds to the amino acid deletion found in SEQ ID NO: 46 as compared to the wild- type S. cerevisiae MTHl (SEQ ID NO: 45). A corresponding amino acid deletion is an amino acid deletion at a position in the non-5*, cerevisiae polypeptide that is aligned with the altered S. cerevisiae amino acid when the S. cerevisiae polypeptide and the non-5*, cerevisiae polypeptide are aligned overall using any of the well-known amino acid sequence alignment methods. The amino acid deletion in the non-5*, cerevisiae MTHl enzyme need not be identical to the change in S. cerevisiae MTHl . For example, a deletion that is larger or smaller than that which corresponds to that present in S. cerevisiae MTH 1ΔT can be useful.
[067] Open reading frame: As is known in the art, the term "open reading frame (ORF)" refers to a region of DNA or RNA encoding a peptide, polypeptide, or protein. [068] Organic acid transporter (OAT) polypeptides: "Organic acid transporter (OAT) polypeptides" are proteins whose expression and/or activities can be modified to catalyze the net efflux of one or more dicarboxylic acids from microbial cells, e.g., C -4 dicarboxylic acids. OAT polypeptides are a diverse set of proteins that catalyze carboxylic acid transport via several distinct mechanisms. The activity of a particular OAT polypeptide may be either increased or reduced, depending on the substrate(s) for a given OAT polypeptide and the desired dicarboxylic acid product. Furthermore, it may be possible to modify the subcellular localization of an OAT polypeptide to promote the efflux of a specific dicarboxylic acid product. As an example, a vacuolar or tonoplast dicarboxylate transporter may be targeted to the cytoplasmic membrane in order to facilitate the efflux of a dicarboxylic acid product such as malic acid. Representative OAT polypeptides include the A.flavus C4-dicarboxylate transporter/malic acid transport protein, S. pombe malate transporter MAEl, aluminum activated malate transporters (e.g. ALMTl), plant tonoplast dicarboxylate transporters (e.g. A. thaliana AttDT), mammalian sodium/dicarboxylate co-transporters, mono- and dicarboxylic acid transporters related to the K. lactis JENl and JEN2 proteins, respectively; and proteins related to the E. coli DcuC succinate efflux polypeptide. In some cases the microorganism has a genetic modification that increases OAT activity, for example, by increasing the level of OAT polypeptide overall, increasing the level of OAT in the relevant cell compartment or increasing the intrinsic activity of OAT. For example, the genetic modification is the addition of a gene encoding an OAT polypeptide; the genetic modification increases the transcription or translation of a gene encoding an OAT polypeptide; the genetic modification increases activity by increasing expression of the OAT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the OAT polypeptide is heterologous to the microorganism; the OAT polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases OAT activity, for example, by decreasing the level of OAT polypeptide overall, decreasing the level of OAT in the relevant cell compartment or decreasing the intrinsic activity of OAT. For example: the genetic modification decreases OAT activity by decreasing expression of an OAT polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification, the genetic modification is a deletion of all or part of a gene encoding an OAT polypeptide or the disruption of a gene encoding an OAT polypeptide, or the genetic modification that decreases OAT activity is a nucleotide substitution in one or more nucleotides of an OAT coding or regulatory sequence that results in decreased OAT expression or activity. In some cases the OAT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 92-105, 109 and 110, or the polypeptides represented by the Genbank Accession numbers in Figure 25.
[069] PDC-reduced: As used herein, the term "PDC-reduced" refers to a cell containing a modification (e.g., a genetic modification that deletes all or a portion of a PDC gene or a genetic modification that alters the activity or expression of PDC) that reduces pyruvate decarboxylase activity as compared with an otherwise identical cell that is not modified. In some embodiments, a PDC-reduced cell has reduced activity of one or more pyruvate decarboxylase polypeptides relative to the unmodified cell (e.g., an otherwise identical cell lacking the modification). In some cases, a PDC-reduced cell has reduced or substantially eliminated Pdcl polypeptide activity. In certain cases, the PDC-reduced cell further comprises reduced or substantially eliminated Pdc2, Pdc5, and/or Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced or substantially eliminated Pdc2 polypeptide activity. In certain embodiments thereof, the PDC-reduced cell further comprises reduced or substantially eliminated Pdcl, Pdc5, and/or Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced or substantially eliminated Pdc5 polypeptide activity. In certain cases thereof, the PDC-reduced cell further comprises reduced and/or substantially eliminated Pdcl, Pdc2, and/or Pdc6 polypeptide activity. In some cases the PDC-reduced cell has reduced or substantially eliminated Pdc6 polypeptide activity. In certain cases, the PDC-reduced cell further comprises reduced and/or substantially eliminated Pdcl, Pdc2, and/or Pdc5 polypeptide activity. In some cases the PDC-reduced cell has reduced and/or substantially eliminated Pdcl and Pdc5 polypeptide activity. In some cases, a PDC-reduced cell has reduced and/or substantially eliminated Pdcl and Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced and/or substantially eliminated Pdc5 and Pdc6 polypeptide activity. In some cases, a PDC-reduced cell has reduced and/or substantially eliminated Pdcl, Pdc5 and Pdc6 polypeptide activity. In some embodiments, a PDC-reduced cell has 3-fold, 5-fold, 10-fold, 50-fold less pyruvate decarboxylase activity as compared with an otherwise identical parental cell not containing the modification. In some cases, a PDC-reduced cell has pyruvate decarboxylase activity below at least about 0.075 micromol/min mg protein"1, at least about 0.045 micromol/min mg protein"1, at least about 0.025 micromol/min mg protein"1; in some embodiments, a PDC-reduced cell has pyruvate decarboxylase activity below about 0.005 micromol/min mg protein"1 when using the methods described by van Maris et al. (2003) (Appl. Environ. Microbiol. 69:2094-2099, 2003). In some cases, a PDC-reduced cell has no detectable pyruvate decarboxylase activity. In some cases, a cell with no detectable pyruvate decarboxylase activity is referred to as "PDC-negative". In some cases, a PDC-negative cell lacks Pdcl, Pdc5 and Pdc6 polypeptide activity. In some cases, a PDC-negative cell has pyruvate decarboxylase activity below about 0.005 micromol/min mg protein"1. In some cases the pyruvate decarboxylase polypeptide is chosen from an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 41-44 or the polypeptides represented by the Genbank Accession numbers in Figure 7. [070] Phosphoenolpyruvate carboxykinase (PEPCK) polypeptide: A "phosphoenolpyruvate carboxykinase (PEPCK) polypeptide" is a polypeptide that catalyzes the reversible formation of oxaloacetate and ATP from phosphoenolpyruvate, ADP, and carbon dioxide (EC 4.1.1.49). Under physiological conditions such as glucose limitation, PEPCK acts to catalyze the formation of phosphoenolpyruvate from OAA (for gluconeogenesis), thereby reversing the anaplerotic flux provided by PYC and PPC. In some cases the PEPCK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 17- 22 or the polypeptides represented by the Genbank Accession numbers in Figure 4. [071] Phosphoenolpyruvate carboxylase (PPC) polypeptide: A "phosphoenolpyruvate carboxylase (PPC) polypeptide" is a polypeptide catalyzes the addition of carbon dioxide to phosphoenolpyruvate (PEP) to form oxaloacetate (EC 4.1.1.31). E. coli PPC has been observed to be negatively regulated by downstream products, including by malate. In some embodiments, the PPC polypeptide is modified to be less sensitive to inhibition by one or more of malate, aspartate, and/or oxaloacetate. In some cases the PPC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs:9-16 or the polypeptides represented by the Genbank Accession numbers in Figure 3. [072] Plasmid: As is known in the art, the term "plasmid" refers to a circular or linear, extra- chromosomal, replicatable piece of DNA.
[073] Polymerase chain reaction: As is known in the art, the term "polymerase chain reaction (PCR)" refers to an enzymatic technique to create multiple copies of one sequence of nucleic acid. Copies of DNA sequence are prepared by shuttling a DNA polymerase between two amplimers. The basis of this amplification method is multiple cycles of temperature changes to denature, then re-anneal amplimers, followed by extension to synthesize new DNA strands in the region located between the flanking amplimers.
[074] Polypeptide: The term "polypeptide", as used herein, generally has its art-recognized meaning of a polymer of at least three amino acids. However, the term is also used to refer to specific functional classes of polypeptides, such as, for example, anaplerotic polypeptides (e.g. pyruvate carboxylase polypeptides, phosphoenolpyruvate carboxylase polypeptides, phosphoenolpyruvate carboxykinase polypeptides, pyruvate kinase polypeptides, biotin protein ligase polypeptides, vitamin H transport protein polypeptides, bicarbonate transport polypeptides, and carbonic anhydrase polypeptides), MTHl polypeptides, glucose sensing and regulatory polypeptides (e.g. SNFl, MIGl, MIG2, HXK2, RGTl, SNF3, RGT2, STDl, GRRl, YCKl, HXKl, and GLKl), hexose transporter polypeptides (e.g. HXTl, HXT2, HXT3, HXT4, HXT5, HXT6, and HXT7), and C4-dicarboxylic acid biosynthetic polypeptides (e.g. ATP-citrate lyase polypeptides, fumarase polypeptides, fumarate reductase polypeptides, isocitrate lyase polypeptides, malate dehydrogenase polypeptides, malate synthase polypeptides, malic enzyme polypeptides, and succinate dehydrogenase polypeptides), pyruvate decarboxylase polypeptides, citrate synthase polypeptides). For each such class and certain others, the present specification provides several examples of known sequences of such polypeptides. Those of ordinary skill in the art will appreciate, however, that the term "polypeptide" is intended to be sufficiently general as to encompass not only polypeptides having the complete sequence recited herein (or in a reference or database specifically mentioned herein), but also to encompass polypeptides that represent functional fragments (i.e., fragments retaining at least one activity) of such complete polypeptides. Moreover, those of ordinary skill in the art understand that protein sequences generally tolerate some substitution without destroying activity. Thus, any polypeptide that retains activity and shares at least about 30-40% overall sequence identity, often greater than about 50%, 60%, 70%, or 80%, and further usually including at least one region of much higher identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99% in one or more highly conserved regions, usually encompassing at least 3-4 and often up to 20 or more amino acids, with another polypeptide of the same class, is encompassed within the relevant term "polypeptide" as used herein. Other regions of similarity and/or identity can be determined by those of ordinary skill in the art by analysis of the sequences of various polypeptides presented in SEQ ID NOS: 1-108 and Figures IB and 2-34 herein. In some cases the polypeptide has an amino acid sequence that differs from the amino acid sequence of a polypeptide presented in SEQ ID NOS: 1-108 and Figures IB and 2-34 herein by fewer than 20, 15, 10 or 5 amino acids. In some cases the amino acid changes are conservative changes.
[075] Promoter. As is known in the art, the term "promoter" or "promoter region" refers to a DNA sequence, usually found upstream (5') to a coding sequence, that controls expression of the coding sequence by controlling production of messenger RNA (mRNA) by providing the recognition site for RNA polymerase and/or other factors necessary for start of transcription at the correct site.
[076] Pyruvate carboxylase enzyme (PYC) polypeptide: A "pyruvate carboxylase (PYC) polypeptide" can be any enzyme that uses a HCO3" substrate to catalyze an ATP-dependent conversion of pyruvate to oxaloacetate (EC 6.4.1.1). PYC polypeptides contain a covalently attached biotin prosthetic group, which serves as a carrier of activated CO2. In most instances, the activity of PYC polypeptides depends on the presence of acetyl-CoA. Biotin is not carboxylated (on PYC) unless acetyl-CoA (or a closely related acyl-CoA) is bound to the enzyme. Aspartate often serves as an inhibitor of PYC polypeptides. PYC polypeptides are generally active in a tetrameric form. In some cases the PYC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 1-8 or the polypeptides represented by the Genbank Accession numbers in Figure 2. [077] Pyruvate decarboxylase (PDC) polypeptide: A "pyruvate decarboxylase polypeptide" can be any thiamin diphosphate-dependent enzyme that catalyses the decarboxylation of pyruvic acid to acetaldehyde and carbon dioxide (EC 4.1.1.1). In some cases the PDC polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 41-43 or the polypeptides represented by the Genbank Accession numbers in Figure 7.
[078] Pyruvate kinase: Pyruvate kinase (PYK) catalyses the irreversible conversion of phosphoenolpyruvate (PEP) to pyruvate (EC 2.7.1.40), the final step in glycolysis. Many PYK enzymes are tetrameric complexes of identical subunits. PYK polypeptides play a key role in regulating glycolytic flux. PYK polypeptides from Saccharomyces cerevisiae have an absolute requirement for both monovalent and divalent cations, undergo homotropic activation by PEP and Mn2+, and heterotropic activation by fructose 1 ,6-bisphosphate (FBP). Potassium is the physiologically important monovalent activator, but several other monovalent cations can also activate PYK polypeptides. In some cases the PYK polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 23-40 or the polypeptides represented by the Genbank Accession numbers in Figure 5. [079] Recombinant: A "recombinant" host cell, as that term is used herein, is a host cell that has been genetically modified. For example, a "recombinant cell" can be a cell that contains a nucleic acid sequence not naturally occurring in the cell, or an additional copy or copies of an endogenous nucleic acid sequence, wherein the nucleic acid sequence is introduced into the cell or an ancestor thereof by human action. A recombinant cell includes, but is not limited to: a cell which has been genetically modified by deletion of all or a portion of a gene, a cell that has had a mutation introduced into a gene, a cell that has had a nucleic acid sequence inserted either to add a functional gene or disrupt a functional gene, and a cell that has a gene that has been modified by both removing and adding a nucleic acid sequence. A "recombinant vector" or "recombinant DNA or RNA construct" refers to any nucleic acid molecule generated by the hand of man. For example, a recombinant construct may be a vector such as a plasmid, cosmid, virus, autonomously replicating sequence, phage, or linear or circular single-stranded or double- stranded DNA or RNA molecule. A recombinant nucleic acid may be derived from any source and/or capable of genomic integration or autonomous replication where it includes two or more sequences that have been linked together by the hand of man. Recombinant constructs may, for example, be capable of introducing a 5' regulatory sequence or promoter region and a DNA sequence for a selected gene product into a cell in such a manner that the DNA sequence is transcribed into a functional mRNA, which may or may not be translated and therefore expressed.
[080] Reduced inhibition. A polypeptide with "reduced inhibition" includes a polypeptide that is less inhibited by the presence of an inhibitory factor as compared to a wild-type form of the polypeptide or a polypeptide that is less inhibited by the presence of an inhibitory factor as compared to the corresponding endogenous polypeptide expressed in the organism into which the polypeptide has been introduced. In certain cases, the inhibitory factor is an allosteric inhibitor. In certain cases, the inhibitory factor may be a product or an intermediate of a C4- dicarboxylic acid biosynthetic pathway, e.g., a product produced by the polypeptide that is inhibited. This type of inhibition is commonly referred to as feedback inhibition, and reduced inhibition includes reduced feedback inhibition. For example, a wild-type PPC from E. coli may have 10-fold less activity in the presence of a given concentration of one or more of malate, aspartate, and oxaloacetate, respectively. A PPC with reduced inhibition may have, for example, 5-fold less, 2-fold less, or wild-type levels of activity in the presence of the same concentration of one or more of malate, aspartate, and oxaloacetate. Once a variant enzyme having one or more amino acid changes which result in reduced inhibition has been identified, it can be used as a model by those skilled in the art to create variants of a heterologous enzyme by making the same or a similar amino acid change(s) at the corresponding position(s) in the heterologous enzyme. The amino acid change in the heterologous enzyme need not be identical to the change in the model enzyme. For example, if the amino acid change in the model enzyme changes a basic amino acid to a neutral amino acid, e.g., Ala, the change in the heterologous enzyme can change a basic amino acid to a different neutral amino acid, e.g., GIy.
[081] Restriction enzyme: As is known in the art, the term "restriction enzyme" refers to an enzyme that recognizes a specific sequence of nucleotides in double stranded DNA and cleaves both strands; also called a restriction endonuclease. Cleavage typically occurs within the restriction site or close to it.
[082] Screenable: The term "screenable" is used to refer to a marker whose expression confers a phenotype facilitating identification, optionally without facilitating survival, of cells containing the marker. In many embodiments, a screenable marker imparts a visually or otherwise distinguishing characteristic (e.g. color changes, fluorescence).
[083] Selectable: The term "selectable" is used to refer to a marker whose expression confers a phenotype facilitating identification, and specifically facilitating survival, of cells containing the marker. Selectable markers include those, which confer resistance to toxic chemicals (e.g. ampicillin, kanamycin) or complement a nutritional deficiency (e.g. uracil, histidine, leucine). [084] Sequence Identity: As used herein, the term "sequence identity" refers to a comparison between two sequences (e.g., two nucleic acid sequences or two amino acid sequences) and assessment of the degree to which they contain the same residue at the same position. As is known to those of ordinary skill in the art, an assessment of sequence identity includes an assessment of which positions in different sequences should be considered to be corresponding positions; adjustment for gaps, etc. is permitted. Furthermore, an assessment of residue identity can include an assessment of degree of identity such that consideration can be given to positions in which the identical residue (e.g., nucleotide or amino acid) is not observed, but a residue sharing one or more structural, chemical, or functional features is found. Identity can be determined by a sequence alignment. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Any of a variety of algorithms or approaches may be utilized to calculate sequence identity. For example, in some embodiments, the Needleman and Wunsch (1970) J. MoI. Biol. 48:444-453 algorithm can be utilized. This algorithm has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com). In some such embodiments, the Neddleman and Wunsch algorithim is employed using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6. In some embodiments, sequence alignment is performed using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a sequence identity or homology limitation of the disclosure) are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5. In some embodiments, a sequence alignment is performed using the algorithm of Meyers and Miller ((1989) CABIOS, 4:11-17). This algorithm has been incorporated into the ALIGN program (version 2.0). In some such embodiments, this algorithm is employed using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In some embodiments, a sequence alignment is performed using the ClustalW program. In some such embodiments, default values, namely: DNA Gap Open Penalty = 15.0, DNA Gap Extension Penalty = 6.66, DNA Matrix = Identity, Protein Gap Open Penalty = 10.0, Protein Gap Extension Penalty = 0.2, Protein matrix = Gonnet, are employed. Identity can be calculated according to the procedure described by the ClustalW documentation: "A pairwise score is calculated for every pair of sequences that are to be aligned. These scores are presented in a table in the results. Pairwise scores are calculated as the number of identities in the best alignment divided by the number of residues compared (gap positions are excluded). Both of these scores are initially calculated as percent identity scores and are converted to distances by dividing by 100 and subtracting from 1.0 to give number of differences per site. In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or 100% of the length of the reference sequence. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
[085] Small Molecule: In general, a small molecule is understood in the art to be an organic molecule that is less than about 5 kilodaltons (Kd) in size. In some embodiments, the small molecule is less than about 3 Kd, 2 Kd, or 1 Kd. In some embodiments, the small molecule is less than about 800 daltons (D), 600 D, 500 D, 400 D, 300 D, 200 D, or 100 D. In some embodiments, small molecules are non-polymeric. In some embodiments, small molecules are not proteins, peptides, or amino acids. In some embodiments, small molecules are not nucleic acids or nucleotides. In some embodiments, small molecules are not saccharides or polysaccharides.
[086] Source organism: The term "source organism", as used herein, refers to the organism in which a particular polypeptide or genetic sequence can be found in nature. Thus, for example, if one or more homologous or heterologous polypeptides or genetic sequences is/are being expressed in a host organism, the organism in which the polypeptides or sequences are expressed in nature (and/or from which their genes were originally cloned) is referred to as the "source organism". Where multiple homologous or heterologous polypeptides and/or genetic sequences are being expressed in a host organism, one or more source organism(s) may be utilized for independent selection of each of the heterologous polypeptide(s) or genetic sequences. It will be appreciated that any and all organisms that naturally contain relevant polypeptide or genetic sequences may be used as source organisms in accordance with the present disclosure. Representative source organisms include, for example, animal, mammalian, insect, plant, fungal, yeast, algal, bacterial, archaebacterial, cyanobacterial, and protozoal source organisms. For example, a source organism may be a fungus, including yeasts, of the genus Aspergillus, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Yarrowia, or Zygosaccharomyces. In certain embodiments, the source organism may be of the species Aspergillus niger, Aspergillus terreus, Kluyveromyces lactis, S. cerevisiae, S. pombe, Y. lipolytica, or Zygosaccharomyces bailii. For example a source organism may be a bacterium, including a bacterium of the genus Actinobacillus, Alcaligenes, Bacteroides, Brevibacteria, Capnocytophaga, Corynebacteria, Erwinia, Escherichia, Haemophilus, Lactobacillus, Lactococcus, Methanococcus, Methanothermobacter, Nocardia, Propionibacterium, Pseudomonas, Staphylococcus, (Thermo) synechococcus, or Zymomonas. In certain embodiments, the source organism may be of the species Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Alcaligenes faecalis, Bacteroides fragilis, C. glutamicum, Capnocytophaga ochracea, E. carotovora, E. coli, E. chrysanthemi, Haemophilus influenzae, Lactobacillus plantarum, Lactococcus lactis, Lactococcus lactis cremoris MGl 363, Lactococcus lactis NIZO Bl 157, Lactococcus lactis NIZO Bl 157, Lactococcus lactis subsp. Lactis strain, Lactococcus lactis subsp. lactis strain IFPL730, Lactococcus lactis subsp. lactis strain IFPL730, Methanococcus jannaschii, Methanothermobacter thermautotrophicus str. Delta H Nocardia sp. JS614, Pseudomonas aeruginosa PAOl, Pseudomonas fluorescens PfO-I, Pseudomonas putida, Pseudomonas putida (ATCC 12633), Pseudomonas sp., Staphylococcus epidermidis RP62A, (Thermo) synechococcus vulcanus, or Zymomonas mobilis subsp. mobilis ZM4 (ATCC 31821). For example a source organism may be a plant of the genus Arabidopsis, Brassica or Triticum. In certain embodiments, the source organism may be of the species Arabidopsis thaliana, Brassica napus or Triticum secale. For example a source organism may be a mammal of the genus Oryctolagus, Rattus, Mus or Homo. In certain embodiments, the source organism may be of the species Oryctolagus cuniculus, Rattus norvegicus, Mus musculus or Homo sapiens. For example a source organism may be a protozoa of the genus Trypanosoma. In certain embodiments, the source organism may be of the species Trypanosoma cruzi. In some cases, the source organism can be the organism from which any of the polypeptides represented by the Genbank Accession and/or Genbank GI numbers in Figures 2-34 are derived.
[087] Succinate dehydrogenase (SDH) polypeptides: "Succinate dehydrogenase (SDH) (complex II or succinate ubiquinone oxidoreductase) polypeptides" are polypeptides that participate in the aerobic mitochondrial electron transport chain and tricarboxylic acid (TCA) cycle by oxidizing succinate to fumarate and transferring the electrons to ubiquinone (EC 1.3.5.1). Two electrons from succinate are transferred one at a time through a flavin cofactor and a chain of iron-sulfur clusters to reduce ubiquinone to an ubisemiquinone intermediate and to ubiquinol. In general, a complex of SDH polypeptides is composed of a catalytic heterodimer and a membrane domain, comprising two smaller hydrophobic subunits that anchor the enzyme to the mitochondrial inner membrane. Succinate dehydrogenase (SDH) of Saccharomyces cerevisiae consists of four subunits encoded by the SDHl, SDH2, SDH3, and SDH4 genes. In some cases the microorganism has a genetic modification that increases succinate dehydrogenase activity, for example, by increasing the level of succinate dehydrogenase polypeptide overall, increasing the level of succinate dehydrogenase in the relevant cell compartment or increasing the intrinsic activity of succinate dehydrogenase. For example, the genetic modification is the addition of a gene encoding a succinate dehydrogenase polypeptide; the genetic modification increases the transcription or translation of a gene encoding a succinate dehydrogenase polypeptide; the genetic modification increases activity by increasing expression of the succinate dehydrogenase polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the succinate dehydrogenase polypeptide is heterologous to the microorganism; the succinate dehydrogenase polypeptide is homologous to the microorganism. In some cases the microorganism has a genetic modification that decreases succinate dehydrogenase activity, for example, by decreasing the level of succinate dehydrogenase overall, decreasing the level of succinate dehydrogenase in the relevant cell compartment or decreasing the intrinsic activity of succinate dehydrogenase. For example: the genetic modification decreases expression of a succinate dehydrogenase polypeptide to a level below that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the genetic modification is a deletion of all or part of a gene encoding a succinate dehydrogenase polypeptide or the disruption of a gene encoding a succinate dehydrogenase polypeptide or one or more point mutations in a gene encoding a succinate dehydrogenase polypeptide; the genetic modification is a nucleotide substitution in one or more nucleotides of a succinate dehydrogenase coding or regulatory sequence that results in decreased succinate dehydrogenase expression or activity; the genetic modification is deletion of all or part of the succinate dehydrogenase coding sequence. The deletion, insertion or point mutation(s) can be in the promoter or the coding sequence. The deletion, insertion or point mutation(s) can decrease activity to less than 90%, 70%, 50%, 30%, 10% or 5% of the activity of a wild-type succinate dehydrogenase polypeptide. In some cases the succinate dehydrogenase polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of any of SEQ ID NOs: 88-91, or the polypeptides represented by the Genbank Accession numbers in Figure 32. [088] Transcription: As is known in the art, the term "transcription" refers to the process of producing an RNA copy from a DNA template.
[089] Transformation: The term "transformation", as used herein, typically refers to a process of introducing a nucleic acid molecule into a host cell. Transformation typically achieves a genetic modification of the cell. The introduced nucleic acid may integrate into a chromosome of a cell, or may replicate autonomously. A cell that has undergone transformation, or a descendant of such a cell, is "transformed" and is a "recombinant" cell. Recombinant cells are modified cells as described herein. If the nucleic acid that is introduced into the cell comprises a coding region encoding a desired protein, and the desired protein is produced in the transformed microbial cell and is substantially functional, such a transformed microbial cell is "functionally transformed." Cells herein may be transformed with, for example, one or more of a vector, a plasmid or a linear piece (eg., a linear piece of DNA created by linearizing a vector) of DNA to become functionally transformed. The plasmid or linear piece of DNA may or may not comprise a selectable or screenable marker.
[090] Translation: As is known in the art, the term "translation" refers to the production of protein from messenger RNA.
[091] Yield: The term "yield", as used herein, refers to the amount of a desired product (e.g.,
OAA and/or one or more C4-dicarboxylic acids) produced (molar or weight/volume) divided by the amount of carbon source (e.g., glucose, dextrose) consumed (molar or weight/volume) multiplied by 100.
[092] Unit: The term "unit", when used to refer to an amount of an enzyme, refers to the enzymatic activity and indicates the amount of micromoles of substrate converted per mg of total cell proteins per minute.
[093] Vector: The term "vector" as used herein refers to a DNA or RNA molecule (such as a plasmid, linear piece of DNA, cosmid, bacteriophage, yeast artificial chromosome, or virus, among others) that carries nucleic acid sequences into a host cell. The vector or a portion of it can be inserted into the genome of the host cell.
[094] Vitamin H transport (VHT) polypeptides: "Vitamin H transport (VHT) polypeptides" are polypeptides that mediate biotin uptake through a carrier-mediated and energy-requiring mechanism. Many microbes species are biotin auxotrophs; VHT polypeptide activity may be essential for growth in such strains. VHT polypeptides are members of a major facilitator superfamily. In some cases the microorganism has a genetic modification that increases VHT activity, for example, by increasing the level of VHT overall, increasing the level of VHT in the relevant cell compartment or increasing the intrinsic activity of VHT. For example, the genetic modification is the addition of a gene encoding a VHT polypeptide; the genetic modification increases the transcription or translation of a gene encoding a VHT polypeptide; the genetic modification increases expression of a VHT polypeptide to a level above that at which it is expressed in an otherwise identical microorganism that lacks the genetic modification; the VHT polypeptide is heterologous to the microorganism; the VHT polypeptide is homologous to the microorganism. In some cases the VHT polypeptide has an amino acid sequence that is at least about 75%, 85%, 90%, 95% or 100% identical to that of SEQ ID NO:77 or the polypeptides represented by the Genbank Accession numbers in Figure 13.
FIGURES
[095] FIGURE IA depicts a biological pathway for the production of OAA and C4- dicarboxylic acids.
[096] FIGURE IB is a table providing information about polypeptides useful in the production OAA and C4-dicarboxylic acids respectively. DNA sequences are not provided for each protein, but any suitable degenerate sequences, including codon optimized sequences, can be used to encode the disclosed polypeptides.
[097] FIGURE 1C is a table providing information about organic acid transporter polypeptides useful in the production OAA and C4-dicarboxylic acids respectively. DNA sequences are not provided for each protein, but any suitable degenerate sequences, including codon optimized sequences, can be used to encode the disclosed polypeptides.
[098] FIGURES 2-34 are tables disclosing lists of some of the candidate polypeptides that may be applicable to the OAA and C4-dicarboxylic pathways described herein. FIGURES 2-34 are referenced throughout the description. Each reference and information designated by each of the Genbank Accession numbers and/or Genbank GI numbers are hereby incorporated by reference in their entirety. The order of Genbank Accession and/or Genbank GI numbers, genes, polypeptides and sequences presented in Figures 2-34 is not indicative of their relative importance and/or suitability to any of the embodiments disclosed herein.
Detailed Description
Host Cells
[099] Any of a variety of host cells may be genetically engineered to increase the production of OAA and C4-dicarboxylic acids. It will often be desirable to utilize cells that are amenable to manipulation, particularly genetic manipulation, as well as to growth on large scale and under a variety of conditions. In certain cases, it will be desirable to utilize host cells that are amenable to growth under anaerobic conditions, microaerobic conditions, and/or under conditions of relatively low pH.
[0100] In some cases, it will be desirable to utilize yeast or fungal host cells. Any fungus known in the art for use in industrial processes can be used as a matter of routine experimentation by the skilled artisan having the benefit of the present disclosure. For example, the yeast to be modified (e.g., transformed) can be selected from any known genus and species of yeast. Yeasts are described by N. J. W. Kreger-van Rij, "The Yeasts," Vol. 1 of Biology of Yeasts, Ch. 2, A. H. Rose and J. S. Harrison, Eds. Academic Press, London, 1987. In one embodiment, the fungus can be of the genus Aspergillus, Saccharomyces, Yarrowia, or Zygosaccharomyces among others. In some embodiments, the fungus is of the species Aspergillus niger, Aspergillus terreus, S. cerevisiae, Y. lipolytica, or Zygosaccharomyces bailii.
[0101] In some cases it will be useful to employ bacterial cells. Particularly useful bacterial host organisms include Corynebacterium glutamicum and E. coli. Other useful bacteria, for example, gram positive, gram negative or archaebacteria, can be used as a host organism, e.g., the genus can be Actinobacillus, Alcaligenes, Bacteroides, Brevibacteria, Capnocytophaga, Corynebacteria, Erwinia, Escherichia, Haemophilus, Lactobacillus, Lactococcus, Methanococcus, Methanothermobacter, Nocardia, Propionibacterium, Pseudomonas , Staphylococcus, (Thermo) synechococcus, or Zymomonas. In certain embodiments, the host organism may be of the species Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Alcaligenes faecalis, Bacteroides fragilis, C. glutamicum, C. glutamicum (ATCC 13032), Capnocytophaga ochracea, E. carotovora, E. coli, Haemophilus influenzae, Lactobacillus plantarum, Lactococcus lactis NIZO Bl 157, Lactococcus lactis subsp. lactis strain IFPL730, Methanococcus jannaschii, Methanothertnobacter thertnautotrophicus str. Delta H, Nocardia sp. JS614, Pseudomonas aeruginosa PAOl, Pseudomonas putida, Pseudomonas putida (ATCC 12633), Staphylococcus epidermidis RP62A, (Thermo) synechococcus vulcanus, or Zymomonas mobilis subsp. mobilis ZM4 (ATCC 31821).
[0102] In some cases, the unmodified host cell naturally produces one or more C4-dicarboxylic acids and is modified to increase production and/or accumulation of one or more C4- dicarboxylic acids. In some cases, the unmodified host cell does not naturally produce one or more C4-dicarboxylic acids.
[0103] In general, any modification may be applied to a cell to increase or impart production and/or accumulation of one or more C4-dicarboxylic acids. In many cases, the modification comprises a genetic modification. In general, genetic modifications may be introduced into cells by any available means including chemical mutation and/or transfer (e.g., via transformation or mating) of nucleic acids. A nucleic acid to be introduced into a cell according to the present disclosure may be prepared by any available means. For example, it may be extracted from an organism's nucleic acids or synthesized by chemical means. Nucleic acids to be introduced into a cell may be, but need not be, in the context of a vector.
[0104] Genetic modifications that increase activity of a polypeptide include, but are not limited to: introducing one or more copies of a gene encoding the polypeptide (which may differ from any gene already present in the host cell encoding a polypeptide having the same activity); altering a gene present in the cell to increase transcription or translation of the gene (e.g., altering, adding additional sequence to, deleting sequence from, replacement of one or more nucleotides, or swapping for example, a promoter, regulatory or other sequence); and altering the sequence (e.g. coding or non-coding) of a gene encoding the polypeptide to increase activity (e.g., by increasing catalytic activity, reducing feedback inhibition, targeting a specific subcellular location, increasing mRNA stability, increasing protein stability). [0105] Genetic modifications that decrease activity of a polypeptide include, but are not limited to: deleting all or a portion of a gene encoding the polypeptide; inserting a nucleic acid sequence that disrupts a gene encoding the polypeptide; altering a gene present in the cell to decrease transcription or translation of the gene or stability of the mRNA or polypeptide encoded by the gene (for example, by altering, adding additional sequence to, deleting sequence from, replacement of one or more nucleotides, or swapping for example, a promoter, regulatory or other sequence) and altering the sequence (e.g. coding or non-coding) of a gene encoding the polypeptide to decrease activity (e.g., by decreasing catalytic activity, increasing feedback inhibition, mislocalizing to a non-native subcellular location, decreasing mRNA stability, decreasing protein stability).
[0106] A vector for use in accordance with the present methods can be a plasmid, linear piece of DNA, a cosmid, or a yeast artificial chromosome, among others known in the art to be appropriate for use in microorganisms (e.g. fungi, bacteria). A vector can comprise an origin of replication, which allows the vector to be passed on to progeny cells of a parent cell comprising the vector. Alternatively, if integration of the vector into the host cell genome is desired, the vector can comprise sequences that direct such integration (e.g., specific sequences or regions of homology, etc.).
[0107] Nucleic acids to be introduced into a cell may be so introduced together with at least one detectable marker (e.g., a screenable or selectable marker). In some embodiments, a single nucleic acid molecule to be introduced may include both a sequence of interest (e.g., a gene encoding a polypeptide of interest as described herein) and a detectable marker. In general, a detectable marker allows cells that have received an introduced nucleic acid to be distinguished from those that have not. For example, a selectable marker may allow transformed cells to survive on a medium comprising an antibiotic fatal to untransformed cells, or may allow transformed cells to metabolize a component of the medium into a product not produced by untransformed cells, among other phenotypes.
[0108] As will be appreciated, nucleic acids can be introduced into cells by any available means including, for example, chemical-mediated transformation, particle bombardment, electroporation, etc.
[0109] Nucleic acids to be expressed in a cell are typically in operative association with one or more expression sequences such as, for example, promoters, terminators, and/or other regulatory sequences. Any such regulatory sequences that are active in the host cell (including, for example, homologous or heterologous host sequences, constitutive, inducible, or repressible host sequences, etc.) can be used.
[0110] A promoter, as is known, is a DNA sequence that can direct the transcription of a nearby coding region. A promoter can be constitutive, inducible or repressible. Constitutive promoters continually direct the transcription of a nearby coding region. Inducible promoters can be induced by the addition to the medium of an appropriate inducer molecule, which will be determined by the identity of the promoter. Repressible promoters can be repressed by the addition to the medium of an appropriate repressor molecule, which will be determined by the identity of the promoter.
[0111] Representative useful promoters for fungal expression include, for example, the constitutive promoter S. cerevisiae triosephosphate isomerase (TPI) promoter, the S. cerevisiae glyceraldehyde-3 -phosphate dehydrogenase (isozyme 3) TDH3 promoter, the S. cerevisiae TEFl promoter and the S. cerevisiae ADHl promoter. Representative terminators for use in accordance with the present disclosure include, for example, S. cerevisiae CYCl.
[0112] Representative promoters for bacterial expression include, for example, the lac, trc, trcRBS, phoA, tac, or XPLAPR promoter from E. coli (or derivatives thereof) or the phoA, gpd, rplM, or rpsJ promoter from a coryneform bacteria.
[0113] In some cases, a genetic modification is one that involves disruption of one or more nucleic acid sequences present in a cell. Such disruption may be achieved by any desired means including, for example, chemical disruption and/or integration of disrupting nucleic acid sequences, etc.
[0114] Alternatively or additionally, a genetic modification may comprise introduction of one or more new nucleic acids into a cell. In some cases, the introduced nucleic acid sequences may be from a heterologous source; in some embodiments, introduced nucleic acid sequences may represent additional or alternative copies of sequences already present in the cell.
[0115] In some cases, where nucleic acid sequences originating from a source heterologous to the host cell are utilized, such sequences may be modified, for example, to adjust for codon preferences and/or other expression-related aspects (e.g., linkage to promoters and/or other regulatory sequences active in the host cell, etc.) of the host cell system.
Production and Isolation of one or more C4-dicarboxylic acids
[0116] After obtaining a recombinant microorganism, the microorganism can be cultured in a medium. The medium can be any medium known in the art to be suitable for this purpose. Culturing techniques and media are known in the art. In one embodiment, culturing can be performed by aqueous fermentation in an appropriate vessel. Examples for a typical vessel for fermentation comprise a shake flask or a bioreactor.
[0117] The medium can comprise a carbon source such as glucose, sucrose, fructose, lactose, galactose, or hydrolysates of vegetable matter, among others. In some cases, the medium can also comprise a nitrogen source as either an organic or an inorganic molecule. Alternatively or additionally, the medium can comprise components such as amino acids; purines; pyrimidines; corn steep liquor; yeast extract; protein hydrolysates; water-soluble vitamins, such as B complex vitamins; inorganic salts such as chlorides, hydrochlorides, phosphates, or sulfates of Ca, Mg, Na, K, Fe, Ni, Co, Cu, Mn, Mo, or Zn, among others. Further components known to one of ordinary skill in the art to be useful in yeast culturing or fermentation can also be included. The medium can be buffered but need not be. Considerations for selection of medium components include, but are not limited, to productivity, cost, and impact on the ability to recover one or more C4-dicarboxylic acids.
[0118] The carbon dioxide source can be gaseous carbon dioxide (which can be introduced to a headspace over the medium or sparged through the medium) or a carbonate salt (for example, calcium carbonate), for example, incorporated into the medium.
[0119] A host cell is modified to increase its production of one or more C4-dicarboxylic acids. The modified cell can be cultured under conditions and for a time sufficient for one or more C4- dicarboxylic acids to accumulate. In some cases, such modification allows one or more C4- dicarboxylic acids to be produced when it was not produced previously. In some cases the modification increases production of one or more C4-dicarboxylic acids in a cell that already produces one or more C4-dicarboxylic acids at some level. Thus, a modification or modifications can increase production of one or more C4-dicarboxylic acids at least about 1.1- fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 35 -fold, at least about 50-fold as compared with an otherwise identical host cell lacking the modification(s).
[0120] After culturing has progressed for a sufficient length of time to produce a desired concentration of one or more C4-dicarboxylic acids, it can be brought to a state of greater purity by separation of the one or more C4-dicarboxylic acids from at least one other component of the microbial cell or the medium. In some cases, the one or more C4-dicarboxylic acids is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, pure or more.
[0121] Any available technique can be utilized to isolate the accumulated one or more C4- dicarboxylic acids. For example, the isolation can comprise purifying the one or more C4- dicarboxylic acids from the medium by known techniques, such as the use of an ion exchange resin, activated carbon, microfiltration, ultrafiltration, nanofϊltration, liquid-liquid extraction, crystallization, electrodialysis, or chromatography, among others.
Exemplification
[0122] The following examples are included to demonstrate certain embodiments of the disclosure. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the disclosure, and thus can be considered to constitute certain modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure. [0123] Saccharomyces cerevisiae has been engineered for increased production of oxaloacetate by overexpression of pyruvate carboxylase (PYC), an approach that has proved useful for generation of strains that produce high levels of malic acid (WO/2009/011974). In S. cerevisiae the carboxylation reaction catalyzed by pyruvate carboxylase consumes ATP so that the production of oxaloacetate from glucose yields no ATP by substrate level phosphorylation. Furthermore, two other highly expressed yeast enzymes, pyruvate decarboxylase and pyruvate dehydrogenase, also use pyruvate as a substrate, and the reactions catalyzed by these two enzymes are much more thermodynamically favorable than that catalyzed by pyruvate carboxylase. These limitations can be addressed by engineering a strain that generates oxaloacetate via carboxylation of phosphoenolpyruvate using either phosphoenolpyruvate carboxykinase (PEPCK) or phosphoenolpyruvate carboxylase (PPC).
[0124] In contrast to the ATP neutral conversion of phosphoenolpyruvate (PEP) to oxaloacetate via pyruvate kinase and pyruvate carboxylase, the one-step carboxylation of PEP to oxaloacetate via phosphoenolpyruvate carboxykinase (PEPCK) yields ATP. However, the endogenous S. cerevisiae PEPCK, which is regulated as a gluconeogenic enzyme, has never been shown to catalyze a net in vivo conversion of PEP to oxaloacetate. It is possible that this lack of activity is due to glucose repression, catabolite inactivation, thermodynamic constraints, and/or low substrate affinity. In an attempt to improve malic acid production, particularly under anaerobic conditions and/or high levels of carbon dioxide, we constructed S. cerevisiae strains expressing a heterologous PEPCK. As described below, we were able to generate strains that produced high levels of malic acid under conditions of high carbon dioxide with reduced need for carbon catabolism for ATP production.
[0125] A second alternative anaplerotic reaction, the carboxylation and dephosphorylation of phosphoenolpyruvate by PPC, is nearly thermodynamically equivalent to the reaction catalyzed by PYK, the main enzyme acting on phosphoenolpyruvate in S. cerevisiae. Since the enzyme PPC is not found in yeast, overexpression of a heterologous PPC was thought to be a promising strategy for diverting carbon flux away from ethanol and the tricarboxylic acid cycle and towards oxaloacetate and derivatives thereof. Strains were generated that produced high levels of malate via PPC dependent carboxylation.
[0126] Example 1 : Initial selection for anaplerosis via PEPCK
To test whether overexpression of a heterologous PEPCK could relieve the C4-compound medium requirement for growth of a pyruvate carboxylase negative (Pyc) S. cerevisiae strain, a strain was generated from CEN.JB27 (Bauer et al. (1999) FEMS Microbiol Lett. 179:107-13) as follows. CEN.JB27 (Table 1) was grown on 5-FOA agar plates, prepared with synthetic medium (SM: demineralized water, 3 g/1 KH2PCK 0.5 g/lMgSC>4 * 7 H2O, 6.6 g/1 K2SO4, vitamins and trace elements (Verduyn et al. (1992) Yeast 8:501-17) supplemented with 1 g/15-FOA to select for plasmid loss, aspartic acid as the nitrogen and C4 source (6.7 g/1), uracil (0.03 g/1) and 20 g/1 Bacto Agar. Notably, the pH was not set. Uracil auxotrophy and diagnostic PCR of the E. coli PPC confirmed plasmid loss for the transformant IMK157. Stock cultures of this and all other CEN.JB27-derived strains were grown in SM, supplemented with 20 g/1 glucose, 6.7 g/1 aspartic acid with the pH adjusted to 6.0 with KOH (SM ASP media). After growth in shake-flasks, glycerol was added to the culture broth (20% v/v) and 2 ml aliquots were stored at -80 0C. IMY002 was constructed by transformation of IMKl 57 with the plasmid MB4917 (WO/2009/011974) which harbored the PEPCK gene from A. succinogenes on a CEN plasmid under the strong TDH3 promoter. IMY002 was tested for growth on glucose in SM supplemented with 20 g/1 glucose, with ammonium sulfate (1 g/1) as the nitrogen source. No growth was observed under atmospheres of air, 20% CO2 or 100% CO2. [0127] To select for mutants of the PEPCK-overexpressing Pyc'S. cerevisiae strain IMY002 with the ability to grow on glucose without supplementation with C4-compounds, IMY002 was grown in a pH-controlled nitrogen-limited chemostat in continuous cultivation medium with aspartate at a dilution rate of 0.1 /h. Pre-cultures for continuous fermentations were grown overnight in shake flasks in SM ASP. Chemostat fermentations were performed anaerobically at 30 0C in 2 1 fermentors (Applikon, Schiedam, the Netherlands) with a working volume of 1 1. The pH was controlled at 5.0 by automated addition of 2 M KOH, while medium addition was controlled by a peristaltic pump. The culture volume was kept constant using an electrical level sensor. Medium for continuous cultivation consisted of demineralized water with 3 g/1 KH2PO4, 6.6 g/1 K2SO4, 0.5 g/1 MgSO4 * 7 H2O, 0.15 ml/1 silicon antifoam (BDH, Poole, UK) and 1 ml/1 trace element solution according to Verduyn et al. supra. In cultures with ammonia as the nitrogen source 1 g/1 (NH4)2SO4 was added. After heat sterilization for 20 min at 120 0C, solutions of vitamins (filter-sterilized, according to Verduyn et al. supra), ethanol-dissolved ergosterol and Tween 80 (final concentrations of respectively 0.01 g/1 and 0.42 g/1), glucose (30 g/1, autoclaved for 20 min at 110 0C) were added. For medium without ammonium sulfate, aspartic acid (2 g/1, filter sterilized, pH set to 5 with KOH) was added as the nitrogen source. [0128] After a steady state was obtained with a dry weight of 2.8 g/1, the nitrogen source in the feed medium was changed from aspartate to ammonium sulfate. To improve the thermodynamics of the PEPCK reaction, the fermentation was continuously sparged with pure CO2. The rate of base addition, which is closely related to the speed of ammonium consumption and thus to growth, showed a steady decrease after the medium switch at t = 97 hours, and biomass dry weight followed washout kinetics. To prevent further washout, the medium feed pump was switched off 23 hours after the medium switch, resulting in a residual dry weight concentration of 0.3 g/1. After an additional 60 hours, the rate of base addition started to increase again, indicating that biomass was being produced in significant quantities. Due either to glucose or nitrogen depletion, growth halted, but after turning on the medium feed pumps again at t = 264 hours at a dilution rate of 0.05/h, ammonium consumption resumed immediately at a steady rate. Biomass increased to approximately 2 g/1. Finally, switching from CO2 sparging to N2 sparging at t = 440 hours resulted in washout of the culture, which was monitored by dry weight measurements. A similar result was obtained with a second fermentation. [0129] Culture samples from both cultivations were streaked on ammonium sulfate plates under 100% CO2 or N2 atmosphere. In contrast to the original Pyc" strain IMY002, which did not grow on SM plates with 1 g/1 ammonium sulfate (SM ammonia) even after prolonged incubation, the culture samples from both fermentations did produce colonies when incubated under a 100% CO2 atmosphere. This phenotype was retained after propagation on glucose-aspartate medium. These results suggest that the new phenotype of the isolates, growth under 100% CO2 atmosphere on ammonium sulfate, is the result of one or more genetic mutations, and is not merely the result of adaptation. For both fermentations single colonies were selected from plate, stocked on SM ASP under an air atmosphere, and designated IMY050 and IMY051.
Table 1 : Strains used in this study
Figure imgf000060_0001
Figure imgf000061_0001
[0130] In an effort to localize these putative mutations to either the plasmids or the genome, IMY050 and IMY051 were grown on non-selective YPD medium to stimulate plasmid loss. After several serial transfers, culture broth was plated on YPD. Single colonies were then transferred to agar plates made with SM ASP (without uracil) or YPD to check for uracil auxotrophy. Colonies which only grew on the YPD plate were restreaked to confirm the phenotype and subsequently stored as IMWOOl and IMW002. In addition, the plasmids from IMY050 and IMY051 (MB4917*1 and MB4917*2, respectively) were isolated with a Zymoprep II Yeast Plasmid Miniprep Kit (Zymo Research Corp., Orange CA), transformed to competent Escherichia coli TOPlO cells (Invitrogen, Carlsbad, CA) and isolated with a GenElute Plasmid Miniprep Kit (Sigma Aldrich, St. Louis, MO). IMY002, IMWOOl and IMW002, were then transformed with MB4917, MB4917*1 (IMWOOl only), MB4917*2 (IMW002 only) and pUDC 1 , an empty vector obtained by introducing an additional Xbal site after the stop codon of the PEPCK gene in MB4917 by PCR using primers MB4917 EV Forward and MB4917 EV Reverse (Table 2), followed by Xbal digestion and self ligation of the gel isolated vector fragment. The resulting set of strains was tested for growth under 100% CO2 atmosphere on SM ammonia or SM ASP. Of the various strains, only the initial isolates, IMY050 and IMY051, and IMWOOl and IMW002, with either the original or isolated plasmids were able to grow on SM ammonia, indicating that the mutation was stable and was located on the genome. However, the lack of growth on SM ammonia observed for the cured strains with the empty vector indicated that overexpression of PEPCK is required for growth.
Table 2: Oligonucleotides used in this study
Figure imgf000062_0001
[0131] Example 2: Further selection for anaplerosis via PEPCK and characterization of strains. Based on the success of this preliminary work in selecting for anaplerotic PEPCK activity, we sought mutants with the ability to produce malic acid. The strain MY2888 (MTH1ΔT, Ieu2, ura3, trpl, pycl::LEU2, pyc2::HIS3, canl::TDH3p-Spmael::TRPl::TDH3p-MDH3delSKL, pdc5::loxP; described in WO/2009/011974) has been developed as an optimized host for production of malic acid, when pyruvate carboxylase activity is reintroduced. MY2888 was transformed to prototrophy with MB4914, MB4917 or MB4922, encoding respectively, the PEPCK from Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, and Erwinia carotovora to yield the strains MY3272, MY3273, and MY3274, described in WO/2009/011974. As with IMY002, these strains are incapable of growth on minimal medium with ammonium sulfate in air or 20% CO2.
[0132] The strains were first grown overnight in YNB ASP (1.7 g/1 yeast nitrogen base, Difco, 20 g/1 glucose, 5.3 g/1 aspartate adjusted to pH 6.0 with KOH). The strains were then plated (6 x 106 cfu/plate) on YNB ammonia (20 g/1 glucose, 5 g/1 NH4SO4) and exposed to 1 J/m2 ultraviolet light (U/V) in a GS Gene Linker (Biorad, Hercules, CA) to induce mutation. Plates were transferred in the dark to an incubation chamber with 20% CO2 and incubated 5-7 days. This and all other cultivations in 20% CO2 were carried out in a HeraCell (Thermo Scientific) incubator set to 20% CO2/80% air, 300C. Colonies from these plates were restreaked onto YNB ammonia plates and grown in 20% CO2 to confirm they had acquired the ability to grow on ammonia as the sole nitrogen source. Strains derived in this manner were routinely propagated on YNB ASP.
[0133] Strains selected by the above method were fermented to produce malic acid as follows. To adapt cells prior to malate producing shake flask fermentations, strains were passaged at least twice on YNB ammonia agar in 20% CO2 in air. Adapted cells were used to inoculate seed fermentations in 10 ml SM-M media (as SM media except without K2SO4 and having 3.0 g/1 MgSO4*7H2O) supplemented with 1 g/1 urea, 10 g/1 glucose. Liquid cultivations in 20% CO2 were grown in 125 ml baffled flasks with shaking at 150 rpm on a Labotron shaker (Infors, Bottmingen, Switzerland). Precultures were used to inoculate 10 ml SM-M with 1 g/1 urea, 100 g/1 glucose and 5 g/1 CaCO3 at an initial ODβoo = 0.5. Cultures were grown 72 h and analyzed for malic acid by HPLC as described in WO/2009/011974. Malate production data is shown in Table 3.
[0134] Example 3 : Pyruvate kinase activity assays
We hypothesized that the required mutation might be related to pyruvate kinase (PYK) activity, as PYK competes with PEPCK for PEP. Cell free extracts were prepared from one of the fermentors in Example 1 as described by Zelle et al. (2008) Appl Environ Microbiol. 74:2766-77 and protein concentrations in cell extracts were determined by the Lowry method using bovine serum albumin as the standard. PYK activity was assayed in 0.1 M cacodylic acid (pH 6.2), 0.1 M KCl, 10 mM ADP, 1 mM fructose- 1 ,6-bisphosphate, 25 mM MgCl2, 0.15 mM NADH, 10 U/ml lactate dehydrogenase. The reaction was started by the addition of 2 rnM phosphoenolpyruvate and followed by the change in absorbance at 340 nm. Enzyme measurements showed a 5 -fold decrease in PYK activity after selection, from 10 to 2 μmol/min/mg protein.
Table 3: Malate production by and sequence of PYKl locus from selected strains derived in this study
Figure imgf000064_0001
Αpck gene encoded by plasmid in each strain: As, Actinobacillus succinogenes pck; Ap, Actinobacillus pleuropneumoniae pck; Ec, Erwinia carotovora pck b Strains fermented on SM-M with 1 g/1 urea, 100 g/1 dextrose, 5 g/1 CaCO3 in 20% CO2 c not determined
[0135] Example 4: Mutations in the PYKl locus
The PYKl locus from strains generated as described above was sequenced, and 17 unique mutations were discovered (Table 3), 16 resulting in amino acid changes and one in a deletion within the promoter. Sequence was obtained by PCR amplifying the region from 650 bp upstream to 150 bp downstream of the PYKl locus using MO6354 and MO6197 (Table 2) in five separate reactions which were then pooled and sequenced using oligos MO6355, MO6195, MO6359, MO6357 and MO6361.
[0136] Example 5 : Mutation to PYKl is sufficient to enable anaplerosis via PEPCK In order to demonstrate that a PYKl mutation coupled with PEPCK overexpression was sufficient for malate production in a Py c- MDH3Δskl MTHΔT Spmael background, a strain was constructed as follows. PYKl was deleted from a malate producing strain (MY2928) that harbored an episomal construct encoding the pyruvate carboxylase from Yarrowia lipolytica (MB5094) by transformation with a PCR product amplified from the Saccharomyces cerevisiae heterozygous deletion diploid collection (ATCC, Cat #GSA-6, Manassas, VA). The PCR product, obtained using oligos MO6194 and MO6196, consisted of the kanMX ORF, conferring G418 resistance, flanked by -300 bp of sequence 5' and 3' of the pyklr.kanMX cassette. G418 resistant colonies were selected and streaked to YNB agar supplemented with 5-FOA (1 mg/ml), ethanol (10 g/1), glycerol (10 g/1), aspartate (5.3 g/1), uracil (50 mg/1) and casamino acids (2 g/1) to yield pykl ::kanMXPyc- strains lacking episomal Y. lipolytica PYC. These strains were incapable of growth on glucose.
[0137] The pykl:: kanMX Py c- strain is transformed with a PCR product from the MY3898 pykl locus, which contains a C -> T substitution at nucleotide 1211 of the PYKl sequence, resulting in the mutation S404F, obtained using oligos MO6354 and MO6197. Transformants are selected for the ability to grow on glucose by plating to YPD, and the presence of the mutation is confirmed by sequencing as described above. This strain is transformed to prototrophy with the episome MB4917, encoding /?c£ from Actinobacillus succinogenes. Growth of this strain on YNB ammonia medium in 20% CO2 atmosphere demonstrates the pykl mutation is sufficient to enable PEPCK anaplerotic activity.
[0138] Example 6: Anaplerosis via phosphoenolpyruvate carboxykinase (PEPCK) from Capnocytophaga ochracea and Bactericides fragilis
[0139] Genes encoding the phosphoenolpyruvate carboxykinase (PEPCK) proteins corresponding to those encoded by B acteroides fragilis and Capnocytophaga ochracea were constructed by de novo gene synthesis as follows. The sequences in Table 4 were synthesized by Blue Heron (Bothell, WA), cleaved with Xbal andXhol, and ligated to pRS426-GPD (Mumberg et al. (1995) Gene 156: 119-22) to produce MB5534 (B. fragilis pck) and MB5535 (C. ochracea pck). MY3825 was cured of plasmid on YNB ASP with 5-FOA (1 mg/ml) and transformed to prototrophy with MB5534 and MB5535, yielding MY4114 and MY4115. Both were capable of growth on YNB ammonia in 20% CO2, and when fermented as in Example 3, produced 6 and 4.5 g/1 malate respectively.
Table 4. DNA sequences encoding PEPCK genes.
Figure imgf000066_0001
tactggttatacaggcgaaatcaaaaaaggtattttctcagctatgaacttcgaactaccagtatttagaaa caccatgcctatgcactgttcagcaaatgttggtaaaggaggagacactgctatcttctttggactatcagg aacgggaaaaacaacattatctgcagatccgaatagacaccttataggagacgacgaacacggatggacccc tgaaaatacagtatttaattttgaaggtggttgctacgccaaagttgtggacttgacagcagaaaaagaacc cttttccagaactgacataactgaaaatacgagagtttcctacccgatataccatatagcaaacattcaacc tggaagtattggccataaccctaaaaatatatttttcttgacgtttgatgcatatggagtattacccccaat ttctaaattaacccctgaacaagcagcataccaattcgtttcaggttacacaagcaaagtcgcgggtacaga agtaggaataacaacccctcaaaagacattctccgcttgtttcggtgcagcttttatgccattacatcccgc caacggtaagatgaaaagatgtagtttgaaagatacaagagcattaattaccgcagccctaaacggaaaact tcaatcaatattgaaccccgagaatacatggtctgacaaagctcaattttctgcgaaattaaaagaactagc tgaatcttttgtacaaaatttcaaagataaaaagtttgccgaaggcgcctccgctgatgtattagccggagc tcccaaattataactcgag
[0140] Example 7: Anaplerosis via a heterologous PPC
The plasmid MB5060, encoding the Corynebacterium glutamicum ppc was constructed as follows. DNA was amplified with primers CgPPC-fr and CgPPC-rv using proofreading polymerase Pfu under reaction conditions specified by the manufacturer (Stratagene, La Jolla, CA) and C. glutamicum genomic DNA as a template. The fragment obtained was digested with Accl and Dral, and end-filled with Klenow before being gel purified and ligated into pDB20 (Becker, et al, PNAS, 1991. 88: 1968-1972.) which had been digested with Notl, end-filled with Klenow and gel purified. Identity of the plasmid and orientation of the insert was confirmed by restriction digest. MY2888 was transformed to prototrophy with MB5060 to yield the strain MY3461, which was capable of growth on SM ammonia. When fermented in SM-M with 10% glucose and 5% CaCO3, MY3461 produced 16 g/1 malic acid. [0141] Example 8: Anaplerosis via a heterologous PPC in pykl mutant strains In order to increase yield of malate via phosphoenolpyruvate carboxylase catalyzed anaplerosis, C glutamicum ppc was overexpressed in strains with mutations in the pykl gene described above. Strains MY4246, MY4247, and MY4248 were constructed from MY3683, MY3826 and MY3827, respectively. First, these strains were cured of their episome by streaking to YNB ASP agar plates supplemented with 1 g/1 5-FOA to yield Ura" strains without an episome. Strains were transformed to prototrophy with MB5060 to yield MY4246, MY4247 and MY4248. When fermented in SM-M with 10% glucose and 5% CaCO3, these strains produced 45, 60, and 40 g/1 malic acid.

Claims

1. A recombinant fungal cell having a first genetic modification that decreases pyruvate kinase activity and a second genetic modification that increases phosphoenolpyruvate carboxykinase activity, wherein the recombinant fungal cell, when cultured under conditions that produce a C4 dicarboxylic acid, produces more of at least one C4 dicarboxylic acid than an otherwise identical fungal cell not having the first and second genetic modifications.
2. A recombinant fungal cell having a genetic modification that increases the activity of a dicarboxylic acid transporter, wherein the dicarboxylic transporter has at least 90% identity to any of SEQ ID NOs: 104, 109, and 110.
3. The recombinant fungal cell of claim 1 having a further genetic modification that increases the activity of a dicarboxylic acid transporter.
4. The recombinant fungal cell of claim 3 wherein the dicarboxylic transporter has at least 90% identity to any of SEQ ID NOs: 104, 109, and 110.
5. The recombinant fungal cell of any of claims 1-4 having a genetic modification that increases malate dehydrogenase (MDH) activity.
6. The recombinant fungal cell any of claims 1-5 having a further genetic modification selected from the group consisting of a modification that: a. increases anaplerotic activity; b. increases or decreases organic acid transport activity; c. increases or decreases glucose sensing and regulatory polypeptide activity; d. increases or decreases hexose transporter (HXT) activity; and e. increases or decreases the activity of a C4 dicarboxylic acid biosynthetic polypeptide.
7. The recombinant fungal cell of claim 6, wherein the further genetic modification to increase anaplerotic activity comprises at least one modification selected from the group consisting of a modification that: a. increases pyruvate carboxylase (PYC) activity; b. increases phosphoenolpyruvate carboxylase (PPC) activity; c. decreases pyruvate decarboxylase (PDC) activity; d. increases biotin protein ligase (BPL) activity; e. increases biotin transport protein (VHT) activity; f. increases or decreases bicarbonate transport activity; g. increases carbonic anhydrase activity.
8. The recombinant fungal cell claim 6, wherein the modification to increase or decrease the activity of a C4 dicarboxylic acid polypeptide comprises at least one modification selected from the group consisting of a modification that: a. increases malate dehydrogenase (MDH) activity; b. increases or decreases fumarase activity; c. increases or decreases fumarate reductase activity; d. increases or decreases malate synthase activity; e. increases or decreases malic enzyme activity; f. increases or decreases isocitrate lyase activity; g. increases or decreases ATP-citrate lyase activity; h. increases or decreases succinate dehydrogenase activity.
9. The recombinant fungal cell of claim 7 wherein the genetic modification to decrease pyruvate decarboxylase (PDC) activity reduces the activity of each of PDCl, PDC5, and PDC6.
10. The recombinant fungal cell of claim 7 wherein the genetic modification to decrease pyruvate decarboxylase (PDC) activity reduces the activity of only two of PDCl, PDC5 and PDC6.
11. The recombinant fungal cell of claim 7 wherein the genetic modification to decrease pyruvate decarboxylase (PDC) activity reduces the activity of only one of PDCl, PDC5 and PDC6.
12. The recombinant fungal cell of claim 6, wherein the modification to increase or decrease glucose sensing and regulatory polypeptide activity comprises at least one modification selected from the group consisting of modifications to increase or decrease SNFl, MIGl, MIG2, HXK2, RGTl, SNF3, RGT2, STDl, MTHl, GRRl, YCKl, HXKl, and GLKl polypeptide activity.
13. The recombinant fungal cell of claim 6, wherein the genetic modification to increase hexose transporter (HXT) activity comprises at least one modification selected from the group consisting of modifications to increase or decrease HXTl, HXT2, HXT3, HXT3, HXT4, HXT5, HXT6, or HXT7 polypeptide activity.
14. A method of producing a C4-dicarboxylic acid, comprising: culturing a recombinant fungal cell of any one of preceding claims under conditions that achieve C4-dicarboxylic acid production.
15. The method of claim 14, wherein the C4-dicarboxylic acid is chosen from one or more of malic acid, succinic acid and fumaric acid.
16. A recombinant microbial cell comprising at least one genetic modification selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity; (e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
17. The recombinant microbial cell of claim 16 comprising at least two genetic modifications selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
18. The recombinant microbial cell of claim 17 comprising at least three genetic modifications selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
19. The recombinant microbial cell of claim 18 comprising at least four genetic modifications selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
20. The recombinant microbial cell of claim 19 comprising at least five genetic modifications selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
21. The recombinant microbial cell of claim 20 comprising at least six genetic modifications selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity; (b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
22. The recombinant microbial cell of claim 21 comprising at least seven genetic modifications selected from:
(a) a genetic modification that increases or decreases pyruvate carboxylase (PYC) activity;
(b) a genetic modification that increases phosphoenolpyruvate carboxylase (PPC) activity;
(c) a genetic modification that increases phosphoenolpyruvate carboxykinase (PEPCK) activity;
(d) a genetic modification that decreases pyruvate kinase (PYK) activity;
(e) a genetic modification that increases malate dehydrogenase activity;
(f) a genetic modification that decreases PDC activity; and
(g) a genetic modification that increases MTHl activity.
23. The recombinant microbial cell of claim 16 wherein the cell comprises a genetic modification that increases pyruvate carboxylase activity and a genetic modification that decreases PDC activity.
24. The recombinant microbial cell of claim 16 wherein the cell comprises a genetic modification that decreases PYK activity and a genetic modification that increases phosphoenolpyruvate carboxylase activity.
25. The recombinant microbial cell of claim 16 wherein the cell comprises a genetic modification that decreases pyruvate kinase activity and a genetic modification that increases phosphoenolpyruvate carboxykinase activity.
26. The recombinant microbial cell of claim 25 wherein the cell further comprises a genetic modification that increases phosphoenolpyruvate carboxylase activity.
27. The recombinant microbial cell of any of claims 24-26 wherein the cell further comprises a genetic modification that decreases pyruvate carboxylase activity.
28. The recombinant microbial cell of any of claims 24-26 where in the cell further comprises a genetic modification that increases pyruvate carboxylase activity.
29. The recombinant cell of claims 9-13 wherein the cell further comprises a genetic modification that decreases PDC activity.
30. The recombinant microbial cell of any of claims 23-29 further comprising a genetic modification that increases MTHl activity.
31. The recombinant microbial cell of any of claims 23-30 further comprising a genetic modification that increases malate dehydrogenase activity.
32. The recombinant microbial cell of any of claims 23-31 further comprising a genetic modification that increases organic acid transporter polypeptide activity
33. The recombinant microbial cell of any of claims 16-32 wherein the pyruvate carboxylase is at least 80% identical to any of SEQ ID NOs: 1-8 or a polypeptide represented by a Genbank Accession number in Figure 2.
34. The recombinant microbial cell of any of claims 16-33wherein the phosphoenolpyruvate carboxylase is at least 80% identical to any of SEQ ID NOs: 9-16 or a polypeptide represented by a Genbank Accession number in Figure 3.
35. The recombinant microbial cell of any of claims 16-34 wherein the phosphoenolpyruvate carboxykinase is at least 80% identical to any of SEQ ID NOs: 17-22 or a polypeptide represented by a Genbank Accession number in Figure 4.
36. The recombinant microbial cell of any of claims 16-35 wherein the pyruvate kinase is at least 80% identical to any of SEQ ID NOs: 23-40 or a polypeptide represented by a Genbank Accession number in Figure 5.
37. The recombinant microbial cell of any of claims 16-36 wherein the genetic modification that decreases PDC activity is decreased activity of at least one polypeptide that is at least 80% identical to any of SEQ ID NOs: 41-44 or a polypeptide represented by a Genbank Accession number in Figure 7.
38. The recombinant microbial cell of any of claims 16-37 wherein the genetic modification that increases MTHl activity is increased activity or expression of an MTHl or MTH 1ΔT polypeptide that is either a) at least 80% identical to either of SEQ ID NOs: 45-46 or a polypeptide represented by a Genbank Accession number in Figure 8; or b) at least 90, 95, 100% identical to SEQ ID NO: 46 (S. cerevisiae MTH1ΔT).
39. The recombinant microbial cell of any of claims 16-38 wherein the malate dehydrogenase is either: at least 80% identical to any of SEQ ID NOs: 47-52, or 78 or a polypeptide represented by a
Genbank Accession number in Figure 6; or at least 90, 95, 100% identical to SEQ ID NO: 78 (MDH3ΔSKL).
40. The recombinant microbial cell of any of claims 16-39 wherein the organic acid transporter polypeptide is at least 80% identical to any of SEQ ID NOs: 92-105, 109, 110 or a polypeptide represented by a Genbank Accession number in Figure 25.
41. The recombinant microbial cell of claim 40 wherein the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 101 (S. pombe MAEl).
42. The recombinant microbial cell of claim 40 wherein the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 105 (A. oryzae OAT).
43. The recombinant microbial cell of claim 40 wherein the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 104 (A.flavus OAT).
44. The recombinant microbial cell of claim 40 wherein the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO: 109
45. The recombinant microbial cell of claim 40 wherein the organic acid transporter polypeptide is at least 90, 95, 96, 97, 98, 99, or 100% identical to SEQ ID NO:110
46. The recombinant microbial cell of any of the preceding claims wherein the cell is a fungus.
47. The recombinant microbial cell of claim 46 wherein the fungus is from a genus selected from Aspergillus, Saccharomyces, Yarrowia, and Zygosaccharomyces.
48. The recombinant microbial cell of claim 37 where in the fungus is of the species Aspergillus niger.
49. The recombinant microbial cell of claim 47 where in the fungus is of the species Aspergillus terreus.
50. The recombinant microbial cell of claim 47 where in the fungus is of the species Yarrowia lipolytica.
51. The recombinant microbial cell of claim 47 where in the fungus is of the species Zygosaccharomyces bailii.
52. The recombinant microbial cell of claim 47 where in the fungus is of the species Saccharomyces cerevisiae.
53 The recombinant microbial cell of claim 52 where in the Saccharomyces cerevisiae is TAM, Lp4f, m850, RWB837, MY2928, MY3825, MY3826 or derivatives thereof.
54. A method of producing a C4-dicarboxylic acid comprising: cultivating a recombinant microbial cell of any one of the preceding claims under conditions that achieve C4- dicarboxylic acid production.
55. The method of claim 54, further comprising a step of isolating the C4- dicarboxylic acid.
56. The method of claim 54 or 55 where in the C4-dicarboxylic acid is malic acid.
57. The method of claim 54 or 55 where in the C4-dicarboxylic acid is fumaric acid.
58. The method of claim 54 or 55 where in the C4-dicarboxylic acid is succinic acid.
59. A method of preparing a C4-dicarboxylic acid derivative, the method comprising steps of: a) cultivating a recombinant microbial cell of any one of claims 1-36 under conditions that allow production of a C4-dicarboxylic acid; and b) converting the C4-dicarboxylic acid into a C4-dicarboxylic acid derivative.
60. The method of claim 59 further comprising the step of isolating the C4- dicarboxylic acid.
61. The method of claims 59 or 60 further comprising the step of isolating the C4- dicarboxylic acid derivative.
62. The method of any of claims 59-61 wherein the C4-dicarboxylic acid is chosen from one or more of malic acid, fumaric acid and succinic acid.
63. The method of claim 62 wherein the C4-dicarboxylic acid is malic acid.
64. The method of claim 62 wherein the C4-dicarboxylic acid is fumaric acid.
65. The method of claim 62 wherein the said C4-dicarboxylic acid is succinic acid.
66. The method of any of claims 59-65 wherein the C4-dicarboxylic acid derivative is chosen from one or more of: tetrahydrofuran (THF), butane diol (e.g. 1,4-butanediol), γ- butyrolactone, pyrrolidinones (e.g. N-methyl-2-Pyrrolidone), adipic acid , esters, linear aliphatic esters, diamines, 4,4-Bionelle, hydroxybutyric acid, dibasic ester (DBE), succindiamide, 1,4- diaminobutane, maleic anhydride, succinonitrile, a hydroxybutyrolactone derivative, a hydroxysuccinate derivative, and an unsaturated succinate derivative.
67. The method of claim 66 wherein the C4-dicarboxylic acid derivative is 1,4- butanediol.
68. The method of claim 66 wherein the C4-dicarboxylic acid derivative is THF.
69. The method of claim 66 wherein the C4-dicarboxylic acid derivative is a polymer.
70. The method of claim 66 wherein the C4-dicarboxylic acid derivative is N-methyl- 2-pyrrolidone.
71. The method of claim 66 wherein the C4-dicarboxylic acid derivative is γ- butyrolactone.
72. The method of claim 66 wherein the C4-dicarboxylic acid derivative is adipic acid.
73. The method of claim 66 wherein the C4-dicarboxylic acid derivative is a linear aliphatic ester.
74. The method of claim 66wherein the C4-dicarboxylic acid derivative is a hydroxy succinate derivative.
75. The method of claim 66 wherein the C4-dicarboxylic acid derivative is a hydroxybutyrolactone derivative.
76. The method of claim 66 wherein the C4-dicarboxylic acid derivative is a maleic anhydride.
77. The method of any one of claims 59-76 wherein the converting comprises one or more of physical treatments, fermentation, biocatalysis, and chemical transformation.
78. The method of claim 77 wherein the converting comprises one or more physical treatments.
79. The method of claim 77 wherein the converting comprises fermentation.
80. The method of claim 77 wherein the converting comprises one or more chemical transformations .
81. The method of claim 77 wherein the converting comprises one or more biocatalyses.
82. A C4-dicarboxylic acid derivative prepared by the method of any of claims 59-81.
83. A polymer containing one or more C4-dicarboxylic acid derivatives prepared by the method of any of claims 59-81.
84. An isolated nucleic acid which encodes a pyruvate kinase polypeptide whose amino acid sequence comprises a nucleotide sequence having at least 80% overall sequence identity to an nucleotide sequence selected from SEQ ID NOs: 25-40.
85. The isolated nucleic acid of claim 84, wherein the nucleotide sequence of the nucleic acid comprises the nucleotide sequence selected from SEQ ID NOs: 25-40.
PCT/US2010/028429 2009-03-24 2010-03-24 Methods and microorganisms for production of c4-dicarboxylic acids WO2010111344A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
IL215376A IL215376A0 (en) 2009-03-24 2011-09-25 Methods and microorganisms for production of c4-dicarboxylic acids

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US16301909P 2009-03-24 2009-03-24
US61/163,019 2009-03-24

Publications (2)

Publication Number Publication Date
WO2010111344A2 true WO2010111344A2 (en) 2010-09-30
WO2010111344A3 WO2010111344A3 (en) 2011-07-21

Family

ID=42781834

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2010/028429 WO2010111344A2 (en) 2009-03-24 2010-03-24 Methods and microorganisms for production of c4-dicarboxylic acids

Country Status (2)

Country Link
IL (1) IL215376A0 (en)
WO (1) WO2010111344A2 (en)

Cited By (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8158395B2 (en) 2010-06-21 2012-04-17 Novozymes, Inc. Polypeptides having C4 dicarboxylic acid transporter activity and polynucleotides encoding same
EP2495317A1 (en) * 2011-03-01 2012-09-05 Technische Universität Hamburg-Harburg Modified phosphoenolpyruvate carboxylase from Corynebacterium glutamicum and uses thereof
WO2012118848A1 (en) 2011-02-28 2012-09-07 Novozymes, Inc. Microorganism for c4-dicarboxylic acid production
WO2013028512A1 (en) 2011-08-19 2013-02-28 Novozymes, Inc. Recombinant microorganisms for production c4-dicarboxylic acids
US20130157330A1 (en) * 2010-09-01 2013-06-20 University Of Florida Research Foundation, Inc. L-malate production by metabolically engineered escherichia coli
US8497103B2 (en) 2010-06-21 2013-07-30 Novozymes, Inc. Methods for C4-dicarboxylic acid production in filamentous fungi
US8617859B2 (en) 2010-06-04 2013-12-31 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
US8741611B2 (en) 2009-09-01 2014-06-03 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
KR101426441B1 (en) 2012-05-16 2014-08-05 인하대학교 산학협력단 Recombinant microorganism expressing carbonic anhydrase from Dunaliella sp and phosphoenolpyruvate carboxylase from P.tricornutum CCMP 637, and method for producing organic acid using the same
WO2013158749A3 (en) * 2012-04-17 2015-06-18 Gevo, Inc. Engineered microorganisms with improved growth properties
WO2018003641A1 (en) * 2016-06-29 2018-01-04 花王株式会社 Method for producing c4 dicarboxylic acid
CN111051498A (en) * 2017-06-30 2020-04-21 齐米科技股份有限公司 Engineered microorganisms for enhanced oligosaccharide utilization
CN112094826A (en) * 2013-12-12 2020-12-18 帝斯曼知识产权资产管理有限公司 Fumarate reductase
WO2021076782A1 (en) * 2019-10-15 2021-04-22 Donald Danforth Plant Science Center Methods and compositions for improving agronomic characteristics of c4 plants
CN113846024A (en) * 2021-12-01 2021-12-28 南京昊禾生物科技有限公司 Method for reducing byproduct fumaric acid in L-malic acid fermentation process, strain and application

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009011974A1 (en) * 2007-05-18 2009-01-22 Microbia Precision Engineering, Inc. Organic acid production by fungal cells

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009011974A1 (en) * 2007-05-18 2009-01-22 Microbia Precision Engineering, Inc. Organic acid production by fungal cells

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHRISTIAN RIEDEL ET AL: 'Characterization of the Phosphoenolpyruvate Carboxykinase Gene from Corynebacterium glutamicum and Significance of the Enzyme for Growth and Amino Acid Production' J. MOL. MICROBIOL. BIOTECHNOL. vol. 3, no. 4, 2001, pages 573 - 583 *
HUI WU ET AL: 'Improved Succinic Acid Production in the Anaerobic Culture of an Escherichia coli pflB IdhA Double Mutant as a Result of Enhanced Anaplerotic Activities in the Preceding Aerobic Culture' APPLIED AND ENVIRONMENTAL MICROBIOLOGY vol. 73, no. 24, 2007, pages 7837 - 7843 *
HYOHAK SONG ET AL: 'Production of succinic acid by bacterial fermentation' ENZYME AND MICROBIAL TECHNOLOGY vol. 39, no. ISS.3, 2006, pages 352 - 361 *
SANG JUN LEE ET AL: 'Genome-Based Metabolic Engineering of Mannheimia succiniciproducens for Succinic Acid Production' APPLIED AND ENVIRONMENTAL MICROBIOLOGY vol. 72, no. 3, 2006, pages 1939 - 1948 *

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2473600B1 (en) * 2009-09-01 2016-06-29 Novozymes Inc. Methods for improving malic acid production in filamentous fungi
US8999685B2 (en) 2009-09-01 2015-04-07 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
US20140234925A1 (en) * 2009-09-01 2014-08-21 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
EP3103876A1 (en) * 2009-09-01 2016-12-14 Novozymes Inc. Methods for improving malic acid production in filamentous fungi
US8741611B2 (en) 2009-09-01 2014-06-03 Novozymes, Inc. Methods for improving malic acid production in filamentous fungi
US8617859B2 (en) 2010-06-04 2013-12-31 Novozymes, Inc. C4 dicarboxylic acid production in filamentous fungi
US8497103B2 (en) 2010-06-21 2013-07-30 Novozymes, Inc. Methods for C4-dicarboxylic acid production in filamentous fungi
US8518676B2 (en) 2010-06-21 2013-08-27 Novozymes, Inc. Polypeptides having C4 dicarboxylic acid transporter activity and polynucleotides encoding same
US9303275B2 (en) 2010-06-21 2016-04-05 Novozymes, Inc. Polypeptides having C4 dicarboxylic acid transporter activity and polynucleotides encoding same
US8158395B2 (en) 2010-06-21 2012-04-17 Novozymes, Inc. Polypeptides having C4 dicarboxylic acid transporter activity and polynucleotides encoding same
US20130157330A1 (en) * 2010-09-01 2013-06-20 University Of Florida Research Foundation, Inc. L-malate production by metabolically engineered escherichia coli
US9187772B2 (en) * 2010-09-01 2015-11-17 University Of Florida Research Foundation, Inc. L-malate production by metabolically engineered escherichia coli
US9447440B2 (en) 2011-02-28 2016-09-20 Novozymes, Inc. Microorganisms for C4-dicarboxylic acid production
US8722387B2 (en) 2011-02-28 2014-05-13 Novozymes, Inc. Microorganisms for C4-dicarboxylic acid production
WO2012118848A1 (en) 2011-02-28 2012-09-07 Novozymes, Inc. Microorganism for c4-dicarboxylic acid production
CN103492551A (en) * 2011-02-28 2014-01-01 诺维信股份有限公司 Microorganism for c4-dicarboxylic acid production
EP2495317A1 (en) * 2011-03-01 2012-09-05 Technische Universität Hamburg-Harburg Modified phosphoenolpyruvate carboxylase from Corynebacterium glutamicum and uses thereof
CN103917649A (en) * 2011-08-19 2014-07-09 诺维信股份有限公司 Recombinant microorganisms for production C4-dicarboxylic acids
WO2013028512A1 (en) 2011-08-19 2013-02-28 Novozymes, Inc. Recombinant microorganisms for production c4-dicarboxylic acids
US8663956B2 (en) 2011-08-19 2014-03-04 Novozymes, Inc. Recombinant microorganisms for production C4-dicarboxylic acids
WO2013158749A3 (en) * 2012-04-17 2015-06-18 Gevo, Inc. Engineered microorganisms with improved growth properties
KR101426441B1 (en) 2012-05-16 2014-08-05 인하대학교 산학협력단 Recombinant microorganism expressing carbonic anhydrase from Dunaliella sp and phosphoenolpyruvate carboxylase from P.tricornutum CCMP 637, and method for producing organic acid using the same
CN112094826A (en) * 2013-12-12 2020-12-18 帝斯曼知识产权资产管理有限公司 Fumarate reductase
CN112094826B (en) * 2013-12-12 2023-12-19 德希尼布能源法国公司 fumarate reductase
WO2018003641A1 (en) * 2016-06-29 2018-01-04 花王株式会社 Method for producing c4 dicarboxylic acid
JPWO2018003641A1 (en) * 2016-06-29 2019-04-18 花王株式会社 Method for producing C4 dicarboxylic acid
US10590442B2 (en) 2016-06-29 2020-03-17 Kao Corporation Method for producing C4 dicarboxylic acid
CN111051498A (en) * 2017-06-30 2020-04-21 齐米科技股份有限公司 Engineered microorganisms for enhanced oligosaccharide utilization
EP3645702A4 (en) * 2017-06-30 2021-11-03 Zimitech, Inc. Engineered microorganisms for enhanced use of oligosaccharides
US11597938B2 (en) 2017-06-30 2023-03-07 Zimitech, Inc. Engineered microorganisms for enhanced use of oligosaccharides
WO2021076782A1 (en) * 2019-10-15 2021-04-22 Donald Danforth Plant Science Center Methods and compositions for improving agronomic characteristics of c4 plants
CN113846024A (en) * 2021-12-01 2021-12-28 南京昊禾生物科技有限公司 Method for reducing byproduct fumaric acid in L-malic acid fermentation process, strain and application
US11732279B2 (en) 2021-12-01 2023-08-22 Nanjing Haohe Biotechnology Co., Ltd. Method AMD strains for reducing byproduct fumaric acid in fermentation process of L-malic acid and use thereof

Also Published As

Publication number Publication date
IL215376A0 (en) 2011-12-29
WO2010111344A3 (en) 2011-07-21

Similar Documents

Publication Publication Date Title
WO2010111344A2 (en) Methods and microorganisms for production of c4-dicarboxylic acids
US20150104543A1 (en) Organic acid production by fungal cells
US7109010B2 (en) Methods and materials for the synthesis of organic products
US8945888B2 (en) Method for producing high amount of glycolic acid by fermentation
US20110045559A1 (en) Malic acid production in recombinant yeast
CA2704654A1 (en) Succinic acid production in a eukaryotic cell
JP2022025108A (en) Fungal production of fdca
CN110914435A (en) Yeast producing ectoin
CN110651034A (en) FDCA-decarboxylated monooxygenase-deficient host cells for the production of FDCA
CA2714088A1 (en) Process for the production of a dicarboxylic acid
US20070141687A1 (en) Increase in stress tolerance with ascorbic acid during fermentation
CN109689864B (en) Malate dehydrogenase
KR101521045B1 (en) Recombinant microorganisms for producing organic acids
WO2009065777A1 (en) Dicarboxylic acid production in a filamentous fungus
CA2931591C (en) Fumarate reductases
KR101437041B1 (en) Preparation method of succinic acid using recombinant yeast having a resistance to succinic acid
CN116926024A (en) Glutathione synthetase with enhanced heat resistance and application
CN116731102A (en) Preparation process of glutathione
CN117467551A (en) Acid-resistant yeast strain for high yield of L-malic acid, construction method and application thereof

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2012502193

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: JP

122 Ep: pct application non-entry in european phase

Ref document number: 10756761

Country of ref document: EP

Kind code of ref document: A2