CN103589749A - Methods for enhancing stress tolerance in plants - Google Patents

Abstract

Increased tolerance to abiotic stress in a plant is provided by introducing DNA expressing a cold shock protein, e.g. bacterial cold shock protein.

Description

For strengthening the method for stress tolerance in plants

The application is to be dividing an application of on 09 29th, 2004 and the denomination of invention 200480035385.X application for a patent for invention that is " for strengthening the method for stress tolerance in plants " the applying date.

CROSS-REFERENCE TO RELATED APPLICATIONS

According to 35USC § 119 (e), the application requires the right of priority of the U.S. Provisional Application series number 60/506,717 of submitting on September 29th, 2003 and the series number 60/530453 of submitting on December 7th, 2003.

Sequence table is introduced

Two parts of sequence table copies (sequence table copy 1 and sequence table copy 2) are hereby incorporated by with the computer-reader form of this sequence table, these two parts of copies are all on CD-ROMs, the file that contains respectively the called after CSP.ST25.txt creating on September 28th, 2004, file size is about 98 megabyte (recording in MS-DOS).

Invention field

The present invention relates to virus, fungi, bacterium and other abiotic stress tolerances in cold in plant, non-irrigated, salt, cold germination (cold germination), heat and other abiotic stress tolerances and plant.Specifically, the present invention relates to a kind of method that strengthens described plant biological and abiotic stress tolerance by express cold shock protein in vegetable cell.

Background of invention

It is the commodity industry of multi-million dollar that seed and fruit is produced, for the many states of the U.S. and in the world many countries are main sources of its income.The seed of commercially valuable comprises, for example, canola (canola), cottonseed and sunflower seed, it enjoys values, because can squeeze vegetables oil from seed.Due to they rich in proteins, therefore commercially also valuable such as the fabaceous seed of pea, Kidney bean and root of Szemao crotalaria, for example, with regard to soybean, the protein that it contains 40-45% and 18% lipid and oils.In addition, coffee is also a kind of valuable crop, by the seed of the arabica that is dried and toasted (Coffea arabica) plant, is made, and chocolate is made by cocoa tree seed or " beans ".Similarly, many fruits and seed are commercially also valuable, comprise, for example corn, rice, wheat, barley and other cereals, nut, beans, tomato and citrus fruit.For example, corn seed can be made into numerous food or the article for cooking, as taco shells, Semen Maydis oil, corn-dodger, corn flakes, Semen Maydis powder etc.Corn is also used as the raw material of many products productions, includes but not limited to feed and Alcohol Production.

Due to biology and abiotic stress, seed and fruit is produced the institute being subject to inherently and is limit.For example, soybean (Glycine max) is a kind of crop (Zhang etc., Plant Soil188:(1997) that cannot germinate when duration of storage is lost by seed germination and work as soil moisture reduction).This phenomenon is in fact also present in corn and other important farm crop.The abiotic stress tolerance that improves plant will be conducive to crop in agricultural, growth be increased and/or in cold, non-irrigated, flood, heat, ultraviolet ray, coerce, germinate under ozone increase, acid rain, pollution, salt stress, heavy metal, mineralising soil and other abiotic stress.Biology is coerced, and for example fungi and virus infection, worldwide also cause a large amount of crop failures.

In several centuries, traditional breeding method (by a kind of genotypic specific allelotrope and another kind of hybridization) is already for strengthening biological stress tolerance, abiotic stress tolerance and output.Traditional breeding method is limited to the allelotrope of existing limited quantity in mother plant inherently.It has limited again the quantity of the hereditary variability of accumulation by this way.Molecular biology has allowed that the present inventor can find the gene that can improve stress tolerance in plants widely.Our contriver seeks to determine how other biological reacts and to tolerate it coercing environment.Cold shock protein be by bacterium and other biological cold-peace coerce existence under environment the part of use system.The inventor propose will coding cold shock protein and the gene transfered plant of associated protein in and express, can strengthen cold, non-irrigated, hot, the moisture of plant and fungi, virus and the other biological stress tolerance of other abiotic stress tolerances and plant.They also believe use and cold shock protein homology or have the gene of sequence similarity, also can strengthen biology and abiotic stress tolerance.

Farmer can reduce the loss that they cause because of biological and abiotic stress with the present invention.

Summary of the invention

The invention provides a kind of plant of expressing cold shock protein (Csp) in vegetable cell.The expression of cold shock protein has produced stronger abiotic stress tolerance in described plant.In one embodiment, the polynucleotide of coding cold shock protein are expressed by be operably connected to the promotor and the terminator that work in plant.

More particularly, the invention provides a kind of recombinant DNA molecules, in 5 ' to 3 ' direction, comprise: DNA polynucleotide of the promotor working in being included in plant, the 2nd DNA polynucleotide that are operably connected to coding cold shock protein, it is operably connected to 3 ' the Transcription Termination DNA polynucleotide that polyadenylation site is provided.Described DNA polynucleotide are preferred and the 2nd DNA polynucleotide allos conventionally.The present invention also provides a kind of recombinant DNA molecules that inserts intron between DNA polynucleotide and the 2nd DNA polynucleotide that has.The present invention also provides a kind of recombinant DNA molecules, a kind of albumen that comprises SEQ ID NO:3 motif of wherein said the 2nd DNA polynucleotide encoding.In the particular of recombinant DNA of the present invention, the described the 2nd DNA polynucleotide encoding is a kind of is selected from:

(a) there is the albumen of the same aminoacid sequence in gram positive bacterium cold shock protein aminoacid sequence substantially,

(b) from the cold shock protein of Bacillus subtilus (Bacillus subtilis),

(c) Bacillus subtilus cold shock protein B (CspB) homologue,

(d) there is the albumen of the same aminoacid sequence in SEQ ID NO:2 substantially,

(e) there is the albumen of the same aminoacid sequence in gram negative bacterium cold shock protein aminoacid sequence substantially,

(f) comprise the albumen from intestinal bacteria (Escherichia coli) cold shock protein,

(g) protein escherichia coli A (CspA) homologue,

(h) there is the albumen of the same aminoacid sequence in SEQ ID NO:1 substantially,

(i) from the cold shock protein of agrobacterium tumefaciens (Agrobacterium tumefaciens), and

(j) have substantially same as SEQ ID NO:5, the albumen of 7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37,39,41,43,45,47,49,51,53,55,57,59,61,63 or 65 arbitrary aminoacid sequences.

The present invention also provides a kind of recombinant DNA molecules, the group that wherein said promotor is selected free inducible promoter, constitutive promoter, sequential adjustment type promotor, grows adjustment type promotor, organizes preferred type promotor, low temperature enhancement type promotor, low temperature specificity promoter, coerces enhancement type promotor, coerced specificity promoter, drought-inducible promoter, water deficit-inducible promoters and tissue-specific promoter form.

The present invention also provides the vegetable cell that comprises above-mentioned recombinant DNA molecules in its genome and plant and propagulum and by the offspring of its generation.Plant includes, but are not limited to crop plants, monocotyledons and dicotyledons.More particularly, these plants can comprise soybean, corn, canola, rice, cotton, barley, oat, turfgrass, cotton and wheat.

The present invention also provides the transgenic plant of abiotic stress tolerance, and it transforms with the recombinant DNA molecules of expressing cold shock protein.Such plant and cell thereof and in their genome, comprise the recombinant DNA molecules of expressing cold shock protein such as the propagulum of seed.Such plant has the proterties of one or more following enhancings: higher growth rate under the cold condition of restriction non-transformed plant-growth mutually of the same race,

(a) higher growth rate under the hot conditions of restriction non-transformed plant-growth mutually of the same race,

(b) higher growth rate under the moisture condition of restriction non-transformed plant-growth mutually of the same race,

(c) higher growth rate under the salt increasing in the restriction soil of non-transformed plant-growth mutually of the same race and/or water or ion condition,

(d) the larger percentile plant survival rate of unconverted plant more of the same race after cold shock,

(e) output increasing when comparing with unconverted plant mutually of the same race, or

(f) compare arid resistance with unconverted plant mutually of the same race.

A kind of method of the present invention comprises breeding plant of the present invention, as, in order to produce seed, only by above-mentioned seed being implanted in soil and making it growth, as coerced under environment.More particularly, the invention provides a kind of method of plant of production, described plant has the proterties such as the enhancing of the output of abiotic stress tolerance, increase or the root mass of increase.Described method comprises step:

A) recombinant DNA molecules that comprises coding cold shock protein DNA is inserted in the genome of vegetable cell,

B) obtain the vegetable cell transforming,

C) from the vegetable cell aftergrowth of described conversion; With

D) select the plant of the proterties with enhancing.

In one aspect of the invention, plant is selected from the plant of the abiotic stress tolerance with enhancing, and described abiotic stress tolerance is selected from: after thermotolerance, salt tolerance, drought tolerance and cold shock, survive.

The present invention also provides separated protein, and it is at least 40% same as having the SEQ of being selected from ID NOS:5,7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37,39,41,43,45,47,49,51,53,55,57,59, the protein of 61,63 and 65 aminoacid sequence.The protein that in some aspects, can have a homology higher compared with 40% identity by use replaces cold shock protein to obtain similar proterties.As, use with the protein that there is at least 50%, 60%, 70%, 80%, 90% or at least 95% identity at this concrete cold shock protein disclosing and replace.Similarly, the present invention also provides a kind of separated nucleic acid of the cold shock protein motif of encoding, its can with there are the SEQ of being selected from ID NOs:4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40,42,44,46,48,50,52,54,56,58,60,62, the nucleic acid hybridization of 90 and 92 DNA sequence dna.

The present invention also specifically provides the separated nucleic acid of coding cold shock protein, and described cold shock protein has substantially same as being selected from SEQ ID NOs:5, and 7,9,29,31,33,35,37,39,41,43,53,55,57,59,61,63 and the DNA sequence dna of 65 sequences.

The present invention also provides the propagulum that comprises above-mentioned recombinant DNA molecules, and when they are planted or otherwise germinate, the field crops germinateing from described propagulum, on the field of being sowed above-mentioned propagulum.

The present invention also provides a kind of method of seeding, is included in the seed of planting claim 59 in soil;

B) from described plant results seed; Therefore produce and obtain seed.

A kind of method of producing transgenic plant is also provided, described method comprises step: (i) DNA molecular is imported in the genome of vegetable cell, described DNA molecular comprises at least 40% and has the SEQ of being selected from ID Nos:5 with coming from, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, the DNA polynucleotide of the albumen of 63 and 65 aminoacid sequence, or its fragment, cis element, wherein said DNA polynucleotide are operably connected to promotor and are operably connected to 3 ' Transcription Termination DNA polynucleotide, (ii) select described transgenic plant cells, (iii) the described transgenic plant cells of regenerating in transgenic plant, the plant producing by the method is also provided.

Especially, the present invention relates to the following:

1. a recombinant DNA molecules, it comprises in 5 ' to 3 ' direction:

A) be included in DNA polynucleotide of the promotor working in plant, it is operably connected to;

B) the 2nd DNA polynucleotide of coding cold shock protein, are operably connected to;

C) play 3 ' Transcription Termination DNA polynucleotide of polyadenylation sequence effect.

2. the recombinant DNA molecules of the 1st wherein inserts DNA of plants intron between described DNA polynucleotide and described the 2nd DNA polynucleotide.

3. the recombinant DNA molecules of the 1st, the albumen of the amino acid motif that wherein said the 2nd DNA polynucleotide encoding comprises SEQ ID NO:3.

4. the recombinant DNA molecules of the 3rd, wherein said the 2nd DNA polynucleotide encoding is selected from following albumen:

(a) there is the albumen of the same aminoacid sequence in the aminoacid sequence from gram positive bacterium cold shock protein substantially,

(b) from the cold shock protein of Bacillus subtilus,

(c) Bacillus subtilus cold shock protein B (CspB) homologue,

(d) there is the albumen of the same aminoacid sequence in SEQ ID NO:2 substantially,

(e) there is the albumen of the same aminoacid sequence in the aminoacid sequence from gram negative bacterium cold shock protein substantially,

(f) comprise the albumen from protein escherichia coli,

(g) homologue of protein escherichia coli A (CspA),

(h) there is the albumen of the same aminoacid sequence in SEQ ID NO:1 substantially,

(i) from the cold shock protein of agrobacterium tumefaciens, and

(j) have substantially same as SEQ ID NO:5, the albumen of arbitrary aminoacid sequence in 7,9,11,13,15,17,19,21,23,25,27,29,31,33,35,37,39,41,43,45,47,49,51,53,55,57,59,61,63 or 65.

5. the recombinant DNA molecules of the 1st, wherein promotor is selected from: inducible promoter, constitutive promoter, sequential adjustment type promotor, grow adjustment type promotor, organize preferred type promotor, low temperature enhancement type promotor, low temperature specificity promoter, coerce enhancement type promotor, coerce specificity promoter, drought-inducible promoter, water deficit-inducible promoters and tissue-specific promoter.

6. the transgenic plant of the abiotic stress tolerance having transformed with the DNA molecular of expressing cold shock protein.

7. the propagulum of the plant of the 6th.

8. the offspring of the plant of the 6th.

9. the plant of the 6th, it is a kind of crop.

10. the plant of the 6th, it is a kind of monocotyledons.

The plant of 11. the 6th, it is a kind of dicotyledons.

The plant of 12. the 6th, it is selected from soybean, corn, canola, rice, cotton, barley, oat, turfgrass, cotton and wheat.

The plant of 13. the 6th, it has:

(a) by restriction unconverted plant-growth mutually of the same race cold condition under higher growth rate,

(b) by restriction unconverted plant-growth mutually of the same race hot conditions under higher growth rate,

(c) by restriction unconverted plant-growth mutually of the same race moisture condition under higher growth rate,

(d) by higher growth rate under the salt increasing in the restriction soil of unconverted plant-growth mutually of the same race and/or water or ion condition,

(e) the larger percentile plant survival rate of unconverted plant more of the same race after cold shock,

(f) output increasing when comparing with unconverted plant mutually of the same race, or

(g) compare arid resistance with unconverted plant mutually of the same race.

The propagulum of the plant of 14. the 13rd, it is seed.

15. 1 kinds of methods, are wherein implanted in soil by the seed of the 14th and make it growth.

16. 1 kinds of methods that produce transgenic plant, described method comprises the following steps:

A) recombinant DNA molecules of the 1st is inserted in the genome of vegetable cell;

B) obtain the transformed plant cells that contains described recombinant DNA;

C) from described vegetable cell aftergrowth; With

D) plant of the abiotic stress tolerance of selective enhancement or the root growth of increase.

17. 1 kinds of stress tolerant plants of producing by the method for the 16th.

The method of 18. the 16th, wherein said abiotic stress is selected from: after thermotolerance, salt tolerance, drought tolerance and cold shock, survive.

19. 1 kinds of separated albumen, its

(a) be at least 40% same as being selected from SEQ ID NO:5, at least one albumen of 7,9,29,31,33,35,37,39,41,43,53,55,57,59,61,63 and 65,

(b) under rigorous condition be selected from SEQ ID NO:4,6,8,10,12,14,16,18,20,22,24,26,28,30,32,34,36,38,40,42,44,46,48,50,52,54,56,58,60,62,64,90 and 92 nucleic acid hybridization,

(c) have substantially same as SEQ ID NO:5, arbitrary aminoacid sequence in 7,9,29,31,33,35,37,39,41,43,53,55,57,59,61,63 and 65.

20. 1 kinds of farm crop, it comprises at least 50% the plant growing from the propagulum that comprises protokaryon cold shock protein.

Accompanying drawing summary

Fig. 1 has shown the plasmid figure of pMON57396.

Fig. 2 has shown the plasmid figure of pMON23450.

Fig. 3 has shown the plasmid figure of pMON57397.

Fig. 4 has shown the plasmid figure of pMON57398.

Fig. 5 has shown the plasmid figure of pMON23450.

Fig. 6 has shown the plasmid figure of pMON57399.

Fig. 7 has shown the plasmid figure of pMON48421.

Fig. 8 has shown the plasmid figure of pMON56609.

Fig. 9 has shown the plasmid figure of pMON56610.

Figure 10 has shown the plasmid figure of pMON73607.

Figure 11 has shown the plasmid figure of pMON61322.

Figure 12 has shown the plasmid figure of pMON73608.

Figure 13 has shown the plasmid figure of pMON65154.

Figure 14 has shown the plasmid figure of pMON72472.

Figure 15 has shown the plasmid figure of pENTR1.

Figure 16 has shown the growth form of expressing indicator plant and control plant, has shown that the gene importing provides abiotic stress tolerance.

Figure 17 has shown the plasmid figure of pMON42916.

Figure 18 has shown the plasmid figure of pMON73983.

Figure 19 has shown the plasmid figure of pMON73984.

Specific embodiments describes in detail

The invention provides a kind of plant biological and abiotic stress to the tolerance of enhancing.Due to the cells described plant cold shock protein (csp), the plant providing has the stress tolerance of enhancing.The invention provides the example of several embodiments, and estimate that other embodiments should be able to work in the present invention.

Following definition and method are provided and to define better the present invention, have and guided those of ordinary skills to put into practice the present invention.Unless otherwise mentioned, term will be understood according to those of ordinary skills' convention.For example, the definition of the Essential Terms of molecular biology and molecular genetics is found in Lewin, Genes VII, Oxford University Press and Cell Press, New York, 2000; Buchanan, etc., Biochemistry and Molecular Biology of Plants, Courier Companies, USA, 2000; Lodish, etc., Molecular Cell Biology, W.H.Freeman and Co., New York, 2000.Genetic Essential Terms are found in preceding reference and Lynch, etc., Genetics and Analysis of Quantitative Traits, Sinauer and Associates, Sunderland, MA, 1998; Hartwell, etc., Genetics:From Genes to Genomes, McOraw-Hill Companies, Boston, MA, 2000; Hartl, etc., Genetics:Analysis of Genes and Genomes, Jones and Bartlett Publishers, Sudbury, MA; Strachan, etc., Human Molecular Genetics, JohnWiley and Sons, New York, 1999.

Used the DNA base nomenclature shown in 37CFR § 1.822.Single-letter and the trigram amino-acid residue nomenclature of standard have been used.

Many agronomy characters can affect " output ".For example, these proterties can comprise, be not limited to, on plant height, pod number, plant, pod position, internode quantity, pod are split inclination angle, granularity, root nodule and nitrogen fixation efficiency, nutrient substance assimilation efficiency, biology and abiotic stress resistance, carbon assimilation, plant structure, lodging resistance, rate of emergence, seedling vigor and shoot proterties.For example, these proterties also can comprise, be not limited to growth rate (being included in the growth rate under stress conditions), spike number amount, the seed amount of each fringe, seed granularity, seed compositions (starch, oil, protein), the full characteristic of seed of percentage of germination (being included in the germination under stress conditions), arbitrary or all plant parts.Useful several different methods is measured output, and these methods can comprise unit weight, seed weight, every strain plant seed quantity, every strain plant seed weight, per unit area seed amount or weight (being every acre of seed amount or seed weight), every acre of bushel number, every acre of metric ton number, every acre of short ton number, per hectare kilogram number.In one embodiment, plant of the present invention has showed the proterties strengthening, and is one of output key element.

" nucleic acid (sequence) " or " polynucleotide (sequence) " refers to strand or double-stranded DNA (thymus nucleic acid) or the RNA (Yeast Nucleic Acid) in genome or synthetic source, be respectively the polymer of deoxyribonucleotide or ribonucleotide base, reading code is from 5 ' (upstream) end to 3 ' (downstream) end.Described nucleic acid can be justice or complementation (antisense) chain.

" natural " refers to naturally occurring (" wild-type ") nucleotide sequence.

" allos " sequence refers to derive from the sequence of external source or alien species, or if identical source is the sequence of modifying from its prototype.For example, natural promoter can be used to make the heterologous gene in identical or different species to transcribe.

Plant " position " comprises all sites or the part of plant, comprise, but be not limited to root, seedling, leaf, stem, pollen, seed, flower, stamen, gynoecium, button, embryo, petal, filigree, carpel (comprising column cap, ovary and style), cell or above-mentioned any part.

" propagulum " comprises reduction division and mitotic all products, includes but not limited to seed and can breed the plant parts into new plant.For example, propagulum comprises that seedling, root or other can be grown to the plant parts of complete plant.Propagulum also comprises graft, a part of grafting of this plant on another part of different plants (or even plant not of the same race) to produce organism alive.Propagulum also comprises by clone, by assembling reduction division product or reduction division product being assembled, forms all Plants and Seeds that embryo or zygote (natively or human intervention) produce.

" separated " nucleotide sequence is isolated or purified substantially, containing conventionally other associated nucleotide sequences, i.e. other karyomit(e) or DNA in its naturally occurring biological cell.This term comprises the nucleic acid of biological chemistry purifying, makes substantially except the nucleic acid depolluting and other cellular components.This term also comprises the nucleic acid of recombinant nucleic acid and chemosynthesis.

" identity " or " same " as used herein, when relating between protein or nucleic acid relatively, refers to 98% or higher identity.

If the first nucleic acid or protein sequence show that " substantially same " or " substantially similar " is in reference to nucleotide sequence or protein, when carrying out optimum comparison (thering is 20% suitable Nucleotide or aminoacid insertion or disappearance that summation is less than canonical sequence in comparison window) with other nucleic acid (or its complementary strand) or protein, at at least 20 Nucleotide or amino acid position, preferably at least 50 Nucleotide or amino acid position, more preferably at least 100 Nucleotide or amino acid position, and most preferably in the first nucleic acid of total length or the comparison window of protein, have at least about 60% nucleotide sequence equal, more preferably 70%, preferably at least about 80%, equate, more preferably at least about 85%, equate, and most preferably at least about 90%, equate.For comparing the optimum comparison of comparison window, can carry out by local homology's algorithm, preferably by using computer to carry out these algorithms, (be found in, for example, Wisconsin genetics software package 7.0 editions, Genetics Computer Group, 575Science Dr., Madison, WI).Described can be a part for full-length molecule or longer molecule with reference to nucleic acid.In other words, if hybridization mutually under stringent condition, two nucleic acid are substantially same.Suitable hybridization conditions can rule of thumb come to determine, if or known, can based on the relative G+C content of for example probe and between probe and target sequence mispairing quantity estimate.Can be by Change Example as hybridization temperature or salt concn and freely adjust hybridization conditions (Sambrook etc., Molecular Cloning.A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989).

When sequence is that when so arrangement makes the first nucleotide sequence affect the function of the second nucleotide sequence, the first nucleotide sequence is " to be operably connected " with the second nucleotide sequence.Preferably, described two parts that sequence is single continuous kernel acid molecule, are more preferably adjacent.For example, if this promotor regulates or mediates transcribing of this gene in cell, it is to be operably connected with this gene.For example, when described terminator cause RNA polymerase this terminator place or near termination contain described gene transcription product time, Transcription Termination region (terminator) is to be operably connected with this gene.For example, enhanser does not adjoin with its promotor acting on conventionally mutually, but is generally arranged in same nucleic acid molecule.

By two kinds of different separated sequence fragments of artificial combination, prepare " restructuring " nucleic acid or DNA or RNA molecule, as, by chemosynthesis or by genetic engineering technique, operate separated nucleic acid fragment.Technology for nucleic acid operation well-known (referring to, as., Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989).For example, at Beaucage and Carruthers, Tetra.Letts.22:1859-1862,1981, with Matteucci etc., J.Am.Chem.Soc.103:3185, has discussed the synthetic method of using of nucleic acid chemistry in 1981, for example, can on commercial oligonucleotide automatic DNA synthesizer DNA, carry out the chemosynthesis of nucleic acid.

Gene " expression " refers to that genetic transcription produces corresponding mRNA and this mRNA translation generates corresponding gene product, i.e. peptide, polypeptide or albumen.The modulated element of genetic expression is controlled or is regulated, and described controlling element comprises the 5 ' controlling element such as promotor.

Term " recombinant DNA construction body ", " recombinant vectors ", " expression vector " or " expression cassette " refer to any source, the All Media with genome conformity or self-replicating ability, for example plasmid, clay, virus, BAC (bacterial artificial chromosome), autonomously replicating sequence, phage, wire or cyclic single strand or double-stranded DNA or RNA nucleotide sequence, it comprises DNA molecular, and wherein one or more DNA sequence dna industry connect in exercisable mode in function.

" complementation " refers to that nucleotide sequence is by the natural combination of base pairing.If it is complementary only having some nucleic acid pairings, the complementation between two single chain molecules can be part; If or all base pairs are all complementary, the complementation between above-mentioned single chain molecule is completely.Complementation degree has affected efficiency and the intensity of hybridization and amplified reaction.

" homology " refers to similarity level between nucleic acid or aminoacid sequence, with Nucleotide or amino acid identity or similarity words and phrases, is respectively sequence similarity or identity.Also the concept that refers to have identity function between different nucleic acid or protein of homology, homologue and homology.Homologue comprises the gene of orthogenesis homology and parallelism homology.Homologue can be complied with used gene coded sequence and determined, with one or more following manner, is disclosed in this or sees suitable database (for example NCBI or other databases).For protein sequence, sequence should be used algorithm to compare (for example, referring to the content that relates to " identity " and " substantially same " part).For nucleotide sequence, the sequence of a DNA molecular can compare in roughly the same mode with sequence known or that infer homology.At any complete essence of molecule (DNA, RNA or protein molecule) (25 Nucleotide or amino acid, more preferably 50 Nucleotide or amino acid, more preferably 100 Nucleotide or amino acid, or the total length of shorter sequence most preferably) on region, homologue has at least 20%, more preferably 30%, more preferably 40%, more preferably 50%, more preferably 60%, more preferably 70%, more preferably 80%, more preferably 88%, more preferably 92%, most preferably 95% identity.

Or, if there is the two sequences of identity function, or the complementary sequence of or two sequences wherein, hybridization mutually under rigorous condition, DNA or the RNA of two sequences, or coding or codified aminoacid sequence are homologies, or homologue, or coding homologous sequence.Therefore, if determine whether two protein sequences are homologues, this two sequences all will carry out computer operation described here, and creates the degenerated code sequence of the nucleotide sequence of all possible energy coded protein, determines whether they can hybridize under rigorous condition.Impel the suitable rigorous condition of DNA hybridization, for example, hybridization in 6.0x sodium chloride/sodium citrate (SSC) at approximately 45 ℃, then at 50 ℃, with 2.0x SSC, wash, be well known to those skilled in the art, or be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.For example, the salt concn in washing step can be selected from the low preciseness of about 2.0x SSC 50 ℃ in the high preciseness of about 0.2x SSC at 50 ℃.In addition, the temperature of washing step can the low rigorous condition from the room temperature at approximately 22 ℃ be incremented to the rigorous condition of height of approximately 65 ℃.Temperature and salt concn can change, or variable in temperature and salt concn is when change, and another remains unchanged.In a preferred embodiment, the nucleic acid of the albumen of the present invention of encoding under the rigorous condition of height can with one or more nucleic acid molecule or its complementary molecule or the hybridization of both fragments specifics, for example at approximately 65 ℃ in about 2.0xSSC.Can be by the hybridization of several different methods detection probes well-known to those skilled in the art and target DNA molecule, these methods include, but not limited to fluorescent mark, radio-labeling, the mark based on antibody and chemiluminescent labeling.

" cold shock protein " (Csp (s) or CSP (s)) has the albumen that is greater than 40% identity with intestinal bacteria CspA albumen (SEQ ID NO:1) or Bacillus subtilus CspB albumen (SEQ ID NO:2), or cold shock protein can be by finding with determined conserved domain in the literature.For example, in intestinal bacteria CspA or Bacillus subtilus CspB length range, cold shock protein and intestinal bacteria CspA or Bacillus subtilus CspB have 40% identity as used herein, more preferably 50% identity, more preferably 60% identity, more preferably 70% identity, more preferably 80% identity, more preferably 90% identity, more preferably 95% identity.Can utilize several databases, offer those skilled in the art determine whether new or existing albumen comprise cold shock structural domain or no be cold shock protein, comprise from Genbank to being used to provide the Protein Data Bank of determining albumen mutual relationship and/or finding associated protein.At this, being included in this definition is all known cold shock proteins, includes but not limited to from colibacillary CspA CspB, CspC, CspD, CspE, CspF, CspG, CspH and CspI (United States Patent (USP) 6,610,533).

Described conservative cold shock structural domain be shown in SEQ NO:3 ([FY]-G-F-I-x (6,7)-[DER]-LIVM]-F-x-H-x-[STKR]-x-[LIVMFY]) (Prosite motif PS00352; Bucher and Bairoch, (In) ISMB-94; Proceedings2nd International Conference on Intelligent Systems for Molecular Biology, Altman R., Brutlag D., Karp P., Lathrop R., Searls D., compiles., Menlo Park, 1994; Hofmann etc., Nucleic Acids Res.27:215,1999) in.Or, can use Sprint database (a kind of relevant protein fingerprint spectrum database) (Attwood etc., Nucleic Acids Res.28:2000; Attwood, etc., Nucleic Acids Research, 30 (1), in publication, 2002) find cold shock protein.Or, can use matrix or Pfam based on describing to find cold shock protein.Pfam is the big collection (Bateman etc., Nucleic Acids Research28:263,2000) of the comparison of a kind of multiple sequence and the hidden Markov model that comprises many common protein structure domains.(November calendar year 2001 under write operation; Pfam the 6th edition), there are 3071 families.Comprising cold shock protein, is PF00313.Species tree has shown the classification of determined cold shock protein in Pfam database.

" cold shock protein " also includes, but not limited to any albumen of finding in the search of using cold shock protein as the inquiry sequence of the database of " Blink " (Blast Link) function of use NCBI as used herein." Blink " is a kind of fast search function, for finding the protein with similar sequences.Definite division that should " cold shock protein " or " cold shock structural domain ", for outside above-mentioned those, can not replace described definition.Cold shock protein or the albumen that contains cold shock structural domain comprise, but be not limited to, all known albumen at present in public and private database, and also to go similar in appearance to declared albumen (being for example enough to of discovery, intestinal bacteria CspA and Bacillus subtilus CspB) those, under standard blast that it generally uses at Blast Link (November 1 calendar year 2001) search set(ting)value " being hit ".When write operation, Blast2 just moves, and Blast Link (" Blink ") operation default parameter carries out protein-protein blast search.When write operation, we think that the default settings of Blink use is as follows: operation BLOSUM62 matrix, use " nr " database, select CD search, as being based on statistical combination, there is the complicacy being elected to be as " low-complexity ", expected value is 10, have 3 word length, breach point penalty is existence 11 and extends 1.The demonstration that Table I is listed use these typical set value to hit initial 200 of intestinal bacteria CspA, but we do not limit our claim in these initial 200 hit.Those skilled in the art should note, under these quite strict standards, having found the albumen of 167 bacterial origins, but also find 28 multicellular animals albumen and 5 vegetable-proteins.These albumen comprise wide material sources and albumen CspA homology, and contriver estimates that it will play a role in the present invention.This shows all-embracing list anything but, estimates that other albumen will play a role in the present invention.

Table 20. foundation and intestinal bacteria CspA similarity some cold shock proteins of finding and the albumen that contains cold shock structural domain.This list is to use the Blast Link set(ting)value of NCBI standard to edit.The Genbank ID and the title that have shown each albumen.Annotation: due to the mode of albumen name, some albumen and sequence will have several entries, as albumen, cDNAs, allelotrope etc.Genbank ID can be considered to the unique identifier of each entry.Entry is arranged with the general order that is up to minimum identity relatively obtaining with inquiry sequence.

Bacillus subtilus (B.subtilis) CspB is a kind of to the albumen of accumulation in cold shock response (Willimsky, etc., Journal of Bacteriology174:6326 (1992)).It is combined territory (Lopez, etc., The Journal of Biological Chemistry276:15511 (2001)) with having homology (in Table I) from colibacillary CspA and contain single-chain nucleic acid.In NCBI (Blink), use identical basic Blast search, following albumen is designated as " hitting ".The shown here quantity of hitting is limited in 200, but many other albumen are estimated to work in the present invention.

Some cold shock proteins that table 21. is found with Bacillus subtilus CspB search and the albumen that contains cold shock structural domain.This list is to use Blast Link (Blink) set(ting)value of NCBI standard to edit.The Genbank ID and the title that have shown each albumen.Annotation: due to the mode of albumen name, some albumen and sequence will have several entries, as albumen, cDNAs, allelotrope etc.Genbank ID can be considered to the unique identifier of each entry.Entry is arranged with the general order that is up to minimum identity relatively obtaining with inquiry sequence.

When temperature reduces or applies other and coerce, CSP is one group of albumen that quantitatively may or there is no increase.In fact, with regard to cold shock protein, in the biological intestinal bacteria of best research, when other albumen are during by cold induction.Some cold shock proteins are constitutive expressions, also have some albumen to seem to be specific to and specifically coerce and/or growth conditions or stage.This comment sees Yamanaka, etc., Molecular Microbiology, 27:247 (1998).In this comment, Yamanaka and colleague have described 9 cold shock proteins (CspA-CspI) in intestinal bacteria in detail and how to have expressed.CspA, CspB and CspG are cold inductions.CspD is in the cell periodic static phase and be induced between hunger period.CspC and E relate to cell fission.

CspA is from the main cold shock protein of intestinal bacteria (E.coli) (SEQ ID NO:1).CspA is also referred to as main cold shock protein 7.4.CspA to the induction of cold shock response camber (Goldstein, etc., Proceedings of the National Academy of Science (USA) 87:283 (1990)).In some degrowth environment, rrna is inactive is because RNA or DNA secondary structure form event, can be used as and increase the synthetic signal of CSPs in its natural biological body.In vitro in environment CSPs be combined with ssDNA and RNA (Phadtare, etc., Molecular Microbiology33:1004 (1999)).In translation process, CSPs is considered to be combined with RNA and stop secondary structure to form in relatively nonspecific mode, has stablized RNA (this function is sometimes referred to as RNA chaperone).Then, this ribose physical efficiency easily replaces this CSPs and in wire RNA template, starts translation.We believe that the present invention can relate to the single-chain nucleic acid combined function of these protein, this function can be from any cold shock protein or the albumen that contains cold shock structural domain, it comprises, for example, prokaryotic organism cold shock protein, the gene that contains eukaryote Y-frame, some glycin-rich protein (GRP) and other albumen of containing cold shock structural domain.These albumen include, but not limited at Fig. 4, Trends in Biochemical Science, those shown in 23 (8): 289 (1998) (paper comprises, is hereby incorporated by).This figure has clearly illustrated the evolutionary relationship between these albumen.These albumen probably originated from before modern bacterium and eukaryotic cell divergence, and had supposed that these protein, in unicellular evolution appearance, have just existed before 3,500,000,000 years.As embodiment, we select two kinds of protein transductions to dissolve plant, and as shown in the figure quoting as proof as above-mentioned, these protein are compared with many its eukaryote counterparts, more divergent each other.We estimate that the ectopic expression of these protein can be under various stress conditions, comprise survival after cold, non-irrigated, salt stress, heat, cold shock, fungi infestation, virus infection, infected by microbes and cold germination, the tolerance of improvement to biological and abiotic stress, includes but not limited to plant-growth, vigor, output and health.

The another kind of possible explanation increasing in Plant Under The Stress growth rate is to express excited pathogenic agent associated molecule graphic (PAMP) by CSP.In this model, to there is PAMP response in plant, it will excite plant responding, and some is similar to Systemic acquired resistance (SAR) (be more similar to biology and coerce produced SAR), as plant coercing and just it " being done some preparations " before applying.For this model running, when CSP exists, plant should send signal, recently already by Plant accepter is combined to this mechanism (Felix, etc., Journalof Biological Chemistry278 (8): 6201-8 (2003)) that provides with CSP.This mechanism means any and excites the gene of PAMP type response receptors bind to work in the present invention.The response of PAMP type is generally used for the research that biology is coerced, and the reagent generally giving by external source excites.At this, we can excite the PAMP type response of the CSP that CSP transgenosis is produced.By particle gun or agriculture bacillus mediated conversion, this transgenosis is transformed into vegetable cell as a part for recombinant DNA construction body.It can cause again the response of Systemic acquired resistance type in plant, has strengthened the resistance to abiotic stress.This response energy is incorporated in monocotyledons and dicotyledons, includes but not limited to corn, soybean, wheat, rice, Arabidopis thaliana, canola and cotton.If above-mentioned PAMP method is CSPs is the model of representative, estimate that this CSP can provide biology to coerce with abiotic stress and protect.These mechanism are not intended to restriction, and wherein one or both, or other are all, may with occurred phenotypic correlation.

MF2, a kind of Csp sample albumen from bacillus thuringiensis (Bacillus thuringensis), it is said the protection of some anti-virus infection can be provided in plant.United States Patent (USP) 6,528,480 have shown the extract friction plant leaf that contains this albumen by use the tolerance that biology is coerced producing with this plant of virus infection.In this patent, they estimate energy, but do not produce transgenic plant.

Within " non-transformed plant mutually of the same race " is intended to be included in all plants mutually of the same race with conversion of plant.In one embodiment, described non-transformed plant and conversion of plant are mutually of the same race and strain.In another embodiment, described plant is likely identical with conversion of plant.

" cold shock structural domain " is (CSD) a kind of and protein sequence cold shock protein homology.For the present invention, the albumen that comprises cold shock structural domain is a kind of " cold shock protein ".Between intestinal bacteria CspA or Bacillus subtilus CspB and the cold shock structural domain of the albumen that contains cold shock structural domain, observe and be greater than 40%, 50%, 60%, 70%, 80%, 90%, 95% or 98% amino acid identity (Wistow, Nature344:823 (1990); Yamanaka, etc., Mol.Micro., 27:247, specifically referring to Figure 1B of Yamanaka reference; Graumann, waits .TIBS23:286).

" yeast " is often referred to Saccharomyces cerevissiae but also comprises chestnut wine fission yeast (Schizosacchoramyces pombe) and other kinds (for example, from Pichia) as used herein." corn " refers to Zea Mays and can be by all kinds and the mutation of its cultivation." wheat " refers to all Triticum aestivum kinds, includes but not limited to spring wheat, winter wheat and all selectable wheat breeds." wheat " comprises any other wheat breed, includes but not limited to flint wheat (Triticum durum), Si Peierte wheat (Triticum spelta), emmer (Triticum dicoccum) and wild emmer (Triticum monococcum)." wheat " also comprises can be by all kinds of above-mentioned arbitrary wheat breed cultivation and the offspring of described cross-fertilize seed (hybrid that comprises triticale, a grow wheat and rye)." soybean " refers to Glycine max or Glycine soia and can be by all kinds or the mutation of its cultivation." rice " refers to Oryza sativa and can be by all kinds or the mutation of its cultivation." barley " refers to Hordeum vulgare and can be by all kinds and the mutation of its cultivation." oat " refers to Avena sativa and can be by all kinds and the mutation of its cultivation." canola " is the new wound name of Semen Brassicae campestris plant, oilseed rape (Brassica napus L.) and the turnip rape (B.campestris L) of recently giving the genetic modification seed, oil and the food that produce, comprises the biology of all Semen Brassicae campestris plants and available its breeding at this canola.Intestinal bacteria (E.coli and Escherichia coli) comprise intestinal bacteria kind biology and all bacterial strains thereof as used herein; Be E.coli K12.Intestinal bacteria (E.coli and Escherichia coli) also can comprise all biologies that can engage with any coli strain as used herein, when one is F ⁺or Hfr bacterial strain, and another one is not while being.Bacillus subtilus (B.subtilis and Bacillus subtilis) refers to that all bacillus Bacillus subtilus kinds are biological.Agrobacterium tumefaciens (Agrobacterium tumifaciens) comprises bacterial strain and the type of all these kinds as used herein." turfgrass " comprises that all once cultivation maybe can cultivate grass seeds and the strains that produce turf, and described turf includes but not limited to: lawn, for the match place of (being American football, baseball or Association football) and the All Ranges of golf course (region of kicking off, alley ,Guo ridge, barrier etc.)." cotton " refers to the Gossypium of institute platymiscium and can be by all plants of its cultivation.

In " thermotolerance " of this indication as plant the measuring of energy for growth in thermal environment or under compared with hot temperature degree, described thermal environment or the growth of phase kindred plant, vigor, output, size are played to disadvantageous effect compared with hot temperature degree.Thermophytes nonrefractory plant-growth more of the same race under heat stress environment obtains better.

" salt tolerance " refers to the ability of certain plants growth under the coercing that osmotic stress or the salt in water and soil or ion produce.For example, when the substratum of water liquid or carrier contains when different plant-growths mutually of the same race are played to the water of detrimental action and the mixture of ion, compare with mutually of the same race and/or mutation plant, the plant with the growth rate of increase should have salt tolerance accordingly.The non-transformed plant of the more of the same race and strain of some conversion of plant has stronger tolerance for the situation of these types.

Allly at this, use numerical value modified by term " about ", approximately mean that this numerical value can change, in either direction, at the most 10% and still keep identical implication.For example, 1M solution should comprise all such solution, is less than or equal to 1.1M but is more than or equal to 0.9M.For example, percentage ratio also can be modified, and 10% comprises all percentage ratios of from 9% to 11%.The term that adjective " just in time " limits is not limited by term " about ".

" glycin-rich protein " is defined as the albumen in a kind of eukaryotic cell, contains the albumen of cold shock structural domain, or substantially same with it, or its homologue.

" after cold shock, survive " and be defined as plant lasting ability of growing one period of working lipe after being placed in lower than the temperature of this plant growth stage normal temps.Should be understood that certain plants, or even those are mutually of the same race, through being chosen under cold environment, can grow.The Wigor pure lines ability of corn is subject to cold environment and has obviously higher surviving rate when being placed in the commercially available most of commercial strain of those environment Zhong Shi， compare U.S..Wigor in Poland as commodity selling.Therefore, for transgenic plant, cold tolerance should be in the plant of identical strain of identical association phase and the scope of identical type plant relatively, to obtain significant science data.Then, should to plant, give a mark at once, or after shock several days or measure their vitality, growth rate and other phenotypes several week.

" arid " or " growth moisture is limited " is defined as one dry period, particularly, when its overtime, can damage farm crop or hinder their smooth growth.In addition, different plants mutually of the same race, and those different lines mutually of the same race, can have different tolerances to arid, dry and/or lack of water.In laboratory, arid can be by giving plant 95% compared with control plant or moisture is still less simulated, and find in vigor, growth, size, root is long and all other physiology and physics are measured difference.Arid also can be by watering to certain plants in field, and other plant does not water to simulate, and their growth velocity, the particularly growth of the serious limited local plant of moisture relatively.

Abiotic stress tolerance includes but not limited to, the output increasing, growth, biomass, health or other are indicated measuring of stress tolerances, and it includes but not limited to that heat stress, salt stress, cold coercing (being included in cold the coercing in germination process), water stress (include but not limited to drought coerce), nitrogen coerces (comprising high nitrogen and low nitrogen).

Biological stress tolerance includes, but not limited to measuring of the output, growth, biomass, health or other indication stress tolerances that increase, and it includes but not limited to that the fungi infestation of plant, bacterium infect and virus infection.

Some gene order disclosing as the present invention's part is bacterial origin, for example, and some prokaryotic organism cold shock protein.The bacterial gene of unmodified as well known to those skilled in the art is expressed very low sometimes in transgenic plant.Vegetable codon usage is more similar to the mankind and other higher organisms such as the unicellular organism of bacterium.Some reports have disclosed for improving the method for plant recombinant gene expression.These reports have disclosed several different methods, based on vegetable codon frequency meter, improve codon the 3rd bit base preference, use containing suspicious polyadenylation or be rich in A/T region or the recombination sequence of intron montage consensus sequence, for artificial reconstructed encoding sequence so that the sequence that can more effectively translate to be provided.Although these merit attention for the synthesis of gene constructed method, but the inventor intends according to (U.S. Patent numbers 5 such as Brown, 689,052 1997, it is hereby incorporated by full) and/or the above-mentioned method of quoting and additive method, the synthetic gene of producing cold shock protein or containing cold shock domain protein.Therefore, the invention provides a kind of method for the preparation of express the synthetic plant gene of desirable proteins product in plant.In brief, according to the method for Brown etc., reduce the frequency of rare in coding desirable proteins polynucleotide sequence or half rare monocotyledons codon and replace with the monocotyledons codon of preference more.The frequency of occurrences based on six monomeric units in monocotyledons, namely the rarest 284, the frequency of occurrences of 484 and 664 6 monomeric units, by analyzing encoding sequence in continuous Hexanucleotide segment and changing the required polypeptide of the polynucleotide sequence coding of this sequence modification, the accumulation increasing in monocotyledons is to produce the result that preference codon frequency increases.In addition, Brown etc. have disclosed the expression that the method that reduces rare codon frequency by application increases recombination, polyadenylation signal and the appearance of intron splice site in minimizing nucleotide sequence have been used, remove in nucleotide sequence and also with non-self-complementary Nucleotide, replace above-mentioned sequence from complementary series, and keep the structure gene of this polypeptide of coding, and reduce the method for the frequency that in nucleotide sequence, the pairing of 5 '-CG-3 ' dinucleotides occurs.For the most of amino acid that exist in expectation polypeptide, these step order are carried out, and the storage effect having has caused containing in nucleotide sequence for the preferential more monocotyledons codon of preference utilizing of monocotyledons.Particularly all albumen is referred in this estimated to be made into synthetic gene as discussed above, or uses similar method, these albumen to include but not limited to intestinal bacteria CspA and Bacillus subtilus CspB.

Work described here has definite reinforcement expression of plants cold shock protein and the method that contains cold shock domain protein, after mixing susceptible plants nucleus, plastid or chloroplast gene group during ectopic expression, it can give the resistance to many plant stresses, can include but not limited to that hot and cold, non-irrigated, salt and other coerce, or coerce relevant phenotype (survival and other abiotic stress after cold germination, cold shock).United States Patent (USP) 5,500,365 (being incorporated herein by reference especially at this) described a kind of for the synthesis of plant gene to optimize the method for this synthetic gene proteins encoded expression level.The method relates to the genetically modified structural gene sequence of modification external source and makes them more " be similar to plant " and be therefore more likely translated and express by plant, monocotyledons or dicotyledons.But, use United States Patent (USP) 5,689 preferably in monocotyledons, the method disclosed in 052, it is for strengthening genetically modified expression.

In exploitation nucleic acid construct of the present invention, the Multiple components of this construct or its segment are inserted in suitable cloning vector conventionally, if the plasmid copying in such as colibacillary host bacterium.Already described in the literature the variety carrier existing, it is commercially available wherein having many.After every time cloning, the cloning vector with required inset can separated and further operate, such as restriction digest, insert new segment or Nucleotide, connection, disappearance, sudden change, excision etc., to be applicable to expecting the composition of sequence.Once complete this construct, the method then transforming according to host cell can be transferred in suitable carrier for further operation.

Double chain DNA molecule of the present invention comprises, for example, by any applicable method, can insert the cold shock protein in Plant Genome expression cassette.Applicable plant conversion carrier comprises those that come from agrobacterium tumefaciens Ti-plasmids, and is disclosed in, as Herrera-Estrella etc., (1983), Bevan (1984), Klee etc., those of (1985) and EPO publication number 120,516.Except coming from the Ti of Agrobacterium or the plant conversion carrier of hair root induction (Ri) plasmid, alternative method can be used for DNA construct of the present invention to be inserted in vegetable cell.Such method for example can include, but not limited to pharmaceutical chemicals by using liposome, electroporation, the picked-up of increase dissociative DNA, by microparticle bombardment, be sent dissociative DNA and used virus or pollen to transform.

Being suitable for using electroporation that the gene of encoding cold shock protein or contain cold shock domain protein is imported to monocotyledonous plasmid expression vector can be comprised of following: the promotor working in plant; The intron that provides splice site to be beneficial to genetic expression, for example Hsp70 intron (PCT publication number WO93/19189); And such as 3 ' polyadenylation sequence of nopaline synthase 3 ' sequence (NOS3 ').This expression cassette can be assembled into and be suitable for the height copy replisome that a large amount of DNA produce.

A kind of Ti-plasmids box carrier for Plant Transformation is pMON-17227.This carrier is described in PCT publication number WO92/04449 and the gene of the enzyme that contains the conferring glyphosate resistance of encoding (called after CP4), and for many plants, this gene is a kind of fabulous selective marker.As described in this article, this gene is fused on Arabidopis thaliana EPSPS chloroplast transit peptides (CTP2) and from FMV promoter expression.When q.s cell (or protoplastis) that acquisition contains sedoheptulose 1,7-bisphosphatase gene or cDNA, this cell (or protoplastis) is regenerated as whole plant.Selection for regeneration step method is not crucial, for from pulse family (clover, soybean, trifolium etc.), umbelliferae (Radix Dauci Sativae, celery, parsnip), Cruciferae (wild cabbage, radish, canola/Semen Brassicae campestris etc.), Curcurbitaceae (muskmelon and cucumber), Gramineae (wheat, barley, rice, corn etc.), Solanaceae (potato, tobacco, tomato, pepper), various colored crops, Sunflower Receptacle for example, and produce nut trees, it is available that for example the host of apricot, cashew nut tree, walnut tree and pecan has suitable experimental program.

Can put into practice for expressing the plant of cold shock protein and include, but not limited to locust tree by the present invention, alfalfa, sweet fennel, apple, apricot, choke, rocket salad, asparagus, avocado, banana, barley, bean, beet, blackberry, blueberry, blueberry, stem cabbage, brussels sprouts, Caulis et Folium Brassicae capitatae, canola, cantaloupe, Radix Dauci Sativae, cassava, Cauliflower, celery, cherry, coriander, citrus, the little oranges and tangerines of Ke Laimenshi, coffee tree, corn, cotton, cucumber, Pseudotsuga menziesii (Mirbel) Franco, eggplant, witloof, wide leaf lettuce, eucalyptus, fennel, Fructus Fici, cucurbit, grape, natsudaidai, honeydew melon, yam bean, Kiwifruit, lettuce, fragrant-flowered garlic, lemon, bitter orange, torch pine, mango, muskmelon, mushroom, nut, oat, gumbo, onion, orange, ornamental plant, papaya, parsley, pea, peach, peanut, pears, pepper, persimmon, pine tree, pineapple, psyllium, plum, pomegranate, white poplar, potato, pumpkin, Wen cypress, pine, red witloof, radish, immature fruit of Juteleaf Raspberry, rice, rye, Chinese sorghum pine broom, soybean, spinach, pumpkin, strawberry, sugar beet, sugarcane, Sunflower Receptacle, sweet potato, sweetgum, red tangerine, tea tree tobacco, tomato, turf, vine, watermelon, wheat, Chinese yam, shagreen bush pumpkin, or any other plant.

" promotor " refers in conjunction with RNA polymerase (and being often other transcription factors) and starts the DNA sequence dna that downstream DNA sequence is transcribed.When comparing with its hetero-organization, in some tissue, promotor provides expression enhancing or that weaken conventionally.Select promotor, selecting specifically when plant is born abiotic stress, to increase the promotor of expressing in the present invention should be particularly useful.

Observed in the art some stress response plant has been had to similar effect, and can provide to a kind of resistance of coercing the resistance that another kind is coerced.For example, to the relation between dehydration and low temperature response, can find out this point (Shinozaki, etc., Current Opinions in Plant Biology3 (3): 217,2000).Many other papers have shown between different abiotic stress, to have general mutual relationship, and point out to cause producing the tolerance (Pernas stronger to some other abiotic stress for a kind of tolerance performance of coercing, Deng., FEBS Lett467 (2-3): 206,2000; Knight, Int Rev Cytol195:269,2000; Didieriean, etc., Planta199:1,1996; Jeong, etc., Mol Cells12:185,2001).

Outside being contained in the expression of plants element of T-DNA, in DNA section, contained expression cassette and regulatory element is present in many plasmid DNA skeletons conventionally, and a plasmid maintains the use of element, these elements comprise, but be not limited to, aad (Spc/Str) gene of tool bacterium spectinomycin/streptomycin resistance, the pBR322ori (ori322) of replication orgin for keeping intestinal bacteria is provided, for conjugal transfer, enter the bom site of agrobacterium tumefaciens cell, and contain the 0.75kb oriV DNA section from RK2 plasmid replication starting point.In addition, those integrate required element for the designed plasmid of conversion of plant contains the promising Agrobacterium albumen endogenous dna that plays insertion element effect conventionally.These elements comprise marginarium (borders) (right hand edge district (RB) and left hand edge district (LB)).

Recombinant DNA technology laboratory rules are that those are well known and normally used as used herein.Standard technique is for clone, and DNA is separated with RNA, amplification and purifying.General enzymatic reaction comprises according to using DNA ligase, archaeal dna polymerase, restriction enzyme etc. described in product description.These technology and multiple other technologies are conventionally according to Sambrook etc., Molecular Cloning-A Laboratory Manual, the 2nd edition., Cold Spring Harbor Laboratory, Cold Spring Harbor, what New York (1989) was described carries out.

The patent documentation of all publications of quoting as proof in this manual and announcement is hereby incorporated by, as each piece of independent publication or patent application clearly and are individually shown to be incorporated herein by reference.

Following included embodiment is used for illustrating embodiment of the present invention.Those skilled in the art are to be understood that disclosed in an embodiment technology represents subsequently be the inventor find can in the present invention's practice, play the technology of fine effect.But, consider content disclosed in this invention, those skilled in the art should recognize and can carry out many modifications to disclosed specific embodiments, still can obtain same or similar result, and do not deviate from the spirit and scope of the present invention, therefore all in drawings and Examples listed or shown in content be considered to illustrative, be not intended to restriction.

Embodiment

Embodiment 1.

PMON57396 (Fig. 1) is a kind of binary vector, for agriculture bacillus mediated conversion be similar to the constitutive expression of the albumen (SEQ ID NO:56) of intestinal bacteria CspA at Arabidopis thaliana.For cloning this intestinal bacteria CspA gene, CspA sequence information (the Genbank M30139 of NCBI (National Center for Biotechnology Information) based on from being under the jurisdiction of the National Library of Medicine (National Library of Medicine) of NIH (National Institutes of Health (NCBI)), GI:409136), design two gene-specific primer MF1 and MF2.MF1 sequence is AGGTAATACACCATGGCCGGTAA (SEQ ID NO:66), it is in the annealing of CspA translation initiation site place and introduce NcoI site at 5 ' end, MF2 sequence is TTAAGCAGAGAATTCAGGCTGGTT (SEQ ID NO:67), and it is in the annealing of the last codon of CspA place and introduce EcoRI site at this primer end.Carry out PCR separating Escherichia coli CspA.Specifically, cracking e.colidh5αcell, a small amount of lysate is as template amplification CspA gene, with MF1 and MF2 primer, Taq polysaccharase with carry out the dNTP of Roche Molecular Biochemicals (Indianapolis, IN).Thermal cycle conditions is as follows: 94 ℃, and 1 minute, then 94 ℃, 16 seconds; 55 ℃, 1 minute and 72 ℃, 30 circulations of 1 minute.With gel electrophoresis, purify increased CspA DNA, with NcoI and EcoRI, digest and connect into binary vector pMON23450 (Fig. 2), this carrier is in advance with NcoI and EcoRI digestion and linearized.Use T4 ligase enzyme to connect, and program after carrying out according to the suggestion of manufacturer (BRL/Life Technologies, Inc., Gaithersburg, MD).By connection mixture be transformed in Bacillus coli cells for plasmid propagation (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989).The cell transforming on suitable selection substratum, carry out flat board cultivation (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989), and after several hours or several days bacterium colony is rule.Plasmid preparation is from single bacterium colony and measure complete insertion sequence.

The plasmid producing also by restriction mapping (for example, referring to Griffiths, etc., An Introduction to Genetic Analysis, the 6th edition, pp449-451, ISBN0-7167-2604-1, W.H.Freeman and Co., New York) and order-checking be confirmed.In carrier, selected NcoI-EcoRI cloning site is in upstream (5 ') side joint CaMV e35S promotor with at downstream (3 ') side joint epitope tag (Flag, its oligopeptides DYKDDDK (SEQ ID NO:68) that encodes, SIGMA, St Louis) time, thereby the intestinal bacteria CspA in this construct adds Flag epitope tag at C-end, and can start and transcribe arabidopsis thaliana transformation by CaMV e35S promotor.Above-mentioned clone has produced the plasmid that a kind of coding is similar to the albumen of SEQ ID NO:55.The plasmid producing is called pMON57396.

Embodiment 2.

PMON57397 (Fig. 2) is a kind of binary vector, for agriculture bacillus mediated conversion be similar to the constitutive expression of the albumen (SEQ ID NO:57) of intestinal bacteria CspA at Arabidopis thaliana.For building pMON57397, with restriction enzyme XhoI and SalI, digest the binary vector pMON57396 (seeing above-described embodiment) that contains intestinal bacteria CspA gene that its C-end is added with Flag epitope tag, to remove in carrier these sites and to discharge FLAG epitope tag (this FLAG epitope tag coding oligopeptides DYKDDDK, SIGMA, St Louis).Then purifying the again plasmid of wire.Use T4 ligase enzyme to connect, and program after carrying out according to the suggestion of manufacturer (BRL/Life Technologies, Inc., Gaithersburg, MD).By connection mixture be transformed in Bacillus coli cells for plasmid propagation (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989).The cell transforming on suitable selection substratum, carry out flat board cultivation (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989) and after several hours or several days, bacterium colony is rule.Plasmid preparation is from single bacterium colony and measure complete insertion sequence.Above-mentioned clone has produced the plasmid that a kind of coding is similar to the albumen of SEQ ID NO:57.

The plasmid producing (does not for example exist to guarantee XhoI and SalI site by restriction mapping yet, referring to Griffiths, Deng, An Introduction to Genetic Analysis, the 6th edition, pp449-451, ISBN0-7167-2604-1, W.H.Freeman and Co., New York) and order-checking and being confirmed.In this construct, intestinal bacteria CspA gene does not have marker at C-end, and is started and transcribed by CaMV e35S promotor.

Embodiment 3.

PMON57398 (Fig. 4) is a kind of binary vector, for agriculture bacillus mediated conversion be similar to the constitutive expression of the albumen (SEQ ID NO:59) of Bacillus subtilus CspB at Arabidopis thaliana.For cloning this Bacillus subtilus CspB gene, CspB sequence information (the Genbank U58859 of NCBI (National Center for Biotechnology Information) based on from being under the jurisdiction of the National Library of Medicine (National Library of Medicine) of NIH (National Institutes of Health (NCBI)), gi:1336655), design two gene-specific primer MF3 and MF4.MF3 sequence is AGGAGGAAATTCCATGGTAGAAG (SEQ ID NO:69), it is in the annealing of CspB translation initiation site place and introduce NcoI site at 5 ' end, MF4 sequence TCAATTTATGAATTCGCTTCTTTAGT (SEQ ID NO:70), it is in the annealing of the last codon of CspB place and introduce EcoRI site at this primer end.Carry out the separated Bacillus subtilus CspB of PCR.Bacillus subtilis cell obtains from Carolina Biological Supply (Burlington, NC), lysing cell using a small amount of lysate as template amplification CspB gene, use MF3 and MF4 primer, Taq polysaccharase and from the dNTPs of Roche Molecular Biochemicals (Indianapolis, IN).Thermal cycle conditions is as follows: 94 ℃, and 1 minute, then 94 ℃, 16 seconds; 55 ℃, 1 minute and 72 ℃, 30 circulations of 1 minute.With gel electrophoresis, purify increased CspB DNA, with NcoI and EcoRI, digest and connect into binary vector pMON23450 (Fig. 5), this carrier is in advance with NcoI and EcoRI digestion and linearized.Use T4 ligase enzyme to connect, and program after carrying out according to the suggestion of manufacturer (BRL/Life Technologies, Inc., Gaithersburg, MD).By connection mixture be transformed in Bacillus coli cells for plasmid propagation (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989).The cell of conversion is carried out on suitable selection substratum flat board cultivate (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989) and after one day, bacterium colony is rule.Plasmid preparation is from single bacterium colony and measure complete insertion sequence.

The plasmid producing also by restriction mapping (for example, referring to Griffiths, etc., An Introduction to Genetic Analysis, the 6th edition, pp449-451, ISBN0-7167-2604-1, W.H.Freeman and Co., New York) and order-checking be confirmed.In carrier, selected NcoI-EcoRI cloning site is in upstream (5 ') side joint CaMV e35S promotor with at downstream (3 ') side joint epitope tag (Flag, its oligopeptides DYKDDDK (SEQ ID NO:68) that encodes, SIGMA, St Louis) time, thereby Bacillus subtilus CspB sample gene adds Flag epitope tag at C-end in this construct, and can start and transcribe arabidopsis thaliana transformation by CaMV e35S promotor.This clone has produced a kind of plasmid, and it has the sequence that the coding inserting in described plasmid is similar to the albumen of SEQ ID NO:59.

Embodiment 4.

PMON57399 (Fig. 6) is a kind of binary vector, for agriculture bacillus mediated conversion be similar to the constitutive expression of the albumen (SEQ ID NO:61) of Bacillus subtilus CspB at Arabidopis thaliana.For building pMON57399, with restriction enzyme XhoI and SaU digestion, at its C-end, be added with the binary vector pMON57398 (seeing above-described embodiment) that contains Bacillus subtilus CspB gene of Flag epitope tag, to remove in carrier these sites and to discharge FLAG epitope tag (this FLAG epitope tag coding oligopeptides DYKDDDK, SIGMA, St Louis).Then purifying the again plasmid of wire.Use T4 ligase enzyme to connect, and program after carrying out according to the suggestion of manufacturer (BRL/Life Technologies, Inc., Gaithersburg, MD).By connection mixture be transformed in Bacillus coli cells for plasmid propagation (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989).The cell of conversion is carried out on suitable selection substratum flat board cultivate (Sambrook etc., Molecular Cloning:A Laboratory Manual, the 2nd edition, Cold Spring Harbor Press, 1989) and after several hours or several days, bacterium colony is rule.Plasmid preparation is from single bacterium colony and measure complete insertion sequence.This clone has produced a kind of plasmid, has the sequence that the coding being inserted in described plasmid is similar to the albumen of SEQ ID NO:61.

The plasmid producing (does not for example exist to guarantee XhoI and SalI site by restriction mapping yet, referring to Griffiths, Deng, An Introduction to Genetic Analysis, the 6th edition, Dp449-451, ISBN0-7167-2604-1, W.H.Freeman and Co., New York) and order-checking and being confirmed.In carrier, selected NcoI-EcoRI cloning site is when the N-end side joint CaMV e35S promotor of upstream (5 '), Bacillus subtilus CspB gene in this construct does not have marker at C-end, and is started and transcribed arabidopsis thaliana transformation by CaMV e35S promotor.Described plasmid is transformed into agrobacterium tumefaciens.

Embodiment 5.

Can be with any obtainable method arabidopsis thaliana transformation plant.For example, can use In planta conversion method by vacuum infiltrate arabidopsis thaliana transformation plant (referring to, Bechtold etc., In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants.CR Acad.Sci.Paris Sciences de la vie/life sciences316:1194-1199 (1993)).This embodiment has illustrated how arabidopsis thaliana is converted.

parent plant material and growth conditions

Prepare 2.5 inches of basins that soil is housed, and cover with screen cloth, guarantee that soil is not pressed too tightly and screen cloth contacts (it has guaranteed that the seedling germinateing can grow through sieve aperture) with soil surface.Sowing seed also covers with the cover (germination dome) that germinates.Vernalization treatment seed 3-4 days.At 20-22 ℃, 70% humidity, within 16 hours, under hour dark condition of illumination/8, cultivate plants.Water weekly twice, and bestow the Peters20-20-20 fertilizer (from Hummert International, Earth City, MO) lower than 1/2X (half of intensity recommended by manufacturer).(full strength of recommending with manufacturer) adds trace nutrient (Hummert ' s Dyna-cereal soluble trace elements) once week about.About 1-2 is after week, removes and covers and allow plant in basin reduce to every basin one strain or two strains.When it is grown, prune leader (primary bolt), to promote more regeneration buds (secondary bolt) to produce.In 5-7 days, this plant is ready be can be used for infiltrating.

agrobacterium preparation (small-scale and large scale culturing):

On LB flat board, to agrobacterium strains ABI line, this substratum contains spectinomycin 100mg/L, Streptomycin sulphate 100mg/L, paraxin 25mg/L and kantlex 50mg/L (being called SSCK).Infiltrating a few days ago, the Agrobacterium of a ring is placed in to the test tube that contains 10ml LB/SSCK and is placed on vibrator, in the dark overnight incubation at 28 ℃.Second day dilutes with 1:50 Agrobacterium and is placed on vibrator in 400ml YEP/SSCK, at 28 ℃, cultivates 16-20 hour.(note: we find that transformation efficiency is obviously higher when LB is when incubated overnight and YEP are used for extensive incubated overnight for the first time).

infiltrate

Be injected into 500ml centrifugal bottle and rotate 20-25 minute under 3500rpm, results agrobatcerium cell.Pour out supernatant liquor.Dry sediment, then be resuspended in 25ml and infiltrate substratum (MS basis salt 0.5%, GamborgShi B-5 VITAMIN 1%, sucrose 5%, MES0.5g/L, pH5.7) in, this substratum contains 0.44nM benzylaminopurine (BAP) (the 1.0mg/L DMSO mother liquors of 10 μ l) and from the 0.02%Vac-In-Stuff (Silwet L-77) of Lehle Seeds (Round Rock, TX).BAP and Silwet L-77 are infiltrating a day fresh interpolation.Add 200 μ l Silwet L-77 and 20 μ l BAP (0.5mg/L mother liquor).Use and infiltrate substratum as well-known blank, obtain the OD of the Agrobacterium suspension of dilution in 1: 10 ₆₀₀.Calculate 400ml Agrobacterium suspension/infiltration substratum, OD600=0.6, infiltrates required volume for vacuum.

Equation:

Resuspended culture is placed in to the Rubbermaid container of vacuum water extractor.The basin that upset contains plant is to infiltrate in solution, and consequently whole plant is all immersed, and comprises rosette, but does not allow too many soil be submerged.Before immersion, be soaked in water at least 30 minutes (stoping soil to absorb Agrobacterium suspension) of plant.

Be evacuated down to the about 23-27 inch of mercury, continue 10 minutes.Air inlet fast.Discharge at short notice moisture in basin, basin is sidelong on the cloth pad with lining, with cover, cover cloth pad to keep humidity, and be put back in growth case.Second day, opens the cover on basin, makes basin upright, and removes cloth pad.Within continuous 5 days, do not water a plant.After upright 5 days, water a plant and continued growth under foregoing the same terms.(blade being infiltrated can be degenerated, but plant should survive until bloomed).

seed results and sterilizing

After infiltrating approximately 2 weeks, by using Lehle Aracons (Lehle Seeds, Round Rock, TX) to make plant be individually formed one by one cone.After all seed maturity results, (infiltrate latter approximately 4 weeks), from water, shift out plant and whole seeds are dried up.After approximately 2 weeks, by the subpyramidal branch of harvesting, gather in the crops seed.Use sieve cleaned seeds, hold back silique and branch thing, allow seed pass through.Seed is placed in to envelope or 15ml test tube.

Before sterilizing, the seed of desired amt is transferred in 15ml taper test tube.Unclamp taper test tube cap and by test tube side in vacuum drier, in moisture eliminator, be placed with and hold 400mlClorox SYNTHETIC OPTICAL WHITNER (Clorox Company, Oakland, CA) and the beaker (in stink cupboard, HCl being added in Clorox) of 4ml hydrochloric acid.Be evacuated down to and just seal this moisture eliminator, close vacuum fan 16 hours (that is, make this moisture eliminator still in vacuum but always directly do not vacuumize).After sterilizing, open vacuum drier the seed-bearing test tube of appearance is placed in to sterile hood (unclamping lid still can discharge gas).

Seed broadcasting (" spilling ") is being selected on flat board, this flat board contains MS basis salt 4.3g/L, GamborgShi B-5 (500X) 2.0g/L, sucrose 10g/L, MES0.5g/L and 8g/L Phytagar (Life Technologies, Inc., Rockville, MD), Pyocianil 250mg/L, cefotaxime 100mg/L.Selection level is kantlex 60mg/L, glyphosate 60pM or Bialaphos10mg/L.

First, take out the seed inspection pollutent of minute quantity.If there is pollutent, seed again sterilizing, more than approximately 4 hours, is checked to pollutent again.Conventionally do not need sterilizing for the second time, but seed speckles with fungal contamination sometimes, need to repeat sterilizing.(the sterilizing time length is generally shorter than 16 hours, because sterilizing surpasses, within 24 hours, can obviously reduce percentage of germination).With Parafilm, seal flat board and be placed in refrigerating chamber and impose the about 2-4 days of vernalization treatment.After seed vernalization is processed, be placed in the percival that cold white bulb is housed.

transfer to soil

At approximately 26 ℃ and after 16/8 photoperiod 5-10 days, can see that transformant becomes green plants.1-2 is after week again, and plant will have at least one group of true leaf.Plant is transferred to soil, cover the cover that germinates, and move in the growth case with conventional Arabidopis thaliana growth conditions.Keep covering until there is significantly new growth (5-7 days conventionally).

Embodiment 6.

For the relatively growth of wild-type non-transgenic and CspA or CspB transgenic arabidopsis plant, make it vertical-growth in sterile petri dish:

Wild-type or transgenic seed make to carry out with the following method sterilization of liquids:

● in 70% ethanol, incubation carries out vortex mixed after 5 minutes

● in 30%Chlorox (6.15% clorox)+0.01%Triton X-100, incubation carries out vortex mixed after 5 minutes

● sterilized water continuous washing 5 times

Seed is placed in (Becton Dickinson-Falcon#35-1112) on the plastic culture dish that 100x15mm is square, and each culture dish contains 40ml nutrient agar, is prepared as follows:

With ammonium hydroxide, regulate 0.5X Murashige and Skoog substratum (Sigma#M5519) pH to 5.8 containing grand nutrition element, micronutrient element and VITAMIN, add 1%Phytagel (Sigma#P8169), as solid carrier.

On half culture dish, broadcast sowing 10 wild-type Arabidopis thaliana seeds, the about 1cm being uniformly distributed apart from edge.Use the Gilson P-200 pipettor of tip sterilization to carry out this step.10 CspA or CspB transgenic arabidopsis seed are similarly sown in second half of culture dish, are uniformly distributed.With marking pen mark flat board so which to indicate partly contain transgenic seed.

Culture dish is placed in the dark 3 days with lamination seed at 4 ℃, is then placed in Percival thermostat container (AR-36L type), at 8 ℃ 24 hours 120 micro-einstein/square metre permanent light under continue 6 weeks.When incubation finishes, relatively CspA and CspB and wild-type rosette form leafage size, find that CspA and CspB are larger.This results are shown in Figure 16.See first, second and last dull and stereotyped photo, at this, used said determination method.In Figure 16, the 3rd photo (CspB+Flag, pMON57399) shown that in flat board, plant has stood to be similar to cold shock test as described below.

Transgenic arabidopsis seed cold shock seedling vigor assessment: horizontal plate assay method.

Introduce:

This is a kind of method that continues energy for growth while being transformed into low temperature from normal temperature for assessment of the transgenic arabidopsis seed that germinates on horizontal culture dish nutrient agar.In brief, to seed sterilizing, lamination from control plant and test transgenic plant and be sown on culture dish in any half 6x8 grid.Dull and stereotyped one week of level attitude incubation under normal temperature, then move at chilling temperature again incubation two weeks, keep dull and stereotyped level attitude.Adopt Digital photographic art record the canopy area of seedling and carry out quantitatively with imaging software.The total canopy area of test seedling can be used as quantitative factor with the ratio that contrasts the total canopy area of seedling and carrys out various goal gene cold tolerance potentiality in comparison transgenosis tester strain.

Material: following main conventional equipment used can obtain from standard biological technology experiment chamber (autoclave, balance, laminar flow hood super clean bench etc.)

-Arabidopis thaliana seed: use Arabidopsis thaliana cv in this experimental program.

-culture dish: Falcon#35-1112 (the square x15mm of 100mm is dark)

-substratum: Sigma M5519=Murashige & Skoog basic medium

-Phytagel(Sigma#P-8169)

-1-rises vial, to nutrient agar autoclaving wherein and for the flat board of casting.We use healthy and free from worry (Corning) vial with orange screw-cap.

-magnetic stirring apparatus and magnetic stirring bar

-can use the electric pipette manager of 50ml plastic suction pipet.

-for the little luminescent lamp box with plastics magnifying glass according to shining seed

-P1000Gilson pipettor (or Equivalent) and sterilization tip

-P200Gilson pipettor (or Equivalent) and sterilization tip

-70% sterilizing ethanol

-30%Chlorox SYNTHETIC OPTICAL WHITNER+0.1%Tween20

-aseptic deionized water

-aseptic micro-centrifuge tube and test-tube stand

-4 ℃ of refrigerating chambers, cold box or refrigerator, preferred dark

-there are approximately 150 μ E/m ²22 ℃ of Percival growth chambers of/second light source or Equivalent.

-there are approximately 150 μ E/m ²8 ℃ of Percival growth chambers of/second light source or Equivalent.

Adhesive tape 3M micropore adhesive tape (3M#1530-1) for-semipermeability surgery

-black (Sharpie) marker pen

-Glassine balance pan paper (VWR#12578-165)

-counter

-notebook

-IBM compatible

-Image-Pro Plus software, 4.1.0.0 version

-Microsoft Excel Software

Experimental program:

1-will be housed in the Eppendorf tube of the sterilizings that are placed in such as seed in test tube or envelope,

Black marking pen for 2-(sharpie) mark test tube to be to remember seed identity,

3-is by by following solution continuous washing and keep the following time to carry out surface sterilization to seed in test tube.Note, the test tube at least twice that overturns in washing process is to guarantee solution and seed-coat good contact.Seed will be fallen test tube bottom, form soft precipitation:

A.70% sterilizing ethanol, continues 3-5 minute,

B.30%Chlorox SYNTHETIC OPTICAL WHITNER+0.1%Tween20, continues 3-5 minute,

C. the deionized water of sterile filtration, continues 30 seconds,

D. repeat c tetra-times above and the last time, leave about 0.5ml sterilized water and overlay in seed precipitation.

1-places Eppendorf tube in the dark 3 days with lamination seed at 4 ℃, makes the dull and stereotyped seed germination of cultivating more consistent.

[or, can be directly by seed broadcasting on culture dish nutrient agar, with rubber belt sealing and before 8 ℃ of cold incubations, culture dish is placed in the dark at 4 ℃ 3 days-under seeing.]

2-, by prepare 0.5X Murashige and the Skoog substratum of 1 liter of sample size in vial, regulates pH to 5.8 with ammonium hydroxide, then adds 10 grams of Phytagel, prepares flat board.When regulating pH, use magnetic stirring apparatus and mix with phytagel, then to liquid high pressure sterilizing, setting (slowly exhaust) 45 minutes.

3-casts dull and stereotyped in laminar flow hood super clean bench, uses the electric pipette manager with 50ml sterilizing transfer pipet that 40ml substratum is discharged into after each flat board, uses at once cap covers dull and stereotyped.

4-allows dull and stereotyped cooling at least 2 hours with gas blower in laminar flow hood super clean bench, after finishing, at 4 ℃, is housed in the plastics bag with the date.

5-mark flat board also scatters seeds:

1-ties four dull and stereotyped limits with semipermeability micropore adhesive tape, and the mark date is also placed in Percival incubator by flat board, is set in 22 ℃ and approximately 100 μ E/m ²16 hour photoperiod on daytime.By dull and stereotyped horizontal positioned, only put one deck incubation 7 days.With digital camera, take pictures and store the data on CD for each flat board.

2-transfers to flat board in Percival incubator, is set in 8 ℃ and approximately 100 μ E/m ²24 hour photoperiod on daytime.By dull and stereotyped horizontal positioned, only put one deck maximum 3 weeks of incubation again.With digital camera, take pictures and store the data on CD for each flat board.

Within the every 2-3 of 3-days, observe flat board once, observe test germplasm upgrowth situation compared with the control and frequently the representational conventional proterties of germplasm carried out to digital photographing.At 8 ℃, incubative time should be less than 2 weeks (maximum 3 weeks).Those germplasms that show difference of looking long will carry out flat board and cultivate to avoid overcrowding when carrying out digital photographing under lower seed density.

4-is used digital camera to take pictures and Image-Pro Plus software measurement rosette form leaf clump canopy area.Calculate the average seedling canopy area of contrast and test colony, in analysis, get rid of the seed that there is no germination.After temperature variation, calculate the ratio of the average seedling canopy area of contrast seedling and test seedling, standard deviation and the standard error of contrast and test seedling group.If there is significant difference between test seedling and contrast seedling, result is just reliable.On notebook, record result.

5-, for transgenic plant material, is discarded in (with the grey rubbish container of transparent plastics refuse bag) in suitable processing vessel by dull and stereotyped and seedling.

Embodiment 7.

Experimental program (Invitrogen, Carlsbad, CA) according to manufacturer connects into carrier pCR-TOPO2.1 by the PCR product of CspA and CspB gene.The NcoI/EcoRI fragment subclone of pCR-TOPO2.1 derivative is entered to pMON48421 (Fig. 7), by identical restriction enzyme linearizing.The NotI fragment of the pMON48421 derivative that contains 35S promoter, Csp gene and e9 terminator is entered to pMON42916 (Figure 17) at NotI site subclone, for building respectively pMON56609 (Fig. 8) and the pMON56610 (Fig. 9) that contains CspA and CspB gene.Adopt currently known methods that described plasmid is transformed in agrobacterium tumefaciens.Estimate that pMON56609 contains the nucleotide sequence that coding is similar to the albumen of SEQ ID NO:7.Estimate that pMON56610 contains the nucleotide sequence that coding is similar to the albumen of SEQ ID NO:9.

Embodiment 8.

Agrobacterium preparation:

On the LB flat board that contains kantlex 50mg/L and Totomycin 50mg/L (being called LB/KH), agrobacterium strains EHA105 is rule.In common cultivation a few days ago, the Agrobacterium of a ring is transferred in the test tube containing 10ml LB/KH, and in 28 ℃ of dark on vibrator incubation 24 hours.This culture is diluted to 1:100 in 20ml LB/KH, and on vibrator, is incubated overnight in 28 ℃ of dark.The culture that second day is got 1ml1:2 dilution is placed in cuvette, makes blank measure OD600 with LB/KH.The 5ml O.D1.0 Agrobacterium suspension calculating for cultivating is altogether volume required.

Equation:

Get volume required Agrobacterium culture and be placed in 40ml centrifuge tube, under 7000rpm centrifugal 7 minutes.Remove supernatant liquor dry sediment.By throw out be resuspended in the common culture medium that 5ml contains 20mg/L Syringylethanone (CC MEDIA-MS basis salt, sucrose 20g/L, glucose 10g/L, VitB1 HCl0.5mg/L, L-PROLINE 115mg/L, 2,4-D2mg/L) in.

Rice embryo transforms:

The Nipponbare of results greenhouse growth and the fringe (panicles) of Taipai309 rice varieties.By will then be immersed in 50% commercial SYNTHETIC OPTICAL WHITNER 10 minutes then in sterile distilled water rinsing carry out sterilizing.With 70% Ethanol Treatment fringe 3 minutes.Then from fringe, peel off seed shelling singly, then transfer in the falcon plastic test tube that contains 0.1%tween20 solution.Follow in laminar flow hood super clean bench with 70% Ethanol Treatment seed.Then use rinsed with sterile water seed.Then by 50% SYNTHETIC OPTICAL WHITNER, process 45 minutes.In sterile distilled water, rinsing seed is 5 minutes.Finally with 0.1% mercury chloride, process seed 5 minutes.With sterile distilled water, wash seed 8 minutes again.

In laminar flow hood super clean bench, under aseptic condition, from aseptic seed, cut off embryo, and be placed in the common culture medium (the CC MEDIA that contains 2g/L phytagel) of solid.The Agrobacterium suspension of mono-of 50 μ L is dropped on the culture dish of sterilizing.10 embryos are transferred in every suspension.Carry out the infection of 15 minutes.With sterilizing transfer pipet point, remove Agrobacterium suspension.Shift the embryo infecting also cultivates in the dark 2 days to fresh solid CC MEDIA flat board.At the 3rd day, with 500mg/L cefotaxime, wash embryo.Then on sterilizing filter paper, be dried embryo and be placed in delay (Delay) substratum (MS basis salt, VitB1 HCl1mg/L, glutamine 500mg/L, magnesium chloride 750mg/L, casein hydrolysate 100mg/L, sucrose 20mg/L, 2,4-D2mg/L, Pichloram2.2mg/L, cefotaxime 250mg/L).Embryo is cultivated 7 days on delay substratum in dark.Forming during this period callus.Shift callus to selecting in substratum (the delay substratum that contains 50mg/L Totomycin) and cultivating in the dark 10 days.Afterwards this callus is carried out to succeeding transfer culture in fresh selection substratum.After 10 days, shift callus and also cultivate in the dark 7 days in regeneration culture medium (MS basis salt, sucrose 30mg/L, kinetin 2mg/L, NAA-0.2mg/L, cefotaxime 250mg/L, Totomycin 25mg/L) again.Then callus transferred in fresh regeneration culture medium and moved under 30 ℃ of 16 hour photoperiods.Shift the seedling of healing tissue development in root media (half intensity MS basis salt, sucrose 15g/L, cefotaxime 250mg/L, Totomycin 25mg/L).The seedling of taking root is transferred to moisture test with in test tube and be placed in fog chamber and temper (hardening).

Select sun plant.For example, can carry out with being similar to described those methods of embodiment 12-14 and 26-29.Comprise the described breeding method for generation of transgenic plant offspring.

Embodiment 9.

tri-leaf period cold shock response-CspB and CspA rice transgenic plant

Plant materials preparation:

Germinate: with 0.01% mercury chloride, process 3 minutes to seed sterilizing, and in milique water, thoroughly wash 10 minutes to remove the mercury chloride of trace.In milique water, soak and within 3 hours, make sterilizing seed imbibition.The seed of imbibition germinates on the wet filter paper of sterilizing under 30 ℃ of temperature and 60%RH, has used germinator (Serwell Instruments Inc.).

Tri-leaf period, seedling was determined: the seedling germinateing 3 days is transferred in the portrays (52.5mm (length) x26mm (deeply) x5.2mm (diameter)) in greenhouse, and this greenhouse has light intensity and the 60%RH of 800 micro-rubbing/mt2/ seconds.In the portrays that contains red sand loam, seedling grows into tri-leaf period (approximately 12 days) always.One week applying fertilizer solution (N-75PPM, P-32PPM, K-32PPM, Zn-8PPM, Mo-2PPM, Cu-0.04PPM, B-0.4PPM and Fe-3.00PPM) once until off-test.

CspB-R2 plant analysis

Experimental program: at 100 micro-rubbing/mt ²under/second illumination and 70%RH, allow rice seedling in tri-leaf period (12 days) stand 10 ℃ and coldly coerce 4 days (Percival growth room).After Stress treatment, in greenhouse, allow plant recovery 10 days and the 10th day to survival plant carry out observation on Growth, recording image evidence.Every kind of strain is each to be processed to have and repeats for 10 times and they are completely randoms.

Result: at 8 different lines for cold stress tolerance test, compare with wild-type, 6 strains have obviously higher cold tolerance.Compare with wild-type, comprise that the strain of R2-226-6-9-3, R2-226-29-1-1, R2-257-20-2-1, R2-238-1-1-3, R2-230-4-4-2 and R2-257-3-1-3 is by the growth (for the contrast without coercing) of the high recovery of performance and low reduction, shown high cold tolerance (table-1, dull and stereotyped-1).Strain R2-230-4-42, has extraordinary performance, and it has 100% survival rate and in recovery process, keeps good growth (table 1).

Table 1.CspB R2 transgenic strain tri-leaf period, cold coercing recovered observation on Growth result

(index: WT=wild-type)

cspB-R3 plant analysis

Experimental program: under 1000 micro-rubbing/mt2/ illumination second, allow tri-leaf period seedling be exposed to 8 ℃ and coldly coerce 1 day (Percival growth room).Subsequently, in 28 ℃ of greenhouses, allow seedling recover 15 days and when recovering to finish, record plant height.

Result: 8 different lines are used for testing cold stress tolerance, compares all 8 strains and has all shown the tolerance of improving with wild-type (non-transgenic) plant.These results have confirmed to show the R2 analytical data (table 2) that improves cold tolerance.

Table 2:CspB R3 transgenic strain tri-leaf period, cold coercing recovered observation on Growth result

csDA-R2 plant analysis

Experimental program: in the growth room of 1000 micro-rubbing/mt2/ illumination second and 70%RH, allow rice seedling in tri-leaf period (12 days) stand 10 ℃ of cold coercing 3 days.After Stress treatment, in greenhouse, allow plant recovery 15 days recorded observation on Growth at the 15th day.Each numerical value is 12 mean values of observing, and this experiment is implemented according to following completely random (CRD) experimental design.

Result: compare with wild-type, have 6 strains to show the cold tolerance improving in 7 tested independent CspA transgenic strains.In this experiment, compare with the plant that nothing is coerced, in the control plant (WT) of deepfreeze, plant height has reduced approximately 50%.And in the independent strain transgenic plant of the difference with CspA gene of deepfreeze, plant height reduces between 4.5%-22.50% (except a kind of strain growth reduces 47.09%).These results show that CspA has improved the cold tolerance (table 3) of rice.

Table 3:CspA R2 transgenosis rice strain cold coercing in tri-leaf period recovered observation on Growth result

cspA-R3 plant analysis

Experiment I

Experimental program: under 1000 micro-illumination that rub, allow tri-leaf period seedling be exposed to 10 ℃ of cold coercing 3 days.Subsequently, in 28 ℃ of greenhouses, allow seedling recover 30 days and when recovering to finish, record plant height and survival rate of seedling (in this experiment, each transgenic strain repeats 8 times and wild-type repetition 10 times).

Result: stood cold 6 transgenic strains of coercing better compared with wild-type performance under cold coercing.The cold tolerance improving by demonstration, these results have further confirmed R2 analytical data (table 4).

Table 4:CspA R3 transgenosis rice strain cold coercing in tri-leaf period recovered observation on Growth result

Annotation: only to survival plant record plant height, more than provided their mean value.

Experiment II

Experimental program: under 1000 micro-illumination that rub, allow tri-leaf period seedling be exposed to 10 ℃ of cold coercing 1 day.Subsequently, in 28 ℃ of greenhouses, allow seedling recover 30 days and when recovering to finish, record plant height and survival rate of seedling (in this experiment, each transgenic strain repeats 8 times and wild-type repetition 10 times).

Result: stood cold 5 transgenic strains of coercing better compared with wild-type performance under cold coercing.The cold tolerance improving by demonstration, these results have further confirmed R2 analytical data (table 5).

Table 5:CspA R3 transgenosis rice strain cold coercing in tri-leaf period recovered observation on Growth value result

heat stress response in tri-leaf period

Plant materials preparation:

Germinate: with 0.01% mercury chloride, process 3 minutes to seed sterilizing, and thoroughly wash (in deionized water approximately 10 minutes) to remove the mercury chloride of trace.In milique water, soak and within 3 hours, make sterilizing seed imbibition.The seed of imbibition germinates on the wet filter paper of sterilizing under 30 ℃ of temperature and 60%RH, has used germinator (Serwell Instruments Inc.).

Determining of seedling in tri-leaf period: the seedling germinateing 3 days is transferred in the portrays (52.5mm (length) x26mm (deeply) x5.2mm (diameter)) in greenhouse, and this greenhouse has light intensity and the 60%RH of 800 micro-rubbing/mt2/ seconds.In containing the portrays of laterite, seedling grows into tri-leaf period (approximately 12 days) always.One week applying fertilizer solution (N-75PPM, P-32PPM, K-32PPM, Zn-8PPM, Mo-2PPM, Cu-0.04PPM, B-0.4PPM and Fe-3.00PPM) once until off-test.

cspA-R2 plant analysis

Experimental program: under 70%RH, allow rice seedling in tri-leaf period (12 days) stand 50 ℃ of heat stresses 3 days.After Stress treatment, in greenhouse, allow plant recovery 15 days recorded observation on Growth value at the 15th day.Each numerical value is 12 mean values of observing.

Result: compare with wild-type, have 6 strains to show the thermotolerance of improving in 7 tested independent CspA transgenic strains.In this experiment, compare with the plant that nothing is coerced, in heat treated control plant (WT), plant height has reduced over 50%.And in the independent strain transgenic plant of the heat treated difference with CspA gene, plant height reduces between 9.5%-35%.These results show that CspA has improved the thermotolerance (table 6) of rice.

Table 6:CspA R2 transgenosis rice strain vegetable hot in tri-leaf period is coerced and is recovered observation on Growth result

CspB-R3 plant analysis

Experimental program: by tri-leaf period seedling be exposed to 53 ℃ of heat stresses 2 hours, in 28 ℃ of greenhouses, allow subsequently seedling recover 15 days and when recovering to finish, record plant height.

Result: compare with wild-type, have 7 product to tie up under heat stress test in 8 transgenic strains of test and show better.These results show that CspB has improved the hot patience (table 7) of rice.

Table 7:CspB R3 transgenosis rice strain vegetable hot in tri-leaf period is coerced and is recovered observation on Growth result

CspA-R3 plant analysis

Experiment I

Experimental program: by tri-leaf period seedling be exposed to 53 ℃ of heat stresses 3 hours, in 28 ℃ of greenhouses, allow subsequently seedling recover 30 days and when recovering to finish, record plant height.

Result: the thermotolerance of improving by demonstration, these results have confirmed R2 analytical data (table 8).

Table 8:CspA R3 transgenosis rice strain vegetable hot in tri-leaf period is coerced and is recovered observation on Growth result

Experiment II

Experimental program: under 1000 micro-illumination that rub, allow tri-leaf period seedling be exposed to 50 ℃ of heat stresses 1 hour, allow subsequently seedling recover in 28 ℃ of greenhouses 30 days and record plant height when recovering to finish.

Result: the thermotolerance of improving by demonstration, these results have confirmed R2 analytical data (table 9).

Table 9:CspA R3 transgenosis rice strain vegetable hot in tri-leaf period is coerced and is recovered observation on Growth result.

water stress response

Plant materials preparation:

Germinate: with 0.01% mercury chloride, process 3 minutes to seed sterilizing, and in milique water, thoroughly wash 10 minutes to remove the mercury chloride of trace.In milique water, soak and within 3 hours, make sterilizing seed imbibition.The seed of imbibition germinates on the wet filter paper of sterilizing under 30 ℃ of temperature and 60%RH, has used germinator (Serwell Instruments Inc.).

CspB-R2 plant analysis

Experimental program

Germination seedling (3 days) is transferred in the water stress of two kinds of different levelss, and this water stress is containing in the PVC basin of vermiculite, to set up, according to field capacity (FC), measuring.FC-100% be state of saturation (being that 100g vermiculite needs 350ml water) (Sharp etc., 1988, Plant physiol.87:50-57).By adding the water of aequum, at the water stress (being 50%FC and 25%FC) containing setting up different levels in the PVC basin of vermiculite.In whole experimentation, by adding the amount of moisture losing due to evaporation every day, keep the moisture state in Different stress level constant.In the greenhouse of 800 micro-rubbing/mt2/ light intensities second and 60%RH, allow seedling under Water Stress Conditions, grow 15 days.At the 15th day that grows, adopt Taking Pictures recording root and seedling.Each strain is processed repetition 10 times at every turn, and they are completely randoms.

By adopting following formula to calculate the percentage that growth reduces.

Result: 4 different CspB transgenic strains are carried out to the analysis of water stress tolerance.Compare with wild-type plant, the CspB transgenic strain of all tests in the process of coercing all demonstrates obviously higher growth.Above-mentioned transgenic strain comprises R2-257-15-1-1, R2-238-1-1-3, R2-257-3-1-6 and R2-226-6-9-3, shows that minimum percentage ratio reduces (FC-100%) with comparing without contrasting of coercing in root and seedling growth.The scope reducing in the root of these strains and seedling growth is between 11-25%.And wild-type plant shows maximum minimizing in growth, it approaches 50%.These results show that CspA has improved the water stress tolerance of rice (table-10 and table-11).

The comparison of table 10:cspB transgenic strain and wild-type root and seedling growth when water stress finishes

(index: WT=wild-type, R:S=root and seedling ratio)

The comparison of table 11:cspB transgenic strain and wild-type root and seedling growth decrement.

Strain	Root growth reduces %	Seedling growth reduces %	Root and seedling growth reduce %
				R2-257-15-1-1	11	23.8	20
R2-238-1-1-3	25	31	30
				R2-257-3-1-6	6	25.2	21
R2-226-6-9-3	19	30.5	27.5
				WT-Taipei	28.4	47.9	42.8

CspA-R2 plant analysis

A. plant materials preparation:

Germinate: with 0.01% mercury chloride, process 3 minutes to seed sterilizing, and in milique water, thoroughly wash 10 minutes to remove the mercury chloride of trace.In milique water, soak and within 3 hours, make sterilizing seed imbibition.The seed of imbibition germinates on the wet filter paper of sterilizing under 30 ℃ of temperature and 60%RH, has used germinator (Serwell Instruments Inc.).

Determining of seedling in tri-leaf period: the seedling germinateing 3 days is transferred in the portrays (52.5mm (length) * 26mm (deeply) * 5.2mm (diameter)) in greenhouse, and this greenhouse has light intensity and the 60%RH of 800 micro-rubbing/mt2/ seconds.In the portrays that contains red sand loam, seedling grows into tri-leaf period (approximately 12 days) always.Fertilizer solution (N-75PPM, P-32PPM, K-32PPM, Zn-8PPM, Mo-2PPM, Cu-0.04PPM, B-0.4PPM and Fe-3.00PPM) is sprayed onto to seedling surface, weekly until off-test.

Experimental program: in the greenhouse of 800 micro-rubbing/mt2/ illumination second and 60%RH, allow a month large seedling stand water stress 3 days.By stopping irrigating, force water stress.When within 3 days, finishing, plant starts to demonstrate wilting symptom.By water plant irrigating, alleviate this and coerce, after 24 hours, record plant and show the percentile observed value of wilting symptom.In each processing, each strain keeps minimum 12 strain plants.

Result: compare with wild-type, independently have 6 strains to show the water stress tolerance of improving in CspA transgenic strain at tested 7.After irrigation, 66% control plant does not recover from wilt, and between the CspA of the independent strain of difference transgenic plant, has the plant of 5%-43% to show wilting symptom (except the wilting of the plant demonstration 85% of a strain) after irrigation.These results show that CspA has improved water stress tolerance (table 12) in rice.

The water stress response of table 12:CspA R2 transgenosis rice strain.

Strain	Show the plant % wilting
		R2-362-3-1-2	17
R2-328-2-1-1	43
		R2-362-7-1-2	85
R2-365-4-5-3	5
		R2-362-6-1-6	Nil
R2-362-3-1-10	15
		R2-362-7-1-2	8
WT-Nipponbare	66

salt stress response

CspB-R3 plant analysis

Experimental program: by the seedling (48 hours) germinateing is transferred to growing 10 days containing in the PVC basin of 200mM NaCl vermiculite, allow them stand Salt Strees Condition.After coercing 10 days, by seedling being transferred in the new basin containing culsageeite, allow them recover 15 days.The observation on Growth value of record such as plant height when recovering to finish.This experiment is carried out after completely randomized design (CRD) in greenhouse, and each processing keeps repeating for 8 times.

Result: 7 CspB transgenic strains and wild-type plant have stood 200mM NaCl and coerced.Under this condition, to compare with wild-type, 5 transgenic strain performances are better.These results show that CspB has improved the tolerance (table 13) of rice plant to salt stress.

Table 13:CspA R2 transgenosis rice strain salt stress recovers observation on Growth result

R3 water stress is measured

By they are transferred in the basin that contains vermiculite, allow and stand water stress from the seedling (3 days) of 4 independent transgenic strains (1,2,3,4) of cspA and the germination of wild-type (No. Nipponbare5).The moisture state that keeps 3 kinds of levels, they are 100% field capacity (FC-100=3.72 ml water/gram vermiculite), 25% field capacity (FC25=0.93 ml water/gram vermiculite), 15% field capacity (FC15=0.558 ml/g of vermiculite).800 micro-rubbing ./mt2/ second. in the greenhouse of light intensity and 60%RH, seedling grows 30 days in different moisture states.In whole experimentation, by adding the amount of moisture losing due to evaporation every day, keep the moisture state in Different stress level constant.In the time of the 30th day, by adding moisture, make its level to FC100 and keep 15 days, allow plant recovery.In experimentation, record such as plant height (pl.ht.) and root (R) seedling (S) length when coercing (ES) and finish and when recovering end the observation on Growth value of dry weight.

Each strain is processed repetition 10 times at every turn, and they are completely randoms.

Table 15: average seedling and root dry weight (mg) while recovering to finish

Table 16: coerce average seedling length while finishing

Strain code name	Strain	FC100	FC25	FC15
						1	R2-362-3-1-3-4	42±4.6	28.4±1.7	27.4±2.1
2	R2-362-6-1-2-2	40.4±2.1	26.1±1.1	25.2±2.2
					3	R2-363-7-1-3-3	40.1±2.7	27±2.0	26.3±1.4
4	R2-365-10-1-2-1	38.9±2.3	26.3±1.6	23.3±2.4
					5	WT-Nipponbare	39.5±1.05	24.2±2.0	24.7±1.9

Embodiment 10.

cspA

Build pMON73607 (Figure 10)

1. with NcoI and ApaI enzyme, cut pMON61322 carrier to open main chain and to cut Csp A gene.By the separated backbone segments of gel-purified.

2. from pMON56609 (Fig. 8) carrier pcr amplification intestinal bacteria cspA gene.Use PCR primer to leave NcoI site and create SwaI and ApaI site at 3 ' end at 5 ' end of gene.

3. connect PCR fragment and pMON61322 (Figure 11) main chain.Be transformed into library efficiency (library efficiency) DH5 α cell.The bacterium colony of screening is identified the clone with inset with ApaI and NcoIc.

4. carrier is checked order to confirm the fidelity of cspA gene and other selection areas of plasmid.

cspB

Build pMON73608 (Figure 12)

1. with NcoI and ApaI enzyme, cut pMON61322 carrier to open main chain and to cut HVA1 gene.By the separated backbone segments of gel-purified.

2. from pMON56610 carrier pcr amplification Bacillus subtilus cspB gene.Use PCR primer to leave NcoI site and create SwaI and ApaI site at 3 ' end at gene 5 ' end.

3. connect PCR fragment and pMON61322 main chain.Be transformed into library efficiency DH5 cell.The bacterium colony of screening is identified the clone with inset with ApaI and NcoIc.

4. pair carrier checks order to confirm the fidelity of Csp B gene and other selection areas of plasmid.

Embodiment 11. maize plants transform

Can maize transformation plant by approach well known, for example, referring to embodiment 20-25 herein.

Embodiment 12.

Can adopt the copy number of following methods analyst transgenic plant.

From tender leaf, collect leaf texture, from the side near bottom and leaf, collect as far as possible.Sample is placed in to 96 orifice plate freeze-drying to spend the night.By placing 3 3mm Metal Ball and use Mega shredder to vibrate 2 minutes homogeneous structures under 1200rpm in each hole.Use contains beta-mercaptoethanol, is buffered to the standard buffer solution extraction DNA of the Tris of pH8, EDTA, NaCl and sodium lauryl sulphate.First with potassium acetate, with chloroform, extract again, and precipitate with Virahol.Then centrifugal, with ethanolic soln, wash and be dried, before further analyzing, DNA is resuspended in Tris-EDTA damping fluid.

With multiple digestion with restriction enzyme DNA and by non-sex change agarose gel electrophoresis isolated fragment.With NaOH solution denatured DNA.Containing in the Tris damping fluid of NaCl and gel being transferred on nylon leaching film by capillary action.Before adding suitable probe, by nylon leaching film prehybridization in containing salmon sperm dna buffered soln, this probe can be radioactivity or DIG mark.After hybridization, washing trace by detecting to radioautograph exposure or with anti-DIG antibody conjugates and suitable substrate detection DIG.

Embodiment 13.

We use the total length open reading frame of cspA and cspB at expression in escherichia coli, have used the carrier (Novagen, Merck KgaA, Darmstadt, the branch of Germany) of the antigen of allowing synthetic and purifying His-mark.Used supplier, the product of Strategic Biosolutions for example, the antigen of purifying can be used for producing polyclonal antibody.The antibody producing can be used to the plant that CSP albumen is expressed in test.

Embodiment 14.

The improvement of transgenic corns strain.In the germplasm such as corn germplasm A (CORN OF GERMPLASM A), corn germplasm C (CORN OF GERMPLASM C) and corn germplasm D (CORN OF GERMPLASM D), produce primary transformant raw.Primary transformant selfing also backcrosses with identical inbreeding genotype non-transgenic plant.Seed from selfing plant is planted in the fields and measures to identify by Taqman zygosity determination method the candidate that isozygotys of inferring, the heterozygosis candidate of inferring and negative candidate.By the heterozygosis candidate of inferring and multiple suitable test cross plant hybridization, as corn germplasm B (CORN OF GERMPLASM B) and corn germplasm D (CORN OF GERMPLASM D).The seed of results hybridization, manual shelling, and divide into groups by selection.Other breeding methods also can adopt, for example, and referring to this paper embodiment 29.

Embodiment 15.

Seedling is processed, and restriction can obtain moisture to the following level of optimum and make to process the phenotype response that generation can be surveyed.For example, this processing can take limiting moisture amount in some days to cause the form of carrying out property water deficit, or takes to produce by water culture osmotic stress seedling the form of isosmotic dehydration, or adopts salt to process.The transgenic positive plant this processing to the phenotype response of improvement can be screened.During the phenotype response of measuring can be included in processing or decubation thinning growth rate or dry weight accumulation after processing, wilt or wilt and recover and root growth rate and dry weight accumulation.For field efficiency assay, those responses with improvement will get a promotion.Screening is by the many transgenic positive of growing in little basin of needs and transgenosis heliophobous plant, and these plants grow in the controllable environment such as growth room or greenhouse.Screened number of plant is subject to arrange with the variable of applied processing and institute's survey phenotypic correlation.

Embodiment 16.

The plant of field growing can through restriction can obtain moisture to optimum with lower horizontal processing, make to process the phenotype response that generation can be surveyed.For example, this processing can be taked during the late growing stage of plant and early stage reproductive development, and in some days, restriction plant can obtain the form that amount of moisture causes the water deficit of carrying out property.In this is processed, with respect to transgenosis heliophobous plant, screening has the transgenic positive plant of improving phenotype response.The phenotype response of measuring can be included in seedling growth rate during processing, leaf withering, grain yield and such as the fringe Yield Components of grain quantity and thousand seed weight.For First Year yield trials, those events with improvement response will get a promotion.Screening can be carried out under the standard species density in planting in region, two nonirrigated farmlands with controlled irrigation.Screened number of plant is subject to arrange with the variable of applied processing and institute's survey phenotypic correlation.

Embodiment 17.

Some described genes will be cloned and be transformed in plant, and produce phenotype with a kind of following method (embodiment 17-30) that is similar to.For example, the Nucleotide of Nucleotide and coding SEQ ID NOS:4-53.

Build object carrier

Use well known to a person skilled in the art that method builds GATEWAY ^tMobject (Invitrogen Life Technologies, Carlsbad, CA) plant expression vector (pMON65154, Figure 13).The element of expression vector is summarized in table 17.The plasmid pMON65154 main chain that comprises bacterium copy function and the ampicillin resistance gene at expression in escherichia coli that comes from plasmid pSK-.In pMON64154, expression of plants element is that those skilled in the art can obtain, and the reference of each element is provided in table 17.All positions of quoting in table 17 refer to the base pair coordinate of each element in the disclosed plasmid figure of Figure 13.In general, pMON65154 comprises the selective marker expression cassette that contains the cauliflower mosaic virus 35 S promoter that operably connects coding neomycin phosphotransferase II (nptII) gene.This selective marker expression cassette 3rd ' district comprises agrobacterium tumefaciens nopaline synthase gene (no) 3rd ' district and Rhizoma Solani tuber osi protein enzyme inhibition factor II (pinII) gene 3rd ' district after it.Plasmid pMON65154 also comprises an expression of plants box, uses GATEWAY ^tMcloning process can insert goal gene.This GATEWAY ^tMclone's box 5 ' side joint has rice Actin muscle 1 promotor, exon and intron, and 3 ' side joint has potato pinII gene 3rd ' district.Use GATEWAY ^tMmethod, replaces this clone's box with goal gene.In the methods for plant transformation that the carrier pMON65154 that comprises goal gene and derivative thereof are sent at the direct DNA by such as microparticle bombardment, be useful especially.Those skilled in the art use approach well known can build the expression vector with similar features.In addition, those skilled in the art are to be understood that other promotors and 3rd ' district can be used for expressing goal gene, and can use other selective markers.

The element of table 17. plasmid pMON65154

Build a kind of separated plasmid vector (pMON72472, Figure 14) for agriculture bacillus mediated methods for plant transformation.This plasmid pRG76 comprises goal gene expression of plants box, the GATEWAY in pMON65154 ^tMclone's box and plant selectable marker expression cassette.In addition the T-DNA marginarium, left and right from Agrobacterium is added on this plasmid.The 5 ’， left hand edge districts that right hand edge district is positioned at rice Actin muscle 1 promotor are positioned at 3 ' of pinII3 ' sequence, and this pinII3 ' sequence is positioned at 3 ' of nptII gene.In addition, the pSK-main chain of pMON65164 is replaced so that this plasmid copies in intestinal bacteria and Agrobacterium by plasmid main chain.The rop sequence that plays DNA replication dna effect in intestinal bacteria in the oriV that plays DNA replication dna effect in Agrobacterium, pBR322 that this main chain comprises multiple Hosts source and for select the spectinomycin/streptomycin resistance gene of existing plasmid intestinal bacteria and Agrobacterium.

The element being present in plasmid vector pRG81 has been described in table 18.

The genetic elements of table 18. plasmid vector pRG81

Embodiment 18.

Encoding sequence is at the GATEWAY inserting such as pMON65154 (Figure 13) ^tMbefore object plant expression vector, by PCR, increase.All encoding sequences all can obtain full length sequence or the DNA sequence dna information from clone, make to be carried out from the amplification of cDNA library expectation sequence.In order to remove most 5 ' and 3 ' non-translational region, according to initial sum terminator codon place or near sequence it, design pcr amplification primer.For can be by being recombined into GATEWAY ^tMcarrier (Invitrogen Life Technologies, Carlsbad, CA) is cloned, and PCR product end is with attB1 and attB2 sequence.

Two kinds of methods are for generation of the aim sequence of the pcr amplification of attB flank.These two kinds of methods are specified in GATEWAY ^tMin clone technology working instructions (Invitrogen Life Technologies, Carlsbad, CA).In first method, use the one group of primer that comprises attB and template specificity sequence.Primer sequence is as follows:

AttB1 forward primer:

5 ' GGG CAC TTT GTA CAA GAA AGC TGG GTN template specificity sequence 3 ' (SEQ ID NO:71)

AttB2 reverse primer

5 ' GGGG CAC TTT GTA CAA GAA AGC TGG GTN template specificity sequence 3 ' (SEQ ID NO:72)

Or attB joint PCR is for the preparation of attB flank PCR product.AttB1 joint PCR is used two groups of primers, i.e. the primer of gene-specific primer and assembling attB sequence.Design DNA sequence dna primer, comprises 12 base pairs of attB1 or attB2 sequence 5 ' end.The primer using is as follows:

AttB1 gene specific forward primer

5 ' CCTGCAGGACCATG forward gene-specific primer 3 ' (SEQ ID NO:73)

AttB2 gene specific reverse primer

5 ' CCTGCAGGCTCGAGCTA cdna reverse Auele Specific Primer 3 ' (SEQ ID NO:74)

Second group of primer is attB joint primer, has following sequence:

AttB1 forward primer 5 ' GGGGACAAGTTTGTACAAAAAAGCAGGCTCCTGCAGGACCATG3 ' (SEQ ID NO:75)

AttB2 joint reverse primer 5 ' GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTGCAGGCTCGAGCTA3 ' (SEQ ID NO:76)

According to the described method of Invitrogen Life Technologies (Carlsbad, CA), by pcr amplification attB1 and attB2 flanking sequence.Purifying reclaim attB flank PCR product from gel as mentioned above.

In some cases, use GATEWAY ^tMtechnology, reclaims attB flanking sequence from PCR, but is not inserted in donor carrier (Donor Vector).Work as GATEWAY ^tMwhile being recombined into the failure of donor carrier, use the conventional cloning process of ligase enzyme for DNA sequence dna is inserted in intermediate carrier (Entry Vector) (Invitrogen Life Technologies, Carlsbad, CA).The consistency of restriction endonuclease sites and required insertion sequence in this carrier is depended in the selection of intermediate carrier.With the digestion with restriction enzyme intermediate carrier through selecting, to remove ccdB gene, dephosphorylation also passes through gel-purified.Selected restriction enzyme depends on the sequence that used intermediate carrier and expectation are inserted.For example, use EcoRI or the combination of other restriction enzymes such as EcoRV and XmaI or NcoI and XhoI to remove ccdB gene from pENTR11 (Figure 15).Other restriction enzymes can be used together with other intermediate carriers, for GATEWAY ^tMin method.For using digestion with restriction enzyme intermediate carrier, it is essential on expectation PCR product, producing suitable sticky end.Can well known to a person skilled in the art that method produces sticky end by multiple, for example digestion with restriction enzyme, joint connect or add restriction site in PCR processes.

In some cases, on PCR fragment and intermediate carrier, can not produce suitable sticky end.Or, instruct and produce suitable sticky end by digestion with restriction enzyme cDNA clone.But, likely produce PCR fragment and intermediate carrier that flat end connects.Use the method, with digestion with restriction enzyme intermediate carrier to remove ccdB gene.With T4DNA polysaccharase, make the flat end of linear intermediate carrier of gel-purified.Those skilled in the art will know that other prepare the method for the DNA molecular of flat end, for example, use the method for Klenow archaeal dna polymerase.By with T4DNA polysaccharase or other suitable polysaccharases, T4 polynucleotide kinase and Phosphoric acid esterase incubation, the flat end of PCR product and preferably dephosphorylation.The flat end that uses approach well known to carry out intermediate carrier and PCR product is connected.Connection product is transformed into intestinal bacteria and plasmid, analyze in single bacterium colony, insert the existence of DNA and in intermediate carrier with respect to the desired orientation in attL site.Selection is with the clone who is next to the aminoterminal attL1 sequence of open reading frame.

More appropriately, when using GATEWAY ^tMmethod, when attB flank PCR product can not insert in plasmid, the TA method of use clone PCR products (Marchuk etc., 1991).This TA method has utilized Taq polysaccharase terminal enzyme (DNA) active.Use method described herein, with digestion with restriction enzyme intermediate carrier and produce flat end.The linear intermediate carrier of this flat end and dTTP and Taq polysaccharase incubation, at a thymine residue of 3 ' end interpolation of every DNA chain.Due to Taq polysaccharase hobby dATP, the PCR product that therefore great majority produce is added with an adenosine at 3 ' end conventionally.Therefore, intermediate carrier and PCR product have complementary single base 3 ' projection.After well known to a person skilled in the art under condition and connecting, plasmid is transformed into intestinal bacteria.From single bacterium colony, separation quality grain analyzing is identified the plasmid in correct direction with expectation inset.For example, or the PCR product TA by end with attB site is cloned in commercial TA cloning vector, pGEM-T EASY (Promega Corporation, Madison, WI).

Before importing plant, to all pcr amplification product order-checkings.To passing through GATEWAY ^tMpCR inset order-checking in the object expression vector that method produces, the aminoacid sequence of the sequence encoding of being inserted to confirm expectation.If use connection method to produce intermediate carrier, using GATEWAY ^tMtechnology checks order to insertion sequence in intermediate carrier before producing object expression vector.Point mutation does not affect amino acid coding, i.e. silent mutation is acceptable.

Embodiment 19. construction of expression vector

GATEWAY ^tMcloning (Invitrogen Life Technologies, Carlsbad, CA) transforms for building corn the expression vector using.This GATEWAY ^tMthe detailed GATEWAY that is described in of method ^tMin clone technology working instructions (Invitrogen Life Technologies, Carlsbad, CA).Use GATEWAY ^tMsystem is conducive to the high-flux clone of encoding gene in plant expression vector.As mentioned above, by PCR, produce the gene order with attB1 and attB2 flanking sequence.Depend on recombinated sequence, attB1 and attB2 are placed in to 5 ' and 3 ' of encoding sequence, produce justice or antisense expression vector., pMON65154 (Figure 13), wherein arbitrary encoding sequence all can insert in justice or antisense orientation, built as described in Example 1, and at GATEWAY ^tMin cloning process, be used as object carrier.

Appoint the method for getting one for insert the encoding sequence of pcr amplification at plant expression vector for two kinds.In first method, the PCR product of the object encoding sequence that comprises 5 ' and 3 ' end attB1 and attB2 flanking sequence and donor carrier (pDONR201 ^tM, Invitrogen Life Technologies, Carlsbad, CA) and at BP CLONASE ^tMthere is lower incubation.GATEWAY ^tMmiddle clone's deposits yields is from this reaction and be transformed into intestinal bacteria.From centre clone's thing isolated plasmid dna.For confirming the fidelity of PCR reaction, can the insertion encoding sequence from intermediate carrier be checked order.By plasmid DNA and the linearizing object carrier incubation of separation clone's thing in the middle of intestinal bacteria bacterium colony, preferred pMON65154, at LR CLONASE ^tMthere is the lower plant expression vector that comprises object encoding sequence that produces.Will be from LR CLONASE ^tMthe DNA of reaction is transformed into intestinal bacteria.The separated plasmid DNA from object expression vector order-checking are to determine the sequence in correct direction and this plant expression vector.At the second, produce in the method for plant expression vector, as mentioned above, by the PCR product with attB1 and attB2 flanking sequence and donor carrier (pDONR201 ^tM, Invitrogen Life Technologies, Carlsbad, CA) and BP CLONASE ^tMincubation.After incubation, the reaction mixture of aliquot further with linearizing object carrier and LR CLONASE ^tMincubation.Produced DNA is transformed into intestinal bacteria, and uses PCR well known in the art or southern blotting technique analytical technology to select the plant expression vector that contains object encoding sequence.Invitrogen Life Technologies (GATEWAY ^tMclone technology working instructions) method of the plant expression vector that this two kinds of generations comprise object encoding sequence has been described.

Or, use restriction enzyme and ligase enzyme to produce intermediate carrier.Intermediate carrier can obtain from EInvitrogen Life Technlogies (Carlsbad, CA).Every kind of intermediate carrier, as pENTR1A, pENTR2B, pENTR3C, pENTR4 and pENTR11, has unique clone and expression characterization.PENTR11 is preferentially for practice of the present invention.Those skilled in the art should recognize that other intermediate carriers also can be used.Using before restriction enzyme and ligase enzyme will expect that sequence is inserted a kind of intermediate carrier, in each side of ccdB gene, need intermediate carrier to carry out restriction digest.Depend on existing restriction site on the DNA sequence dna that will be inserted into intermediate carrier, use the restriction enzyme of multiple various combination.Preferred intermediate carrier is dephosphorylation, and after restriction digest by gel-purified.Use well known to a person skilled in the art that molecular biology ordinary method will expect that DNA sequence dna inserts intermediate carrier.TA clone (U.S. Patent number 5,827,657) is a kind of preferred method that PCR fragment is cloned into intermediate carrier.

Carrier (being called pMON and 5 numeral numbers) and wherein comprise and use GATEWAY ^tMthe encoding sequence that cloning process produces is, for example, and SEQ ID NOS:4-28.Estimate to use method as herein described, some encoding sequence of the present invention can be cloned into plant expression vector.

Embodiment 20.

Maize planting germplasm A in greenhouse (CORN OF GERMPLASM A) plant.When the long 1.5-2.0mm of embryo, from plant, gather in the crops fringe, 10-15 days after pollination conventionally, 11-12 days after the pollination of being everlasting.By spraying or fringe being immersed in 80% ethanol fringe is carried out to surface sterilization, air-dry subsequently.Or, by being immersed in the 50%CLOROX containing 10%SDS ^tMin fringe was carried out to surface sterilization in 20 minutes, then use rinsed with sterile water 3 times.

Use well known to a person skilled in the art the immature embryo of separated every the seed of method.Containing 16.9mg/L AgNO ₃substratum 211 (N6 salt, 2% sucrose, 1mg/L2,4-D, 0.5mg/L nicotinic acid, 1.0mg/L VitB1-HCl, 0.91g/L altheine, 100mg/L inositol, 0.5g/L MES, 100mg/L casein hydrolysate, 1.6g/L MgCl ₂, 0.69g/L L-PROLINE, 2g/L GELGRO ^tM, pH5.8) (be called substratum 211V) and above cultivate immature embryo 3-6 days, preferably before microparticle bombardment, cultivate 3-4 days.

Embodiment 21.

The method that known agriculture bacillus mediated maize cell and other monocotyledonss transform (Hiei etc., 1997; U.S. Patent number 5,591,616; U.S. Patent number 5,981,840; Disclosed European patent application EP 0672752).Although multiple agrobacterium strains can be used (seeing above-mentioned reference), the inventor preferentially uses strains A BI.This Agrobacterium ABI bacterial strain is from strains A 208, and a kind of C58 nopaline type bacterial strain, by cultivating and remove Ti-plasmids wherein at 37 ℃, also contains the Ti-plasmids pMP90RK (Koncz and Schell, 1986) of modification.A kind of agrobacterium tumefaciens binary vector system (An etc., 1998) be preferred for maize transformation.Already describe the interchangeable Ti-plasmids (Rogers etc., 1988) of integrating altogether, can be used for maize transformation.Use electroporation (Wen-jun and Forde, 1989) or triparental cross (Ditta etc., 1980) a kind of binary vector that comprises one or more goal gene can be imported in harmless (disarmed) agrobacterium strains.Binary vector can contain selectable marker gene, the marker gene that can screen and/or one or more give the gene of the plant desired phenotype proterties of conversion.A binary vector for illustration, pMON30113, is shown in Fig. 4.Other binary vectors can be used and be known to the skilled person.

Before maize cell is cultivated altogether, agrobatcerium cell can be cultivated in LB (DIFCO) liquid nutrient medium at 28 ℃, and this substratum contains suitable microbiotic selects Ti-plasmids for modifying and the maintenance of binary vector.For example, ABI/pMON30113, can containing cultivation in the LB substratum of 50 μ g/ml kantlex, select the maintenance for the Ti-plasmids of pMP90RK modification, and 100 μ g/ml spectinomycins is selected the maintenance for binary vector pMON30113.In agrobacterium strains host, with suitable selective reagents, keeping plasmid, is apparent to those skilled in the art.Before maize cell inoculation, at room temperature in AB substratum (Chilton etc., 1974) in cultivate agrobatcerium cell and spend the night, this substratum is containing the suitable microbiotic and the 200 μ M Syringylethanones that are useful on plasmid and keep.Before maize cell inoculation at once, preferably by centrifugation Agrobacterium, at the 1/2MSVI substratum that contains 200 μ M Syringylethanones (2.2g/L GIBCO (Carlsbad, CA) MS salt, 2mg/L glycine, 0.5g/L nicotinic acid, 0.5g/L L-pyridoxol-HCl, 0.1mg/L VitB1,115g/L L-PROLINE, 10g/L D-Glucose and 10g/L sucrose, pH5.4) washing in, with 0.1-1.0x10 ⁹individual cells/ml is resuspended in the 1/2MSPL substratum (2.2g/L GIBCO (Carlsbad containing 200 μ M Syringylethanones, CA) MS salt, 2mg/L glycine, 0.5g/L nicotinic acid, 0.5g/L L-pyridoxol-HCl, 0.1mg/L VitB1,115g/L L-PROLINE, 26g/L D-Glucose, 68.5g/L sucrose, pH5.4) in.Those skilled in the art can replace 1/2MSVI and 1/2MSPL with other substratum.

Separated prematurity maize as previously mentioned.After excision, in 0-7 days, with Agrobacterium, inoculate embryo, preferably in excision inoculation at once afterwards.Or immature embryo can be cultivated over 7 days.For example, as mentioned above, the callus of embryogeny can be induced and cultivate altogether with Agrobacterium.Preferably, excision prematurity maize, is immersed in Agrobacterium suspension, and this suspension prepare also at room temperature and Agrobacterium incubation 5-20 minute in 1/2MSPL substratum as mentioned above.

At inoculation indusium, transfer to the 3.0mg/L2 that contains of half intensity, 4-dichlorphenoxyacetic acid (2, after 4-D), in the MS substratum (Murashige and Skoog, 1962) of 1%D-glucose, 2% sucrose, 0.115g/L L-PROLINE, 0.5mg/L VitB1-HCl, 200 μ M Syringylethanones and 20 μ M Silver Nitrates or silver thiosulfate.At 23 ℃, immature embryo and Agrobacterium are cultivated to 1-3 days altogether in the dark.Those skilled in the art can replace described substratum with other substratum.

The embryo of common cultivation is transferred to substratum 15AA (462mg/L (NH ₄) SO ₄, 400mg/L KH ₂pO ₄, 186mg/L MgSO ₄-7H ₂o, 166mg/L CaCl ₂-2H ₂o, 10mg/L MnSO ₄-H ₂o, 3mg/L H ₃bO ₃, 2mg/L ZnSO ₄-7H ₂o, 0.25mg/L NaMoO ₄-2H ₂o, 0.025mg/L CuSO ₄-5H ₂o, 0.025mg/L CoCl ₂-6H ₂o, 0.75mg/L KI, 2.83g/L KNO ₃, 0.2mg/L nicotinic acid, 0.1mg/L VitB1-HCl, 0.2mg/L pyridoxol-HCl, 0.1mg/L Bio, 0.1mg/L choline chloride 60,0.1mg/L calcium pantothenate, 0.05mg/L folic acid, 0.05mg/L para-amino benzoic acid, 0.05mg/L riboflavin, 0.015mg/L vitamin B12,0.5g/L casamino acids, 33.5mg/L Na ₂eDTA, 1.38g/L L-PROLINE, 20g/L sucrose, 10g/L D-Glucose) or contain 1.5mg/L2, in the MS substratum of 4-D, 500mg/L Pyocianil, 3% sucrose, 1.38g/L L-PROLINE and 20 μ M Silver Nitrates or silver thiosulfate, and at 27 ℃, without selection, cultivate 0-8 days in the dark.For selecting the medium optimization of transformant and plant regeneration to contain 500mg/L Pyocianil.Those skilled in the art can replace the microbiotic that other control Agrobacterium growth with other microbiotic.The substratum that other sustenticular cells are cultivated can be used as selection.Do not selecting in delay (cultivating for 0 day) situation, selection can start from 25mg/L paromycin.Select substratum can comprise the variant of substratum 211 (above-mentioned) or substratum 211, wherein N6 salt is replaced into MS salt.After two weeks, the callus of embryogeny is transferred in the substratum containing 100mg/L paromycin, approximately two weekly intervals go down to posterity and cultivate once.While selecting to postpone after common cultivation, start embryo cultivating containing in the substratum of 50mg/L paromycin, then at the callus containing continuing culturing embryo formation in the substratum of 100-200mg/L paromycin.Those skilled in the art can be under the paromycin concentration of Growth of Cells that suppresses to lack selectable marker gene cultured tissue, but the concentration at the callus place transforming can be bred.Or, can identify by other selective marker the cell of conversion.Believe under 25-50mg/L paromycin initial incubation approximately two weeks, then under 50-200mg/L paromycin, cultivate and can cause the callus transforming to recover.Select to start 6-8 and recover transformant after week.Plant regeneration is from the embryogeny callus of conversion as above, and this callus recovers for transformant after microparticle bombardment.

The agriculture bacillus mediated maize calli of embodiment 22. transforms

This embodiment has described the method for using Agrobacterium-mediated Transformation maize calli.The method has been used a kind of nptII selectable marker gene and paromycin selective agent as illustration.Those skilled in the art should recognize that other selective markers and selective agent combine replaceable use.

Use well known to a person skilled in the art that method is from immature embryo evoked callus.For example, from the lower 1.5mm-2.0mm immature embryo of the corn seed excision such as the genotypic growth of corn germplasm A (CORN OF GERMPLASM A), and plumular axis side is cultivated down on substratum 211V, generally after excision, cultivate 8-21 days.Or, determine by well known to a person skilled in the art that method can start and maintain the cultivation of definite callus.

According to being described in the Agrobacterium of the method for embodiment 21 for the preparation of plant tissue inoculation.50-100 piece callus is transferred to containing about 0.1-1.0x10 ⁹in the culture dish of the 60mmX20mm of the 15ml Agrobacterium suspension of cfu/ml.A callus is normally being cultivated whole callus or the callus that 2mm-8mm diameter is definite producing from immature embryo for the 21st day.Callus at room temperature with Agrobacterium suspension incubation approximately 30 minutes, then by suction, remove liquid.

Add approximately 50 μ L sterile distilled waters to the Whatman#1 filter paper in 60mm x20mm culture dish.After 1-5 minute, 15-20 piece callus is transferred on every filter paper, for example used

sealing culture dish.Callus and Agrobacterium are cultivated altogether approximately 3 days in the dark at 23 ℃.

From filter paper, callus is transferred on the substratum 211 containing 20 μ M Silver Nitrates and 500mg/L Pyocianil, at 27 ℃-28 ℃, cultivated 2-5 days C in the dark, preferably 3 days.By callus being transferred to containing starting on the substratum 211 of 20 μ M Silver Nitrates, 500mg/L Pyocianil and 25mg/L paromycin, select.At 27 ℃-28 ℃, cultivate in the dark after 2 weeks, callus is transferred to containing in the substratum 211 (substratum 211QRG) of 20 μ M Silver Nitrates, 500mg/L Pyocianil and 50mg/L paromycin.After two weeks, callus is uploaded culture at fresh substratum 211QRG, and at 27 ℃-28 ℃, further cultivates two weeks in the dark.Then, callus is transferred to containing on the substratum 211 of 20 μ M Silver Nitrates, 500mg/L Pyocianil and 75mg/L paromycin.At 27 ℃-28 ℃, cultivate 2-3 after week in the dark, identify paromycin resistant calli.One of ordinary skill in the art would recognize that the callus incubation time interval of going down to posterity is about, with the shorter timed interval, shifting tissue can accelerated selection process, as being better than biweekly once in a week.

From the plant of the callus regeneration that transforms, transfer in soil and in greenhouse, grow as described embodiments.After agriculture bacillus mediated conversion, substratum 217 (seeing embodiment 9) further adds 500mg/L Pyocianil and substratum 127T (seeing embodiment 9) further adds 250mg/L Pyocianil.Agriculture bacillus mediated being converted of summarizing in use table Y produces the maize plant of the conversion that comprises gene of the present invention.

The method of embodiment 23. microparticle bombardments

Microparticle bombardment precontract 4 hours, immature embryo is transferred on substratum 211SV (increasing the substratum 211V of sucrose to 12%).Preferably 25 immature embryos are placed in to 60x15mm culture dish, line up 5x5 grid, the coleoptile end of scutellum is pressed onto in substratum lightly with 20 degree angles.Before bombardment, tissue is preserved in the dark.

Before microparticle bombardment, prepare on it goldc grains suspension that precipitation has required DNA.10 milligram of 0.6 μ rn goldc grains (BioRad) is suspended in 50 μ L damping fluids (150mM NaCl, 10mM Tris-HCl, pH8.0), adds 25 μ L2.4nM expectation DNA solutions in goldc grains suspension, and vortex approximately 5 seconds lightly.Add 75 μ L0.1M spermidines vortex solution approximately 5 seconds lightly.Add 75 μ L25% polyoxyethylene glycol (3000-4000 molecular weight, American Type Culture Collection) solution vortex solution approximately 5 seconds lightly.Add 75 μ L2.5M CaCl ₂and vortex solution 5 seconds.Add CaCl ₂after, by solution warm hundred 10-15 minute at room temperature.By suspension centrifugal 20 seconds (Sorval MC-12V whizzer) under 12,000rpm, remove supernatant liquor subsequently.With 100% washing with alcohol goldc grains/DNA, precipitate twice and be resuspended in 10mL100% ethanol.Goldc grains/DNA prepared product is housed at-20 ℃ to maximum two weeks.

Use electric discharge particle accelerated gene delivery apparatus (U.S. Patent number 5,015,580) that DNA is imported in maize cell.By disperse goldc grains/DNA suspension of 310-320 μ L on thin slice, goldc grains/DNA suspension is coated on to Mylar thin slice, and (one side scribbles aluminium lamination for Du Pont Mylar polyester film, model SMMC2, on two sides all scribble PVDC multipolymer, be cut into the square of 18mm) on.At goldc grains suspension, fixedly after 1-3 minute, remove excess ethyl alcohol air-dry thin slice.As U.S. Patent number 5,015, described in 580, carry out the microparticle bombardment of corn tissue.In electric discharge particle delivery apparatus, alternating current voltage can change.For the microparticle bombardment of the pre-incubated immature embryo of corn germplasm A (CORN OF GERMPLASM A), preferably use the peak voltage of 35%-45%.After microparticle bombardment, cultured tissue at 27 ℃ in the dark.

The selection of embodiment 24. transformants

Expression based on transgenosis neomycin phosphotransferase (nptII) gene, selects transformant comprising on the substratum of paromycin.DNA sent after 24 hours, and tissue is transferred to (substratum 211HV) on the 211V substratum containing 25mg/L paromycin.At 27 ℃, incubation, after 3 weeks, is transferred to (substratum 211G) on the substratum 211 containing 50mg/L paromycin by tissue in the dark.After 3 weeks, tissue is transferred on the substratum 211 (substratum 211XX) containing 75mg/L paromycin.Separated transformant after the selection of 9 weeks.Table Y has disclosed the result of using microprojectile bombardment methods disclosed here to carry out transformant experiment.

Embodiment 25. can educate the regeneration of transgenic plant

Can educate transgenic plant produces from the maize cell transforming.The callus of conversion is transferred to substratum 217 (N6 salt, 1mg/L VitB1-HCl, 0.5mg/L nicotinic acid, 3.52mg/L benzylaminopurine, 0.91mg/L altheine mono-hydrate, 100mg/L inositol, 0.5g/L MES, 1.6g/L MgCl ₂-6H ₂o, 100mg/L casein hydrolysate, 0.69g/L L-PROLINE, 20g/L sucrose, 2g/L GELGRO ^tM, at 27 ℃, cultivate 5-7 days in the dark in pH5.8).Somatic embryo maturation and seedling regeneration start from substratum 217.Tissue is transferred to substratum 127T (MS salt, 0.65mg/L nicotinic acid, 0.125mg/L pyridoxol-HCl, 0.125mg/L VitB1-HCl, 0.125mg/L calcium pantothenate, 150mg/L altheine, 100mg/L inositol, 10g/L glucose, 20g/L L-maltose, 100mg/L paromycin, 5.5gPHYTAGAR ^tM, for seedling, grow in pH5.8).Being organized under 400-600lux illumination on substratum 127T cultivated at 26 ℃.In about 4-6 week after transferring to 127T substratum, when approximately 3 inches high of seedlings and while having root, seedling is transferred in soil, preferably in 3 inches of basins.In growth room, plant is cultivated 2 weeks at 26 ℃, and then, before 5 gallons of basins that are transplanted to for greenhouse growth, the mist platform in greenhouse (mist bench) is upper to be cultivated 2 weeks.Plant grows to the ripening stage and carries out reciprocal cross pollination with the corn germplasm A (CORN OF GERMPLASM A) of inbreeding in greenhouse.From plant, collect seed and for further breeding activity.

Embodiment 26. isolating nucleic acid from plant

At seedling replanting, in soil, 0-2 is all afterwards, and isolating nucleic acid from the leaf texture of R0 plant, collects and quick-frozen in 96 hole disposable boxes, from each plant, has collected the tissue of about 100 milligrams and before analysis, has been housed at-80 ℃.

Use the Qiagen Rneasy96 of improvement ^tMtest kit (Qiagen Inc., Valencia, CA) DNA isolation and RNA from single tissue sample.At 700 μ L Rneasy ^tMin RTL damping fluid (Qiagen Inc., Valencia, CA), use the freezing tissue of 100 milligrams of Bead agitator (Biospec Products, Bartlesville, OK) homogeneous.Sample under 3200rpm centrifugal 15 minutes, and whole supernatant liquors are transferred to Promega WIZARD ^tMin the hole of transparent plate (Promega Corporation, Madison, WI).By vacuum filtration transparent plate clarification sample solution.The supernatant liquor of clarification is for nucleic acid extraction.

For DNA extraction, the sample of 70 μ L clarifications is transferred on the PCR flat board of v-hole, with adhesive foil, cover, and be heated to 95 ℃, continue 8 minutes.At 0 ℃, incubation sample is 5 minutes, follows centrifugal 3 minutes to remove insolubles.Sephadex G-50 gel-filtration box (Edge Biosystems, Gaithersburg, MO) conduct in centrifugal 2 minutes under 2000rpm is prepared.The heat treated supernatant liquor of 50 μ L is loaded in each hole, and by box under 2500rpm centrifugal 2 minutes.20 extra μ L TE damping fluids are added in post effluent liquid, and before analysis, sample plate is housed at-20 ℃.

For RNA, extract, the settled solution of 500 microlitres is transferred in 96 clean hole sample boxs.In each hole, add 100% ethanol of 250 microlitres, and fully mix with sample.Then the solution of whole approximately 750 microlitres is loaded into Promega WIZARD ^tMqiagen Rneasy in filtering unit ^tMin dull and stereotyped hole.The RW1 damping fluid (QiagenInc., Valencia, CA) of 500 milliliters is added in each hole, and remove damping fluid by vacuum filtration.80 microlitres are not added in each hole containing the DNA enzyme (Qiagen Inc., Valencia, CA) of RNA enzyme, and at room temperature incubation is 15 minutes, by vacuum filtration, DNA enzyme solution is extracted out from hole.500 extra microlitre RW1 damping fluids (Qiagen Inc., Valencia, CA) are added in hole, and remove this damping fluid by vacuum filtration.Use the RPE damping fluid 2X (Qiagen, Valencia, CA) of 500 microlitres by vacuum filtration, sample further to be washed.By extracting, be dull and stereotypedly placed on microtiter plate and under 3000rpm centrifugal 3 minutes to remove all RPE buffer solns that residue in strainer.Add the RNA level water (containing DNA enzyme) of 80 microlitres in each hole, then incubation 2 minutes at room temperature.To extract dull and stereotyped and microtiter plate under 3000rpm centrifugal 3 minutes, and by RNA prepared product at-80 ℃ chilled storage in collection flat board.

Embodiment 27. copy numbers are measured

Use

method is measured R0 plant transfer gene copy number.Use pMON65154 and pRG76GATEWAY from the sequence construct in potato pinII gene 3rd ' district ^tMobject carrier, can be used for the mensuration of transgenosis inset copy number.PinII forward and reverse primer are as follows:

Forward primer 5 ' ccccaccctgcaatgtga3 ' (SEQ ID NO:77)

Reverse primer 5 ' tgtgcatccttttatttcatacattaattaa3 ' (SEQ ID NO:78)

PinII

probe sequence is 5 ' cctagacttgtccatcttctggattggcca3 ' (SEQ ID NO:79).

This probe has fluorescence dye FAM (6-Fluoresceincarboxylic acid) at 5 ' end mark, and quencher dyestuff TAMRA (6-carboxy-N, N, N ', N '-tetramethylrhodamin) is connected to 3 ' end of this probe by joint.

probe obtains from Applied Biosystems (Foster City, CA).?

during copy number is measured, _ SAT, a kind of single copy corn gene is used as interior mark.SAT primer is as follows:

Forward primer 5 ' gcctgccgcagaccaa3 ' (SEQ ID NO:80)

Reverse primer 5 ' atgcagagctcagcttcatc3 ' (SEQ ID NO:81)

SAT probe sequence is 5 ' tccagtacgtgcagtccctcctcc3 ' (SEQ ID NO:82)

This probe has fluorescence dye VIC at its 5 ' end mark ^tM(Applied Biosystems, Foster City, CA), has quencher dyestuff TAMRA at its 3 ' end.

According to manufacturers instruction (Applied Biosystems, Foster City, CA), carry out

pCR.In each mensuration, use 5-100ng DNA.Pcr amplification and

probe in detecting is at 1X

in Universal PCR Master Mix (Applied Biosystems, Foster City, CA), carry out, it contains AmpliTaq

archaeal dna polymerase,

the damping fluid of UNG, the dNTPs that contains dUTP, Passive Reference1 and optimization.The pinII of every kind of forward of 800nM and oppositely pinII primer and 150nM probe is used for

measure.Every kind of Sat forward of 200nM and the Sat of reverse primer and 150nM

probe is used for

copy number is measured. pCR carries out 2 minutes at 50 ℃, carries out 10 minutes at 95 ℃, then carries out at 95 ℃ 15 seconds and 40 circulations of 1 minute at 60 ℃.Use ABI Prism7700 sequence detection system or ABI7900HT sequence detection system (Applied Biosystems, Foster City, CA) to measure in real time

fluorescence probe.According to

eZ RT-PCR test kit working instructions (Applied Biosystems, Foster City, CA) calculate C _γvalue.AAC _γvalue is calculated as: C _γ(internal standard gene (Sat))-C _t(transgenosis)-C _γ(internal standard gene in non-transgenic plant (Sat)).As follows according to table 12 Plays copy number assignment.

Table 19. for

measure the standard of copy number

Copy number	Standard
		1	-0.5<ΔΔC γ<0.50
2	0.5<ΔΔC γ<1.50
		>2	ΔΔC γ>1.50

The plant that contains gene of the present invention can pass through

method is analyzed copy number.By inciting somebody to action with southern blotting technique hybridization, with southern blotting technique analysis, confirm in analyzed approximately 80% plant

copy number measurement result.

Embodiment 28. determination of gene expression

By

rT-PCR measures the genetically modified expression of the present invention, and it has used from Applied Biosystems's (Foster City, CA)

eZ RT-PCR test kit.The rna expression that mensuration is expressed with respect to transgenosis standard, this transgenosis standard is the transgenic corns event that is called DBT418, comprises bacillus thuringiensis (B.thuringiensis) the cryIAI gene that operably connects pinII3 ' non-translational region.This DBT418 event to be can give the horizontal expression cryIAI gene to the commercial horizontal resistance of lepidopterid such as Pyrausta nubilalis (Hubern). (European Corn Borer), and be DEKALB Genetics Corporation with

trade name is as commodity selling.Use sequence construct pMON65154 and pRG76GATEWAY from potato pinII gene 3rd ' district ^tMobject carrier, can be used for the mensuration of the encoding sequence transgenosis transcript level of any insertion object carrier.PinII primer and the probe described are used for before

rT-PCR.Ubiquitin fusion protein (UBI) RNA is used as all

interior mark during RT-PCR measures.The UBI primer using is as follows:

Forward primer 5 ' cgtctacaatcagaaggcgtaatc3 ' (SEQ ID NO:83)

Reverse primer 5 ' ccaacaggtgaatgcttgatagg3 ' (SEQID NO:84)

UBI

probe sequence is

5’catgcgccgctttgcttc3’(SEQ?ID?NO：85)

This UBI

probe has fluorescence dye VIC at its 5 ' end mark ^tM(Applied Biosystems, Foster City, CA), has quencher dyestuff TAMRA at its 3 ' end.

According to being described in

single stage method in EZ RT-PCR test kit (Applied Biosystems, Foster City, CA), carry out reverse transcription, pcr amplification and

detect.In each mensuration, use total RNA of 5-100ng.Contrast RNA from DBT418 event in-vitro transcription is included as the contrast on each flat board, and running concentration range is 0.01pg-10pg.From DBT418 leaf and from total RNA of non-transgenic inbreeding corn germplasm A (CORN OF GERMPLASM A) respectively as positive control and negative contrast.Containing 3mM manganous acetate, every kind of dATP of 300uM, dCTP, dGTP and the rTth of dUTP ，100 unit ^tM(Applied Biosystems, Foster City, CA) AmpErase UNG's of archaeal dna polymerase He25 unit (Applied Biosytems, Foster City, CA) in EZ damping fluid (50mM N-bicine N-, 115mM potassium acetate, 0.01mMEDTA, 60mM Passive Reference1,8% glycerine, pH8.2, Applied Biosystems, Foster City, CA), carry out RT-PCR.RT-PCR carries out as follows: at 50 ℃ 2 minutes, at 60 ℃ 30 minutes, at 95 ℃ 5 minutes, then carry out at 95 ℃ 20 seconds and 40 circulations of 1 minute at 60 ℃ every kind of forward of 400nM and the reverse primer pinII sequence that is used for increasing, 200nM

pinII probe is used for detecting.Use every kind of forward of 400nM and reverse primer amplification UBI RNA, 200nM UBI

be used for detecting.Use ABI Prism7700 sequence detection system or ABI7900HT sequence detection system (Applied Biosystems, Foster City, CA) to measure

fluorescence.With respect to transgene expression in DBT418, quantitative to transgene expression of the present invention, and record the ratio that transgene expression is expressed DBT418,

(transgenosis)/

(DBT418).

Embodiment 29. plant breeding

Backcross and can be used to improve source plant (starting plant).Backcross the certain desired proterties from source plant is transferred in the inbreeding kind and other plant that lacks this proterties.It can carry out as follows, for example, by good inbreeding kind (A) (backcross parent) and donor inbreeding kind (non-recurrent parent) are hybridized for the first time, this donor inbreeding kind carries for the suitable gene of discussed proterties, for example,, according to the prepared construct of the present invention.The offspring of hybridization for the first time who selects anticipant character to shift from non-recurrent parent in produced offspring, then backcrosses selected offspring and described good backcross parent (A).After 5 times or more times backcross, produced the selection to anticipant character, for controlling the locus that will be transferred proterties, this offspring is hemizygote, but for great majority or other nearly all genes, and is similar to described good parent.Backcross for the last time should self-pollination to produce for being transferred gene, one or more transformation event, is the offspring of pure-line breeding.

Therefore,, by a series of breeding production operations, selected transgenosis can be transferred to all different strains, without carrying out further reorganization operation from a kind of strain.Because they have the typical genetics behavior identical with any other gene and can a kind of method identical with other corn genes operate by breeding technique, so transgenosis is valuable.Therefore, can produce for one or more of transgenosiss is the inbreeding plant of isozygotying.By hybridizing different inbreeding plants, can produce the different hybrids in a large number with different transgenic crosses.Like this, can produce and have and the closely-related expectation agronomy character of hybrid (" hybrid vigour ") and the plant of giving anticipant character by one or more transgenosiss.

Expectation penetrates in corn hybrid gene of the present invention for the identification of every kind of phenotype that gene is given in conversion of plant.Import genetically modified host gene type, preferably corn germplasm A (CORN OF GERMPLASM A), is a kind of good inbreeding kind, so only need the breeding of limited number of times just can produce the corn hybrid of high yield.Regeneration is hybridized from the conversion of plant of callus and the plant of homologous genes type such as corn germplasm A (CORN OF GERMPLASM A).Twice of offspring's self-pollination also identified the plant of isozygotying for transgenosis.In order to hybridize, by the transgenic plant of isozygotying and tester's hybridization.This tester is a kind of inbreeding kind that belongs to the Heterotic Groups different from transgenosis parent, known its can produce the hybrid of high yield, for example, produce the hybrid from corn germplasm A (CORN OF GERMPLASM A) and corn germplasm E (CORN OF GERMPLASM E) or corn germplasm B (CORN OF GERMPLASM B) hybridization.

The phenotypic method of embodiment 30. assessment

The expression of gene of the present invention has produced various phenotypes in transformant and plant, as disclosed hereinto.In Transformation of Callus and plant regeneration process and in plant and offspring, collect phenotypic data.Be collected in phenotypic data relevant to mode of appearance and callus growth in the callus of conversion, for example, seedling, root, starch, mucoid, the growth rate, the growth rate of minimizing, the death that without embryo, occur, increase.Should estimate that those skilled in the art can recognize other phenotypic characters in transformed calli.

In transferring to the process of soil, plant regeneration and aftergrowth also collect phenotypic data.Phenotypic data comprises such as normal plants, tuft, narrow leaf, tool striped leaf, have that knot phenotype, chlorosis, albino, anthocyanin produce, the proterties of buggy whipped (a kind of phenomenon well known in the art, wherein most of Newborn Leaves extend and reel mutually) or the male flower fringe, fringe or the root that change.Estimate that art technology person can identify in conversion of plant other phenotypic character.

Multiple phenotype is monitored in plant breeding and inbreeding kind and hybrid plant mensuration process.For example, in R0 and R1 plant (Direct Regeneration is from plant and the lineal descent thereof of callus), record plant type (conventional morphological characters, for example above-mentioned for seedling described those) and produce the trophic component from the grain of above-mentioned plant.Trophic component is analyzed and can be comprised that amino acid forms, the amount of albumen, starch and oils, and the characteristic of albumen, starch and oils, fiber, ash content, content of mineral substances can be all determined.Estimate that those skilled in the art can comprise the analysis of other components of grain.In R2 and R3 plant, observe pollen and discharge day, heading day and plant type.In addition, make R2 plant metabolites distribution plan.Use the obtainable method of those skilled in the art, can analyze 50-100 kind or more kinds of metabolites in plant, set up thus the metabolite fingerprint of this plant.In addition, under field condition, measure elongate leaf speed in R3 plant.In comprising the genetically modified hybrid of the present invention, can measure multiple phenotype.For example, can record output, moisture, unit weight, trophic component, chlorophyll content, Ye Wen, standing forest, seedling vigor, plant height, number of sheets order, tiller, stilit root, hold green property (stay green), stem's lodging, root lodging, plant health, shaky/proliferative ability, green snap, nuisance resistance (comprising disease, virus and insect) and metabolite distribution plan.In addition, can record the phenotypic character of the cereal of hybrid results, comprise line number, seeds abortion, seed weight, seed size, seed density and the cereal physical attribute of seed in the quantity, fringe of every row seed on fringe.In addition in hybrid or inbreeding kind, can measure such as the long characteristic of photosynthesis, leaf area, containment structure, seed drying rate and internode.Expectation can be made and transcribe distribution plan the transgenic plant of expression gene of the present invention.

For measure expressing the hybrid yield of the transgenic plant of gene of the present invention, should recognize that hybrid must test a plurality of positions in the geographical position of corn general planting, as, other positions of Iowa, Huo Middle West, Illinois.In order to identify that transgenosis is for the contribution of corn hybrid improvement, estimate that the output test more than a year needs.Therefore, can be at First Year the position assessment transgenosis hybrid at sufficient amount, to identify with non-transgenic hybrid counterpart at least about 10% volume variance.Second Year carries out output test in enough positions, in order to identify the volume variance of 4-5% between two kinds of hybrids, needs abundant repetition.In addition, in the output test of Second Year, can under normal field condition and stress conditions, assess hybrid, as, under moisture or population density stress conditions.Those skilled in the art will know that and how to remove to design the volume variance that yield trials makes can detect other statistically significant of expectation quality level between two kinds of hybrids.

Surface sterilization and the imbibition of embodiment 31. corn seeds

For every approving and forwarding gene, by being placed on, approximately 50 seeds 50ml is housed containing in the 500ml Erlenmyer flask of the sterilizing of 30% SYNTHETIC OPTICAL WHITNER (chlorine bleach liquor=Chlorox or the Equivalent) solution of 0.01%Triton X-100 and rotate this flask and they were carried out to surface sterilization in 5 minutes on orbital shaker.Then, outwell bleaching agent solution and with the sterilizing deionized water wash of about 100ml, then outwell bath water.Repetition is washed more than the aqua sterilisa of 4 times, leaves last bath water on seed.In this water under room temperature incubation seed 24 hours, for the imbibition under foaming condition (by 0.2 μ m filter paper).

I. prepare the substratum in Phytotrays

Water-nutrient agar for the preparation of some Phytotrays.We use Phytotray IT (or plastics casing: 60x30x15cm), upturned position allows this container one side broad in the middle in bottom, and using less one side as lid.In the liquid circulation cycle at 45 minutes, at deionized water mesohigh sterilizing 0.3%BactoAgar, prepare enough water-nutrient agars, each Phytotray100ml.Cooling substratum, to till its easy handling, when it also melts, is poured about 100ml in each Phytotray.

II. the cold seedling vigor of corn is measured

● when culture medium solidifying, the seed of itself and sterilizing is put in laminar flow hood super clean bench.

● use sterilizing tweezers, select 20 healthy, extremely consistent seed is also placed in a Phytotray seed for this mensurations, even interval seed can easily be pulled out arbitrary individuality after a while.

● place seed embryo one skew back is inserted downwards, and seed is just in time under agar surface.In this position, the seedling of appearance and root can directly extend and be not limited.

● at 22 ℃ in substratum incubation seed one week, or until most seed is taken root and is started from agar, reveals.

● except retaining the extremely consistent seedling of 10 strain growths, in laminar flow hood super clean bench, pull out all seedling.

● Phytotrays is transferred in microtherm growth room, be set in 10 ℃ and 16 hour cycle in daytime and this incubation 2 weeks.

● Phytotrays is moved back at 22 ℃ and is kept one week.

● pull out seedling, root length and the seedling of measuring every strain seedling are long, and measure the fresh weight g of every 3 strain seedling, are recorded on notebook.

Adapt to cold germination and the mensuration of emerging.

Same as described above, but outside having in the following example:

● in I, after last water washing, in the imbibition step of spending the night, flask is placed in to 10 ℃.At 10 ℃, also precooling contains the Phytotrays that solidifies substratum.

● in cooling Phytotrays, sow after the seed that enfleurage rises, they are directly placed in to 10℃ cold house.

● after approximately 5 days, except retaining 10 strain radicles, have the extremely consistent seed of the growth of about equal length, pull out other all seeds.Phytotrays is sent back in 10℃ cold house and kept 1-2 week.Pull out seedling, root length and the seedling of measuring every strain seedling are long, and measure the fresh weight of every 3 strain seedling, are recorded on notebook.

● the Phytotrays of second group is transferred at 22 ℃ and kept 1 week.

Pull out seedling, root length and the seedling of measuring every strain seedling are long, are recorded on notebook.

The plasmid that embodiment 31. builds for transformation of soybean

Embodiment (for CspA and B construct-pMON73983 and 73984)

PMON73983 (Figure 18) is a kind of binary vector, for agriculture bacillus mediated conversion be similar to the constitutive expression of the albumen (SEQ ID NO:1) of Bacillus subtilus CspA soybean.For cloning this Bacillus subtilus CspA gene, the CspA sequence information (Genbank#M30139) of NCBI (National Center for Biotechnology Information) based on from being under the jurisdiction of the National Library of Medicine (National Library of Medicine) of NIH (National Institutes of Health (NCBI)), designs two gene-specific primer MSA452 and MSA453.The sequence of MSA452 is GCGCAGGCCTAGATGTACCATGTCCGGTAAAATGACTGGTATCGTAAAATGG (SEQ ID NO:86), it is in the annealing of CspA translation initiation site place and import StuI and BglII site at 5 ' end, MSA453 sequence is CGCGAATTCGGATCCTTATTACAGGCTGGTTACGTTACCAGCTGCC (SEQ ID NO:87), and it is in the annealing of the last codon of CspA place and import BamHI and EcoRI site at this primer end.Reverse primer MSA453 is designed to mate 3 ' end of Genbank gene order.

Use primer MSA452 and MSA453, high-fidelity Taq polysaccharase (BRL) and pMON57397 (Fig. 3) to carry out PCR reaction as template.This template is different from 3 ' end of GenBank sequence C spA gene.The CspB DNA of amplification is by gel electrophoresis purifying and be connected on pCR-XL-TOPO carrier (Invitrogen).According to the experimental program of manufacturer, ligation reaction is transformed in intestinal bacteria Top10 cell (Invitrogen).Pick out four transformant bacterium colonies and use Qiagen Miniprep test kit to prepare in a small amount DNA.Use M13-specificity forward and reverse primer to check order to inset.By the clone's called after pMON73981 that contains correct sequence and for further subclone.

With StuI and BamHI, digest PMON73881DNA with Separation of Cs pA gene fragment.Continue with StuI and BamHI digestion pMON73980DNA, then by Gene CleanII test kit purifying.Connect the carrier pMON73980 of this CspB fragment and purifying and ligation reaction electricity is transformed in intestinal bacteria DH10B cell.Containing on the substratum of spectinomycin, selecting transformant.By transformant, prepare in a small amount DNA, use CaMV35S-promotor specificity forward primer to detect the existence of inset in DNA.The clone's called after pMON73983 that contains this inset.A large amount of preparation DNA also carry out a series of attested digestion, comprise BgIII, EcoRI, PstI, EcoRI+BamHI, StuI+XhoI.These have confirmed correct clone.

PMON73984 is a kind of binary vector, for agriculture bacillus mediated conversion be similar to the constitutive expression of the albumen (SEQ ID NO:2) of Bacillus subtilus CspB at Arabidopis thaliana.For cloning this Bacillus subtilus CspB gene, the CspB sequence information (Genbank#X59715) of NCBI (National Center for Biotechnology Information) based on from being under the jurisdiction of the National Library of Medicine (National Library of Medicine) of NIH (National Institutes of Health (NCBI)), designs two gene-specific primer MSA454 and MSA455.The sequence of MSA454 is GCGCAGGCCTAGATGTACCATGTTAGAAGGTAAAGTAAAATGGTTCAACTCTG (SEQ ID NO:88), it is in the annealing of CspB translation initiation site place and import StuI and BglII site at 5 ' end, MSA455 sequence is CGCGAATTCGGATCCTTATTACGCTTCTTTAGTAACGTTAGCAGCTTGTGG (SEQ ID NO:89), and it is in the annealing of the last codon of CspB place and import BamHI and EcoRI site at this primer end.Reverse primer MSA455 is designed to mate 3 ' end of Genbank gene order.Use primer MSA454 and MSA455, high-fidelity Taq polysaccharase (BRL) and pMON57399 to carry out PCR reaction as template.This template is different from 3 ' end of GenBank sequence C spB gene.The CspB DNA of amplification is by gel electrophoresis purifying and be connected on pCR-XL-TOPO carrier (Invitrogen).According to the experimental program of manufacturer, ligation reaction is transformed in intestinal bacteria Top10 cell (Invitrogen).Pick out four transformant bacterium colonies and use Qiagen Miniprep test kit to prepare in a small amount DNA.Use M13-specificity forward and reverse primer to check order to inset.By the clone's called after pMON73982 that contains correct sequence and for further subclone.

With StuI and BamHI, digest PMON73882DNA with Separation of Cs pB gene fragment.Continue with StuI and BamHI digestion pMON73980DNA, then by Gene CleanII test kit purifying.Connect the carrier pMON73980 of this CspB fragment and purifying and ligation reaction electricity is transformed in intestinal bacteria DH10B cell.Containing on the substratum of spectinomycin, selecting transformant.By transformant, prepare in a small amount DNA, and use CaMV35S-promotor-specificity forward primer to detect the existence of inset in DNA.The clone's called after pMON73984 that contains this inset.A large amount of preparation DNA also carry out a series of attested digestion, comprise BglII, EcoRI, PstI, EcoRI+BamHI, StuI+XhoI.These have confirmed correct clone.Soybean plants is by producing by conversion with the above-mentioned pMON construct being stably integrated in its genome.

Embodiment 32.

Use the DNA construct maize transformation plant from above-mentioned studied embodiment 10 and 11

Greenhouse

● drought tolerance is carried out to twice test, once test 10 cspA events, 10 cspB events of another test.

● the 24 strain transgenic positive from each event and the negative hybrid seedling of 24 strain transgenosiss are tested to (the hybrid fringe that all seeds carry out self-separation).

● this test is carried out on greenhouse worktable.

● this processing comprises restriction feedwater and monitors total basin weight that each has plant pot.The heavily about 1000g of each water-filled basin, restriction feedwater, until each basin weight arrives 400g position, then allows basin maintain this weight in remaining experimentation.

● in whole process of the test, by measuring the distance on the top from basin soil surface to " the highest " blade, determine plant height.From these are measured, by the height comparing between twice measurement, determine LER (elongate leaf speed).

● in an event, in drought process, carry out the comparison of LER between transgenosis feminine gender and transgenic positive plant.

● the event for tested 3/10, in process of the test, for LER, cspA transgenic plant obtain obviously (p<0.10) and improve.

● the event for tested 3/10, in process of the test, for LER, cspB transgenic plant obtain obviously (p<0.10) and improve.

Field efficiency

● for the later stage vegetative phase drought tolerance in growth, use hybrid seed to carry out 3 tests, once test 16 cspB events (CA), another test 21 cspB events (KS), also once test 14 cspA events (HI).

● for CA and HI test, seedling capable (rows) is containing having an appointment 34 strain plants, and repeating for 6 and 4 times, appear respectively in separated existing transgenosis.Separated seedling is capable comes from separated fringe.

● for KS test, the Miao Hanghan 34 strain plants of having an appointment; Crop row as transgenosis and non-transgenic pairing, has 6 repetitions.

● this processing is included in approximately 10 days (the giving to maintain on a small quantity the necessary water of plant life) of later stage vegetative phase restriction feedwater of growth.After 10 days, plant is well irrigated until gather in the crops.

● in whole process of the test, measure many kinds of phenotypes, comprise LER, chlorophyll (using SPAD instrument) and photosynthetic rate.After test, the extra phenotype of mensuration comprises: pollen discharges day and heading day and such as the fringe feature of seed/fringe, the seed-bearing fringe of tool, seed weight and output.

● in an event and in all constructs, carry out the phenotype comparison between transgenic positive and heliophobous plant.

● in CA test, in arid treating processes or afterwards, cspB as construct (in all events of nutrient characteristics and repeat in " the best " 6 events of proterties) transgenic positive plant significantly (p<0.10) improved LER, the gentle seed/fringe of leaf.

● in CA test, in arid treating processes or afterwards, individual case significantly (p<0.10) has been improved LER, average spike length, seed quality/fringe, stomatal conductance and heading day.

● in KS test, cspB as construct (in all events of nutrient characteristics and repeat in " the best " 6 events of proterties) transgenic positive plant significantly (p<0.10) improved seed/row, seed/fringe, seed/plant, pod weight and the output of carrying on LER, fringe.

● in KS test, individual case significantly (p<0.10) has been improved LER, photosynthetic rate, stomatal conductance, fringe/row and seed/plant.

● in HI test, 3 events significantly (p<0.10) have been improved LER (being other phenotypes of unique mensuration at HI Determination of Chlorophyll content).

CA and the general introduction of KS result:

The efficiencies general introduction of field, cspB-KS habitat (site)

1. the execution of field design, position homogeneity and plantation and sampling all meets the high-quality test that can produce information data set.

2. restrict water supply and process with a kind of all mensuration phenotypes, particularly LER, chlorophyll and photosynthetic rate, produce the mode of processing impact and carry out.

3. it is use real number and that meet the improvement of the transgenosis mediation of observing statistically significant level that the processing that affects the phenotype of nutrition and regeneration meets at statistics.

4. in comprising genetically modified plant, one or more events have improved that LER, chlorophyll, photosynthetic rate, stomatal conductance, Ye Wen, pollen discharge day statistically, interval, fringe/basin, seed/fringe, seed/plant are reeled off raw silk from cocoons in heading day, flowering period, pod is heavy and estimated output.

5. in dry-cure, for LER, fringe/basin, seed/plant, pod, weigh and estimated output, in wet treatment, for LER, observe the horizontal statistics of construct and improve p<0.10.

Table 20.

Field, cspB-CS habitat efficiencies general introduction (font variation)

1. the execution of field design, position homogeneity and plantation and sampling all meets the high-quality test that can produce information data set.

2. restrict water supply and process with a kind of nutrition phenotype, particularly LER, chlorophyll and photosynthetic rate to all mensuration, impact is processed in generation, but all regeneration phenotype generations are not processed to the mode affecting, carries out.

3. it is use real number and that meet the improvement of the transgenosis mediation of observing statistically significant level that the processing that affects object phenotype (nutrition) meets statistically.

4. in comprising genetically modified plant, one or more events have improved that LER, chlorophyll, photosynthetic rate, stomatal conductance, Ye Wen, pollen discharge day statistically, interval, fringe/basin, seed/fringe, average spike length and seed quality/fringe are reeled off raw silk from cocoons in heading day, flowering period.

5. in dry-cure, for LER, the gentle pollen of leaf, discharge day, in wet treatment, for ASI, observe the horizontal statistics of construct and improve.

Table 21.

Many in these events had been tested for already subsequently improves cold germination efficiency and seedling grows under cold environment, but is not proved to be effective.Therefore, these genes by promoters driven unlikely in corn, work to improve cold germination or seedling grows under cold environment, but different promotor (propomters) drives identical gene, or different cold shock proteins can work to improve these phenotypes in corn.

Claims (28)

1. produce a method for drought-resistant plant, comprise the following steps:

(a) recombinant DNA of the cold shock protein of encoding (Csp) is inserted in the genome of one or more vegetable cells to transform this vegetable cell, described cold shock protein has and the basic identity of SEQ ID NO:1 or SEQ ID NO:2 and the cold shock structural domain sequence that comprises SEQ ID NO:3

[FY]-G-F-I-x(6，7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY]；

(b) from the vegetable cell aftergrowth of described conversion; With

(c) from the plant of described regeneration, option table reveals the plant of drought tolerance, and drought tolerance is given in the expression of cold shock protein described in the plant of wherein said selection (Csp).

2. according to the process of claim 1 wherein that described cold shock protein (Csp) has basic identity in the whole length of Bacillus subtilus CspB (SEQ ID NO:2) or in the whole length of protein escherichia coli CspA (SEQ ID NO:1).

3. according to the process of claim 1 wherein that described cold shock protein (Csp) has identity in the whole length of Bacillus subtilus CspB (SEQ ID NO:2) or in the whole length of protein escherichia coli CspA (SEQ ID NO:1).

4. according to the method for any one in claim 1-3, wherein said plant is maize plant, soybean plants, vegetable lamb, wheat plant, barley plants, Semen Brassicae campestris plant or rice plants.

5. one kind has the vegetable cell that is inserted into the recombinant DNA in its genome, wherein said recombinant DNA coding cold shock protein (Csp), described cold shock protein has and the basic identity of SEQ ID NO:1 or SEQ ID NO:2 and the cold shock structural domain sequence that comprises SEQ ID NO:3

[FY]-G-F-I-x (6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY], and wherein said protein expression is given described vegetable cell lack of water tolerance.

6. one kind has the vegetable cell that is inserted into the recombinant DNA in its genome, wherein said recombinant DNA coding cold shock protein (Csp), described cold shock protein has and the basic identity of SEQ ID NO:1 or SEQ ID NO:2 and the cold shock structural domain sequence that comprises SEQ ID NO:3

[FY]-G-F-I-x (6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY], and wherein said protein expression is given the resistance of the plant that comprises described vegetable cell to drought stress.

7. according to the vegetable cell of claim 5 or 6, wherein said cold shock protein (Csp) has basic identity in the whole length of protein escherichia coli CspA (SEQ ID NO:1) or in the whole length of Bacillus subtilus CspB cold shock protein (SEQ ID NO:2).

8. according to the vegetable cell of claim 5 or 6, wherein said cold shock protein (Csp) has identity in the whole length of protein escherichia coli CspA (SEQ ID NO:1) or in the whole length of Bacillus subtilus CspB cold shock protein (SEQ ID NO:2).

9. according to the vegetable cell of claim 5 or 6, wherein said vegetable cell is corn plant cell.

10. according to the vegetable cell of claim 5 or 6, wherein said vegetable cell is soybean plant cell.

11. according to the vegetable cell of claim 5 or 6, and wherein said vegetable cell is cotton plant cell, wheat plant cell, barley plants cell, Semen Brassicae campestris vegetable cell or rice plants cell.

12. 1 kinds of methods for generation of the transgenic seed of the recombinant DNA that comprises coding cold shock protein (Csp), this seed can be used for producing the transgenic plant crop of the drought tolerance with enhancing, and described method comprises:

(a) the first drought-enduring plant strain of the recombinant DNA that selection comprises coding cold shock protein (Csp), wherein said cold shock protein (Csp) has and the basic identity of SEQ ID NO:1 or SEQ ID NO:2 and cold shock structural domain sequence [the FY]-G-F-I-x (6 that comprises SEQ ID NO:3,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY], and the resistance of the plant of described the first plant lines to drought stress given in the expression of wherein said cold shock protein matter (Csp); With

(b) described recombinant DNA is infiltrated in different plant lines.

13. according to the method for claim 12, and wherein said cold shock protein (Csp) has basic identity in the whole length of Bacillus subtilus CspB (SEQ ID NO:2) or in the whole length of protein escherichia coli CspA (SEQ ID NO:1).

14. according to the method for claim 12, and wherein said cold shock protein (Csp) has identity in the whole length of Bacillus subtilus CspB (SEQ ID NO:2) or in the whole length of protein escherichia coli CspA (SEQ ID NO:1).

15. 1 kinds of methods of producing field crop under for growth moisture suboptimal and restricted condition, described method comprises the transgenic plant of cultivating the recombinant DNA with the coding cold shock protein (Csp) being inserted in its genome, and wherein said cold shock protein (Csp) has and the basic identity of SEQ ID NO:1 or SEQ ID NO:2 and the cold shock structural domain sequence that comprises SEQ ID NO:3

[FY]-G-F-I-x (6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY], and the resistance of described plant to drought stress given in the expression of wherein said cold shock protein matter (Csp).

16. according to the method for claim 15, and wherein said cold shock protein (Csp) has basic identity in the whole length of Bacillus subtilus CspB (SEQ ID NO:2) or in the whole length of protein escherichia coli CspA (SEQ ID NO:1).

17. according to the method for claim 15, and wherein said cold shock protein (Csp) has identity in the whole length of Bacillus subtilus CspB (SEQ ID NO:2) or in the whole length of protein escherichia coli CspA (SEQ ID NO:1).

18. according to the method for any one in claim 12-17, and wherein said plant is maize plant, soybean plants, vegetable lamb, wheat plant, barley plants, Semen Brassicae campestris plant or rice plants.

19. 1 kinds of methods for generation of drought-enduring plant, comprise the following steps:

(a) recombinant DNA of the cold shock protein of encoding (Csp) is inserted in the genome of one or more vegetable cells to transform this vegetable cell, wherein said cold shock protein (Csp) by under the stringent hybridization condition of 2.0X sodium chloride/sodium citrate at 50 ℃ with the DNA molecule encode of SEQ ID NO:62 or SEQ ID NO:64 hybridization;

(b) from the vegetable cell aftergrowth of described conversion; With

(c) from the plant of described regeneration, option table reveals the plant of drought tolerance, and drought tolerance is given in the expression of cold shock protein described in the plant of wherein said selection (Csp).

20. according to the method for claim 19, and wherein said plant is maize plant, soybean plants, vegetable lamb, wheat plant, barley plants, Semen Brassicae campestris plant or rice plants.

21. 1 kinds have the vegetable cell that is inserted into the recombinant DNA in its genome, wherein said recombinant DNA coding cold shock protein (Csp), described cold shock protein is by the DNA molecule encode of hybridizing with SEQ ID NO:62 or SEQ ID NO:64 under the stringent hybridization condition of 2.0X sodium chloride/sodium citrate at 50 ℃, and described protein expression is given described vegetable cell lack of water tolerance.

22. 1 kinds have the vegetable cell that is inserted into the recombinant DNA in its genome, wherein said recombinant DNA coding cold shock protein (Csp), described cold shock protein by under the stringent hybridization condition of 2.0X sodium chloride/sodium citrate at 50 ℃ with the DNA molecule encode of SEQ ID NO:62 or SEQ ID NO:64 hybridization, and described protein expression is given the resistance of the plant that comprises described vegetable cell to drought stress.

23. according to the vegetable cell of claim 21 or 22, and wherein said vegetable cell is corn plant cell.

24. according to the vegetable cell of claim 21 or 22, and wherein said vegetable cell is soybean plant cell.

25. according to the vegetable cell of claim 21 or 22, and wherein said vegetable cell is cotton plant cell, wheat plant cell, barley plants cell, Semen Brassicae campestris vegetable cell or rice plants cell.

26. 1 kinds of methods for generation of the transgenic seed of the recombinant DNA that comprises coding cold shock protein (Csp), this seed can be used for producing the transgenic plant crop of the drought tolerance with enhancing, and described method comprises:

(a) the first drought-enduring plant strain of the recombinant DNA that selection comprises coding cold shock protein (Csp), wherein said cold shock protein (Csp) is by the DNA molecule encode of hybridizing with SEQ ID NO:62 or SEQ ID NO:64 under the stringent hybridization condition of 2.0X sodium chloride/sodium citrate at 50 ℃, and the resistance of the plant of described the first plant lines to drought stress given in the expression of described cold shock protein matter (Csp); With

(b) described recombinant DNA is infiltrated in different plant lines.

27. 1 kinds of methods of producing field crop under for growth moisture suboptimal and restricted condition, described method comprises the transgenic plant of cultivating the recombinant DNA with the coding cold shock protein (Csp) being inserted in its genome, described cold shock protein (Csp) is by the DNA molecule encode of hybridizing with SEQ ID NO:62 or SEQ ID NO:64 under the stringent hybridization condition of 2.0X sodium chloride/sodium citrate at 50 ℃, and the resistance of described plant to drought stress given in the expression of wherein said cold shock protein matter (Csp).

28. according to the method for claim 26 or 27, and wherein said plant is maize plant, soybean plants, vegetable lamb, wheat plant, barley plants, Semen Brassicae campestris plant or rice plants.

Images