WO2013065876A1

WO2013065876A1 - Method for reducing abiotic stress in plant

Info

Publication number: WO2013065876A1
Application number: PCT/JP2012/079052
Authority: WO
Inventors: Takashi Adachi
Original assignee: Sumitomo Chemical Company, Limited
Priority date: 2011-11-04
Filing date: 2012-11-02
Publication date: 2013-05-10
Also published as: AR088647A1; JP2013116103A

Abstract

The present invention provides a method for reducing abiotic stress in a recombinant Poaceae plant, comprising treating a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, and/or a growing area of the plant with abscisic acid.

Description

DESCRIPTION

METHOD FOR REDUCING ABIOTIC STRESS IN PLANT [ Technical Field]

[ 0001]

The present invention relates to a method for reducing abiotic stress. [ Background Art]

[ 0002]

When plants encounter abiotic stress conditions, the physiological functions of cells gradually or rapidly reduce and various disorders may appear. In order to reduce such abiotic stress to which plants are subjected, recombinant plants in which a cold-shock protein has been produced in the plant bodies and abiotic stress has been reduced are prepared by artificially inserting the cold- shock protein gene of Bacillus subtilis (cspB) or the like into the genomes of plants. Moreover, it is known that some chemicals including plant hormones have the effect of reducing abiotic stress by adjusting the physiological states of plants (see e.g., Non Patent Literatures 1 and 2). In actuality, however, these chemicals were not always sufficient in terms of effect. [ Citation List]

[ Patent Literature]

[ 0003]

[ Patent Literature 1] International Patent Publication No. WO 2005/033318

[ Non Patent Literature]

[ 0004]

[ Non Patent Literature 1] "Amelioration of chilling injuries in cucumber seedlings by abscisic acid" Arnon Rikin and Amos E. Richmond, (1976) Physiologia Plantarum 38: pp. 95-97

[ Non Patent Literature 2] "Chilling injury in Cotton (Gossvpium hisutum L.): Light requirement for the reduction of injury and for the protective effect of abscisic acid" Arnon Rikin, Carlos Gitler and Dan Atsman (1981) Plant and Cell Physiology Volume 22, Issue 3 pp. 453-460

[ Summary of Invention]

[ Technical Problem]

[ 0005]

An object of the present invention is to provide a method for reducing abiotic stress in a plant. [ Solution to Problem] [ 0006]

The present inventor has found that abiotic stress is reduced in the case where a recombinant Poaceae plant in which a cold-shock protein gene is inserted into the genome is treated with a particular compound.

[ 0007]

Specifically, the present invention provides the following [ 1] to [ 8] :

[ 1] A method for reducing abiotic stress in a recombinant Poaceae plant, comprising treating a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, and/or a growing area of the plant with abscisic acid.

[ 2] The method according to [ 1] , wherein the DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is a DNA comprising a nucleotide sequence encoding the amino acid sequence of Bacillus subtilis cspB protein, or a DNA comprising a nucleotide sequence encoding the amino acid sequence of Escherichia coli cspA protein.

[ 3] The method according to [ 1] , wherein the DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is any of^~ he^~~fo^lowi^~ng^{^}DNAs (a) ^"to (c) :- (a) a DNA comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1;

(b) a DNA comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2; and

(c) a DNA comprising a nucleotide sequence encoding an amino acid sequence having 62.5% or more sequence identity to the amino acid sequence of (a) or (b) .

[ 4] The method according to any of [ 1] to [ 3] , wherein the treatment with abscisic acid is spraying treatment to the recombinant Poaceae plant or soil treatment to the growing area of the recombinant Poaceae plant.

[ 5] The method according to any of [ 1] to [ 4] , wherein the abiotic stress is high-temperature stress, low-temperature stress, and/or drought stress.

[ 6] A method for improving the yield of a recombinant Poaceae plant, comprising treating a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, and/or a growing area of the plant with abscisic acid.

[ 7] The method according to any of [ 1] to [ 6] , wherein the recombinant Poaceae plant is rice or corn.

[ 8] Use of abscisic acid in a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, and/or a growing area of the plant for reducing abiotic stress.

[ Advantageous Effect of Invention]

[ 0008]

According to the present invention, abiotic stress in recombinant Poaceae plants can be reduced.

[ Brief Description of Drawings]

[ 0009]

[ Figure 1] Figure 1 is a schematic diagram of the structure of a plant binary vector plasmid pRH-2x35S-cspB-CR . In the diagram, "2xCaMV35S-p" represents a 2x35S promoter nucleotide sequence; "cspB" represents a nucleotide sequence encoding Bacillus subtilis cspB protein; "CR-t" represents a CR terminator nucleotide sequence; "Nos-t" represents a nos terminator nucleotide sequence; "APH4" represents the nucleotide sequence of E. col i-derived hygromycin resistance gene aph4 (GenBank accession number V01499); "Nos-p" represents a nos promoter nucleotide sequence; and "attB" represents the nucleotide sequence of a homologous recombination region derived from Gateway Reading Frame Cassette used in plasmid construction.

[ Figure 2] Figure 2 is a schematic diagram of the structureof a plant binary vector plasmid pRH-2x35S-cspA-CR . In the diagram, "2xCaMV35S-p" represents a 2x35S promoter nucleotide sequence; "cspA" represents a nucleotide sequence encoding E. coli cspA protein; "CR-t" represents a CR terminator nucleotide sequence; "Nos-t" represents a nos terminator nucleotide sequence; "APH4" represents the nucleotide sequence of E. col i-derived hygromycin resistance gene aph4 (GenBank accession number V01499); "Nos-p" represents a nos promoter nucleotide sequence; and "attB" represents the nucleotide sequence of a homologous recombination region derived from Gateway Reading Frame Cassette used in plasmid construction.

[ Description of Embodiments]

[ 0010]

The present invention is a method for reducing abiotic stress and improving the yield of a recombinant Poaceae plant that has been exposed or would be exposed to abiotic stress by treating a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, a growing area of the recombinant Poaceae plant, or the recombinant Poaceae plant and the growing area of the recombinant Poaceae plant with abscisic acid.

[ 0011]

In-- the-- present --invention, examples of ^"the^{- ~}"col^~d- shock protein" encoded by the nucleotide sequence of the DNA introduced into the genome of a Poaceae plant include a wild-type Bacillus subtilis cold-shock protein (cspB gene product, GenBank Accession number AAB01346) and a wild-type E. coli cold-shock protein (cspA gene product, GenBank Accession number AAA23617). Many studies have been conducted on bacterial cold-shock proteins belonging to the cspA family.

[ 0012]

Specific examples of wild-type bacterial cold-shock proteins belonging to the cspA family include the proteins as shown in Table 1.

[ Table 1]

[ 0013]

In the present specification, not only the wild-type cold-shock protein but also a protein having an amino acid sequence derived from the amino acid sequence of the wild- type cold-shock protein by the substitution, addition, or deletion of one or more amino acids is encompassed in the term "cold-shock protein" .

[ 0014] For example, the amino acid sequence represented by SEQ ID NO: 1 is one in which leucine at position 2 in the amino acid sequence of the wild-type Bacillus subtilis cspB protein (GenBank Accession number AAB01346) is substituted by valine, and the amino acid sequence represented by SEQ ID NO: 2 is one in which serine at position 2 in the amino acid sequence of the wild-type E. coli cspA protein (GenBank Accession number AAA23617) is substituted by alanine. In the present specification, such a protein having an amino acid sequence derived from the amino acid sequence of the wild-type cold-shock protein by the substitution, addition, or deletion of one or more amino acids is also called as "Bacillus subtilis cspB protein" or "E. coli cspA protein". In the method of the present invention, a recombinant plant in which a DNA comprising a nucleotide sequence encoding any of those amino acid sequences is introduced into the genome may also be used.

[ 0015]

Examples of an approach for artificially performing the deletion, addition, or substitution of amino acid residue (s) in the amino acid sequence of the cold-shock protein described above include an approach of introducing site-directed mutation to the DNA encoding the amino acid sequence and include a method using amber mutation (gapped duplex method, Nucleic Acids Research, 12, 9441-9456 (1984)), a polymerase chain reaction (PCR) method using primers for mutation introduction, a method of designing DNA molecules having an arbitrary nucleotide sequence and preparing them by artificial synthesis, and an approach of randomly introducing mutation in a DNA encoding any of the amino acid sequences. Examples of the approach of randomly introducing mutation include a method of performing PCR with a DNA encoding the amino acid sequence as a template using a primer pair capable of amplifying the full length of each DNA under reaction conditions in which the respective addition concentrations of dATP, dTTP, dGTP, and dCTP used as substrates have been varied or under reaction conditions in which the concentration of Mg²⁺ promoting the reaction of polymerase has been increased. Examples of such an approach for introducing mutation in a DNA using the PCR method include methods described in Method in Molecular Biology, (31), 1994, 97-112.

[ 0016]

The functions of the cold-shock protein having such an amino acid sequence can be confirmed by introducing a DNA comprising a nucleotide sequence encoding the amino acid sequence to an E. coli cold-shock protein gene-quadruple knockout strain (cspA, cspB, cspE, and cspG) and evaluating whether E. coll become^{" "}viable at a low temperature of 15°C or lower by complementing the functions of the deleted genes ( PNAS (2006) vol. 103 pp. 10122-10127).

t 0017]

In the present invention, the "sequence identity" refers to sequence identity between two nucleotide sequences or two amino acid sequences. The sequence identity is determined by comparing two sequences aligned in the state optimal for the whole regions of the sequences to be compared. In this · context, for aligning the nucleotide sequences or amino acid sequences to be compared in the optimal state, addition or deletion (e.g., gap) may be acceptable. Such sequence identity can be calculated by conducting sequence identity analysis using a program, for example, FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci . USA, 4, 2444-2448 (1988)), BLAST (Altschul et al . , Journal of Molecular Biology, 215, 403-410 (1990)), or CLUSTAL W (Thompson, Higgins & Gibson, Nucleic Acids Research, 22, 4673-4680 (1994)) and preparing alignment. The program is generally available from, for example, the website (http://www.ddb .nig.ac.jp/) of DNA Data Bank of Japan (international DNA data bank operated in Center for Information Biology and DNA Data Bank of Japan; CIB/DDBJ) . Moreover, the sequence identity can also be determined using commercially available sequence analysis software. Specifically, the sequence identity can be calculated by conducting sequence identity analysis using DNASIS-Pro Ver. 3.0 (manufactured by Hitachi Software Engineering Co., Ltd.) and preparing alignment.

[ 0018]

For example, as a result of conducting sequence identity analysis between the amino acid sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2 by the method and preparing alignment, 62.5% sequence identity existed .

[ 0019]

A protein having an amino acid sequence whose sequence identity to the amino acid sequence of any of the cold- shock proteins described above, for example, the amino acid sequence of SEQ ID NO: 1 or 2, is 62.5% or more, preferably 80% or more, more preferably 90% or more, further preferably 95% or more, even more preferably 98% or more, in terms of the full amino acid sequence may also be used as the "cold-shock protein" according to the present invention .

[ 0020]

In general, recombinant plants in which a cold-shock protein is produced in the plant bodies can be obtained by operably linking a DNA comprising a promoter nucleotide sequence functional in plant cells to upstream of a DNA -having - a—nucleotide sequence encoding - the amino ^' acid sequence of the protein, incorporating the obtained DNA to a vector plasmid available in host plant cells, and introducing this to host plant cells.

[ 0021]

The promoter functional in plant cells refers to a nucleotide sequence that is conjugated to upstream (5' side) of the nucleotide sequence of the gene (structural gene) encoding the amino acid sequence of the protein to be introduced into plant cells and has the function of forming transcribed RNA from the structural gene. Examples of the promoter functional in plant cells include T-DNA-derived promoters such as nopaline synthase gene promoter, plant virus-derived promoters such as cauliflower mosaic virus- derived 19S promoter and 35S promoter, plant-derived phenylalanine ammonia-lyase gene promoter, rice-derived or Arabidopsis thai ana-derived actin gene promoter, and rice- derived ubiquitin gene promoter. Moreover, a DNA in which a DNA having the nucleotide sequence of an intron such as rice-derived actin gene intron is conjugated immediately after the DNA having the promoter nucleotide sequence may also be used as the DNA comprising the promoter nucleotide sequence functional in plant cells.

[ 0022]

Moreover, a DNA comprising a terminator nucleotide sequence—afunctional in -plant cells may be linked to^' downstream of the DNA obtained as described above by operably linking the promoter nucleotide sequence functional in plant cells to the DNA having a nucleotide sequence encoding the amino acid sequence of the protein.

[ 0023]

The terminator nucleotide sequence functional in plant cells refers to a nucleotide sequence that is conjugated to downstream (3' side) of the nucleotide sequence of the structural gene to be introduced in plant cells and has the function of terminating RNA transcription from the structural gene and adding a polyadenine sequence for stabilizing the transcript. < Examples of the terminator nucleotide sequence functional in plant cells include terminator nucleotide sequences such as T-DNA-derived terminators such as a terminator in the 3 ' -noncoding region of the nopaline synthase gene (NOS), a terminator in the 3 ' -noncoding region of Agrobacterium tumefaciens-derived transcription gene 7, and plant-derived terminators described in WO 2000/020613.

[ 0024]

The recombinant Poaceae plant used in the present invention, into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, is a recombinant Poaceae plant into Which^{" "}a ^"DNA^"-comprising^" a nucleotide sequence encoding the amino acid sequence of the cold-shack protein described above is inserted into the genome by transformation with the DNA (hereinafter, referred to as the "present recombinant Poaceae plant"). Examples thereof specifically include recombinant corn or recombinant rice into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of Bacillus subtilis cold-shock protein cspB or the amino acid sequence of E. coll cold-shock protein cspA described in WO 2005/033318 is introduced, and preferably include recombinant rice into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of Bacillus subtilis cold-shock protein cspB or the amino acid sequence of E. coli cold-shock protein cspA is introduced.

[ 0025]

Next, abscisic acid used in the present invention will be described.

Abscisic acid (hereinafter, also referred to as the present compound) is one type of plant hormone isolated as an abscission-promoting substance from the petiole of cotton.

[ 0026]

Examples of aspects of the present compound include the followings:

For abscisic acid (CAS registration No.: 14^~375-45-2 ) , isomers such as stereoisomers, for example, asymmetric carbon atom-based optical isomers (e.g., ( S ) - ( + ) -abscisic acid (CAS registration No.: 21293-29-8)), and tautomers are present. Abscisic acid used in the present invention may be an isomer alone or a mixture of isomers at any isomeric ratio.

Moreover, the present compound used in the present invention may be present in a salt form acceptable in terms of pesticide science, depending on its state of being.

Examples of such a salt include: metal salts such as alkali metal salts and alkaline earth metal salts (e.g., salts with sodium, potassium, or magnesium); salts with ammonia; and salts with organic amines such as morpholine, piperidine, pyrrolidine, mono-lower alkylamine, di-lower alkylamine, tri-lower alkylamine, mono-hydroxy-lower alkylamine, di-hydroxy-lower alkylamine, and tri-hydroxy- lower alkylamine, though not limited to these salts.

[ 0027]

The present compound can be purchased and obtained as a reagent from ako Pure Chemical Industries, Ltd. Moreover, the (S)-(+)-form of the present compound can also be purchased and obtained as a reagent from Sigma-Aldrich Corp .

[ 0028]

In the method of the present invention, the ^"present compound may be used alone and may also be used as a formulation with various inert ingredients as described later .

[ 0029]

Examples of a solid carrier used in the formulation include fine powders or granules consisting of: minerals such as kaolin clay, attapulgite clay, bentonite, montmorillonite, acidic clay, pyrophyllite , talc, diatomaceous earth, and calcite; natural organic materials such as corn rachis powder and walnut husk powder; synthetic organic materials such as urea; salts such as calcium carbonate and ammonium sulfate; synthetic inorganic materials such as synthetic hydrated silicon oxide. Examples of a liquid carrier include: aromatic hydrocarbons such as xylene, al kylbenzene , and methylnaphthalene; alcohols such as 2-propanol, ethylene glycol, propylene glycol, and ethylene glycol monoethyl ether; ketones such as acetone, cyclohexanone, and isophorone; vegetable oils such as soybean oil and cotton seed oil; and petroleum aliphatic hydrocarbons, esters, dimethyl sulfoxide, acetonitrile, and water.

[ 0030]

Examples of a surfactant include: anionic surfactants such as alkyl sulfuric acid ester salt, alkylaryl sulfonate, dialkyl sul fosuccinate , polyoxyethylene alkylaryl ether phosphoric acid ester salt, lignin sulfonate, and naphthalene sulfonate formaldehyde polycondensates ; nonionic surfactants such as polyoxyethylene alkylaryl ether, polyoxyethylene alkyl polyoxypropylene block copolymers, and sorbitan fatty acid ester; and cationic surfactants such as alkyltrimethylammonium salt.

[ 0031]

Examples of other pharmaceutical auxiliary agents include: water-soluble polymers such as polyvinyl alcohol and polyvinylpyrrolidone; polysaccharides such as gum arabic, alginic acid and its salt, CMC

( carboxymethylcellulose ) , and xanthan gum; inorganic materials such as aluminum magnesium silicate and alumina sol; preservatives, coloring agents, and stabilizers such as PAP (isopropyl acid phosphate) and BHT (dibutylhydroxytoluene) .

t 0032]

In the present invention, abscisic acid may be used in a mixture with an insecticide, a bactericide, a herbicide, a plant bioregulator , or the like.

[ 0033]

In the present invention, a growth stage at which the plant subject may be exposed to abiotic stress encompasses all stages including a germination stage, the time of raising of seedlings, a vegetative^" stage, a reproductive stage, and a harvesting stage. [ 0034]

In the method of the present invention, in the case of treating a plant with the present compound, a subject of the treatment may be the whole of the plant or a portion (foliage, buds, glumes, flowers, ears, etc.) thereof, and the timing of the treatment may be various growth stages (a germination stage such as before or after budding after seeding, the time of raising of seedlings, the time of transplantation of seedlings, at the time of cutting or sticking, a vegetative stage such as the time of growing after planting, a reproductive stage such as before flowering, during flowering, after flowering, immediately before heading, or a heading time, and a harvesting stage such as before scheduled harvesting, before scheduled maturation, or the time when fruits start to change color) of the plant. Moreover, in the present specification, the seedlings are meant to encompass cuttings, millet seeds, and so on.

[ 0035]

The treatment with abscisic acid is usually performed by treating the plant body directly or a growing site thereof with an effective amount of the present compound. Examples of the growing site of the plant include soil be-fo-re—e-r-—a-f-te-r planting of - the plant ^" Iff^" the case of treating the plant or the growing site of the plant, the treatment with the present compound is carried out one or more times to the plant subject.

[ 0036]

Examples of a treatment method in the method of the present invention include treatment to plant foliage, flower organs, or ears such as foliage spraying, treatment to a growing area of the plant such as soil treatment, and treatment to seedlings.

[ 0037]

Examples of the treatment to plant foliage, flower organs, or ears in the method of the present invention include: a method of treating the surface of plants, such as foliage spraying and trunk spraying; a method of performing spraying treatment to flower organs or the whole plant at a flowering time including before flowering, during flowering, and after flowering; and for grains or the like, a method of spraying to ears or the whole plant at a heading time.

[ 0038]

Examples of the soil treatment method in the method of the present invention include spraying to soil, soil incorporation, and chemical perfusion into soil (chemical irrigation, soil injection, and chemical dripping). Examples of a place to be treated include planting holes, furrows, around a planting hole, around a furrow, the whole surface of cultivation areas, the part between the soil and the plant, the area between roots, areas beneath the trunk, main furrows, growing soil, seedling raising boxes, seedling raising trays, and seedbed. Examples of the timing of treatment include immediately after germination, a seedling raising period, before planting, at the time of planting, and a growing period after planting. Moreover, in the soil treatment described above, the soil may be treated with a solid fertilizer such as a paste fertilizer containing the present compound. .Also, the present compound may be mixed into an irrigation solution, and examples thereof include injection to irrigation facilities (irrigation tubes, irrigation pipes, sprinklers, etc.), mixing into flooding solutions between furrows, and mixing into hydroponic media. Alternatively, an irrigation solution may be mixed with the present compound in advance and treated, for example, using the irrigation method described above or the other appropriate irrigation method such as sprinkling or flooding.

[ 0039]

Examples of the treatment to seedlings in the method of the present invention include: spraying treatment in which a dilution prepared by diluting the present compound with water to an appropriate active ingredient concentration is sprayed to the whole seedlings; immersion treatment in which seedlings are immersed in the dilution; application treatment in which the present compound prepared into a dust is attached to the whole seedlings. Moreover, examples of the treatment to soil before or after planting of seedlings include: a method in which a dilution prepared by diluting the present compound with water to an appropriate active ingredient concentration is sprayed to seedlings and soil therearound after planting of the seedlings; and a method in which the present compound prepared into a solid formulation such as a dust or a granular formulation is sprayed to soil around seedlings after planting of the seedlings.

[ 0040]

A preparation, such as an emulsion, a wettable powder, a flowable formulation, or a microcapsule formulation, containing the present compound is usually diluted with water and sprayed for the treatment. In this case, the concentration of the present compound in the preparation is in the range of usually 0.1 to 1, 000 ppm, preferably 1 to 100 ppm. A preparation, such as a dust or a granular formulation, containing the present compound is usually used directly in the treatment without being diluted.

[ 0041]

-Moreover, in- the- case of treating r.he plant or the growing site of the plant with the present compound, the concentration of the present compound in the treatment solution is in the range of preferably 0.1 to 1, 000 ppm, more preferably 1 to 100 ppm. In the case of performing hydroponic cultivation using a cultivation solution containing the present compound, the concentration of the present compound in the cultivation solution is in the range of preferably 0.1 to 100 ppm, more preferably 1 to 10 ppm.

[ 0042]

The method of the present invention can be carried out in any of agricultural lands (such as fields, paddy fields, and grasses) and non-agricultural lands.

[ 0043]

Examples of the Poaceae plant to which the method of the present invention is applicable include the following plants :

[ 0044]

Crops: corn, rice, wheat, barley, rye, oat, sorghum, sugarcane, etc.

Turf grass: lawn grasses (Zoysia japonica Steud. , Zoysia matrella, etc.), bermudagrasses (Cynodon dactylon, etc.), bent grasses (Agrostis gigantea, Agrostis stolonifera L., Agrostis capillaris L., etc.), bluegrasses (Poa pratensis L., Poa trivialis L., etc.), fescues (Festuca arundinacea, Festuca rubra var. commutata, Festuca rubra L. var. genuina Hack, etc.), ryegrasses {Lolium multiflorum Lam., Lolium perenne, etc.), Dactylis glomerata L., Phleum pratense, etc.

[ 0045]

Examples of the Poaceae plant preferably include rice, corn, wheat, barley, and oat, more preferably include rice and corn.

[ 0046] _,

The present recombinant Poaceae plant is a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of at least one cold-shock protein is introduced, and may be a recombinant plant in which in addition to the DNA, a gene imparting herbicide resistance to plants, a gene producing selective toxin to insect pests, a gene imparting disease resistance to plants, or the like other than the cold-shock protein gene is introduced by cross breeding or a gene recombination method.

[ 0047]

Moreover, the present recombinant Poaceae plant may be one obtained by seeding and growing seeds treated with a safener or the like against an insecticide, a bactericide, and a particular herbicide.

[ 0048]

In the present invention, the "abiotic stress" refers to stress placed on plants by the physicochemical conditions of an environment where the plants grow. Important abiotic stress for influence on plants as environmental conditions is stress such as temperature stress (high-temperature stress or low-temperature stress), drought stress, or salt stress. When plants are exposed to abiotic stress, the physiological functions of their cells reduce and the physiological states of the plants deteriorate, whereby their growth is inhibited. The high- temperature stress refers to stress to which plants are subjected when exposed to a temperature higher than a temperature suitable for plant growth or a temperature suitable for germination, and examples thereof specifically include conditions in which an average cultivation temperature in an environment where plants are cultivated is 25°C or higher, more strictly 30°C or higher, further strictly 35°C or higher. The low-temperature stress refers to stress to which plants are subjected when exposed to a temperature lower than a temperature suitable for plant growth or a temperature suitable for germination, and examples thereof specifically include conditions in which an average cultivation temperature in an environment where plants are cultivated is 15°C or lower, more strictly 10°C or lower, further strictly 5°C or lower. The drought stress refers to stress to which plants are subjected when exposed to a moisture environment where a moisture content in soil decreases due to reduction in rainfall or watering and water absorption is inhibited, whereby plant growth is inhibited, and examples thereof specifically include conditions in which the percentage of moisture content of soil in which plants are cultivated is 15% by weight or less, more strictly 10% by weight or less, further strictly 7.5% by weight or less, and conditions in which the pF value of soil in which plants are cultivated is 2.3 or more, strictly 2.7 or more, further strictly 3.0 or more, though the values may differ depending on the type of soil. In this context, the pF value of soil can be measured according to the principle described in "Method for pF Value Measurement" on pages 61 and 62 of "Encyclopedia of Soil, Plant Nutrition, and Environment" (Matsuzaka et al., Taiyosha Co., Ltd., 1994). Also, the salt stress refers to stress to which plants are subjected when exposed to an environment where osmotic pressure rises due to the accumulation of salts in soil or a hydroponic medium in which the plants are cultivated and the water absorption of the plants is inhibited, whereby their growth is inhibited. Specifically, the salt stress is conditions in which an osmotic pressure potential derived from salts in the soil or the hydroponic medium is 0.2 MPa (2,400 ppm in terms of NaCl concentration) or more, strictly 0.25 MPa or more, further strictly 0.30 MPa . The osmotic pressure in the soil can be determined according to the following Raoult's equation by diluting the soil with water and analyzing the salt concentration of the supernatant:

[ 0049]

Raoult's equation: π (atm) = cRT

R = 0.082 (L-atm/mol-K)

T = absolute temperature (K)

c = ion molar concentration (mol/L)

1 atm = 0.1 MPa

[ 0050]

The abiotic stress in plants is ascertained by comparing change in any of the following plant phenotypes between plants unexposed to abiotic stress conditions and plants exposed thereto.

Specifically, these plant phenotypes serve as indexes for the abiotic stress in plants.

(1) Seedling establishment rate

(2) The number (rate) of healthy leaves

(3) Plant length

(4) Plant body weight

(5) Leaf area

(^~β^")^~ L^~ea^~f^"~colof^'

(7) The number or weight of seeds (8) Quality of harvests

(9) Flower setting rate/fruit bearing rate/seed filling rate

(10) Chlorophyll fluorescence yield

(11) Moisture content

(12) Transpiration capacity

[ 0051]

These indexes can be measured as follows:

(1) Seedling establishment rate

Plant seeds are seeded, for example, in soil, on a filter paper, on an agar medium, or on sand, and cultivated for a given period of time, and the percentage of growing seedlings is then investigated.

(2) The number (or rate) of healthy leaves

The number of healthy leaves is counted for each plant, and the total number of healthy leaves is investigated. Alternati ely, the ratio of the number of healthy leaves to the number of all leaves of the plant is investigated.

(3) Plant length

The length from the base of the stem of the above- ground part to the branch and leaves at the tip is measured for each plant .

(4) Plant body weight

The above-ground pari, of each plant is cut off, and the weight is measured to determine a plant fresh weight. Alternatively, the cut-off sample is dried, and the weight is then measured to determine a plant dry weight.

(5) Leaf area

Each plant is photographed with a digital camera, and the area of a green portion in the photograph is quantified with image analysis software, for example, Win ROOF (manufactured by Mitani Corp.) to thereby obtain the leaf areas of the plant.

(6) Leaf color

Plant leaves are sampled, and the amount of chlorophyll is measured using a chlorophyll gauge (e.g., SPAD-502, manufactured by Konica Minolta Holdings, Inc.) to thereby determine leaf color. Alternatively, each plant is photographed with a digital camera, and the area of a green portion in the photograph is quantified by performing color extraction with image analysis software, for example, Win ROOF (manufactured by Mitani Corp.) to thereby determine the area of the green portion in the plant leaves.

(7) The number or weight of seeds

Plants are cultivated until seeds are set or ripened, and the number of seeds or the total seed weight per plant is then measured. Alternatively, plants are cultivated until seeds are ripened, and a yield component, for example, the number of ears, a ripening rate, or a thousand kernel weight is then investigated. (8) Quality of harvests

Plants are cultivated until seeds are ripened, and the content of starch, protein, or lipid is then measured by conducting, for example, componential analysis to thereby evaluate the quality of harvests.

(9) Flower setting rate/fruit bearing rate/seed filling rate

Plants are cultivated until fruiting, the number of flowers set is then counted. After seed ripening, the number of fruits borne and the number of seeds filled are counted to determine a fruit bearing rate (the number of fruits borne / the number of flowers set x 100) and a seed filling rate % (the number of seeds filled / the number of fruits borne x 100) .

(10) Chlorophyll fluorescence yield

The chlorophyll fluorescence values (Fv/Fm) of plants are measured using a pulse modulation chlorophyll fluorometer (e.g., IMAGING-PAM, manufactured by WALZ Company) to thereby determine a chlorophyll fluorescence yield.

(11) Moisture content

At each plant growth stage, a plant fresh weight and a plant dry weight are determined according to the method described in "(4) Plant body weight" above, and a value obtained by subtracting the plant dry weight from the plant fresh weight is calculated as the moisture content of the plant. Alternatively, after irradiation with near-infrared light, and the moisture content of the plant is nondestructively measured by measuring the absorption amount (transmission amount) at this specific wavelength. The moisture content is measured using, for example, Scanalyzer (manufactured by LemnaTec GmbH) .

(12) Transpiration capacity

At each plant growth stage, the transpiration of water from leaf surface is measured using a porometer (e.g., AP4, manufactured by Delta-T Devices Ltd) .

[ 0052]

The effect of reducing abiotic stress can be evaluated by comparing any of the indexes after exposure of the plants to abiotic stress conditions between plants treated with abscisic acid and untreated plants.

[ 0053]

In the present specification, the abiotic stress can be quantified on the basis of the "intensity of stress" represented by the following equation:

[ 0054]

"Intensity of stress" = 100 x "any one of the plant phenotypes in plants unexposed to abiotic stress" / "the ^"any^{-" "}one of the ^"plant^" phenotypes in plants exposed to abiotic stress" [ 0055]

The method of the present invention is applied to a plant that has been exposed or would be exposed to abiotic stress whose "intensity of stress" represented by the above equation is usually 105 to 200, preferably 110 to 180, more preferably 120 to 160.

[ 0056]

The plant is exposed to the abiotic stress, whereby influence is confirmed in at least one of the phenotypes. Specifically,

(I) reduction in seedling establishment rate,

(2) decrease in the number (or rate) of healthy leaves,

(3) reduction in plant length,

(4) decrease in plant body weight,

(5) reduction in leaf area-increasing rate,

(6) leaf color fading,

(7) decrease in the number or weight of seeds,

(8) deterioration in the quality of harvests,

(9) reduction in flower setting rate, fruit bearing rate, or seed filling rate,

(10) reduction in chlorophyll fluorescence yield,

(II) decrease in moisture content,

(12) reduction in transpiration capacity,

or the like is observed, and the magnitude of the abiotic stress in the plant can be measured with this as an index. [ 0057]

In the present invention, the phrase "improving the yield of a recombinant Poaceae plant" means that increasing effect is confirmed when a plant length, a plant fresh weight or plant dry weight, or the like in the whole or a portion of the above-ground part of each plant after harvesting in an abscisic acid-treated group is measured and compared with that in an untreated group. In the case of evaluating the whole of the above-ground part of the plant, the plant is cultivated until seeds are set or ripened. Then, the above-ground part is cut off, and the plant length, plant fresh weight, or plant dry weight of the whole plant is measured. In the case of evaluating a portion of the above-ground part of the plant, the number of seeds, the total seed weight, or the like per plant individual is measured, or a yield component such as the number of ears, a ripening rate, or a thousand kernel weight is investigated for the evaluation. [ Examples]

[ 0058]

Hereinafter, the present invention will be described more specifically with reference to Preparation Examples,

Treatment - Examples , and Test Examples^".^{" '}However,^' the present invention is not intended to be limited to the examples below. In the examples below, part represents part by weight unless otherwise specified.

[ 0059]

Preparation Example 1

3.75 parts of abscisic acid, 14 parts of polyoxyethylene styryl phenyl ether, 6 parts of calcium dodecylbenzenesul fonate , and 76.25 parts of xylene are well mixed to thereby obtain an emulsion.

[ 0060]

Preparation Example 2

75 parts of abscisic acid, 15 parts of propylene glycol (manufactured by Nacalai Tesque, Inc.), 15 parts of Soprophor FLK (manufactured by Rhodia Nicca Ltd.), 0.6 parts of Antifoam C Emulsion (manufactured by Dow Corning Corp.), and 120 parts of ion-exchanged water are mixed at these ratios, and the slurry is then wet-milled to obtain wet-milled slurry. 0.3 parts of Kelzan S (manufactured by CP Kelco) , 0.6 parts of Veegum granules (manufactured by R.T. Vanderbilt Company, Inc.), and 0.6 parts of Proxel GXL (manufactured by Arch Chemicals) are added and mixed into 72.9 parts of ion-exchanged water to obtain an aqueous thickener solution. 75.2 parts of the obtained wet-milled slurry is added and mixed into 24.8 parts of the aqueous thickener solution ;o obtain^" a flowable ^"preparation .

[ 0061] Preparation Example 3

28.5 parts of an aqueous solution containing 15 parts of abscisic acid, 1.5 parts of sorbitan trioleate, and 2 parts of polyvinyl alcohol is mixed and finely milled by a wet milling method. Then, 45 parts of an aqueous solution containing 0.05 parts of xanthan gum and 0.1 parts of aluminum magnesium silicate is added thereinto, and 10 parts of propylene glycol is further added and mixed by stirring to obtain a flowable preparation.

[ 0062]

Preparation Example 4

45 parts of abscisic acid, 5 parts of propylene glycol (manufactured by Nacalai Tesque, Inc.), 5 parts of Soprophor FLK (manufactured by Rhodia Nicca Ltd.), 0.2 parts of Antifoam C Emulsion (manufactured by Dow Corning Corp.), 0.3 parts of Proxel GXL (manufactured by Arch Chemicals), and 49.5 parts of ion-exchanged water are mixed at these ratios to prepare bulk slurry. 100 parts of the slurry is charged with 150 parts of glass beads (Φ = 1 mm) and milled for 2 hours under cooling with cooling water. After the milling, the glass beads are filtered off to obtain a flowable preparation.

[ 0063]

Preparation Example 5

50.5 parts of abscisic acid, 38.5 parts of NN kaolin clay (manufactured by Takehara Kagaku Kogyo Co., Ltd.), 10 parts of orwet D425, and 1.5 parts of Morwet EFW (manufactured by Akzo Nobel Corp.) are mixed at these ratios to obtain an AI premix. The premix is milled with a jet mill to obtain a dust.

[ 0064]

Preparation Example 6

5 parts of abscisic acid, 1 part of synthetic hydrated silicon oxide, 2 parts of calcium lignosulfonate, 30 parts of bentonite, and 62 parts of kaolin clay are well milled and mixed. Water is added thereto, and the mixture is well kneaded, followed by granulation and drying to obtain a granular formulation.

[ 0065]

Preparation Example 7

3 parts of abscisic acid, 87 parts of kaolin clay, and 10 parts of talc are well milled and mixed to thereby obtain a dust.

[ 0066]

Preparation Example 8

22 parts of abscisic acid, 3 parts of calcium lignosulfonate, 2 parts of sodium lauryl sulfate, and 73 parts of synthetic hydrated silicon oxide are well milled and mixed to thereby obtain a wettable powder.

[ 0067] Example 1 Preparation of cspB-transfected recombinant rice strain

(1) Construction of basic binary vector pRH-2x35S-GW-CR for rice transformation

First, PCR was performed with pBI121 (manufactured by

Clontech Laboratories, Inc.) as a template using two types of specific primers (H35-2F (SEQ ID NO: 3) and 35_1RC (SEQ ID NO: 4)) to amplify a DNA fragment that was a cauliflower mosaic virus-derived 35S promoter region, as a promoter functional in plant cells, having recognition sequences of restriction enzymes Hindlll and Xbal at the ends, respectively. For the PCR, DNA polymerase PrimeSTAR (manufactured by Takara Bio Inc.) was used, and each cycle involving incubation at 98°C for 10 seconds, then 56°C for 5 seconds, and 72°C for 60 seconds was repeated 30 times. The amplified DNA fragment was treated with restriction enzymes Hindlll and Xbal and inserted to a similarly treated plasmid pRl909 (manufactured by Takara Bio Inc.) to prepare a plasmid pRI909-35S.

H35-2F: 5'- CCAAGCTTAGATTAGCCTTTTCAATTTC -3' (SEQ ID NO: 3) 35_1RC: 5 ' -CCTCTAGACGTGTTCTCTCCAAATG-3 ' (SEQ I D NO : 4)

[ 0068]

Likewise-,-- -PGR--was- performed with the p3I121 ^"described above as a template using two types of specific primers (35S-1F (SEQ ID NO: 5) and 35S-1R (SEQ ID NO: 6)) to amplify a DNA fragment that was an enhancer region of 35S promoter of 0.2 kbp in size. The amplified DNA fragment was inserted to a cleavage site of a plasmid pRI909-35S treated with EcoRV to prepare a plasmid pRl909-2x35S having a promoter nucleotide sequence (2x35S) in which the nucleotide sequences of the cauliflower mosaic virus- derived 35S enhancer region and 35S promoter were conjugated in tandem.

35S-1F: 5 ' -CTATCTGTCA CTTTATTGTG AAGATAGTGG-3 ' (SEQ ID NO: 5)

35S-1R: 5 ' -ATCACATCAA TCCACTTGCT TTGAAGACG-3 ' (SEQ ID NO: 6)

[ 0069]

Next, PCR was performed with pBI121 as a template using two types of specific primers (SCR-1F (SEQ ID NO: 7) and ECR_1RC (SEQ ID NO: 8)) to amplify a DNA fragment consisting of a nucleotide sequence of carrot root PR protein gene-derived CR terminator, as a terminator functional in plant cells, having recognition sequences of restriction enzymes Sacl and EcoRI at the ends, respectively. For the PCR, the DNA polymerase described above was used, and each cycle involving incubation at 98°C for 10 seconds, then 58°C for 5 seconds, and 72°C for 30 seconds was repeated 30 times. The amplified DNA fragment was treated with restriction enzymes Sacl and EcoRI and inserted to the similarly treated plasmid pRI909-2x35S comprising a 2x35S promoter nucleotide sequence to construct a plasmid pRI909-35S-CR comprising the nucleotide sequences of the 2x35S promoter and the CR terminator.

SCR-1F: 5 ' -CCGAGCTCGAATTCGCGGCCGCACTTCTTAC-3 ' (SEQ ID NO:

7)

ECR_1RC: 5 ' -CCGAATTCGAGCTCTCAACTTCGTAATTTTATG-3 ' (SEQ ID NO: 8)

[ 0070]

Next, the plasmid pRI 909-35S-CR was treated with restriction enzymes BamHI and Sacl, and then the cleaved DNA fragment was blunt-ended. The blunt-ended linear plasmid pRI 909-35S-CR was converted to Gateway Vector using Gateway Vector Conversion system (manufactured by Life Technologies Corp.) to construct a plasmid pRl909-35S-G -CR having a nucleotide sequence of Gateway Reading Frame Cassette between the promoter (2x35S) nucleotide sequence and the CR terminator nucleotide sequence.

[ 0071]

Furthermore, fusion PCR was performed with the plant -b-i-n-a-r-y—vector—pRI90-9- -^"and pIG121HM ^"described ^"in ^" Japanese Patent Laid-Open No. 2000-1166577 as templates using 8 types of primers (Hind-IF (SEQ ID NO: 9), 909A-1RC (SEQ ID NO: 10), 9APH-1F (SEQ ID NO: 11), APHT-1RC (SEQ ID NO: 12), APHT-1F (SEQ ID NO: 13), APH9-1RC (SEQ ID NO: 14), A909-1F (SEQ ID NO: 15), and EcoT-lRC (SEQ ID NO: 16)) to amplify a DNA fragment of an expression cassette having the hygromycin resistance gene (aph4) between the nucleotide sequences of T-DNA nucleotide sequence-derived NOS promoter and NOS terminator and having recognition sequences of restriction enzymes Hindlll and EcoT22I at the ends, respectively. For the PCR, similar DNA polymerase was used, and each cycle involving incubation at 98°C for 10 seconds, then 60°C for 5 seconds, and 72°C for 120 seconds was repeated 40 times. The amplified DNA fragment was treated with restriction enzymes Hindlll and EcoT22l, and the resulting fragment was inserted to between recognition sequences of restriction enzymes Hindlll and EcoT22I in a similarly treated plant binary vector pRl909 to construct a plant binary vector pRH-2x35S-GW-CR in which the kanamycin resistance gene expression cassette was replaced by a hygromycin resistance gene expression cassette.

Hind-IF: 5 ' -ATGCAAGCTTGGCACTGGCCGTC-3 ' (SEQ ID NO: 9)

909A-1RC: 5 ' -AGGCTTTTTCATGCGAAACGATCCAGATCCGGTGCA-3 ' (SEQ

ID NO: 10)

9APH-1F: ' -GATCGTTTCGCATGAAAAAGCCTGAACTCACCGCGACGTCTG-3 ' (SEQ ID NO: 11)

APHT-1RC: 5 ' -TAGGTCAGGCTCTCGCTAAATTCCCCAATGTCAAG-3 ' (SEQ ID NO: 12)

APHT-1F: 5 ' -CTTGACATTGGGGAATTTAGCGAGAGCCTGACCTA-3 ' (SEQ ID NO : 13)

APH9-1RC : 5 ' -AGAGTCCCGCCTATTCCTTTGCCCTCGGACGAGTGCTGG-3 '

(SEQ ID NO: 14)

A909-1F: 5 ' -GCAAAGGAATAGGCGGGACTCTGGGGTTCGAAATGAC-3 ' (SEQ ID NO: 15)

EcoT-lRC: 5'- CCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGC- 3 ' (SEQ ID NO : 16)

[ 0072]

(2) Construction of expression binary vector having nucleotide sequence encoding Bacil lus subtilis cspB protein First, a DNA fragment having the nucleotide sequence (represented by SEQ ID NO: 17) encoding the amino acid sequence of Bacillus subtil is cspB protein represented by SEQ ID NO: 1 was fully synthesized. PCR was performed with this as a template using two types of specific primers (CspB-lF (SEQ ID NO: 18) and CspB-lRC (SEQ ID NO: 19)) to amplify a DNA fragment encoding cspB. For the PCR, the same DNA polymerase as in (1) was used, and each cycle involving incubation at °C for ^'" 2 minutes, followed by incubation at 98°C for 10 seconds, then 58°C for 5 seconds, and 72°C for 30 seconds was repeated 30 times, followed by final incubation at 72°C for 2 minutes. The amplification fragment was collected and purified, added with adenines at the 5' end, and inserted to a plasmid pCR8/GW/TOPO included in a gene cloning kit pCR8/G /TOPO TA Cloning Kit (manufactured by Life Technologies Corp.) using the kit. Competent cells of an E. coli DH5a strain (manufactured by Toyobo Co., Ltd.) were transformed therewith. A plasmid pENTR-cspB was prepared from the transformed E. coli, and its nucleotide sequence was analyzed.

CspB-lF: 5 ' -ATGGTGGAGGGGAAGGTCA-3 ' (SEQ ID NO: 18)

CspB-lRC: 5 ' -TCACGCTTCCTTGGTAACGTTAGC-3 ' (SEQ ID NO: 19)

[ 0073]

Next, the plant binary vector pRH-2x35S-GW-CR comprising the nucleotide sequences of the 2x35S promoter and the CR terminator (obtained in (1)) and the plasmid pENTR-cspB having the nucleotide sequence encoding the amino acid sequence of Bacillus subtil is cspB protein represented by SEQ ID NO: 1 were subjected to LR reaction using LR Clonase (Life Technologies Corp.), and competent cells of an E. coli DH5a strain (manufactured by Toyobo Co., Ltd.) were transformed therewith to prepare a plasmid pRH- ^■2x-3-5-S^GspB=GR^{~^}comprrsing ^*_h^'e exp ession cassettePhaving the nucleotide sequence encoding the amino acid sequence of Bacillus subtilis cspB protein between the nucleotide sequences of the 2x35S promoter and the CR terminator. Its nucleotide sequence was confirmed. As a result, a plasmid pRH-2x35S-CspB-CR (Figure 1) having the nucleotide sequence represented by SEQ ID NO: 20 was obtained.

[ 0074]

(3) Transformation of rice with cspB gene

The vector pRH-2x35S-CspB-CR prepared in Example 1(2) was introduced into Agrobacterium (Agrobacterium tumefaciens strain LBA4404). The obtained Agrobacterium was cultured in an LB agar medium (0.5% yeast extracts, 1.0% bactotryptone, 0.5% common salt, and 1% agar) containing 50 mg/L kanamycin and 100 mg/L spectinomycin, and drug resistance colonies were selected to thereby obtain recombinant Agrobacterium . A rice cultivar

"Nipponbare" was transformed with the obtained recombinant Agrobacterium according to the method of Toki S. et al. (Plant J., 47, 969-976, 2006).

[ 0075]

After removal of chaff, rice seeds were immersed in

70% ethanol for 5 minutes, then placed in a sterile tube, shaken in a sterilizing solution (2.5% sodium hypochlorite and 0.02% Triton X-100) for 20 minutes, and shaken in a -2-.5% - aqueous - sodium -hypochlorite solution for 20 minutes to perform sterilization. The sterilized seeds were placed in a sterile tube and washed 3 times with sterile water. After the washing, the seeds were inoculated on a callus induction medium (N6D plate; N6 inorganic salt, N6 vitamin, 2 mg/L 2,4-D, 30 g/L sucrose, 0.3 g/L casamino acid, 2.9 g/L proline, 4 g/L gellan gum, pH 5.8) and cultured at 32°C for 5 days in a plant incubator with a day length set to 24 days. Approximately 100 cultured seeds were placed in a 50-mL tube. The Agrobacterium suspension was poured thereto, and the tube was gradually shaken for approximately 2 minutes. Then, the Agrobacterium suspension was removed using a pipetter. After removal of redundant moisture through a sterile filter paper, the infected rice seeds were transferred to a coculture medium (2N6-AS plate; N6 inorganic salt, N6 vitamin, 30 g/L sucrose, 10 g/L glucose, 0.3 g/L casamino acid, 2 mg/L 2,4- D, 10 mg/L acetosyringone , 4 g/L gellan gum, pH 5.2) and cocultured at 28°C for 3 days under the dark. Approximately 100 seeds cocultured for 3 days in order to remove the Agrobacterium were placed in a 50-mL tube. Sterile water was poured thereto, and the tube was shaken and washed for 2 minutes. This operation was repeated 5 times. Then, 500 mg/L Claforan solution was added thereto, and the tube was gradually shaken for approximately 2 mXmTtes . T e CTa^~fbrarf^"sbXutior. ^'wasT^~removed using a sterile pipetter. The washed seeds were placed on a sterile filter paper to remove the redundant moisture of the seeds, arranged on a selection medium [ N6D plate; N6 inorganic salt, N6 vitamin, 2 mg/L 2,4-D, 30 g/L sucrose, 0.3 g/L casamino acid, 2.9 g/L proline, 50 mg/L hygromycin, 500 mg/L Claforan, 4 g/L gellan gum, pH .8] , and cultured at 28°C for approximately 3 to 4 weeks under lighting conditions to obtain drug resistance calli. The obtained drug resistance calli were transplanted to a redifferentiation medium (RE-III plate; MS inorganic salt, MS vitamin, 30 g/L sucrose, 30 g/L sorbitol, 2 g/L casamino acid, 20 mg/L NAA, 2 mg/L kinetin 500 mg/L, Claforan, 50 mg/L hygromycin, 4 g/L gellan gum, pH 5.8) and cultured at 28°C under lighting conditions until redi fferentiation .

[ 0076]

The redi fferentiated individuals were transplanted to a rooting medium (HF plate; MS inorganic salt, MS vitamin, 30 g/L sucrose, 50 mg/L hygromycin, 4 g/L agar, pH 5.8) and cultured at 28°C under lighting conditions until rooting. 10 lines of rooted regenerated individuals were obtained. They were transplanted to pots containing culture soil, and grown at 28°C in a climate chamber with a day length set to 12 hours to obtain 7 lines of Τχ seeds.

[ 0077]

In order to obtain next-generation seeds, the obtained i seeds of each line were seeded to a modified MS agar medium (MS inorganic salts, B5 vitamin, 30 g/L sucrose, 50 mg/L hygromycin, 8 g/L agar, pH 5.8) and cultivated at 28°C for 2 weeks under lighting conditions. Transformants exhibiting hygromycin resistance were transplanted to pots containing culture soil in advance and grown at 28°C in a climate chamber with a day length set to 12 hours.

[ 0078]

The expression analysis of the introduced gene was conducted on the obtained rice transformants using a real- time PCR method. Total RNA was extracted from the individuals of seven lines of the obtained recombinant rice strains using a plant RNA extraction kit "RNeasy Plant Mini Kit" (QIAGEN), and cDNA was synthesized from each extracted total RNA using a cDNA synthesis kit "ReverTra Ace" (Toyobo Co., Ltd.). Real-time PCR was performed with the synthesized cDNA as a template using 7500 Fast Real-time PCR apparatus (manufactured by Applied Biosystems, Inc.) and SYBR Premix Ex Taq kit (manufactured by Takara Bio Inc.) according to the protocols included therein. Two types of specific primers (cspB-F-1 (SEQ ID NO: 21) and cspB-R-1 (SEQ ID NO: 22)) were used in the detection of the amount of mRNA having the nucleotide sequence encoding the cspB protein expressed in the recombinant rice strains. Specific primer set (rubi3-70F (SEQ ID NO: 23^~) and rubi3- 70RC (SEQ ID NO: 24)) specifically detecting rice polyubiquitin gene (GenBank Accession Number AK102389) was used as an internal standard, and the mRNA was quantified on the basis of a AACt method. cspB-F-1: 5 ' -TGTGCACTTCTCCGCCATT-3¹ (SEQ ID NO: 21)

cspB- -1: 5 ' -CTGGCCCTCTTCGAGTGTCT-3 ' (SEQ ID NO: 22) rubi3-70F: 5 ' -CCTCCGTGGTGGTCTCTGA -3' (SEQ ID NO: 23) rubi3-70RC: 5 ' -CGGCATAGGTATAATGAAGTCCAA 3' (SEQ ID NO: 24) [ 0079]

As a result, the expression of the introduced cspB gene was confirmed in all of the obtained 7 recombinant rice strains. Among the obtained recombinant rice strains, recombinant rice strains from which a large number of seeds were collected, i.e., strain 2, strain 9, and strain 10 were evaluated for abiotic stress-reducing effect.

[ 0080]

Test Example 1 Test to evaluate high-temperature stress reduction of cspB-transfected recombinant rice strain by abscisic acid (ABA) treatment (plant length)

(Test plant)

cspB-transfected recombinant rice strains (strain 2, strain 9, and strain 10) and wild-type rice (cultivar: Nipponbare )

Each recombinant - rice strain described above was seeded to a 2-fold-diluted Kimura-B liquid medium (Plant science, 199 (1996) 39-47) containing 50 μg/ml hygromycin, hydroponically cultivated at 28°C for day/23°C for night for 7 days with a day length set to 12 hours, and then used in the test. The wild-type rice was seeded to a 2-fold- diluted Kimura-B liquid medium, hydroponically cultivated under similar conditions, and then used in the test.

(ABA treatment)

On the 7th day after the seeding, young seedlings of 3 individuals each of the recombinant rice strains and the wild-type rice were transplanted to culture soil-filled plastic cups (height 58 mm xx diameter 55 mm) , then flooded, and cultivated at 28°C for 5 days in a climate chamber with a day length set to 12 hours.

The soils of pots in which the rice seedlings thus cultivated for 12 days after the seeding were grown were subjected to irrigation treatment with 15 mL of an aqueous (S)-(+)-ABA solution having a concentration of 10 ppm (containing 0.1% DMSO). An untreated group was similarly subjected to irrigation treatment with 15 mL of water containing 0.1% DMSO. After the irrigation treatment, the seedlings were cultivated at 28°C for 2 days with a day length set to 12 hours.

(High-temperature stress treatment)

Two days after the irrigation treatment, the rice seedlings, together with the pots, were transferred to a climate chamber of 50°C and incubated for 1.5 hours to perform high-temperature stress treatment.

(Evaluation method)

After the high-temperature stress treatment, the plants were flooded in a climate chamber and cultivated for recovery at 28°C for day/23°C for night for 7 days with a day length set to 12 hours. After the cultivation for recovery, the plant lengths of the rice individuals in each treated group were measured.

[ 0081]

(Results)

The averages of measured values of plant lengths in the untreated groups and the ABA-treated groups of the wild-type rice and the recombinant rice strains are shown in Table 2.

With regard to all the recombinant rice strains, the value of the plant length increased in the ABA-treated groups compared with the untreated groups.

With regard to all the recombinant rice strains, the stress-reducing effect in the ABA-treated groups of the recombinant rice strains further increased even compared with additive effect that was the sum of the stress- reducing effect in the ABA-treated wild-type group and the stress-reducing effect in each untreated recombinant strain group shown in Table 2. Thus, it was confirmed that stress in the recombinant rice strains of the present invention was synergistically reduced by ABA treatment.

Stress-reducing effect = Average value of plant lengths in each untreated group or ABA-treated group - Average value of plant lengths in untreated wild-type group

Additive effect = Stress-reducing effect in ABA- treated wild-type group + stress-reducing effect in each untreated recombinant strain group

Difference from additive effect = Value of stress- reducing effect in each ABA-treated recombinant strain group - Value of additive effect

[ 0083]

The cultivation for recovery of these recombinant rice strains 2, 9, and 10 used in the present test is also continued after the stress treatment until seeds are ripened, and their yields are investigated. As a result, improvement in yield is expected in the abscisic acid- treated recombinant rice groups compared with the untreated groups .

[ 0084]

Example 2 Preparation of cspA-transfected recombinant rice strain

(1) Construction of expression binary vector having nucleotide sequence encoding E. coli cspA protein

First, a DNA fragment having the nucleotide sequence (rep-resented by SEQ- -ID ^"NO: ^"25) encoding^" the amino acid sequence of E. coli cspA protein represented by SEQ ID NO: 2 was fully synthesized. PCR was performed with this as a template using two types of specific primers (CspA-lF (SEQ ID NO: 26) and CspA-lRC (SEQ ID NO: 27)) to amplify a DNA fragment encoding cspA. For the PCR, the same DNA polymerase as in Example 1(1) was used, and each cycle involving incubation at 94°C for 2 minutes, followed by incubation at 98°C for 10 seconds, then 58°C for 5 seconds, and 72°C for 30 seconds was repeated 30 times, followed by final incubation at 72°C for 2 minutes. The amplification fragment was collected and purified, added with adenines at the 5' end, and inserted to a plasmid pCR8/GW/TOPO included in a gene cloning kit pCR8/GW/TOPO TA Cloning Kit (manufactured by Life Technologies Corp.) using the kit.

Competent cells of an E. coli DH5a strain (manufactured by Toyobo Co., Ltd.) were transformed therewith. A plasmid pENTR-cspA was prepared from the transformed E. coli, and its nucleotide sequence was analyzed. cspA: (SEQ ID NO: 25)

CspA-lF: 5 ' -ATGGCAGGCAAGATGACAGG-3 ' (SEQ ID NO: 26)

CspA-lRC: 5 ' -TCAGAGGGACGTGACATTGCCAG-3 ' (SEQ ID NO: 27)

[ 0085]

Next, a plasmid pRH-2x35S-CspA-CR (Figure 2) comprising -the- expression- cassette ( SEQTD^~~NOY^~' 28^')^{"" "}having the nucleotide sequence encoding the amino acid sequence of E. coli cspA protein between the nucleotide sequences of the 2x35S promoter and the CR terminator was obtained in the same way as in Example 1(2) from the plasmid pRH-2x35S- GW-CR obtained in Example 1 and the plasmid pENTR-cspA.

[ 0086]

(2) Transformation of rice with cspA gene

Recombinant Agrobacterium was prepared according to the method of Example 1(3) using the vector pRH-2x35S-CspA- CR prepared in Example 2(1), and a rice cultivar Nipponbare was transformed therewith. Regenerated individuals of 30 strains were selected. Among them, Ti seeds were obtained from 18 strains.

[ 0087]

The expression analysis of the introduced gene was conducted on the obtained rice transformants using a realtime PCR method in the same way as in Example 1(3) . A specific primer set (cspA-F-2 (SEQ ID NO: 29) and cspA-R-2 (SEQ ID NO: 30)) was used in the detection of the amount of transcribed RNA having the nucleotide sequence encoding the cspA protein expressed in the recombinant rice strains. cspA-F-2: 5 ' -GGCATCGTGAAGTGGTTCAA-3 ' (SEQ ID NO: 29) cspA-R-2: 5 ' -CCCATCGTCTGGAGTGATGA-3 ' (SEQ ID NO: 30)

[-00-8-8-]·

As a result, the expression of the introduced cspA gene was confirmed in all of the obtained 18 recombinant rice strains.

[ 0089]

Example 3 Preparation of cspB-transfected recombinant corn strain

The T-DNA region of the plasmid pRH-2x35S-cspB-CR (prepared in Example 1) comprising the DNA having the nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1, and expressing the cold-shock protein gene in plant cells is introduced by the Agrobacterium method to immature embryonic cells of a corn cultivar LH59 classified into a dent line.

[ 0090]

Calli dedifferentiated from the immature embryonic cells of the corn cultivar LH59 are cocultured with the Agrobacterium tumefaciens ABI strain containing the plasmid pRH-2x35S-cspB-CR, and then, the cells of interest were selected in a tissue culture medium supplemented with carbenicillin and hygromycin B. Untransformed individuals are removed with hygromycin B. In this case, the Agrobacterium used in the transformation is removed with the tissue culture medium supplemented with carbenicillin.

[ 0091]

The- immature- embryonic cells ^"selected by the tissue culture are redifferentiated to obtain redifferentiated individuals. The 1st generation of the redi fferentiated individuals is mated with a non-recombinant corn cultivar LH59 to obtain recombinant corn strains. The introduced gene in the progeny strains of the recombinant corn strain individuals is analyzed to investigate morphological characteristics. Strain selection is performed to prepare recombinant corn strains in which the DNA comprising the nucleotide sequence encoding the amino acid sequence of cspB protein is introduced.

[ 0092]

Transcribed RNA comprising the nucleotide sequence encoding the amino acid sequence of the cspB protein introduced in the plants is quantified for the prepared recombinant corn strains by a real-time PCR method according to the method described in Example 1, and a strain having high expression is selected.

[ 0093]

Test Example 2 Test to evaluate high-temperature stress reduction of corn by ABA soil treatment

(Test plant)

cspB-trans fected recombinant corn

Seeds of the cspB-transfected recombinant corn prepared above in Example 3 or a cspB-transfected recombinant corn MON-874-60- stra^~in^{~ "}(Monsanto^"" Company) are seeded to soil in a pot and cultivated under stress-free conditions until a growth stage exhibiting sensitivity to abiotic stress.

(ABA treatment and high-temperature stress treatment)

After the cultivation, the soil in the pot in which the corn is grown is subjected to irrigation treatment with 10 mL of an aqueous abscisic acid (ABA) solution (containing 0.1% DMSO). An untreated group is similarly subjected to irrigation treatment with 10 mL of water containing 0.1% DMSO. After the irrigation treatment, cultivation is further performed. Then, high-temperature stress treatment is performed under conditions ¹ and for a period in which the recombinant corn strain is sensitive to high-temperature stress using a method equivalent to the method shown in Test Example 1.

(Evaluation method)

After the stress treatment, cultivation for recovery is performed, and then, the plant length is investigated by the method shown in Test Example 1. Likewise, the cultivation for recovery is also continued after the stress treatment. The fresh weight of the above-ground part, the seed weight, and the like are measured, and the yield is investigated. Stress reduction such as increase in plant length is expected in the ABA-treated group compared with the uncreated group. — Moreover, if the cultivation ^" for recovery is continued until seeds are ripened, improvement in yield such as increase in the fresh weight of the above- ground part is expected.

[ 0094]

Test Example 3 Test to evaluate high- temperature stress reduction of cspB-trans fected recombinant rice strain by ABA treatment (seed yield)

(Test plant)

cspB-transfected recombinant rice strain 10 prepared in Example 1, and wild-type (cultivar: Nipponbare)

After the high-temperature stress treatment, the cultivation for recovery and the plant length measurement in Test Example 1, the ABA-treated group of the recombinant rice strain and the ABA-treated group of the wild-type rice were continuously cultivated at 28°C for day/23°C for night in the climate chamber with a day length set to 12 hours until seeds were ripened.

(Evaluation method)

After the high-temperature stress treatment, the ABA- treated group of the recombinant rice strain and the ABA- treated group of the wild-type rice were cultivated until seeds were ripened, i.e., for 90 days, and the number of the obtained ripened seeds in each treated group was investigated .

(Results )

The number of the seeds obtained from rice in each treated group cultivated for 90 days after the high- temperature stress treatment was 12 seeds on average per individual in the ABA-treated group of the wild-type rice and, by contrast, was 16 seeds on average per individual in the ABA-treated group of the recombinant rice strain. From this result, the seed yield was confirmed to be improved by the treatment of the recombinant rice with ABA compared with the treatment of the wild-type rice with ABA.

[ 0095]

Test Example 4 Test to evaluate low-temperature stress reduction of ' cspB-transfected recombinant rice strain by ABA treatment (plant fresh weight)

(Test plant)

cspB-trans fected recombinant rice strain 2 prepared in Example 1, and wild-type rice (cultivar: Nipponbare)

The recombinant rice strain was seeded to a 2-fold- diluted Kimura-B liquid medium containing 50 μg/ml hygromycin, hydroponically cultivated at 28°C for day/23°C for night for 5 days with a day length set to 12 hours, and used in the test. The wild-type rice was seeded to a 2- fold-diluted Kimura-B liquid medium, hydroponically cultivated under similar conditions, and then used in the test .

(^"ABA^~treaOrient)^"

Young seedlings of the recombinant rice strain or the wild-type rice cultivated for 5 days after the seeding were transferred to a 24-well plate (height 20 mm x 15 mm in diameter/well ) to which 2 mL of a 2-fold-diluted Kimura-B liquid medium containing abscisic acid (ABA) (manufactured by ako Pure Chemical Industries, Ltd.) having a concentration of 0.1 ppm (containing 0.1% DMSO) was dispensed, and cultivated at 28°C for day/23°C for night for 2 days with a day length set to 12 hours. As an untreated group, the wild-type rice cultivated for 5 days after the seeding was cultivated under the same conditions as above in a 24-well plate to which 2 mL of a 2-fold- diluted Kimura-B liquid medium (containing 0.1% DMSO) was dispensed .

(Low-temperature stress treatment)

Two days after the ABA treatment, the seedlings of the recombinant rice strain or the wild-type rice were transferred to a 2-fold-diluted Kimura-B liquid medium and incubated at 4°C for 5 days under conditions of a day length set to 12 hours to perform low-temperature stress treatment .

(Evaluation method)

After the low-temperature stress treatment, the rice seedlings were transferred to a Hoagland liquid medium (Calif^". Agric . Ξ,χρ . Station Circular ^""(^"1938 ) ;^{" "}34^"7:^""l-32^")^{" "}and^" cultivated at 23°C for 14 days with a day length set to 12 hours. Then, the roots of the rice individuals in each treated group were removed by cutting, and the plant fresh weight of each rice individual was measured.

[ 0096]

(Results)

The average values of plant fresh weights per individual in the untreated groups and the ABA-treated groups of the recombinant rice strain and the wild-type rice are shown in Table 3.

With regard to the recombinant rice strain, the plant fresh weight increased in the ABA-treated group compared with the untreated group.

The stress-reducing effect in the ABA-treated group of the recombinant rice strain further increased even compared with additive effect that was the sum of the stress- reducing effect in the ABA-treated wild-type group and the stress-reducing effect in the untreated recombinant strain group shown in Table 3. Thus, it was confirmed that stress in the recombinant rice strain of the present invention was synergistically reduced by ABA treatment.

Stress-reducing effect = Average value of plant fresh weights in untreated group or ABA-treated group - Average value of plant fresh weights in untreated wild-type group

Additive effect = Stress-reducing effect in ABA- treated wild-type group + stress-reducing effect in untreated recombinant strain group

Difference from additive effect = Value of stress- reducing effect in ABA-treated recombinant strain group - Value of additive effect

[ 0098]

Test Example 5 Test to evaluate low-temperature stress reduction of cspB-transfected recombinant rice strain by ABA spraying treatment (plant fresh weight)

(Test plant)

cspB-transfected recombinant rice strain 2

The recombinant rice strain was seeded to a 2-fold- diluted Kimura-B liguid medium containing 50 μg/ml hygromycin, hydroponically cultivated at 28°C for day/23°C for night for 5 days with a day length set to 12 hours, and used in the test.

(ABA treatment)

On the 5th day after the seeding, an (S)-( + )-ABA solution having a concentration of 30 ppm (containing 0.1% -DM-SQ-)—wa^_s—sprayed^-" o^{' "}young ^" seedlings of ^_ the recombinant rice strain. Then, the seedlings were transferred to a 2- fold-diluted Kimura-B liquid medium and cultivated at 28°C for day/23°C for night for 2 days.

(Low-temperature stress treatment)

Two days after the ABA treatment, the seedlings of the recombinant rice strain were incubated at 4°C for 5 days with a day length set to 12 hours to perform low- temperature stress treatment.

(Evaluation method)

After the low-temperature stress treatment, the rice seedlings were transferred to a Hoagland liquid medium and cultivated for recovery at 23°C for 14 days with a day length set to 12 hours. After the cultivation for recovery, the number of healthy leaves was counted.

[ 0099]

(Results)

The average value of the numbers of healthy leaves per individual in the ABA-treated group of the recombinant rice strain increased by 1.8 times compared with the untreated group of the recombinant rice strain. The stress-reducing effect on the cspB-transfected recombinant rice by the spraying treatment with ABA was confirmed.

[ 0100]

Test Example 6 Test to evaluate low-temperature stress reduction of cspB-transfected recombinant rice strain by ABA sodium salt or ABA potassium salt solution treatment (plant fresh weight)

(Test plant)

cspB-transfected recombinant rice strain

The cspB-transfected recombinant rice strain prepared in Example 1 is seeded to a 2-fold-diluted Kimura-B liquid medium containing 50 μg/ml hygromycin, hydroponically cultivated at 28°C for day/23°C for night for 5 days with a day length set to 12 hours, and then used in the test.

(ABA treatment)

On the 5th day after the seeding, young seedlings of the recombinant rice strain or wild-type rice are transferred to 2 mL of a 2-fold-diluted Kimura-B liquid medium (containing 0.1% DMSO) supplemented with an aqueous ABA sodium salt solution or an aqueous ABA potassium salt solution at a concentration corresponding to 0.1 ppm ABA in a 24-well plate (height 20 mm x 15 mm in diameter/well), and cultivated at 28°C for day/23°C for night for 2 days with a day length set to 12 hours. The aqueous ABA sodium salt solution is prepared by adding sodium hydroxide equimolar to ABA to an aqueous ABA solution, and the aqueous ABA potassium salt solution is prepared by adding potassium hydroxide equimolar to ABA as in the aqueous ABA sodium salt solution. As an untreated group, the recom inant rice strain or the wild-type rice cultivated for 5 days after the seeding is cultivated under the same conditions as above in a 24-well plate to which 2 mL of a 2-fold-diluted Kimura-B liquid medium (containing 0.1% DMSO) has been dispensed.

( Low-temperature stress treatment)

Two days after the ABA treatment, the seedlings of the recombinant rice strain are incubated at 4°C for 5 days with a day length set to 12 hours to perform low- temperature stress treatment.

(Evaluation method)

After the 5-day low-temperature stress treatment, the seedlings of the recombinant rice is transferred to a Hoagland solution and cultivated at 23°C for 14 days with a day length set to 12 hours. Then, the root of each rice individual in each treated group is removed by cutting, and the plant fresh weight of the above-ground part is investigated .

[ 0101]

The plant fresh weight increases in the ABA-treated group of the recombinant rice compared with the untreated group, and stress reduction by the ABA sodium salt or ABA potassium salt treatment is expected.

[ 0102]

Test Example 7 Test to evaluate drought stress reduction of cspB-transfected recombinant rice strain by ABA treatment (plant fresh weight) (Test plant)

cspB-transfected recombinant rice strain 2 prepared in Example 1, and wild-type rice (cultivar: Nipponbare)

The recombinant rice strain was seeded to a 2-fold- diluted Kimura-B liquid medium containing 50 μg/ml hygromycin, hydroponically cultivated at 28°C for day/23°C for night for 7 days with a day length set to 12 hours, and then used in the test. The wild-type rice was seeded to a 2-fold-diluted Kimura-B liquid medium, hydroponically cultivated under similar conditions, and then used in the test .

(ABA treatment)

On the 7th day after the seeding, the recombinant rice strain or the wild-type rice was transferred to a 2-fold- diluted Kimura-B liquid medium and hydroponically cultivated at 28°C for day/23°C for night for 6 days with a day length set to 16 hours. After 6 days, the rice seedlings were transferred to a 2-fold-diluted Kimura-B liquid medium containing (S)-(+)-ABA having a concentration of 0.3 ppm (containing 0.1% DMSO) and treated with ABA for 1 day. An untreated group was similarly cultivated in a 2- fold-diluted Kimura-B liquid medium (containing 0.1% DMSO) . (Drought stress treatment)

-A-f-t-e-r- -tire—r=d^'ay^""ABA^" treatment , the rice seedlings were transferred to a 50-mL vacant test tube and dried in air at 28°C for day/23°C for night for 2 days under conditions of a day length set to 16 hours and humidity set to 80% (RH) to perform drought stress treatment.

(Evaluation method)

After the 2-day drought stress treatment, the rice seedlings were transferred to a Hoagland solution and cultivated for recovery at 28°C for day/23°C for night for 14 days with a day length set to 16 hours. After the cultivation for recovery, the plant fresh weight was measured with 5 rice individuals of each treated group included in one set.

[ 0103]

( Results )

The averages of measured values of plant fresh weights (from 5 rice individuals per group) in the untreated groups and the ABA-treated groups of the recombinant rice strain and the wild-type rice are shown in Table 4.

With regard to the recombinant rice strain, the value of the plant fresh weight increased in the ABA-treated group compared with the untreated group.

The stress-reducing effect in the ABA-treated group of the recombinant rice strain further increased even compared with additive effect that was the sum of the stress- reducing effect in the ABA-treated wild-type group and the stress-reducing effect in the untreated recombinant strain group shown in Table 4. Thus, it was confirmed that stress in the recombinant rice strain of the present invention was synergistically reduced by ABA treatment.

[ 0105]

Test Example 8 Test to evaluate high-temperature stress reduction of cspA-trans fected recombinant rice strain by ABA treatment (plant length)

(Test plant)

CspA-transfected recombinant rice strain 5 prepared in Example 2, and wild-type rice (cultivar: Nipponbare )

The recombinant rice strain was seeded to a 2-fold- diluted Kimura-B liquid medium containing 50 μ9/ιτι1 hygromycin, hydroponically cultivated at 28°C for day/23°C for night for 7 days with a day length set to 12 hours, and then used in the test. The wild-type rice was seeded to a 2-fold-diluted Kimura-B liquid medium, hydroponically cultivated under similar conditions, and then used in the test .

(ABA treatment, high-temperature stress treatment, and evaluation method)

ABA treatment, high-temperature stress treatment, and an evaluation method were performed according to the methods of Test Example 1.

[ 0106]

(Results )

The averages of measured values of plant lengths in the untreated groups and the ABA-treated groups of the wild-type and the recombinant rice strain are shown in Table 5.

With regard to the recombinant rice strain, the value of the plant length increased in the ABA-treated group compared with the untreated group.

The stress-reducing effect in the ABA-treated group of the recombinant rice strain further increased even compared with additive effect that was the sum of the stress- reducing effect in the ABA-treated wild-type group and the stress-reducing effect in the untreated recombinant strain group shown in Table 5. Thus, it was confirmed that stress in the recombinant rice strain of the present invention was synergistically reduced by ABA treatment.

Stress-reducing effect = Average value of plant lengths in untreated group or ABA-treated group - Average value of plant lengths in untreated wild-type group

[ 0108]

Test Example 9 Test to evaluate low-temperature stress reduction of cspA-trans fected recombinant rice strain by ABA treatment (plant fresh weight)

(Test plant)

cspA-transfected recombinant rice strain 8 prepared in Example 2, and wild-type rice (cultivar: Nipponbare)

(ABA treatment, low-temperature stress treatment, and evaluation method)

ABA treatment, low-temperature stress treatment, and an evaluation method were performed according to the methods of Test Example 4.

[ 0109]

(Results )

The averages of measured values of plant fresh weights in the untreated groups and the ABA-treated groups of the wild-type and the recombinant rice strain are shown in Table 6.

The stress-reducing effect in the ABA-treated group of the recombinant rice strain further increased even compared with additive effect that was the sum of the stress- reducing effect in the ABA-treated wild-type group and the stress-reducing effect in the untreated recombinant strain group shown in Table 6. Thus, it was confirmed that stress in the recombinant rice strain of the present invention was synergistically reduced by ABA treatment.

[ 0111]

Test Example 10 Test to evaluate low-temperature stress reduction of corn by soil treatment

(Test plant)

cspB-transfected recombinant corn

Seeds of the cspB-transfected recombinant corn prepared above in Example 3 or a cspB-transfected recombinant corn MON87460 strain (Monsanto Company) are seeded to soil in a pot and cultivated at 27°C for 7 days with a day length set to 16 hours.

(ABA treatment)

Seven days after the seeding, the soil in the pot for the recombinant corn is subjected to irrigation treatment with an aqueous ABA solution (containing 0.1% DMSO). An -u-n-trre- ed—group—rs^" similarly subjected^{' "} to ^" irrigation treatment with water containing 0.1% DMSO. After the irrigation treatment, cultivation is further performed under similar conditions.

( Low-temperature stress treatment)

The recombinant corn to which the ABA treatment has been performed for 2 days is incubated at 2.5°C for 5 days with a day length set to 16 hours to perform low- temperature stress treatment.

(Evaluation method)

After the stress treatment, the recombinant corn is cultivated for recovery at 27°C for 5 days with a day length set to 16 hours, and the number of healthy leaves is investigated. A larger number of healthy leaves isobserved in the ABA-treated group of the recombinant corn compared with the untreated group of the recombinant corn, and stress reduction is expected. Moreover, if the cultivation for recovery is continued until seeds are ripened, improvement in yield such as increase in the fresh weight of the above-ground part is expected.

[ 0112]

Test Example 11 Test to evaluate drought stress reduction of corn by soil treatment

(Test plant)

cspB-transfected recombinant corn

Seeds o the cspB-trans fected recombinant corn prepared above in Example 3 or a cspB-transfected recombinant corn MON87460 strain (Monsanto Company) are seeded to soil in a pot and cultivated at 27°C with a day length set to 16 hours under drought stress-free conditions until a growth stage exhibiting sensitivity to abiotic stress.

(ABA treatment)

After the cultivation, the soil in the pot in which the recombinant corn is grown is subjected to irrigation treatment with an aqueous ABA solution (containing 0.1% DMSO). An untreated group is similarly subjected to irrigation treatment with water containing 0.1% DMSO. After the irrigation treatment, cultivation is performed under similar conditions to perform ABA treatment. Then, drought stress treatment is performed under moisture- limited conditions and for a period in which the recombinant corn strain is sensitive to drought stress.

(Evaluation method)

After the drought stress treatment, cultivation for recovery is performed at 27°C with a day length set to 16 hours, and the number of healthy leaves in the recombinant corn is investigated.

[ 0113]

A larger number of healthy leaves is observed in the A3A-r.reated group of the recombinant corn^' compared with the untreated group of the recombinant corn, and stress reduction is expected. Moreover, if the cultivation for recovery is continued until seeds are ripened, improvement in yield such as increase in the fresh weight of the above- ground part is expected.

[ Industrial Applicability]

[ 0114]

According to the present invention, abiotic stress in recombinant Poaceae plants can be reduced, and increase in the yield of the Poaceae plant is expected.

[ Sequence listing Free text]

[ 0115]

SEQ ID NO: 1

Bacillus subtilis CspB

SEQ ID NO: 2

Escherichia coli CspA

SEQ ID NO: 3

Designed oligonucleotide primer for PCR

SEQ ID NO: 4

Designed oligonucleotide primer for PCR

SEQ ID NO: 5

Designed oligonucleotide primer for PCR

SEQ ID NO: 6

Designed oligonucleotide primer for PCR SEQ ID NO: 7

Designed oligonucleotide primer for PCR SEQ ID NO: 8

Designed oligonucleotide primer for PCR SEQ ID NO: 9

Designed oligonucleotide primer for PCR SEQ ID NO: 10

Designed oligonucleotide primer for PCR SEQ ID NO: 11

Designed oligonucleotide primer for PCR SEQ ID NO: 12

Designed oligonucleotide primer for PCR SEQ ID NO: 13

Designed oligonucleotide primer for PCR SEQ ID NO: 14

Designed oligonucleotide primer for PCR SEQ ID NO: 15

Designed oligonucleotide primer for PCR SEQ ID NO: 16

Designed oligonucleotide primer for PCR SEQ ID NO: 17

Bacillus subtilis cspB

SEQ ID NO: 18

Des-i-g-ned-o-l-igOnue-leotlde primer for PCR^~ SEQ ID NO: 19 Designed oligonucleotide primer for PCR SEQ ID NO: 20

cspB expression cassette

SEQ ID NO: 21

Designed oligonucleotide primer for PCR SEQ ID NO: 22

Designed oligonucleotide primer for PCR SEQ ID NO: 23

Designed oligonucleotide primer for PCR SEQ ID NO: 24

Designed oligonucleotide primer for PCR

SEQ ID NO: 25

Escherichia coli cspA

SEQ ID NO: 26

Designed oligonucleotide primer for PCR

SEQ ID NO: 27

Designed oligonucleotide primer for PCR SEQ ID NO: 28

cspA expression cassette

SEQ ID NO: 29

Designed oligonucleotide primer for PCR SEQ ID NO: 30

Designed oligonucleotide primer for PCR

Claims

1. A method for reducing abiotic stress in a recombinant Poaceae plant, comprising treating a recombinant Poaceae plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is introduced, and/or a growing area of the plant with abscisic acid.

2. The method according to Claim 1, wherein the DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is a DNA comprising a nucleotide sequence encoding the amino acid sequence of Bacillus subtilis cspB protein, or a DNA comprising a nucleotide sequence encoding the amino acid sequence of Escherichia coli cspA protein.

3. The method according to Claim 1, wherein the DNA comprising a nucleotide sequence encoding the amino acid sequence of a cold-shock protein is any of the following DNAs (a) to (c) :

(a) a DNA comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 1;

(b) - a - DNA comprising a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2; and (c) a DNA comprising a nucleotide sequence encoding an amino acid sequence having 62.5% or more sequence identity to the amino acid sequence of (a) or (b) .

4. The method according to any of Claims 1 to 3, wherein the treatment with abscisic acid is spraying treatment to the recombinant Poa cea e plant or soil treatment to the growing area of the recombinant Poa ceae plant.

5. The method according to any of Claims 1 to 4 , wherein the abiotic stress is high-temperature stress, low- temperature stress, and/or drought stress.

6. A method for improving the yield of a recombinant Poa ceae plant, comprising treating a recombinant Poa cea e plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence. of a cold-shock protein is introduced, and/or a growing area of the plant with abscisic acid.

7. The^ method according to any of Claims 1 to 6, wherein the recombinant Poa cea e plant is rice or corn.

8. Use of abscisic acid ir. a recombinant Poa cea e plant into which a DNA comprising a nucleotide sequence encoding the amino acid sequence of a . cold-shock protein is introduced, and/or a growing area of the plant for reducing abiotic stress.