CA3218515A1

CA3218515A1 - Method for generating new gene in organism and use thereof

Info

Publication number: CA3218515A1
Application number: CA3218515A
Authority: CA
Inventors: Linjian JIANG; Jiyao Wang; Sudong MO; Bo Chen; Qiang Hu; Dehui DING; Huarong Li
Original assignee: Qingdao Kingagroot Chemical Compound Co Ltd
Current assignee: Qingdao Kingagroot Chemical Compound Co Ltd
Priority date: 2021-05-02
Filing date: 2022-04-29
Publication date: 2022-11-10
Also published as: KR20240005867A; AR125731A1; EP4334452A1; WO2022233271A1; CN115354039A; AU2022268461A1; JP2024516693A

Abstract

Provided is a method for creating a new gene in an organism in the absence of an artificial DNA template, and a use thereof. The method comprises simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different gene elements or different protein domains, and the DNA breaks are ligated to each other through non-homologous end joining (NHEJ) or homologous repair to generate a new combination of the different gene elements or different protein domains that is different from the original genome sequence, thereby creating a new gene. The new gene can change the growth, development, resistance, yield and other traits of the organism.

Description

Method for generating new gene in organism and use thereof Technical Field The present invention relates to the technical fields of genetic engineering and bioinformatics, and in particular, a method for creating a new gene in an organism in the absence of an artificial DNA template, and use thereof Background Art Generally speaking, a complete gene expression cassette in an organism comprises a promoter, 5' untranslated region (5 UTR), coding region (CDS) or non-coding RNA region (Non-coding RNA), 3' untranslated region (3'UTR), a terminator and many other elements.
Non-coding RNA can perform its biological functions at the RNA level, including rRNA, tRNA, snRNA, snoRNA and microRNA. The CDS region contains exons and introns. After the transcribed RNA is translated into a protein, the amino acids of different segments usually form different domains. The specific domains determine the intracellular localization and function of the protein (such as nuclear localization signal, chloroplast leading peptide, mitochondrial leading peptide, DNA binding domain, transcription activation domain, enzyme catalytic center, etc.).
For non-coding RNA, different segments also have different functions. When one or several elements of a gene change, a new gene will be formed, which may have new functions. For example, an inversion event of a 1.7Mb chromosome fragment occurred upstream of the PpOFP1 gene of flat peach may result in a new promoter, which will significantly increase the expression of PpOFP1 in peach fruit with flat shape in the S2 stage of fruit development as compared to that in peach fruit with round shape, thereby inhibit the vertical development of peach fruit and result in the flat shape phenotype in flat peach (Zhou et al. 2018. A 1.7-Mb chromosomal inversion downstream of a PpOFP1 gene is responsible for flat fruit shape in peach.
Plant Biotechnol. J.
DOT: 10.1111/pbi.13455).
The natural generation of new genes in biological genomes requires a long evolutionary process. According to the research work, the molecular mechanisms for the generation of new genes include exon rearrangement, gene duplication, retrotransposition, and integration of movable elements (transposons, retrotransposons), horizontal gene transfer, gene fusion splitting, de novo origination, and many other mechanisms, and new genes may be retained in species under the action of natural selection through the derivation and functional evolution. The relatively young new genes that have been identified in fruit flies, Arabidopsis thaliana, and primates have a history of hundreds of thousands to millions of years according to a calculation (Long et al. 2012. The origin and evolution of new genes. Methods Mol Biol.
DOT:
10.1007/978-1-61779-585-57). Therefore, in the field of genetic engineering and biological breeding, taking plants as an example, if it is desired to introduce a new gene into a plant (even if all the gene elements of the new gene are derived from different genes of the species itself), it can only be achieved through the transgenic technology. That is, the elements from different genes are assembled together in vitro to form a new gene, which is then transferred into the plant through transgenic technology. It is characterized in that the assembly of new gene needs to be carried out in vitro, resulting in transgenic crops.
The gene editing tools represented by CRISPR/Cas9 and the like can efficiently and accurately generate double-strand breaks (DSB) at specific sites in the genome of an organism, and then the double-strand breaks (DSB) are repaired through the cell's own non-homologous end repair or homologous recombination mechanisms, thereby generating site-specific mutations.
The current applications of the gene editing technique mainly focus on the editing of the internal elements of a single gene, mostly the editing of a CDS exon region. Editing an exon usually results in frameshift mutations in the gene, leading to the function loss of the gene. For this reason, the gene editing tools such as CRISPR/Cas9 are also known as gene knockout (i.e., gene destruction) tools. In addition to the CDS region, the promoter, 5'UTR and other regions can also be knocked out to affect the expression level of a gene. These methods all mutate existing genes without generating new genes, so it is difficult to meet some needs in production. For example, for most genes, the existing gene editing technology is difficult to achieve the up-regulation of gene expression, and it is also difficult to change the subcellular localization of a protein or change the functional domain of protein. There are also reports in the literature of inserting a promoter or enhancer sequence upstream of an existing gene to change the expression pattern of the gene so as to produce new traits (Lu et al. 2020. Targeted, efficient sequence insertion and replacement in rice. Nat Biotechnol. DOI: 10.1038/s41587-020-0581-5), but this method requires the provision of foreign DNA templates, so strict regulatory procedures similar to genetically modified crops apply, and the application is restricted.
Summary of the Invention In order to solve the above-mentioned problems in the prior art, the present invention provides a method for creating a new gene in an organism in the absence of an artificial DNA
template by simultaneously generating two or more DNA double-strand breaks at a combination of specific sites in the organism's genome, and use thereof.
In one aspect, the present invention provides a method for creating a new gene in an organism, comprising the following steps:
simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, ligating the DNA breaks to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination of the different gene elements or different protein domains that is different from the original genome sequence, thereby creating the new gene.
In another aspect, the present invention provides a method for in vivo creation of new genes that can be stably inherited in an organism, characterized by comprising the following steps:
(1) simultaneously generating double-stranded DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are capable of separating different gene elements or different protein domains, and the DNA breaks are then ligated to each other by a non-homologous end joining (NEIEJ) or homologous repair, generating a new combination or assemble of the different gene elements or different protein domains derived from the original genomic sequence, thereby the new gene is generated;
in a specific embodiment, it also includes (2) designing primer pairs that can specifically detect the above-mentioned new combination or assemble, then cells or tissues containing the new genes can be screened out by PCR test, and the characteristic sequences of new

2 combinations of gene elements can be determined by sequencing; and

(3) cultivating the above-screened cells or tissues to obtain TO generation organisms, and perform PCR tests and sequencing on the organisms for two consecutive generations including the TO generation and its bred Ti or at least three consecutive generations to select the organisms containing the above-mentioned characteristic sequence of new combination of gene elements, namely, a new gene that can be stably inherited has been created in the organism;
optionally, it also includes (4) testing the biological traits or phenotypes related to the function of the new gene, to determine the genotype that can bring beneficial traits to the organism, and to obtain a new functional gene that can be stably inherited.
In a specific embodiment, in the step (1), DNA breaks are simultaneously generated at two different specific sites in the genome of the organism, wherein one site is the genomic locus between the promoter region and the coding region of a gene, meanwhile, the other site is between the promoter region and the coding region of another gene with different expression patterns, resulting in a new combination of the promoter of one gene and the coding region of the other gene that has a different expression pattern;
preferably, a combination of the strong promoter and the gene of interest is eventually produced.
In another specific embodiment, in the step (1), DNA breaks are simultaneously generated at three different specific sites in the genome of the organism, the three specific sites include two genomic sites whose combination capable of cutting off the promoter region of a highly expressed gene and the third genomic site between the coding region and the promoter region of the gene of interest that has a different expression pattern; or a genomic site between the promoter region and the coding region of a highly expressed gene and another two genomic sites whose combination capable of cutting off the coding region fragment of the gene of interest that has a different expression pattern; then through gene editing at the above-mentioned sites, translocation editing events can be generated, in which the strong promoter fragment that is inserted upstream of the coding region of the gene of interest, or the coding region fragment of the gene of interest is inserted the downstream of the promoter of another highly expressed gene, finally, the combination of the promoter of one gene and the coding region of the other gene of interest with different expression patterns is generated.
In a specific embodiment, the "two or more different specific sites" may be located on the same chromosome or on different chromosomes. When they locate on the same chromosome, the chromosome fragment resulting from the DNA breaks simultaneously occurring at two specific sites may be deleted, inversed or replicating doubled after repair; when they locate on different chromosomes, the DNA breaks generated at two specific sites may be ligated to each other after repair to produce a crossover event of the chromosome arms. These events can be identified and screened by PCR sequencing with specifically designed primers.
In a specific embodiment, the "two or more different specific sites" may be specific sites on at least two different genes, or may be at least two different specific sites on the same gene.
In a specific embodiment, the transcription directions of the "at least two different genes"
may be the same or different (opposite or toward each other).
The "gene elements" comprise a promoter, a 5' untranslated region (5'UTR), a coding region (CDS) or non-coding RNA region (Non-coding RNA), a 3' untranslated region (3'UTR) and a terminator of the gene.
In a specific embodiment, the combination of different gene elements refers to a combination of the promoter of one of the two genes with different expression patterns and the CDS or non-coding RNA region of the other gene.
In another specific embodiment, the combination of different gene elements refers to a combination of a region from the promoter to the 5'UTR of one of two genes with different expression patterns and the CDS or non-coding RNA region of the other gene In a specific embodiment, the "different expression patterns" refer to different levels of gene expression In another specific embodiment, the "different expression patterns" refer to different tissue-specific of gene expression.
In another specific embodiment, the "different expression patterns" refer to different developmental stage-specificities of gene expression.
In another specific embodiment, the combination of different gene elements is a combination of adjacent gene elements within the same gene.
The "protein domains" refer to a DNA fragment corresponding to a specific functional domain of a protein; it includes but is not limited to nuclear localization signal, chloroplast leading peptide, mitochondrial leading peptide, phosphorylation site, methylation site, transmembrane domain, DNA binding domain, transcription activation domain, receptor activation domain, enzyme catalytic center, etc.
In a specific embodiment, the combination of different protein domains refers to a combination of a localization signal region of one of two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene.
In a specific embodiment, the "different subcellular locations" include, but are not limited to, a nuclear location, a cytoplasmic location, a cell membrane location, a chloroplast location, a mitochondrial location, or an endoplasmic reticulum membrane location.
In another specific embodiment, the combination of different protein domains refers to a combination of two protein domains with different biological functions.
In a specific embodiment, the "different biological functions" include, but are not limited to, recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecule signal, ion binding, or specific enzymatic reaction.
In another specific embodiment, the combination of different protein domains refers to a combination of adjacent protein domains in the same gene.
In another specific embodiment, the combination of gene elements and protein domains refers to a combination of protein domains and adjacent promoters, 5'UTR, 3'UTR or terminators in the same gene Specifically, the exchange of promoters of different genes can be achieved by inversion of

4 chromosome fragments: when two genes located on the same chromosome have different directions, DNA breaks can be generated at specific sites between the promoter and CDS of each of the two genes, the region between the breaks can be inverted, thereby the promoters of these two genes would be exchanged, and two new genes would be generated at both ends of the inverted chromosome segment The different directions of the two genes may be that their 5' ends are internal, namely both genes are in opposite directions, or their 5' ends are external, namely both genes are towards each other. Where the genes are in opposite directions, the promoters of the genes would be inverted, as shown in Scheme 1 of Figure 2; where the genes are towards each other, the CDS regions of the genes would be inverted, as shown in Scheme 1 of Figure 4.
The inverted region can be as short as less than 10kb in length, with no other genes therebetween;
or the inverted region can be very long, reaching up to 300kb-3Mb, andcontaining hundreds of genes.
It is also possible to create a new gene by doubling a chromosome fragment:
where two genes located on the same chromosome are in the same direction, DNA breaks can be generated in specific sites between the promoter and CDS of each of the two genes, the region between the breaks can be doubled by duplication, and a new gene would be created at the junction of the doubled segment by fusing the promoter of the downstream gene to the CDS
region of the upstream gene, as shown in Figure 1 Scheme 1 and Figure 3. The length of the doubled region can be in the range of 500bp to 5Mb, which can be very short with no other genes therebetween, or can be very long to contain hundreds of genes. Although this method will induce point mutations in the regions between the promoters and the CDS region of the original two genes, such small-scale point mutations generally have little effect on the properties of the gene expression, while the new genes created by promoter replacement will have new properties of expression. Or alternatively, DNA breaks can be generated at specific positions on both sides of a protein domain of a same gene, and the region between the breaks can be doubled by duplication, thereby creating a new gene with doubled specific functional domains.
The present invention also provides a new gene obtainable by the present method.
Compared with the original genes, the new gene may have different promoter and therefore have expression characteristics in terms of tissues or intensities or developmental stages, or have new amino acid sequences.
The "new amino acid sequence" can either be a fusion of the whole or partial coding regions of two or more gene, or a doubling of a partial protein coding region of the same gene.
The present invention further provides use of the gene in conferring or improving a resistance/tolerance trait or growth advantage trait in an organism.
In a specific embodiment, in the combination of different gene elements, one element is a plant endogenous strong promoter or the region from a strong promoter to

5'UTR, and the other is the HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclase gene coding region of the same plant.
In a specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the plant endogenous wild-type HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclasegenes gene.
In a specific embodiment, the present invention also provides use of the new gene in the improvement of the resistance or tolerance to a corresponding inhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicide in a plant cell, a plant tissue, a plant part or a plant.
In another specific embodiment, in the combination of different gene elements, one element is an endogenous strong promoter or the region from a strong promoter to 5'UTR
of the organism, and the other is a gene coding region of any one of the P450 family in the same organism.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type P450 gene of the organism.
In another specific embodiment, the present invention also provides use of the new gene in enhancing biological detoxification capability, stress tolerance or secondary metabolic ability.
In another specific embodiment, the said P450 gene is rice OsCYP81A gene or maize ZmCYP81A9 gene.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the rice endogenous OsCYP81A6 gene or corn endogenous ZmCYP81A9 gene, respectively.
In another specific embodiment, the present invention also provides use of the new gene in the improvement of the resistance or tolerance of rice or corn to a herbicide.
In another specific embodiment, in the combination of different gene elements, one element is a maize endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the coding region of maize gene ZMM28(Zm00001d022088), ZmKNR6 or ZmBAM1d In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the plant endogenous wild-type ZM1V128 gene, ZmKNR6 gene or ZmBAM1d gene, respectively.
In another specific embodiment, the present invention also provides use of the new gene in the improvement of maize yield.
In another specific embodiment, in the combination of different gene elements, one element is a rice endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the coding region of rice gene COLD1 or OsCPK24.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the rice endogenous wild-type COLD1 gene or OsCPK24, respectively.
In another specific embodiment, the present invention also provides use of the new gene in the improvement of cold tolerance in rice.
In another specific embodiment, in the combination of different gene elements, one element

6 is an endogenous strong promoter or the region from a strong promoter to 5'UTR
of the organism, and the other is a gene coding region of any one of the ATP-binding cassette (ABC) transporter family in the same organism.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method,the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type ATP-binding cassette (ABC) transporter gene of the organism.
In another specific embodiment, the present invention also provides use of the new gene in enhancing biological detoxification capability or stress tolerance In another specific embodiment, in the combination of different gene elements, one element is a plant endogenous strong promoter or the region from a strong promoter to 5'UTR of the plant, and the other is a gene coding region of any one of the NAC transcription factor family in the same plant In another specific embodiment, the said NAC transcription factor family gene is OsNAC045, OsNAC67, ZmSNAC1, OsNAC006, OsNAC42, OsSNAC1 or OsSNAC2.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type NAC transcription factor family gene.
In another specific embodiment, the present invention also provides use of the new gene in enhancing plant stress tolerance or plant yield In another specific embodiment, in the combination of different gene elements, one element is a plant endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the gene coding region of any one of MYB, MADS, DREB and bZIP
transcription factor family in the same plant.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type MYB transcription factor gene, MADS
transcription factor family gene, DREB transcription factor family gene coding region or bZIP transcription factor family gene, respectively.
In another specific embodiment, the present invention also provides the use of new gene in enhancing plant stress tolerance or regulating plant growth and development.
In another specific embodiment, in the combination of different gene elements, one element is the promoter of any one of overexpression or tissue-specific expression rice genes listed in Table A, and the other is the protein coding region or the non-coding RNA
region of another gene that is different from the selected promoter corresponding to the rice gene In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the expression pattern of the new gene is changed relative to the selected protein coding region or the non-coding RNA region of the rice endogenous gene.
In another specific embodiment, the present invention also provides the use of new gene in regulating the growth and development of rice.

7 In another specific embodiment, in the combination of different gene elements, one element is a protein coding region or non-coding RNA region selected from any one of the biological functional genes listed in Table B to K, and the other is the promoter region of another gene that is different from the selected functional gene of the biological genome corresponding to the selected gene.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the expression pattern of the new gene is changed relative to the selected functional gene.
In another specific embodiment, the present invention also provides use of the new gene in regulating the growth and development of organism.
In another specific embodiment, in the combination of different gene elements, one element is an endogenous strong promoter or the region from a strong promoter to 5'UTR
of the organism, and the other is a gene coding region of any one of the GST
(glutathione-s-transferases) family in the same organism.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous GST (glutathione-s-transferases) family gene of the organism.
In another specific embodiment, the present invention also provides use of the new gene in enhancing biological detoxification capability or stress tolerance.
In another specific embodiment, the said GST family gene is wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat GST28E45 (AY479764.1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene.
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the endogenous wheat GST Cla47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat GST28E45 (AY479764.1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene, respectively.
In another specific embodiment, the present invention also provides use of the new gene in the improvement of the resistance or tolerance of wheat or maize to a herbicide.
In another specific embodiment, in the combination of different gene elements, one element is a rice endogenous strong promoter or the region from a strong promoter to 5'UTR of the organism, and the other is the coding region of any one of gene protein in rice GIF1 (0s04g0413500), NOG1 (0s01g075220), LAIR (0s02g0154100), OSA1 (0s03 g0689300), OsNRT1.1A (0s08g0155400), OsNRT2.3B (0s01g0704100), OsRacl (0s01g0229400), OsNRT2.1 (0s02g0112100), OsGIF1 (0s03g0733600), OsNAC9 (0s03g0815100), CPB1/D11/GNS4 (0s04g0469800), miR1432 (0s04g0436100), OsNLP4 (0s09g0549450), RAG2 (0s07g0214300), LRK1 (0s02g0154200), OsNHX1 (0s07t0666900), GW6

8 (0s06g0623700), WG7 (0s07g0669800), D11/0sBZR1 (0s04g0469800, 0s07g0580500), OsAAP6 (0s07g0134000), OsLSK1 (0s01g0669100), IPA1 (0s08g0509600), SMG11 (0 sOlg0197100), CYP72A31 (0s01g0602200), SNAC1 (0s03g0815100), ZBED
(0s01g0547200), OsSta2 (0s02g0655200), OsASR5 (0s11g0167800), OsCPK4 (0s02g03410), OsDjA9 (0s06g0116800), EUI (0s05g0482400), JMJ705 (0s01g67970), WRKY45 (0s05t0322900), OsRSR1 (0s05g0121600), OsRLCK5 (0s01g0114100), APIP4 (0s01g0124200), OsPAL6 (0s04t0518400), OsPAL8 (0s11g0708900), TPS46 (0s08t0168000), OsERF3 (0s01g58420) and OsYSL15 (0s02g0650300).
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the level of the new gene expression is up-regulated relative to the corresponding endogenous gene In another specific embodiment, the present invention also provides use of the new gene in rice breeding.
In another specific embodiment, in the combination of different gene elements, one element is a fish endogenous strong promoter, and the other is a gene coding region of GH1 (growth hormone 1) in the selected fish.
In another specific embodiment, the present invention also provides a fish endogenous high expression GH1 gene obtainable by the method.
In another specific embodiment, the present invention also provides use of the fish endogenous high expression GH1 gene in fish breeding.
In another specific embodiment, in the combination of different protein domains, one element is a wheat endogenous protein chloroplast localization signal domain, and the other is a wheat mature protein coding region of cytoplasmic localization phosphoglucose isomerase (PGIc) In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the new gene locates the phosphoglucose isomerase gene relative to the coding cytoplasm and its mature protein is located in the chloroplast.
In another specific embodiment, the present invention also provides use of the new gene in the improvement of wheat yield.
In another specific embodiment, in the combination of different protein domains, one element is a rice protein chloroplast localization signal domain (CTP), and the other is the mature protein coding region of OsGL03, 0s0X03 or OsCATC
In another specific embodiment, the present invention also provides a new gene obtainable by the present method, the mature protein of the new gene is located in chloroplast different from OsGL03, 0s0X03 or OsCATC.
In another specific embodiment, the present invention also provides use of the new gene in improving the photosynthetic efficiency of rice.
In another specific embodiment, the present invention also provides a chloroplast

9 localized protein OsCACT, the nucleotide encoding the protein has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 28, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
In another specific embodiment, the present invention also provides a hloroplast localized protein OsGL03, the nucleotide encoding the protein has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 29, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
In another specific embodiment, the present invention also provides use of the protein in improving the photosynthetic efficiency of rice.
The present invention further provides a composition, which comprises:
(a) the promoter of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;
(b) a region between the promoter and the 5' untranslated region of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;
(c) a localization signal region of one of the two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene;
(d) gene coding regions of protein domains with different biological functions derived from two genes with different functions;
wherein, the composition is non-naturally occurring, and is directly connected on the biological chromosome and can be inherited stably.
In a specific embodiment, the "different expression patterns" refers to different levels of gene expression.
In another specific embodiment, the "different expression patterns" refers to different tissue-specific of gene expression.
In another specific embodiment, the "different expression patterns" refers to different developmental stage-specificities of gene expression.
In a specific embodiment, the "different subcellular locations" include, but are not limited to, nuclear location, cytoplasmic location, cell membrane location, chloroplast location, mitochondrial location, or endoplasmic reticulum membrane location.
In a specific embodiment, the "different biological functions" include, but are not limited to, recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecule signal, ion binding, or specific enzymatic reaction.
In a specific embodiment, the composition is fused in vivo.
The present invention also provides an editing method for regulating the gene expression level of a target endogenous gene in an organism, which is independent of an exogenous DNA
donor fragment, which comprises the following steps:
simultaneously generating DNA breaks separately at selected sites between the promoter and the coding region of each of the target endogenous gene and an optional endogenous inducible or tissue-specific expression gene with a desired expression pattern; ligating the DNA breaks to each other by means of non-homologous end joining (NHEJ) or homologous repair, thereby generating an in vivo fusion of the coding region of the target endogenous gene and the optional inducible or tissue-specific expression promoter to form a new gene with expected expression patterns.
In a specific embodiment, the target endogenous gene and the optional endogenous inducible or tissue-specific expression gene with a desired expression pattern are located on the same chromosome or on different chromosomes.
In a specific embodiment, the target endogenous gene is yeast ERG9 gene, the endogenous inducible expression gene is HXT1 gene, and the inducible expression promoter is HXT1 in response to glucose concentration.
The present invention also provides a yeast endogenous inducible ERG9 gene obtainable by the editing method.
The present invention also provides use of the yeast endogenous inducible ERG9 gene in synthetic biology.
In particular, the present invention also provides an editing method of increasing the expression level of a target endogenous gene in an organism independent of an exogenous DNA
donor fragment, which comprises the following steps: simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the target endogenous gene and an optional endogenous highly-expressing gene; ligating the DNA breaks to each other via non-homologous end joining (NHEJ) or homologous repair to form an in vivo fusion of the coding region of the target endogenous gene and the optional strong endogenous promoter, thereby creating a new highly-expressing endogenous gene. This method is named as an editing method for knocking-up an endogenous gene.
In a specific embodiment, the target endogenous gene and the optional highly-expressing endogenous gene are located on the same chromosome.
In another specific embodiment, the target endogenous gene and the optional highly-expressing endogenous gene are located on different chromosomes.
In another aspect, the present invention provides an editing method for knocking up the expression of an endogenous HPPD gene in a plant, comprising fusing the coding region of the HPPD gene with a strong plant endogenous promoter in vivo to form a new highly-expressing plant endogenous HPPD gene. That is, simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the HPPD gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway to form an in vivo fusion of the coding region of the HPPD gene and the optional endogenous strong promoter, thereby creating a new highly-expressing HPPD
gene. In rice, the strong promoter is preferably a promoter of the ubiquitin2 gene.
The present invention also provides a highly-expressing plant endogenous HPPD
gene obtainable by the above editing method.
The present invention also provides a highly-expressing rice endogenous HPPD
gene which has a sequence selected from the group consisting of:
(1) a nucleic acid sequence as shown in SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID
NO: 18, SEQ ID NO: 19 or SEQ ID NO: 27 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
In another aspect, the present invention provides an editing method for knocking up the expression of an endogenous EPSPS gene in a plant, which comprises fusing the coding region of an EPSPS gene with a strong plant endogenous promoter in vivo to form a new highly-expressing plant endogenous EPSPS gene. That is, simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the EPSPS gene and an optional highly-expressing endogenous gene, ligating the DNA breaks to each other through an intracellular repair pathway to form an in vivo fusion of the coding region of the EPSPS gene and the optional strong endogenous promoter, thereby creating a new highly-expressing EPSPS gene. In rice, the strong promoter is preferably a promoter of the TKT gene.
The present invention also provides a highly-expressing plant endogenous EPSPS
gene obtainable by the above editing method.
The present invention also provides a highly-expressing rice endogenous EPSPS
gene which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID
NO: 13 or SEQ ID NO: 14 or a partial sequence thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
In another aspect, the present invention provides an editing method for knocking up the expression of an endogenous PPO (PPDX) gene in a plant, which comprises fusing the coding region of the PPO gene with a strong plant endogenous promoter in vivo to form a new highly-expressing plant endogenous PPO gene. That is, simultaneously generating DNA breaks at specific sites between the promoter and the CDS of each of the PPO gene and an optional highly-expressing endogenous gene, ligating the DNA breaks to each other through an intracellular repair pathway to form an in vivo fusion of the coding region of the PPO gene and the optional strong endogenous promoter, thereby creating a new highly-expressing PPO gene. In rice, the strong promoter is preferably a promoter of the CP12 gene. In Arabidopsis thaliana, the strong promoter is preferably a promoter of the ubiquitin10 gene.
The present invention also provides a highly-expressing plant endogenous PPO
gene obtainable by the above editing method.
The present invention also provides a highly-expressing rice endogenous PPO1 gene having a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID
NO: 17, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ
ID
NO: 25, or SEQ ID NO: 26 or a partial sequence thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides a highly-expressing rice endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID

NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO:
37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides a highly-expressing maize endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 49, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides a highly-expressing wheat endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID
NO:
52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides a highly-expressing oilseed rape endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID
NO: 59, SEQ ID NO: 60 or SEQ ID NO: 61, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides use of the gene in the improvement of the resistance or tolerance to a corresponding inhibitory herbicide in a plant cell, a plant tissue, a plant part or a plant.
The present invention also provides a plant or a progeny derived therefrom regenerated from the plant cell which comprises the gene.
The present invention also provides a method for producing a plant with an increased resistance or tolerance to an herbicide, which comprises regenerating the plant cell which comprises the gene into a plant or a progeny derived therefrom.
In a specific embodiment, the plant with increased herbicide resistance or tolerance is a non-transgenic line obtainable by crossing a plant regenerated from the plant host cell of the invention with a wild-type plant to remove the exogenous transgenic component through genetic segregation.
The present invention also provides a herbicide-resistant rice, which comprises one or a combination of two or more of the rice new gene, highly-expressing rice endogenous HPPD gene, highly-expressing rice endogenous EPSPS gene, highly-expressing rice endogenous PPO1 gene, and highly-expressing rice endogenous PPO2 gene.
In a specific embodiment, the herbicide-resistant rice is non-transgenic.
The present invention also provides a maize, wheat or oilseed rape resistant to a herbicide, which comprises one or a combination of two or more of the maize new gene, the wheat or maize new gene, the highly-expressing maize PPO2 gene, the highly-expressing wheat PPO2 gene, and the highly-expressing oilseed rape PPO2 gene.
In a specific embodiment,the maize, wheat or oilseed rape is non-transgenic.
The present invention also provides a method for controlling a weed in a cultivation site of a plant, wherein the plant is selected from the group consisting of the plant, a plant prepared by the method, the rice, or the maize, wheat or oilseed rape, wherein the method comprises applying to the cultivation site one or more corresponding inhibitory herbicides in an amount for effectively controlling the weed.
The present invention also provides an editing method for knocking up the expression of an endogenous WAK gene in a plant, characterized in that it comprises fusing the coding region of the WAK gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous WAK gene. That is, simultaneously generating DNA

breaks respectively in selected specific sites between the promoter and the coding region of each of the WAK gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the WAK gene and the optional strong endogenous promoter to form a new highly-expressing WAK gene.
The present invention also provides a highly-expressing plant endogenous WAK
gene obtainable by the editing method.
The present invention also provides a highly-expressing rice WAK gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID
NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 68, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides an editing method for knocking up the expression of an endogenous CNGC gene in a plant, characterized in that it comprises fusing the coding region of the CNGC gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous CNGC gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the CNGC gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the CNGC gene and the optional strong endogenous promoter to form a new highly-expressing CNGC gene.
The present invention also provides a highly-expressing plant endogenous CNGC
gene obtainable by the editing method.
The present invention also provides a highly-expressing rice CNGC gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown inSEQ ID NO: 69, SEQ ID NO: 70, SEQ ID
NO:
71 or SEQ ID NO: 72, or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.
The present invention also provides use of the gene in conferring or improving a resistance to rice blast in rice.
The present invention also provides a rice resistant to rice blast, which comprises one or a combination of two or more of the highly-expressing rice WAK gene, and the highly-expressing rice CNGC gene.

Preferably the rice is non-transgenic.
The present invention also provides an editing method for knocking up the expression of an endogenous GH1 gene in a fish, characterized in that it comprises fusing the coding region of the GH1 gene with a strong endogenous promoter of a fish in vivo to form a new highly-expressing fish endogenous GH1 gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the GH1 gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the GHlgene and the optional strong endogenous promoter to form a new highly-expressing GH1 gene; the strong promoter is preferably the corresponding fish ColIAla ( Collagen type I alpha la) gene promoter, RPS15A (ribosomal protein S15a) gene promoter, Actin promoter or DDX5 [DEAD (Asp-Glu-Ala-Asp) box helicase 5] gene promoter.
The present invention also provides a highly-expressing fish endogenous GH1 gene obtainable by the editing method.
The present invention also provides use of the highly-expressing fish endogenous GH1 gene in fish breeding.
The present invention also providesan editing method for knocking up the expression of an endogenous IGF2(Insulin-like growth factor 2) gene in a pig, characterized in that it comprises fusing the coding region of the IGF2 gene with a strong endogenous promoter of a pig in vivo to form a new highly-expressing pig endogenous IGF2 gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF2 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF2 gene and the optional strong endogenous promoter to form a new highly-expressing IGF2 gene; the strong promoter is preferably one of the pig TNNI2 and TNNT3 gene promoter.
The present invention also provides a highly-expressing pig endogenous IGF2 gene obtainable by the editing method.
The present invention also provides use of the highly-expressing pig endogenous IGF2 gene in pig breeding The present invention also provides an editing method for knocking up the expression of an endogenous IGF1 (Insulin-like growth factor 1) gene in a chicken embryo fibroblast, characterized in that it comprises fusing the coding region of the IGF1 gene with a strong endogenous promoter of a chicken in vivo to form a new highly-expressing chicken endogenous IGF1 gene That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF1 gene and the optional strong endogenous promoter to form a new highly-expressing IGF1 gene; the strong promoter is preferably chicken MYBPC1 (myosin binding protein C) gene promoter.
The present invention also provides a highly-expressing chicken endogenous IGF1 gene obtainable by the editing method.
The present invention also provides use of the highly-expressing chicken endogenous IGF1 gene in chicken breeding.
The present invention also provides an editing method for knocking up the expression of an endogenous EPO (Erythropoietin) gene in an animal cell, characterized in that it comprises fusing the coding region of the EPO gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressingendogenous EPO gene. That is, simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the EPO gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the EPO gene and the optional strong endogenous promoter to form a new highly-expressing EPO gene.
The present invention also provides a highly-expressing animal endogenous EPO
gene obtainable by the editing method.
The present invention also provides use of the highly-expressing animal endogenous EPO
gene in animal breeding.
The present invention also provides an editing method for knocking up the expression of an endogenous p53 gene in an animal cell, characterized in that it comprises fusing the coding region of the p53 gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressingendogenous p53 gene. That is, simultaneously generating DNA
breaks respectively in selected specific sites between the promoter and the coding region of each of the p53 gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the p53 gene and the optional strong endogenous promoter to form a new highly-expressing p53 gene The present invention also provides a highly-expressing animal endogenous p53 gene obtainable by the editing method.
The present invention also provides use of the highly-expressing animal endogenous p53 gene in animal breeding or cancer prevention.
In a specific embodiment, the "DNA breaks" are produced by delivering a nuclease with targeting property into a cell of the organism to contact with the specific sites of the genomic DNA. There is no essential difference between this type of DNA breaks and the DNA breaks produced by traditional techniques (such as radiation or chemical mutagenesis).
In a specific embodiment, the "nuclease with targeting property" is selected from Meganuclease, Zinc finger nuclease (ZFN), TALEN and the CRISPR/Cas system.
Among them, the CRISPR/Cas system can generate two or more DNA double-strand breaks at different sites in the genome through two or more leading RNAs targeting different sequences;
by separately designing the ZFN protein or TALEN protein in two or more specific site sequences, the Zinc finger nuclease and TALEN systems can simultaneously generate DNA
double-strand breaks at two or more sites. When two breaks are located on the same chromosome, repair results such as deletion, inversion and doubling may occur; and when two breaks are located on two different chromosomes, crossover of chromosomal arms may occur.
The deletion, inversion, doubling and exchange of chromosome segments at two DNA breaks can recombine different gene elements or protein domains, thereby creating a new functional gene.
In a specific embodiment, the said CRISPR/Cas system is Cas9 nuclease system or Cas12 nuclease system.
In a specific embodiment, the "nuclease with targeting property" exists in the form of DNA.
In another specific embodiment, the "nuclease with targeting property" exists in the form of mRNA or protein, rather than the form of DNA.
In a specific embodiment, the method for delivering the nucleases with targeting property into the cell is selected from a group consisting of: 1) PEG-mediated cell transfection; 2) liposome-mediated cell transfection; 3) electric shock transformation; 4) microinjection; 5) gene gun bombardment; 6) Agrobacterium-mediated transformation; 7) viral vector-mediated transformation method; or 8) nanomagnetic bead mediated transformation method.
The present invention also provides a DNA containing the gene.
The present invention also provides a protein encoded by the gene, or biologically active fragment thereof.
The present invention also provides a recombinant expression vector, which comprises the gene and a promoter operably linked thereto.
The present invention also provides an expression cassette containing the gene.
The present invention also provides a host cell, which comprises the expression cassette.
The present invention further provides an organism regenerated from the host cell.
In the research work of the inventors, it was found that in cells simultaneously undergoing dual-target or multi-target gene editing, a certain proportion of the ends of DNA double-strand breaks at different targets were spontaneously ligated to each other, resulting in events of deletion, inversion or duplication-doubling of the fragments between the targets on the same chromosome, and/or the exchange of chromosome fragments between targets on different chromosomes. It has been reported in the literature that this phenomenon commonly exists in plants and animals (Puchta et al. 2020. Changing local recombination patterns in Arabidopsis by CRISPR/Cas mediated chromosome engineering. Nat Commun. DOT: 10.1038/s41467-020- 18277-z;
Li et al.
2015. Efficient inversions and duplications of mammalian regulatory DNA
elements and gene clusters by CRISPR/Cas9. J Mol Cell Biol. DOI: 10.1093/jmcb/mjv016).
The present inventors surprisingly discovered that, by inducing DNA double-strand breaks in a combination of gene editing targets near specific elements of a gene of interest, causing spontaneous repair ligation, directed combination of different gene elements can be achieved at the genome level without the need to provide a foreign DNA template, it is possible to produce therefrom a new functional gene. This strategy greatly accelerates the creation of new genes and has great potential in animal and plant breeding and gene function research.
Detailed description of invention In the present invention, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory procedures used herein are all terms and routine procedures widely used in the corresponding fields. For example, the standard recombinant DNA
and molecular cloning techniques used in the present invention are well known to those skilled in the art and are fully described in the following documents: Sambrook, J., Fritsch, EF and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press:
Cold Spring Harbor, 1989. For a better understanding of the present invention, definitions and explanations of related terms are provided below.
The term "genome" as used herein refers to all complements of genetic material (genes and non-coding sequences) present in each cell or virus or organelle of an organism, and/or complete genome inherited from a parent as a unit (haploid).
Table A lists some of the ubiquitously-expressed genes and tissue-specific expressed genes in rice. Generally, in production applications, a DNA sequence within 3 kb upstream of the start codon of ubiquitously-expressed genes or tissue-specific genes is used as the promoter region and the 5' non-coding region, where the promoter region of ubiquitously expressed genes is used as a representative of strong promoters, and the promoter region of tissue-specifically expressed genes is used as a representative of tissue-specific promoters.
It is known that ubiquitously-expressed genes and tissue-specific genes in other species similar to rice can be found in public databases such as NCBI
(https://www.ncbi.nlm.nih.gov), JGI (https://jgi.doe) .gov/).
Table A: The ubiquitously-expressed genes and tissue-specific expressed genes in rice.
Ubiquitously-expresse Annotation of gene functions d genes LOC_Os02g06640 ubiquitin family protein, putative, expressed LOC_Os03g51600 tubulin/FtsZ domain containing protein, putative, expressed LOC_Os06g46770 ubiquitin family protein, putative, expressed LOC_Os11g43900 translationally-controlled tumor protein, putative, expressed LOC_Os01g67860 fructose-bisphospate aldolase isozyme, putative, expressed LOC_0s07g26690 aquaporin protein, putative, expressed LOC_0s03g27310 histone H3, putative, expressed LOC_Os05g41060 ADP-ribosylation factor, putative, expressed LOC_0s08g03290 glyceraldehyde-3-phosphate dehydrogenase, putative, expressed LOC_Os05g07700 ribosomal protein, putative, expressed LOC 0s03g08010 elongation factor Tu, putative, expressed LOC_Os02g48560 fatty acid desaturase, putative, expressed LOC 0s01g05490 triosephosphate isomerase, cytosolic, putative, expressed LOC 0s03g08020 elongation factor Tu, putative, expressed LOC_Os10g33800 lactate/malate dehydrogenase, putative, expressed LOC_Os06g04030 histone H3, putative, expressed LOC_Os04g57220 ubiquitin-conjugating enzyme, putative, expressed LOC_Os08g09250 glyoxalase family protein, putative, expressed LOC_Os03g08050 elongation factor Tu, putative, expressed LOC_Os08g02340 60S acidic ribosomal protein, putative, expressed LOC_Os03g50885 actin, putative, expressed LOC_0s09g26420 AP2 domain containing protein, expressed LOC_0s03g12670 expressed protein LOC_0s05g49890 ras-related protein, putative, expressed LOC_0s05g06770 40S ribosomal protein S27a, putative, expressed LOC_Os10g08550 enolase, putative, expressed LOC_Os04g53620 ubiquitin family protein, putative, expressed LOC_Os05g39960 40S ribosomal protein S26, putative, expressed LOC_Os02g01560 40S ribosomal protein S4, putative, expressed LOC_Os08g03640 60S acidic ribosomal protein PO, putative, expressed LOC_0s06g23440 eukaryotic translation initiation factor 1A, putative, expressed LOC_Os10g32920 ribosomal protein, putative, expressed LOC_Os01g60410 ubiquitin-conjugating enzyme, putative, expressed LOC_Os01g22490 40S ribosomal protein S27a, putative, expressed LOC_Os03g13170 ubiquitin fusion protein, putative, expressed Seed specificity highly MSU Annotation expressed genes LOC 0s07g10580 PROLM26 - Prolamin precursor, expressed LOC OsOlg55690 glutelin, putative, expressed LOC_Os10g26060 glutelin, putative, expressed LOC Os07g11330 RAL2 - Seed allergenic protein RA5/RA14/RA17 precursor, _ expressed LOC Os07g11510 RAL6 - Seed allergenic protein RA5/RA14/RA17 precursor, _ expressed LOC Os05g41970 SSA1 -2S albumin seed storage family protein precursor, _ expressed LOC Os07g11380 RAL4 - Seed allergenic protein RA5/RA14/RA17 precursor, _ expressed LOC_0s07g10570 PROLM25 - Prolamin precursor, expressed LOC_Os02g16820 glutelin, putative, expressed LOC_0s02g25640 glutelin, putative, expressed LOC_Os02g16830 glutelin, putative, expressed LOC_Os02g15150 glutelin, putative, expressed LOC_Os03g31360 glutelin, putative, expressed LOC_Os02g15169 glutelin, putative, expressed LOC_Os02g15178 glutelin, putative, expressed LOC_Os06g31070 PROLM24 - Prolamin precursor, expressed LOC_Os03g46100 cupin domain containing protein, expressed LOC Os07g11410 RAL5 - Seed allergenic protein RA5/RA14/RA17 precursor, _ expressed LOC_Os08g03410 glutelin, putative, expressed LOC_Os07g11920 PROLM22 - Prolamin precursor, expressed LOC Os07g11360 RAL3 - Seed allergenic protein RA5/RA14/RA17 precursor, _ expressed LOC 0s03g57960 cupin domain containing protein, expressed LOC Os 1 1g33000 SSA5 -2S
albumin seed storage family protein precursor, _ expressed LOC Os07g11650 LTPL164 - Protease inhibitor/seed storage/LTP family protein _ precursor, expressed LOC Os 1 1g37270 AMBP1 - Antimicrobial peptide MBP-1 family protein precursor, _ expressed LOC_Os07g11910 PROLM20 - Prolamin precursor, expressed LOC_Os12g16890 PROLM28 - Prolamin precursor, expressed LOC_0s07g11900 PROLM19 - Prolamin precursor, putative, expressed LOC_Os02g15090 glutelin, putative, expressed LOC_0s08g08960 Cupin domain containing protein, expressed LOC_Os10g35050 aquaporin protein, putative, expressed LOC_0s04g46200 oleosin, putative, expressed GASR6 - Gibberellin-regulated GASA/GAST/Snakin family LOC_0s05g35690 protein precursor, expressed LOC Os07g11630 LTPL163 - Protease inhibitor/seed storage/LTP family protein _ precursor, expressed LOC_Os05g26350 PROLM4 - Prolamin precursor, expressed LOC_Os06g04200 starch synthase, putative, expressed LOC_Os05g26770 PROLM18 - Prolamin precursor, expressed LOC_Os05g26720 PROLM16 - Prolamin precursor, expressed CAMK CAMK like .8 - CAMK includes calcium/calmodulin LOC_OslOg39420 _ .
dependent protein kinases, expressed LOC Os04g33150 desiccation-related protein PCC13-62 precursor, putative, _ expressed 1,4-alpha-glucan-branching enzyme, chloroplast precursor, LOC_Os06g51084 putative, expressed LOC_0s06g46284 glycosyl hydrolase, family 31, putative, expressed Stamen specificity Annotation of gene functions highly expressed genes LOC_Os10g40090 expansin precursor, putative, expressed LOC_Os06g21410 arabinogalactan peptide 23 precursor, putative, expressed LOC Os05g46530 invertase/pectin methyl esterase inhibitor family protein, putative, _ expressed LOC Os04g32680 POEI20 - Pollen Ole e I allergen and extensin family protein _ precursor, expressed LOC_Os01g27190 C2 domain containing protein, putative, expressed LOC_Os06g17450 expressed protein LOC_OsOlg69020 retrotransposon protein, putative, unclassified, expressed LOC_Os10g32810 beta-amylase, putative, expressed LOC_Os02g05670 expressed protein LOC_Os07g15530 expressed protein LOC_Os04g57280 expressed protein LOC Os05g20570 invertase/pectin methyl esterase inhibitor family protein, putative, _ expressed LOC_Os03g04770 beta-amylase, putative, expressed LOC_Os05g40740 monocopper oxidase, putative, expressed LOC_Os02g02450 transposon protein, putative, unclassified, expressed LOC_Os04g33710 expressed protein LOC 0s10g35930 OsPLIM2c - LIM domain protein, putative actin-binding protein and transcription factor, expressed LOC_Os06g03390 expressed protein LOC_Os02g03520 THION25 - Plant thionin family protein precursor, expressed LOC_Os01g39970 protein kinase domain containing protein, putative, expressed LOC_Os12g42650 pollen preferential protein, putative, expressed LOC_0s08g02880 CXXXC11 - Cysteine-rich protein with paired CXXXC motifs precursor, expressed LOC_0s10g17680 profilin domain containing protein, expressed LOC_OsOlg21970 protein kinase, putative, expressed LOC_Os05g13850 TsetseEP precursor, putative, expressed LOC_Os04g57270 expressed protein LOC Os02g26290 fasciclin-like arabinogalactan protein 8 precursor, putative, _ expressed LOC Os07g13440 RALFL12 - Rapid ALkalinization Factor RALF family protein _ precursor, putative, expressed LOC_Os10g17660 profilin domain containing protein, expressed LOC_Os04g25160 pollen allergen, putative, expressed LOC_Os05g13830 TsetseEP precursor, putative, expressed LOC_Os04g26220 pollen allergen, putative, expressed LOC_Os03g01610 expansin precursor, putative, expressed LOC_Os03g01650 expansin precursor, putative, expressed LOC_Os04g11130 DEF9 - Defensin and Defensin-like DEFL family, expressed LOC_Os06g44470 pollen allergen, putative, expressed LOC_Os01g23880 expressed protein LOC_Os08g12520 expressed protein LOC_Os04g11195 gamma-thionin family domain containing protein, expressed Pistil specificity highly Annotation of gene functions expressed genes LOC_Os05g33150 CHIT6 - Chitinase family protein precursor, expressed LOC_Os07g38130 polygalacturonase inhibitor 1 precursor, putative, expressed LOC_Os11g44810 auxin-repressed protein, putative, expressed LOC_Os09g37910 HMG1/2, putative, expressed LOC_OsO1g42520 expressed protein LOC_Os12g38000 60S ribosomal protein L8, putative, expressed LOC_Os03g08500 AP2 domain containing protein, expressed LOC_Os04g18090 histone H1, putative, expressed LOC_Os06g04030 histone H3, putative, expressed LOC_Os10g40730 expansin precursor, putative, expressed LOC_Os07g48910 retrotransposon protein, putative, unclassified, expressed LOC_Os03g22270 auxin-repressed protein, putative, expressed Leaf specificity highly Annotation of gene functions expressed genes LOC Os12g17600 ribulose bisphosphate carboxylase small chain, chloroplast _ precursor, putative, expressed LOC_Os11g47970 AAA-type ATPase family protein, putative, expressed LOC Os12g19381 ribulose bisphosphate carboxylase small chain, chloroplast _ precursor, putative, expressed LOC_Os11g07020 fructose-bisphospate aldolase isozyme, putative, expressed LOC_OsOlg41710 chlorophyll A-B binding protein, putative, expressed LOC_Os09g17740 chlorophyll A-B binding protein, putative, expressed LOC_0s01g45274 carbonic anhydrase, chloroplast precursor, putative, expressed LOC_0s01g45914 expressed protein LOC_Os06g01210 plastocyanin, chloroplast precursor, putative, expressed LOC Os08g10020 photosystem II 10 kDa polypeptide, chloroplast precursor, _ putative, expressed LOC_Os03g39610 chlorophyll A-B binding protein, putative, expressed LOC_OsOlg31690 oxygen-evolving enhancer protein 1, chloroplast precursor, putative, expressed LOC_0s07g37240 chlorophyll A-B binding protein, putative, expressed LOC_Os07g37550 chlorophyll A-B binding protein, putative, expressed LOC_Os04g38600 glyceraldehyde-3-phosphate dehydrogenase, putative, expressed LOC_Os08g33820 chlorophyll A-B binding protein, putative, expressed LOC_Os11g13890 chlorophyll A-B binding protein, putative, expressed LOC_Os06g21590 chlorophyll A-B binding protein, putative, expressed LOC_Os02g10390 chlorophyll A-B binding protein, putative, expressed LOC_0s09g36680 ribonuclease T2 family domain containing protein, expressed LOC Os08g44680 photosystem I reaction center subunit II, chloroplast precursor, _ putative, expressed LOC Os12g19470 ribulose bisphosphate carboxylase small chain, chloroplast _ precursor, putative, expressed LOC Os07g05480 photosystem I reaction center subunit, chloroplast precursor, _ putative, expressed LOC_Os07g04840 PsbP, putative, expressed LOC Os08g01380 2Fe-2S iron-sulfur cluster binding domain containing protein, _ expressed LOC_Os04g33830 membrane protein, putative, expressed LOC_Os05g48630 expressed protein LOC_Os01g52240 chlorophyll A-B binding protein, putative, expressed LOC_Os01g10400 expressed protein LOC_Os04g38410 chlorophyll A-B binding protein, putative, expressed LOC 0512g23200 photosystem I reaction center subunit XI, chloroplast precursor, putative, expressed LOC_Os07g38960 chlorophyll A-B binding protein, putative, expressed LOC_Os01g19740 calvin cycle protein CP12, putative, expressed LOC_Os01g64960 chlorophyll A-B binding protein, putative, expressed LOC_Os03g03720 glyceraldehyde-3-phosphate dehydrogenase, putative, expressed LOC Os12g08770 photosystem I reaction center subunit N, chloroplast precursor, _ putative, expressed LOC_0s02g02890 peptidyl-prolyl cis-trans isomerase, putative, expressed LOC_0s02g47020 phosphoribulokinase/Uridine kinase family protein, expressed LOC 0507g25430 photosystem I reaction center subunit IV A, chloroplast precursor, _ putative, expressed LOC OsOlg17170 magnesium-protoporphyrin IX monomethyl ester _ cyclase,chloroplast precursor, putative, expressed LOC Os07g36080 oxygen evolving enhancer protein 3 domain containing protein, _ expressed LOC_Os11g06720 abscisic stress-ripening, putative, expressed LOC_Os03g03910 catalase domain containing protein, expressed LOC Os03g52840 serine hydroxymethyltransferase, mitochondrial precursor, _ putative, expressed LOC Os carboxyvinyl-carboxyphosphonate phosphorylmutase, putative, _ expressed LOC_Os05g41640 phosphoglycerate kinase protein, putative, expressed LOC 0509g30340 photosystem I reaction center subunit, chloroplast precursor, _ putative, expressed LOC_Os04g21350 flowering promoting factor-like 1, putative, expressed LOC_Os04g16680 fructose-1,6-bisphosphatase, putative, expressed LOC_Os07g47640 ultraviolet-B-repressible protein, putative, expressed LOC_Os12g08730 thioredoxin, putative, expressed LOC_0s12g33120 expressed protein LOC Os03g56670 photosystem I reaction center subunit III, chloroplast precursor, _ putative, expressed LOC_Os03g22370 ultraviolet-B-repressible protein, putative, expressed LOC_Os03g57220 hydroxyacid oxidase 1, putative, expressed LOC OsOlg56680 photosystem II reaction center W protein, chloroplast precursor, _ putative, expressed LOC_Os02g51080 FAD binding domain containing protein, expressed LOC_Os07g32880 ATP synthase gamma chain, putative, expressed LOC_Os03g17070 ATP synthase B chain, chloroplast precursor, putative, expressed LOC_Os01g13690 ligA, putative, expressed LOC Os04g52260 LTPL124 - Protease inhibitor/seed storage/LTP family protein _ precursor, expressed LOC_Os12g43600 RNA recognition motif containing protein, expressed LOC_Os01g51410 glycine dehydrogenase, putative, expressed LOC_Os06g40940 glycine dehydrogenase, putative, expressed LOC_Os06g15400 expressed protein LOC Os12g02320 LTPL12 - Protease inhibitor/seed storage/LTP family protein _ precursor, expressed LOC 0507g01760 aminotransferase, classes I and II, domain containing protein, _ expressed LOC_Os08g39300 aminotransferase, putative, expressed LOC_0s06g04270 transketolase, chloroplast precursor, putative, expressed LOC_Os08g04500 terpene synthase, putative, expressed LOC_Os02g44630 aquaporin protein, putative, expressed LOC Os 3-beta hydroxysteroid dehydrogenase/isomerase family protein, _ putative, expressed LOC_Os06g51220 HMG1/2, putative, expressed LOC_Os04g41560 B-box zinc finger family protein, putative, expressed LOC Os04g56400 glutamine synthetase, catalytic domain containing protein, _ expressed Table B lists some functional genes that have been reported to be related to plant metabolites. Up-regulated expression of these genes or specific expression in fruits, leaves and other organs may enhance the economic value of such plants.
Table B: Genes related to secondary metabolites of plants.
Plant Gene name Utility Reference Zhang, K., et al. (2021). "CrUGT87A1, a UDP-sugar Carex Flavonoids, glycosyltransferases (UGTs) gene from Carex rigesce CrUGT87A1 Salt rigescens, increases salt tolerance by accumulating ns tolerance flavonoids for antioxidation in Arabidopsis thaliana."
Plant Physiol Biochem 159: 28-36.
Solanu Li, Z., et al. (2021). "S1MYB14 promotes flavonoids accumulation and confers higher tolerance to S1MYB14 Flavonoids lycope 2,4,6-trichlorophenol in tomato." Plant Sci 303:
rsicum 110796.
Zhang, Y., et al. (2020). "Citrus PH4-Noemi regulatory Citrus CsPH4 Proanthocy complex is involved in proanthocyanidin biosynthesis anidin via a positive feedback loop." J Exp Bot 71(4):
1306-1321.

Epigallocat Ginkg echin, Wu, Y., et al. (2020). "Overexpression of the GbF3'Hl Gene Enhanced the Epigallocatechin, Gallocatechin, GbF3'Hl Gallocatec biloba and Catechin Contents in Transgenic Populus." J Agric hin, and L. Food Chem 68(4): 998-1006.
Catechin Wang, C., et al. (2020). "Comparative transcriptome L.
analysis of two contrasting wolfberry genotypes during rutheni LrMYB1 Flavonoids fruit development and ripening and characterization of cum the LrMYB1 transcription factor that regulates flavonoid biosynthesis." BMC Genomics 21(1): 295.
Rao, M. J., et al. (2020). "CsCYT75B1, a Citrus Flavonoids, Citrus CYTOCHROME
P450 Gene, Is Involved in Drought sinensi CsCYT75B1 Accumulation of Antioxidant Flavonoids and Induces tolerance Drought Tolerance in Transgenic Arabidopsis."
Antioxidants (Basel) 9(2).
Premathilake, A. T., et al. (2020). "R2R3-MYB
Pear PpMYB17 Flavonoids transcription factor PpMYB17 positively regulates flavonoid biosynthesis in pear fruit." Planta 252(4): 59.
Rapha Fan, L., et al. (2020). "A genome-wide association nus Anthocyani RsPAP2 study uncovers a critical role of the RsPAP2 gene in sativus ns red-skinned Raphanus sativus L." Hortic Res 7: 164.
L.
Zhai, R., et al. (2019). "The MYB transcription factor Pear PbMYB12b Flavonoids PbMYB12b positively regulates flavonol biosynthesis in pear fruit." BMC Plant Biol 19(1): 85.
Shen, Y., et al. (2019). "RrMYB5- and Flavonoids RrMYB10-regulated flavonoid biosynthesis plays a Rosa RrMYB5-rugosa /RrMYB10 proanthocy pivotal role in feedback loop responding to wounding anidin and oxidation in Rosa rugosa." Plant Biotechnol J
17(11): 2078-2095.
Cartha Liu, X., et al. (2019). "Molecular cloning and mus CtCHI
Flavonoids functional characterization of chal cone isomerase from tinctori Carthamus tinctorius." AMB Express 9(1): 132.
us Li, H., et al. (2019). "Overexpression of SmANS
Salvia Enhances Anthocyanin Accumulation and Alters Anthocyani miltior SmANS Phenolic Acids Content in Salvia miltiorrhiza and rhiza Salvia miltiorrhiza Bge f. alba Plantlets." Int J Mol Sci 20(9).
Solanu Jian, W., et al. (2019). "S1MYB75, an MYB-type Anthocyani transcription factor, promotes anthocyanin lycope n accumulation and enhances volatile aroma production rsicum in tomato fruits." Hortic Res 6: 22.
Oryza Fang, C., et al. (2019). "Lsil modulates the antioxidant Stresstolera sativa Lsil capacity of rice and protects against ultraviolet-B
nce L. radiation." Plant Sci 278: 96-106.

Fraxin Chen, X., et al. (2019). "Molecular cloning and us functional analysis of 4-Coumarate:CoA ligase Fm4CL-like mands Lignin 4(4CL-like 1)from Fraxinus mandshurica and its role in churic abiotic stress tolerance and cell wall synthesis." BMC
a Plant Biol 19(1): 231.
Cao, Y., et al. (2019). "PpMYB15 and PpMYBF1 PpMYB15/ Transcription Factors Are Involved in Regulating Peach Flavonoids PpMYBF1 Flavonol Biosynthesis in Peach Fruit." J Agric Food Chem 67(2): 644-652.
Cartha Ahmad, N., et al. (2019). "Overexpression of a Novel mus CtCYP82G2 Flavonoids Cytochrome P450 Promotes Flavonoid Biosynthesis tinctori 4 and Osmotic Stress Tolerance in Transgenic us Arabidopsis." Genes (Basel) 10(10).
Anthocyani Zhu, Y., et al. (2018). "Molecular Cloning and Vitis ns, VbDFR Functional Characterization of a Dihydroflavonol bellula Proanthocy 4-Reductase from Vitis bellula." Molecules 23(4).
anidins Ginkg Zhang, W., et al. (2018). "Characterization and o functional analysis of a MYB gene (GbMYBFL) related GbMYBFL Flavonoids biloba to flavonoid accumulation in Ginkgo biloba." Genes L. Genomics 40(1): 49-61.
Malus Wang, N., et al. (2018). "Transcriptomic Analysis of MdWRKY1 Red-Fleshed Apples Reveals the Novel Role of domest Flavonoids 1 MdWRKY11 in Flavonoid and Anthocyanin ica Biosynthesis." J Agric Food Chem 66(27): 7076-7086.
Wang, L., et al. (2018). "The GhmiR157a-GhSPL10 Gossy regulatory module controls initial cellular pium GhSPL10 Flavonoids dedifferentiation and callus proliferation in cotton by hirsutu modulating ethylene-mediated flavonoid biosynthesis."
J Exp Bot 69(5): 1081-1093.
Salvia Wang, B., et al. (2018). "Molecular Characterization Phenolic and Overexpression of SmJMT Increases the miltior SmJMT
acids Production of Phenolic Acids in Salvia miltiorrhiza."
rhiza Int J Mol Sci 19(12).
Sun, X., et al. (2018). "MdATG18a overexpression Malus Anthocyani improves tolerance to nitrogen deficiency and regulates domest MdATG18a anthocyanin accumulation through increased autophagy ica in transgenic apple." Plant Cell Environ 41(2): 469-480.
Citrus Liu, X., et al. (2018). "Functional Characterization of a sinensi UGTs Flavonoids Flavonoid Glycosyltransferase in Sweet Orange (Citrus sinensis)." Front Plant Sci 9: 166.
Arabid Li, Q., et al. (2018). "Ectopic expression of opsis UGT76E11 Flavonoids glycosyltransferase UGT76E11 increases flavonoid thalian accumulation and enhances abiotic stress tolerance in a Arabidopsis." Plant Biol (Stuttg) 20(1): 10-19.

Arabid Bhatia, C., et al. (2018). "Low Temperature-Enhanced opsis Flavonol Synthesis Requires Light-Associated AtMYB12 Flavonoids thalian Regulatory Components in Arabidopsis thaliana."
Plant a Cell Physiol 59(10): 2099-2112.
Wang, F., et al. (2016). "The Antirrhinum AmDEL
Antirr AmDEL Flavonoids gene enhances flavonoids accumulation and salt and hinum drought tolerance in transgenic Arabidopsis."
Planta 244(1): 59-73 Song, X., et al. (2016). "Molecular cloning and Lyciu Flavonoids identification of a flavanone 3-hydroxylase gene from LcF3H Drought Lycium chinense, and its overexpression enhances chinen tolerance drought stress in tobacco." Plant Physiol Biochem 98:
se 89-100.
Sorghu Phenylprop Scully, E. D., et al. (2016) "Overexpression of anoid SbMyb60 impacts phenylpropanoid biosynthesis and SbMyb60 bicolor Drought alters secondary cell wall composition in Sorghum tolerance bicolor." Plant J 85(3): 378-395.
Malacarne, G., et al. (2016). "The grapevine Vitis VvibZIPC22 transcription factor is involved in the vinifer VvibZIPC22 Flavonoids regulation of flavonoid biosynthesis." J Exp Bot a 67(11): 3509-3522.
Eupato Lijuan, C., et al. (2015). "Chalcone synthase EaCHS1 rium EaCHS1 Flavonoids from Eupatorium adenophorum functions in salt stress adenop tolerance in tobacco." Plant Cell Rep 34(5): 885-894.
horum Bharti, P., et al. (2015). "AtROS1 overexpression Arabid provides evidence for epigenetic regulation of genes opsis AtRO S1 Flavonoids encoding enzymes of flavonoid biosynthesis and thalian antioxidant pathways during salt stress in transgenic a tobacco." J Exp Bot 66(19): 5959-5969.
Malus Anthocyani An, X. H., et al. (2015). "MdMYB9 and MdMYB11 are MdMYB9/M n, involved in the regulation of the JA-induced domest dMYB11 proanthocy biosynthesis of anthocyanin and proanthocyanidin in ica anidin apples."
Plant Cell Physiol 56(4): 650-662.
Mitsunami, T., et al. (2014). "Overexpression of the Arabid PAP1 transcription factor reveals a complex regulation opsis PAP1 Flavonoids of flavonoid and phenylpropanoid metabolism in thalian Nicotiana tab acum plants attacked by Spodoptera a litura." PLoS One 9(9): e108849.
Camell Mahaj an, M. and S. K. Yadav (2014).
"Overexpression ia of a tea flavanone 3-hydroxylase gene confers tolerance CsF3H Flavonoids sinensi to salt stress and Alternaria solani in transgenic tobacco." Plant Mol Biol 85(6): 551-573.
Arabid Fasano, R., et al. (2014). "Role of Arabidopsis UV
opsis RESISTANCE LOCUS 8 in plant growth reduction UVR8 Flavonoids thalian under osmotic stress and low levels of UV-B."
Mol a Plant 7(5): 773-791.

Fagop yrum Bai, Y.
C., et al. (2014). "Characterization of two tataric FtMYB1/Ft Proanthocy tartary buckwheat R2R3-MYB transcription factors and UM MYB2, anidins their regulation of proanthocyanidin biosynthesis."
Gaertn Physiol Plant 152(3): 431-440.
Ipomo Wang, H., et al. (2013). "Functional characterization of Dihydroflavono1-4-reductase in anthocyanin ea Anthocyani IbDFR biosynthesis of purple sweet potato underlies the direct batatas evidence of anthocyanins function against abiotic Lam.
stresses." PLoS One 8(11): e78484.
Liu, Y., et al. (2013). "Proanthocyanidin synthesis in Theobr Theobroma cacao: genes encoding anthocyanidin TcANR/TcL Proanthocy oma AR anidin synthase, anthocyanidin reductase, and cacao leucoanthocyanidin reductase." BMC Plant Biol 13:
202.
Solanu Kostyn, K., et al. (2013). "Transgenic potato plants Flavonoids with overexpression of dihydroflavonol reductase can DFR
tubero vitamin C serve as efficient nutrition sources." J Agric Food SUM Chem 61(27): 6743-6753.
Epime Huang, W., et al. (2013). "A R2R3-MYB
transcription dium Anthocyani factor from Epimedium sagittatum regulates the EsMYBA1 sagittat n flavonoid biosynthetic pathway." PLoS One 8(8):
UM e70778.
Nakatsuka, T., et al. (2012). "Isolation and Gentia characterization of GtMYBP3 and GtMYBP4, GtMYBP3 na Flavonoids orthologues of R2R3-MYB transcription factors that /GtMYBP4 triflora regulate early flavonoid biosynthesis, in gentian flowers." J Exp Bot 63(18): 6505-6517.
Ma, Q. H., et al. (2011). "TaMYB4 cloned from wheat Triticu regulates lignin biosynthesis through negatively TaMYB4 Flavonoids controlling the transcripts of both cinnamyl alcohol aestivu dehydrogenase and cinnamoyl-CoA reductase genes."
m L.
Biochimie 93(7): 1179-1186.
Hoffmann, T., et al. (2011). "Metabolic engineering in Fragari Eugenol, EGS/IGS
strawberry fruit uncovers a dormant biosynthetic a vesca Isoeugenol pathway." Metab Eng 13(5): 527-531.
Mellway, R. D., et al. (2009). "The wound-, pathogen-, and ultraviolet B-responsive MYB134 gene encodes an Populu Proanthocy MYB134 R2R3 MYB transcription factor that regulates s spp. anidins proanthocyanidin synthesis in poplar." Plant Physiol 150(2) 924-941.
Li, F. X., et al. (2006). "Overexpression of the Saussu Saussurea medusa chalcone isomerase gene in S.
rea CHI Apigenin involucrata hairy root cultures enhances their medus biosynthesis of apigenin." Phytochemistry 67(6):
a 553-560.
Vitis VvMYB5a Phenolic Deluc, L., et al. (2006).
"Characterization of a vinifer compounds grapevine R2R3-MYB transcription factor that a regulates the phenylpropanoid pathway." Plant Physiol 140(2): 499-511.
Medic Xie, D. Y., et al. (2004). "Molecular and biochemical ago MtDER1 Flavonoids analysis of two cDNA clones encoding truncat dihydroflavono1-4-reductase from Medicago ula truncatula." Plant Physiol 134(3): 979-994.
Solanu Lukaszewicz, M., et al. (2004). "Antioxidant capacity Phenolic m CHS/CHI/D
manipulation in transgenic potato tuber by changes in acids,Anth tuberos FR phenolic compounds content." J Agric Food Chem ocyanins um L. 52(6): 1526-1533.
Le Gall, G., et al. (2003). "Characterization and content Zea mays LC/ Cl Flavonoids of flavonoid glycosides in genetically modified tomato (Lycopersicon esculentum) fruits." J Agric Food Chem L.
51(9): 2438-2446 Muir, S. R., et al. (2001). "Overexpression of petunia Petuni .
chalcone isomerase in tomato results in fruit containing Petunia chi-a Flavonoids a increased levels of flavonols." Nat Biotechnol 19(5):
470-474.
Taxus Liao, W., et al. (2019). "Sub-cellular localization and chinen TcCYP725A Taxol overexpressing analysis of hydroxylase gene sis 22 TcCYP725A22 of Taxus chinensis." Sheng Wu Gong Cheng Xue Bao 35(6): 1109-1116.
Lycope Munir, S., et al. (2020). "Genome-wide analysis of rsicon Myo-inositol oxygenase gene family in tomato reveals MIOX4 Vitamin C
esculen their involvement in ascorbic acid accumulation." BMC
tum Genomics 21(1): 284.
Zea mays Zhang, H., et al. (2020). "Enhanced Vitamin C
L./Ara ZmPTPN Vitamin C' Production Mediated by an ABA-Induced PTP-like bidops Drought AtPTPN Nucleotidase Improves Plant Drought Tolerance in is tolerance thalian Arabidopsis and Maize." Mol Plant 13(5): 760-776.
a Luo, T., et al. (2020). "Identifying Vitamin E
Elaeis Biosynthesis Genes in Elaeis guineensis by guinee EgHGGT Vitamin E
Genome-Wide Association Study." J Agric Food Chem nsis 68(2): 678-685.
Zhang, L., et al. (2020). "Overexpression of the maize Zea gamma-tocopherol methyltransferase gene (ZmTMT) mays ZmTMT Vitamin E increases alpha-tocopherol content in transgenic L.
Arabidopsis and maize seeds." Transgenic Res 29(1):
95-104.
Zhan, W., et al. (2019). "An allele of ZmPORB2 Zea encoding a protochlorophyllide oxidoreductase mays ZmPORB2 Vitamin E
L.
promotes tocopherol accumulation in both leaves and kernels of maize." Plant J 100(1): 114-127.

Liu, Y., et al. (2019). "A WRKY transcription factor Pyrus PbrWRKY5 PbrWRKY53 from Pyrus betulaefolia is involved in betulae VitaminC
3 drought tolerance and AsA accumulation."
Plant folia Biotechnol J 17(9): 1770-1787.
Arabid Bagri, D. S., et al. (2018). "Overexpression of PDX-II
gene in potato (Solanum tuberosum L.) leads to the opsis PDX-II VitaminB6 enhanced accumulation of vitamin B6 in tuber tissues thalian and tolerance to abiotic stresses." Plant Sci 272:
a.
267-275.
Liao, P., et al. (2018). "Improved fruit alpha-tocopherol, carotenoid, squalene and phytosterol Brassi contents through manipulation of Brassica juncea ca BjHMGS1 VitaminE

juncea SYNTHASE1 in transgenic tomato." Plant Biotechnol J
16(3): 784-796.
Hordeu Chen, J., et al. (2017). "Overexpression of HvHGGT
HvHGGT VitaminE Enhances Tocotrienol Levels and Antioxidant Activity vulgare in Barley." J Agric Food Chem 65(25): 5181-5187.
L.
Medic Jiang, J., et al. (2017).
"P-HYDROXYPHENYLPYRUVATE
ago MsHPPD VitaminE DIOXYGENASE from Medicago sativa is involved in sativa vitamin E biosynthesis and abscisic acid-mediated seed L.
germination." Sci Rep 7: 40625.
Arabid Bu, Y., et al. (2016). "Overexpression of AtOxR
gene opsis improves abiotic stresses tolerance and vitamin C
AtOxR VitaminC
thalian content in Arabidopsis thaliana." BMC
Biotechnol a 16(1): 69.
Medic Jiang, J., et al. (2016). "Overexpression of Medicago ago sativa TMT elevates the alpha-tocopherol content in MsTMT VitaminE
sativa Arabidopsis seeds, alfalfa leaves, and delays L. dark-induced leaf senescence." Plant Sci 249:
93-104.
Arabid Ramirez Rivera, N. G., et al. (2016).
"Metabolic opsis engineering of folate and its precursors in Mexican AtGCHI Vitamin B9 thalian common bean (Phaseolus vulgaris L.)." Plant a Biotechnol J 14(10): 2021-2032.
Tang, Y., et al. (2016). "Roles of MPBQ-MT in Lactuc Promoting alpha/gamma-Tocopherol Production and a LsMT VitaminE
Photosynthesis under High Light in Lettuce." PLoS
sativa One 11(2): e0148490.
Arabid Vom Dorp, K., et al. (2015). "Remobilization of Phytol opsis from Chlorophyll Degradation Is Essential for VTE6 VitaminE
thalian Tocopherol Synthesis and Growth of Arabidopsis."
a Plant Cell 27(10): 2846-2859.
Triticu Zeng, J., et al. (2015). "Metabolic Engineering of Beta-carote Wheat Provitamin A by Simultaneously Overexpressing CrtB
aestivu ne CrtB and Silencing Carotenoid Hydroxylase (TaHYD)."
m L. J Agric Food Chem 63(41): 9083-9092.

S olanu Drought Yu, Z. B., et al. (2016). "A homologue of vitamin K
tolerance epoxide reductase in Solanum lycopersicum is involved SlVKOR
lycope Salt in resistance to osmotic stress." Physiol Plant 156(3):
rsicum tolerance 311-322.
Dong, W., et al. (2014). "Overexpression of folate Oryza GTPCHI/AD VitaminB9/ biosynthesis genes in rice (Oryza sativa L.) and sativa CS/DHFS/F
folate evaluation of their impact on seed folate content." Plant L. PGS
Foods Hum Nutr 69(4): 379-385.
Amaya, I., et al. (2015). "Increased antioxidant capacity Strawb in tomato by ectopic expression of the strawberry FaGalUR VitaminC
erry D-galacturonate reductase gene." Biotechnol J

10(3):
490-500.
myo-inositol Lisko, K. A., et al. (2013). "Elevating vitamin C
Arabid oxygenase/ content via overexpression of myo-inositol oxygenase opsis ¨ua lono-1,4 VitaminC and 1-gulono-1,4-lactone oxidase in Arabidopsis leads thalian -lactone to enhanced biomass and tolerance to abiotic stresses."
a oxidase In Vitro Cell Dev Biol Plant 49(6): 643-655.
Arun, M., et al. (2014). "Transfer and targeted overexpression of gamma-tocopherol methyltransferase Perilla frutesc TMT VitaminE (gamma-TMT) gene using seed-specific promoter improves tocopherol composition in Indian soybean ens cultivars." Appl Biochem Biotechnol 172(4):
1763-1776.
Arabid Zhang, G. Y., et al. (2013). "Increased opsis alpha-tocotrienol content in seeds of transgenic rice AtTMT VitaminE
thalian overexpressing Arabidopsis gamma-tocopherol a methyltransferase." Transgenic Res 22(1): 89-99.
Johnson, A. A., et al. (2011). "Constitutive Oryza overexpression of the OsNAS gene family reveals Increase Zn sativa NAS single-gene strategies for effective iron-and Fe L. zinc-biofortification of rice endosperm." PLoS
One 6(9): e24476.
Zea Aluru, M., et al. (2008). "Generation of transgenic mays crtB /crtI
VitaminA maize with enhanced provitamin A content." J Exp Bot L. 59(13): 3551-3562.
Arabid Lee, K., et al. (2007). "Overexpression of Arabidopsis homogenti sate phytyltransferase or tocopherol cyclase opsis PT/V-TE2&
VitaminE elevates vitamin E content by increasing thalian TC/VTE1 gamma-tocopherol level in lettuce (Lactuca sativa L.)."
a Mol Cells 24(2): 301-306.
Kanwischer, M., et al. (2005). "Alterations in Arabid tocopherol cyclase activity in transgenic and mutant opsis VTE1 VitaminE plants of Arabidopsis affect tocopherol content, thalian tocopherol composition, and oxidative stress." Plant a Physiol 137(2): 713-723.

Hordeu Falk, J., et al. (2003). "Constitutive overexpression of 4-hydroxyph barley 4-hydroxyphenylpyruvate dioxygenase in enylpyruvate VitaminE
vulgare tobacco results in elevation of the vitamin E content in dioxygenase L. seeds but not in leaves." FEBS Lett 540(1-3):
35-40.
Triticu Chen, Z., et al. (2003). "Increasing vitamin C content of DHAR VitaminC plants through enhanced ascorbate recycling." Proc aestivu Natl Acad Sci U S A 100(6): 3525-3530.
m L.
Agius, F., et al. (2003). "Engineering increased vitamin Strawb GalUR VitaminC C levels in plants by overexpression of a erry D-galacturonic acid reductase." Nat Biotechnol 21(2):
177-181.
Arabid gamma-toco Shintani, D. and D. DellaPenna (1998). "Elevating the opsis pherol thalian methyltransf VitaminE vitamin E content of plants through metabolic engineering." Science 282(5396): 2098-2100.
a erase Table C lists the important functional genes in oilseed rape. The combination of such genes with those endogenous promoters of oilseed rape can be used to create non-transgenic endogenous high-expression new genes or tissue-specific expression genes by applying the method in the present invention to bring about more application scenarios for breeding.
There are also a large number of genes with reported functions in rice, corn, wheat, soybeans and other species. For those functional genes or non-coding RNAs that need to be up-regulated to realize competitive advantages for crops, their combinations with known strong expression promoters are available for creating customized new genes with new expression patterns as per needed by using the method in the present invention.
Table C: Important functional genes in oilseed rape Gene name Application Reference Metallothione Pan, Y., et al. (2018). "Genome-Wide in Family Characterization and Analysis of Metallothionein To improve tolerance to Genes (MT) - Family Genes That Function in Metal Stress heavy metal toxicity metallothione Tolerance in Brassica napus L." Int J Mol Sci in 19(8).
Yang, H., et al. (2019). "Overexpression of Alternative To confer tolerance to BnaA0X1b Confers Tolerance to Osmotic and Salt oxidases osmotic and salt stress Stress in Rapeseed." G3 (Bethesda) 9(10):
(A0Xs) in oilseed rape 3501-3511.

To improve freezing tolerance and regulate Savitch, L. V., et al. (2005). "The effect of like chloroplast overexpression of two Brassica CBF/DREB1-like transcription development, thus to transcription factors on photosynthetic capacity and factors improve photochemical freezing tolerance in Brassica napus."
Plant Cell (BnCBF5 and efficiency and Physiol 46(9): 1525-1539.
17) photosynthetic capacity Mitogen-activ To indicate the ated protein transcriptional level of kinase Wang, Z., et al. (2021). "Genome-Wide BnaMKK and (MAPK),Mito Identification and Analysis of MKK and MAPK
BnaMAPK is usually gen-activated Gene Families in Brassica Species and Response to regulated by growth, protein kinase Stress in Brassica napus." Int j Mol Sci 22(2).
(MAPK) development and stress signal.
Family Genes pyrabactin resistance Di, F., et al. (2018). "Genome-Wide Analysis of the 1-like PYL Gene Family and Identification of PYL Genes Abiotic stress response (PYR/PYL) That Respond to Abiotic Stress in Brassica napus."
protein gene Genes (Basel) 9(3).
family Ding, Y., et al. (2018). "Screening of candidate BnPCS1; Key factors in cadmium gene responses to cadmium stress by RNA
BnHMAs stress response sequencing in oilseed rape (Brassica napus L.)."
Environ Sci Pollut Res Int 25(32): 32433-32446.
APETALA2/e thylene Du, C., et al. (2016). "Dynamic transcriptome response analysis reveals AP2/ERF transcription factors factor Cold stress response responsible for cold stress in rapeseed (Brassica (AP2/ERF) napus L.)." Mol Genet Genomics 291(3):
transcription 1053-1067.
factor (TF) superfamily Edrisi Maryan, K., et al. (2019). "Analysis of dehydrin, Cold stress response Brassica napus dehydrins and their Co-Expression DHNs regulatory networks in relation to cold stress."
Gene Expr Patterns 31: 7-17.
WRKY Feng, Y., et al. (2020). "Transcription factor transcription BnaA9.WRKY47 contributes to the adaptation of To adapt to low boron factor Brassica napus to low boron stress by up-regulating environmental stress families; the boric acid channel gene BnaA3.NIP5;1."
Plant NIP5.1 Biotechnol J 18(5): 1241-1254.
Georges, F., et al. (2009). "Over-expression of Brassica napus phosphatidylinositol-phospholipase phosphatidyli Drought resistance, C2 in canola induces significant changes in gene nositol-phosp early flowering and expression and phytohormone distribution patterns, holipase C2 maturation enhances drought tolerance and promotes early flowering and maturation." Plant Cell Environ 32(12): 1664-1681.
Guo, P., et al. (2019). "Genome-wide survey and GRAS gene expression analyses of the GRAS gene family in Root stress response Brassica napus reveals their roles in root family development and stress response." Planta 250(4):
1051-1072.

He, X., et al. (2020). "Comprehensive analyses of Annexins the annexin (ANN) gene family in Brassica rapa, (ANN) Cold stress response Brassica oleracea and Brassica napus reveals their genes roles in stress response." Sci Rep 10(1): 4295.
CaM
(Calmodulin) He, X., et al. (2020). "Genome-wide identification Abiotic stress response and expression analysis of CaM/CML genes in / CML
(calmodulin-li genes Brassica napus under abiotic stress." J Plant Physiol 255: 153251.
ke) genes Huang, R., et al. (2019). "Heat Stress Suppresses WRINKLED1 Brassica napus Seed Oil Accumulation by Heat tolerance ,BnWRI1 Inhibition of Photosynthesis and BnWRI1 Pathway." Plant Cell Physiol 60(7) 1457-1470.
WAX Liu, N., et al. (2019). "Overexpression of WAX
INDUCER1/S To promote growth and INDUCER1/SHINE1 Gene Enhances Wax HINE' increase oil content Accumulation under Osmotic Stress and Oil (WINO
Synthesis in Brassica napus." Int J Mol Sci 20(18).
Liu, P., et al. (2018). "Genome-Wide Identification Cytokinin and Expression Profiling of Cytokinin oxidase/dehyd Oxidase/Dehydrogenase (CKX) Genes Reveal Relates to pod length rogenases Likely Roles in Pod Development and Stress (CKXs) Responses in Oilseed Rape (Brassica napus L.)."
Genes (Basel) 9(3).
mitogen-activ Wang, Z., et al. (2009). "Overexpression of ated protein Brassica napus MPK4 enhances resistance to Disease resistance kinases Sclerotinia sclerotiorum in oilseed rape." Mol Plant 4,MAPK4 Microbe Interact 22(3): 235-244.
ABSCISIC Xu, P. and W. Cai (2019). "Function of Brassica ACID napus BnABI3 in Arabidopsis gsl, an Allele of Stress response INSENSITIV AtABI3, in Seed Development and Stress E3 Response." Front Plant Sci 10: 67.
Alternative Yang, H., et al. (2019). "Overexpression of BnaA0X1b Confers Tolerance to Osmotic and Salt oxidases Tolerance to salt stress Stress in Rapeseed." G3 (Bethesda) 9(10):
(A0Xs) 3501-3511.
Zhang, Y., et al. (2015). "Overexpression of Three Resistance to Glucosinolate Biosynthesis Genes in Brassica Glucosinol ate Sclerotinia sclerotiorum napus Identifies Enhanced Resistance to Sclerotinia Biosynthesis and Botrytis cinerea sclerotiorum and Botrytis cinerea." PLoS
One 10(10): e0140491.
Huang, Y., et al. (2020). "A Brassica napus tropinone Reductase Gene Dissected by Associative Cold resistance reductase Transcriptomics Enhances Plant Adaption to Freezing Stress." Front Plant Sci 11: 971.

Qi, Q., et al. (2003). "Molecular and biochemical characterization of an aminoalcohol aminoalcoholphosphotransferase (AAPT1) from phosphotransf Brassica napus: effects of low temperature and Cold resistance erase(AAPT1 abscisic acid treatments on AAPT expression in Arabidopsis plants and effects of over-expression of BnAAPT1 in transgenic Arabidopsis." Planta 217(4): 547-558.
BnSIP1-1 Luo, J., et al. (2017). "BnSIP1-1, a Trihelix Family Tolerance to osmotic Trihelix Gene, Mediates Abiotic Stress Tolerance and ABA
stress and salt stress Family Gene Signaling in Brassica napus." Front Plant Sci 8: 44.
Ding, L. N., et al. (2020). "Arabidopsis GDSL1 Resistance to overexpression enhances rapeseed Sclerotinia BnGLIP1 sclerotiorum resistance and the functional Sclerotinia sclerotiorum identification of its homolog in Brassica napus."
Plant Biotechnol J 18(5): 1255-1270.
BnLEA (B.
napus group 3 Park, B. J., et al. (2005). Genetic improvement of late Resistance to drought Chinese cabbage for salt anddrought tolerance by embryogenesi and salt stress constitutive expressionof a B.
napusLEA gene.
s abundant Plant Science 169: 553-558.
gene Yu, Q., et al. (2005). Sense and antisense BnPIP1 (B.
napus plasma expression of plasma membrane aquaporin BnPIP1 Drought resistance from Brassica napus in tobacco and its effects on membrane plant drought resistance. Plant Science 169:
aquaporin 647-656.
Dalal, M., et al. (2019). Abiotic stress and ABA-inducible Group 4 LEA from Brassica napus BnLEA 4-1 Drought resistance plays a key role in salt and drought tolerance.
Journal of Biotechnology 139: 137-145.
BnCIPK6 (CBL-interact Chen, L., et al. (2012) The Brassica napus ing protein Calcineurin B-Like 1/CBL-interacting protein kinase 6) Salt resistance, low kinase 6 (CBL1/CIPK6) component is involved in BnCIPK6M phosphorous tolerance (CIPK6 the plant response to abiotic stress and ABA.
Journal of Experimental Botany 63: 6211-6222.
phosphomimi c form) Kuluev, B. R., et al. (2013). "[Morphological AINTEGUM features of transgenic tobacco plants expressing the ENTA (ANT) High yield AINTEGUMENTA gene of rape under control of gene the Dahlia mosaic virus promoter]."
Ontogenez 44(2): 110-114.
Chen, L., et al. (2011). "A novel cold-regulated gene, C0R25, of Brassica napus is involved in BnCOR25 Cold resistance plant response and tolerance to cold stress." Plant Cell Rep 30(4): 463-471.

Zou, Z., et al. (2020). "Genome-Wide Identification and Analysis of VQ Motif-containing Gene Family BnVQ7(BnM
Disease resistance in Brassica napus and Functional Characterization KS1) of BnMKS1 in Response to Leptosphaeria maculans." Phytopathology.
b-ketoacyl-A Gupta, M., et al. (2012). "Transcriptional activation of Brassica napus beta-ketoacyl-ACP synthase II
CP synthase To improve quality with an engineered zinc finger protein transcription II(KASII) factor." Plant Biotechnol J 10(7) 783-791.
Liang, Y., et al. (2019). "Drought-responsive genes, late embryogenesis abundant group3 (LEA3) and vicinal oxygen chelate, function in lipid BnLEA3, Drought resistance accumulation in Brassica napus and Arabidopsis BnVOC
mainly via enhancing photosynthetic efficiency and reducing ROS." Plant Biotechnol J 17(11):
2123-2142.
Liu, S., et al. (2020). "Dissection of genetic architecture for glucosinolate accumulations in BnaA3.MYB2 To improve quality leaves and seeds of Brassica napus by genome-wide association study." Plant Biotechnol J 18(6):
1472-1484.
Shi, L., et al. (2019). "A CACTA-like transposable BnaA9.CYP7 element in the upstream region of To increase yield BnaA9.CYP78A9 acts as an enhancer to increase monooxygena silique length and seed weight in rapeseed." Plant J
se 98(3): 524-539.
Shen, Q., et al. (2011). "Expression of a Brassica Tolerance to Hg napus heme oxygenase confers plant tolerance to BnH0-1 pollution mercury toxicity." Plant Cell Environ 34(5):
752-763.
Ligaba, A., et al. (2006). "The BnALMT1 and Al-activated BnALMT2 genes from rape encode Tolerance to aluminum malate aluminum-activated malate transporters that toxicity transporter) enhance the aluminum resistance of plant cells."
Plant Physiol 142(3): 1294-1303.
SUPPRESSO
R WITH Li, S., et al. (2015). "BnaC9.SMG7b Functions as a MORPHOGE
Positive Regulator of the Number of Seeds per To increase pod seed NETIC number Silique in Brassica napus by Regulating the EFFECTS ON
Formation of Functional Female Gametophytes."
GENITALIA Plant Physiol 169(4): 2744-2760.

BnaA03 .MPK
Wang, Z., et al. (2020). "BnaMPK6 is a 6, Resistance to determinant of quantitative disease resistance mitogen-activ Sclerotinia sclerotiorum against Sclerotinia sclerotiorum in oilseed rape."
ated protein Plant Sci 291: 110362.
kinases Ren, F., et al. (2014). "A Brassica napus PHT1 phosphate transporter, BnPht1;4, promotes phosphate To improve phosphate phosphate uptake and affects roots architecture of transporter, uptake BnPht1;4 transgenic Arabidopsis." Plant Mol Biol 86(6):
595-607.
proline-rich, Haffani, Y. Z., et al. (2006). "Altered Expression of extensin-like PERK Receptor Kinases in Arabidopsis Leads to receptor To increase yield Changes in Growth and Floral Organ Formation."
kinase Plant Signal Behav 1(5): 251-260.
(PERK) Tolerance to osmotic Luo, J., et al. (2017). "BnSIP1-1, a Trihelix Family BnSIP 1- I and salt stress in Gene, Mediates Abiotic Stress Tolerance and ABA
germination stage Signaling in Brassica napus." Front Plant Sci 8: 44.
Peng, D., et al. (2018). "Enhancing freezing To increase trichome tolerance of Brassica napus L by overexpression of density, change LTP2 a stearoyl-acyl carrier protein desaturase gene secondary metabolite (SAD) from Sapium sebiferum (L.) Roxb." Plant concentration Sci 272: 32-41.
Wang, Z., et al. (2018). "Overexpression of OsPGIP2 confers Sclerotinia sclerotiorum Resistance to BnPGIP2 resistance in Brassica napus through increased Sclerotinia sclerotiorum activation of defense mechanisms." J Exp Bot 69(12): 3141-3155.
Yang, M., et al. (2011). "Overexpression of the To increase plant Brassica napus BnLAS gene in Arabidopsis affects BnLAS
drought tolerance plant development and increases drought tolerance." Plant Cell Rep 30(3): 373-388.
Savitch, L. V., et al. (2005). "The effect of CBF/
To improve overexpression of two Brassica CBF/DREB1-like drebltype photosynthetic capacity transcription factors on photosynthetic capacity and transcription and freezing tolerance freezing tolerance in Brassica napus." Plant Cell factor Physiol 46(9): 1525-1539.
To enhance resistance Wang, Z., et al. (2014). "Overexpression of BnWRKY33 in oilseed rape enhances resistance to BnWRKY33 to Sclerotinia Sclerotinia sclerotiorum." Mol Plant Pathol 15(7) sclerotiorum 677-689.
Clauss, K., et al. (2011). "Overexpression of To inhibit sinapine sinapine esterase BnSCE3 in oilseed rape seeds BnSCE3 accumulation triggers global changes in seed metabolism."
Plant Physiol 155(3): 1127-1145 Positively regulates vascular lignification, Jiang, J., et al. (2020). "MYB43 in Oilseed Rape plant morphology and (Brassica napus) Positively Regulates Vascular MYB43 Yield potential but Lignification, Plant Morphology and Yield negatively affects Potential but Negatively Affects Resistance to resistance to Sclerotinia Sclerotinia sclerotiorum." Genes (Basel)

11(5).
sclerotiorum Peng, D., et al. (2018). "Increasing branch and seed To increase branch and yield through heterologous expression of the novel seed yield rice S-acyl transferase gene OsPAT15 in Brassica napus L." Breed Sci 68(3): 326-335.
Faure-Rabasse, S., et al. (2002). "Effects of nitrate pulses on BnNRT1 and BnNRT2 genes: mRNA
To increase nitrate BnNRT2.2 influx rates levels and nitrate influx rates in relation to the duration of N deprivation in Brassica napus L." J
Exp Bot 53(375): 1711-1721 Table D lists important functional genes in some horticulture crops. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain.
Table D: Important functional genes in horticulture crops Crop Gene name Application Reference Huo, L., et al. (2020). "MdATG18a overexpression improves basal Apple MdATG18a Thermo tolerance thermotolerance in transgenic apple by decreasing damage to chloroplasts." Hortic Res 7:21.
Ma, Y., et al. (2021). "The miR156/SPL
module regulates apple salt stress tolerance Apple MdSPL13 Salt stressresistance by activating MdWRKY100 expression."
Plant Biotechnol J 19(2): 311-323.
Sharma, V., et al. (2019). "An apple transcription factor, MdDREB76, confers salt Drought tolerance and drought tolerance in transgenic tobacco Apple MdDREB76 and salt resistance by activating the expression of stress-responsive genes." Plant Cell Rep 38(2): 221-241.
Zhang, F. J., et al. (2021). "The ankyrin Salt tolerance and repeat-containing protein MdANK2B
Apple MdANK2B regulates salt tolerance and ABA
sensitivity ABA sensitivity in Malus domestica." Plant Cell Rep 40(2):
405-419.
Quality Yu, J. Q., et al. (2021). "The apple bHLH
, transcription factor MdbHLH3 functions in Apple MdbHLH3 carbohydrate and determining the fruit carbohydrates and malic acid malate." Plant Biotechnol J 19(2): 285-299.
Huang, D., et al. (2021). "Overexpression of MdIAA24 improves apple drought resistance Apple MdIAA24 Drought tolerance by positively regulating strigolactone biosynthesis and mycorrhization." Tree Physiol 41(1): 134-146.
Zhang, S., et al. (2020). "A novel NAC
transcription factor, MdNAC42, regulates Apple MdNAC42 Anthocyanin anthocyanin accumulation in red-fleshed apple by interacting with MdMYB10." Tree Physiol 40(3): 413-423.

Yang, S., et al. (2020). "MdHAL3, a 4'-phosphopantothenoylcysteine Apple MdHAL3 Salt tolerance decarboxylase, is involved in the salt tolerance of autotetraploid apple." Plant Cell Rep 39(11): 1479-1491.
Shi, K., et al. (2020). "MdWRKY11 improves MdWRKY11-copper tolerance by directly promoting the Apple Copper tolerance MdHMA5 expression of the copper transporter gene MdHMA5." Hortic Res 7: 105.
Huo, L., et al. (2020). "The Apple Autophagy-Related Gene MdATG9 Confers Apple MdATG9 Nitrogen stress Tolerance to Low Nitrogen in Transgenic Apple Callus." Front Plant Sci 11:423.
Huo, L., et al. (2020). "Increased autophagic activity in roots caused by overexpression of Apple MdATG10 Salt tolerance the autophagy-related gene MdATG10 in apple enhances salt tolerance." Plant Sci 294:
110444.
Gao, T., et al. (2020). "Exogenous dopamine alleviate replant and overexpression of the dopamine synthase Apple MdTYDC
disease gene MdTYDC alleviated apple replant disease." Tree Physiol.
Dong, Q., et al. (2020). "MdWRKY30, a MdWRKY26/ Salt tolerance and group Ha WRKY gene from apple, confers Apple tolerance to salinity and osmotic stresses in 28/30 osmotic stress transgenic apple callus and Arabidopsis seedlings." Plant Sci 299: 110611.
Chen, Q., et al. (2020). "Overexpression of an apple LysM-containing protein gene, resistance to MdCERK1-2, confers improved resistance to Apple MdCERK1-2 pathogenic fungus the pathogenic fungus, Alternaria alternata, in Nicotiana benthamiana." BMC Plant Biol 20(1): 146.
Zheng, L., et al. (2019). "Transcriptome Analysis Reveals New Insights into Growth and Apple MdBAK1 MdBAK1-Mediated Plant Growth in Malus development domestica." J Agric Food Chem 67(35):
9757-9771.
Zhang, F., et al. (2019). "MdWRKY100 Resistance to encodes a group I WRKY transcription factor Colletotrichum Apple MdWRKY100 in Malus domestica that positively regulates gloeosporioides resistance to Colletotrichum gloeosporioides infection infection." Plant Sci 286: 68-77.
Ma, B., et al. (2019). "A Mal0 gene encoding P-type ATPase is involved in fruit organic Apple Mal0 Acidity acid accumulation in apple." Plant Biotechnol J 17(3): 674-686.

Jia, D., et al. (2019). "An apple (Malus domestica) NAC transcription factor enhances Apple MdNAC1 Drought resistance drought tolerance in transgenic apple plants."
Plant Physiol Biochem 139: 504-512.
Huang, D., et al. (2019). "Overexpression of Apple MdIAA9 Osmotic stress MdIAA9 confers high tolerance to osmotic stress in transgenic tobacco." Peed 7: e7935.
Feng, Y., et al. (2019). "Genome-Wide Identification and Characterization of ABC
Transporters in Nine Rosaceae Species Apple MdABCG28 Stem growth Identifying MdABCG28 as a Possible Cytokinin Transporter linked to Dwarfing."
Int J Mol Sci 20(22).
Zheng, X., et al. (2018). "MdWRKY9 overexpression confers intensive dwarfing in the M26 rootstock of apple by directly Apple MdWRKY9 Dwarfing inhibiting brassinosteroid synthetase MdDWF4 expression." New Phytol 217(3):
1086-1098.
Zhang, J., et al. (2018). "The ethylene response factor MdERF1B regulates Apple MdERF1B Anthocyanin anthocyanin and proanthocyanidin biosynthesis in apple." Plant Mol Biol 98(3):
205-218.
Sun, X., et al. (2018). "Improvement of drought tolerance by overexpressing MdATG18a is mediated by modified Apple MdATG18a Drought tolerance antioxidant system and activated autophagy in transgenic apple." Plant Biotechnol J 16(2):
545-557.
Meng, D., et al. (2018). "Sorbitol Modulates Resistance to Alternaria alternata by MdWRKY79-Apple MdNLR16 Fungus resistance Regulating the Expression of an NLR
Resistance Gene in Apple." Plant Cell 30(7):
1562-1581.
Dong, Q., et al. (2018). "Genome-Wide Analysis and Cloning of the Apple Stress-Associated Protein Gene Family Apple MdSAP15 Drought tolerance Reveals MdSAP15, Which Confers Tolerance to Drought and Osmotic Stresses in Transgenic Arabidopsis." Int J Mol Sci 19(9).
Ma, J., et al. (2021). "The NAC-type transcription factor CaNAC46 regulates the Salt and drought Pepper CaNAC46 salt and drought tolerance of transgenic tolerance Arabidopsis thaliana." BMC Plant Biol 21(1):
11.
Zhang, H. X., et al. (2020). "Identification of Phytophthora Pepper CaSBP08 Gene in Defense Response Pepper CaSBP08 capsici resistance Against Phytophthora capsici Infection."
Front Plant Sci 11: 183.

Yang, S., et al. (2020). "Pepper CaML06 Negatively Regulates Ralstonia solanacearum Pepper CaML06 Thermo resistance Resistance and Positively Regulates High Temperature and High Humidity Responses."
Plant Cell Physiol 61(7): 1223-1238.
Shen, L., et al. (2020). "CaCBL1 Acts as a Ralstonia Positive Regulator in Pepper Response to Pepper CaCBL1 solanacearum Ralstonia solanacearum." Mol Plant Microbe resistance Interact 33(7): 945-957.
Liu, C., et al. (2020). "Genome-wide analysis of NDR1/HIN1-like genes in pepper Pathogenic bacteria Pepper CaNHL4 resistance (Capsicum annuum L.) and functional characterization of CaNHL4 under biotic and abiotic stresses." Hortic Res 7: 93.
Foong, S. L. et al. (2020). "Capsicum annum Hsp26.5 promotes defense responses against Pepper CaHsp26.5 Virus defense RNA
viruses via ATAF2 but is hijacked as a chaperone for tobamovirus movement protein." J Exp Bot 71(19): 6142-6158.
Ali, M., et al. (2020). "The CaChiVI2 Gene of Thermo tolerance Capsicum annuum L. Confers Resistance Pepper CaChiVI2 and disease Against Heat Stress and Infection of resistance Phytophthora capsici." Front Plant Sci 11:
219.
Mou, S., et al. (2019). "CaLRR-RLK1, a novel RD receptor-like kinase from Capsicum Ralstonia annuum and transcriptionally activated by Pepper CaLRR-RLK1 solanacearum CaHDZ27, act as positive regulator in resistance Ralstonia solanacearum resistance." BMC
Plant Biol 19(1): 28.
Huang, L. J., et al. (2019). "CaHSP16.4, a Thermo and small heat shock protein gene in pepper, is Pepper CaHSP16.4 drought tolerance involved in heat and drought tolerance."
Protoplasma 256(1): 39-51.
Dang, F., et al. (2019). "A feedback loop Ralstonia between CaWRKY41 and H202 coordinates Pepper CaWRKY41 solanacearum the response to Ralstonia solanacearum and resistance excess cadmium in pepper." J Exp Bot 70(5):
1581-1595.
Qiu, A., et al. (2018). "CaC3H14 encoding a tandem CCCH zinc finger protein is directly Ralstonia targeted by CaWRKY40 and positively Pepper CaC3H14 solanacearum regulates the response of pepper to resistance inoculation by Ralstonia solanacearum." Mol Plant Pathol 19(10): 2221-2235.
Hussain, A., et al. (2018). "CaWRKY22 Acts as a Positive Regulator in Pepper Response to Ralstonia RalstoniaSolanacearum by Constituting Pepper CaWRKY22 solanacearum Networks with CaWRKY6, CaWRKY27, resistance CaWRKY40, and CaWRKY58." Int J Mol Sci 19(5).

Guan, D., et al. (2018). "CaHSL1 Acts as a Positive Regulator of Pepper Pepper CaHSL1 Thermo tolerance Thermotolerance Under High Humidity and Is Transcriptionally Modulated by CaWRKY40." Front Plant Sci 9: 1802.
Ashraf, M. F., et al. (2018). "Capsicum annuum HsfB2a Positively Regulates the Thermo tolerance and Ralstonia Response to Ralstonia solanacearum Infection Pepper HsfB2a solanacearum or High Temperature and High Humidity Forming Transcriptional Cascade with resistance CaWRKY6 and CaWRKY40." Plant Cell Physiol 59(12): 2608-2623.
Tanpure, R. S., et al. (2017). "Improved tolerance against Helicoverpa armigera in transgenic tomato over-expressing Pepper CanPI7 Insect resistance multi-domain proteinase inhibitor gene from Capsicum annuum." Physiol Mol Biol Plants 23(3): 597-604.
Qin, L., et al. (2017). "CaRDR1, an Resistance to RNA-Dependent RNA Polymerase Plays a Pepper CaRDR1 TMV Positive Role in Pepper Resistance against TMV." Front Plant Sci 8: 1068.
Cheng, W., et al. (2017). "A novel Ralstonia leucine-rich repeat protein, CaLRR51, acts as Pepper CaLRR51 solanacearum a positive regulator in the response of pepper resistance to Ralstonia solanacearum infection."
Mol Plant Pathol 18(8): 1089-1100.
Shen, L., et al. (2016). "Pepper CabZIP63 acts as a positive regulator during Ralstonia High temperature solanacearum or high temperature-high Pepper CabZIP63 tolerance humidity challenge in a positive feedback loop with CaWRKY40." J Exp Bot 67(8):
2439-2451.
Cai, H., et al. (2015). "CaWRKY6 transcriptionally activates CaWRKY40, Ralstonia Pepper CaWRKY6 solanacearum regulates Ralstonia solanacearum resistance, and confers high-temperature and resistance high-humidity tolerance in pepper." J Exp Bot 66(11): 3163-3174.
Kim, E. Y., et al. (2014). "Overexpression of Drought and salt CaDSR6 increases tolerance to drought and Pepper CaDSR6 tolerance salt stresses in transgenic Arabidopsis plants."
Gene 552(1): 146-154.
Dang, F., et al. (2014). "Overexpression of CaWRKY27, a subgroup IIe WRKY
Ralstonia transcription factor of Capsicum annuum, Pepper CaWRKY27 solanacearum resistance positively regulates tobacco resistance to Ralstonia solanacearum infection." Physiol Plant 150(3): 397-411.

Lee, S. C., et al. (2008). "Involvement of the pepper antimicrobial protein CaAMP1 gene in Pepper CaAMP1 Fungus resistance broad spectrum disease resistance." Plant Physiol 148(2): 1004-1020.
An, S. H., et al. (2008). "Pepper pectin methylesterase inhibitor protein CaPMEI1 is Pepper CaPMEI1 Fungus resistance required for antifungal activity, basal disease resistance and abiotic stress tolerance." Planta 228(1): 61-78.
VvChi5, Zheng, T., et al. (2020). "Chitinase family VvChi17, genes in grape differentially expressed in a Fungus resistance, Grape VvChi22, fruit storage manner specific to fruit species in response to VvChi26VvC Botrytis cinerea." Mol Biol Rep 47(10):
hi31 7349-7363.
Fan, R., et al. (2021). "Characterization of Albizia diacylglycerol acyltransferase 2 from Idesia julibris IpDGAT2 Lipid content polycarpa and function analysis." Chem Phys sin Lipids 234: 105023.
Ye, Q., et al. (2020). "VvBAP1, a Grape C2 Thermo stress Domain Protein, Plays a Positive Regulatory Grape VvBAP1 tolerance Role Under Heat Stress." Front Plant Sci 11:
544374.
Yang, Z., et al. (2020). "Overexpression of beta-Ketoacyl-CoA Synthase From Vitis Grape VvKCS Salt tolerance vinifera L. Improves Salt Tolerance in Arabidopsis thaliana." Front Plant Sci 11:
564385.
Moriyama, A., et al. (2020). "Crosstalk To reduce the Pathway between Trehalose Metabolism and number of flower Grape VvCKX5 buds per Cytokinin Degradation for the Determination of the Number of Berries per Bunch in inflorescence Grapes." Cells 9(11).
Lim, S. D., et al. (2020). "Plant tissue succulence engineering improves water-use Grape VvCEBlopt Drought tolerance efficiency, water-deficit stress attenuation and salinity tolerance in Arabidopsis." Plant J
103(3): 1049-1072.
Dong, T., et al. (2020). "The Effect of Botrytis cinerea Ethylene on the Color Change and Resistance Grape VvERF1 resistance to Botrytis cinerea Infection in 'Kyoho' Grape Fruits." Foods 9(7).
Cai, Y., et al. (2020). "Expression of Sucrose Grape VvSUC11,Vv To enhance drought Transporters from Vitis vinifera Confer High SUC27 resistance Yield and Enhances Drought Resistance in Arabidopsis." Int J Mol Sci 21(7).
Zhu, D., et al. (2019). "VvWRKY30, a grape improve salt stress WRKY transcription factor, plays a positive Grape VvWRKY30 tolerance regulatory role under salinity stress." Plant Sci 280: 132-142.

Zhang, Z., et al. (2019). "VvSWEET10 increase sugar Grape VvSWEET10 Mediates Sugar Accumulation in Grapes."
accumulation Genes (Basel) 10(4).
Yu, Y. H., et al. (2019). "Grape (Vitis enhance powdery vinifera) VvD0F3 functions as a transcription Grape VvD0F3 activator and enhances powdery mildew mildew resistance resistance." Plant Physiol Biochem 143:
183-189.
Closely relates to Yu, Y., et al. (2019) "Functional sa-mediated Characterization of Resistance to Powdery Grape VvTIFY9 powdery mildew Mildew of VvTIFY9 from Vitis vinifera." Int resistance in grapes J Mol Sci 20(17).
Yu, Y., et al. (2019). "The grapevine Positively regulates defensive response R2R3-type MYB transcription factor VdMYB1 positively regulates defense Grape VdMYB1 and increases resveratrol content responses by activating the stilbene synthase gene 2 (VdSTS2) " BMC Plant Biol 19(1) in leaves 478.
Sun, X., et al. (2019). "The ethylene response factor VaERF092 from Amur grape regulates VaERF092 improve cold Grape the transcription factor VaWRKY33, VaWRKY33 tolerance improving cold tolerance." Plant J 99(5):
988-1002.
enhance ethylene Liu, M., et al. (2019). "Expression of stilbene compounds synthase VqSTS6 from wild Chinese Vitis Grape VqSTS6 accumulation and quinquangularis in grapevine enhances improve disease resveratrol production and powdery mildew resistance resistance." Planta 250(6): 1997-2007.
To increase Zhu, Y., et al. (2018). "Molecular Cloning anthocyanin and Functional Characterization of a Grape VbDFR
production in Dihydroflavonol 4-Reductase from Vitis flowers bellula." Molecules 23(4).
To show larger Lim, S. D., et al. (2018). "A Vitis vinifera cells, organ size basic helix-loop-helix transcription factor Grape VvCEBlopt and vegetative enhances plant cell size, vegetative biomass biomass and reproductive yield." Plant Biotechnol J.
Hou, H., et al. (2018). "Overexpression of a To improve SBP-Box Gene (VpSBP16) from Chinese Grape VpSBP16 tolerance to salt and Wild Vitis Species in Arabidopsis Improves drought stress Salinity and Drought Stress Tolerance." Int J
Mol Sci 19(4).
Wen, Z., et al. (2017). "Constitutive heterologous overexpression of a Resistance to strong TIR-NB-ARC-LRR gene encoding a putative pathogenic bacteria disease resistance protein from wild Chinese Grape VpTNL1 pseudomonas Vitis pseudoreticulata in Arabidopsis and syringae tobacco enhances resistance to phytopathogenic fungi and bacteria." Plant Physiol Biochem 112: 346-361.

Wang, L., et al. (2017). "RING-H2-type E3 gene VpRH2 from Vitis pseudoreticulata Resistance to Grape VpRH2 powdery mildew improves resistance to powdery mildew by interacting with VpGRP2A." J Exp Bot 68(7):
1669-1687.
Sun, T., et al. (2017). "VvVHP1; 2 Is To improve Transcriptionally Activated by VvMYBA1 Grape VvVHP1;2 anthocyaninaccumu and Promotes Anthocyanin Accumulation of lation Grape Berry Skins via Glucose Signal." Front Plant Sci 8: 1811.
Be able to have quick response to Jiao, L., et al. (2017). "Overexpression of a biotic and abiotic stress-responsive U-box protein gene VaPUB
stress and affects the accumulation of resistance related Grape VaPUB
obviously affect proteins in Vitis vinifera 'Thompson accumulation of Seedless'." Plant Physiol Biochem 112:
disease resistance 53-63.
related proteins Huang, W., et al. (2017). "Functional Characterization of a Novel R2R3-MYB
To increase Epime EsMYB9 anthocyanin and Transcription Factor Modulating the chumFlavonoid Biosynthetic Pathway from flavonol content Epimedium sagittatum." Front Plant Sci 8:
1274.
To play an Cai, Y., et al. (2017). "Overexpression of a important role in biotic and abiotic Grapevine Sucrose Transporter (VvSUC27) in Grape VvSUC27 Tobacco Improves Plant Growth Rate in the stress response, Presence of Sucrose In vitro." Front Plant Sci especially in the 8: 1069.
presence of sucrose To promote plant growth, reduce Xie, X. and Y. Wang (2016). "VqDUF642, a botrytis cinerea gene isolated from the Chinese grape Vitis sensibility and Grape VqDUF642 enhance resistance quinquangularis, is involved in berry development and pathogen resistance." Planta to erysipelas and 244(5): 1075-1094.
Metarhizium anisopliae To make stress Dubrovina, A. S., et al (2015). "VaCPK20, a response in calcium-dependent protein kinase gene of non-stress Grape VaCPK20 conditions, wild grapevine Vitis amurensis Rupr., mediates cold and drought stress tolerance." J
post-freezing and Plant Physiol 185: 1-12.
drought stress Aleynova, 0. A., et al. (2015). "Regulation of Positively regulates resveratrol production in Vitis amurensis cell VaCPK29 factors take part in Grape cultures by calcium-dependent protein VaCPK20 the biosynthesis of resveratrol kinases." Appl Biochem Biotechnol 175(3):
1460-1476.

The overexpression Nicolas, P., et al. (2014). The basic leucine strongly enhances the accumulation of zipper transcription factor ABSCISIC ACID
RESPONSE ELEMENT-BINDING
diphenylethene Grape VvABF2 FACTOR2 is an important transcriptional (resveratrol) which regulator of abscisic acid-dependent grape is beneficial to berry ripening processes." Plant Physiol plant defense and 164(1): 365-383.
human healthy To obtain adaptability, Fujimori, N., et al. (2014). "Plant tolerance and DNA DNA-damage repair/toleration 100 protein Grape VvDRT100-L
repairation to repairs UV-B-induced DNA damage." DNA
ultraviolet light Repair (Amst) 21: 171-176.
stress Marchive, C., et al. (2013). "Over-expression To enhance of VvWRKY1 in grapevines induces Grape VvWRKY1 resistance to downy expression of j asmonic acid pathway-related mildew in grapes genes and confers higher tolerance to the downy mildew." PLoS One 8(1): e54185.
To hasten growth Kohno, M., et al. (2012).
speed, including "Auxin-nonresponsive grape Aux/IAA19 is a Grape VvIAA19 root elongation and positive regulator of plant growth." Mol Biol flower transformation Rep 39(2): 911-917.
Kobayashi, M., et al. (2012).
Tolerance to cold, "Characterization of grape C-repeat-binding VvCBF2 Grape drought and salt factor 2 and B-box-type zinc finger protein in VvZFPL
stress transgenic Arabidopsis plants under stress conditions." Mol Biol Rep 39(8): 7933-7939.
Deluc, L., et al. (2008) "The transcription Anthocyanin and factor VvMYB5b contributes to the regulation procyani dine Grape VvMYB5b of anthocyanin and proanthocyanidin derivate biosynthesis in developing grape berries."
accumulation Plant Physiol 147(4): 2041-2053.
Mzid, R., et al. (2007). "Overexpression of Resistance to VvWRKY2 in tobacco enhances broad Grape VvWRKY2 fungal pathogens resistance to necrotrophic fungal pathogens."
Physiol Plant 131(3): 434-447.
Marchive, C., et al. (2007). "Isolation and characterization of a Vitis vinifera Resistance to transcription factor, VvWRKY1, and its Grape VvWRKY1 fungal pathogens effect on responses to fungal pathogens in transgenic tobacco plants." J Exp Bot 58(8):
1999-2010.

To increase the Deluc, L., etal. (2006). "Characterization of a biosynthesis of grapevine R2R3-MYB transcription factor Grape VvMYB5a condensed tannins that regulates the phenylpropanoid pathway."
and change xylogen Plant Physiol 140(2): 499-511.
metabolism Qiu, Z., et al. (2019). "The eggplant Ralstonia transcription factor myb44 enhances Eggpla SmMYB44 solanacearum resistance to bacterial wilt by activating the nt resistance expression of spermidine synthase".
Journal of Experimental Botany(19), 19.
Zhang, Y., et al. (2014). "Anthocyanin accumulation and molecular analysis of Eggpla Anthocyanin anthocyanin biosynthesis-associated genes in SmMYB1 nt accumulation eggplant (Solanum melongena L.)." Journal of Agricultural & Food Chemistry 62(13):
2906.
Zhou, L., et al. (2019). "CBFs Function in Eggpla SmCBFs Anthocyanin Anthocyanin Biosynthesis by Interacting with nt SmMYB113 accumulation MYB113 in Eggplant (Solanum melongena L.)." Plant and Cell Physiology(2): 2.
Bracuto, V., et al. (2017). "Functional characterization of the powdery mildew Eggpla Powdery mildew SmML01 susceptibility gene SmML01 in eggplant nt susceptibility genes (Solanum melongena L.)." Transgenic Research 26(3): 1-8.
Chines Ding, Q., etal. (2018). "Ectopic expression of To regulate organ a Brassica rapa AINTEGUMENTA gene BrANT-1 size of Chinese (BrANT-1) increases organ size and stomatal cabbag cabbage density in Arabidopsis." Sci Rep 8(1):
10528.8(1):10528-.
Wang, N., et al. (2020). "Defect in Brnyml, a Chines To keep green magnesium-dechelatase protein, causes a Brnyml stay-green phenotype in an EMS-mutagenized cabbag phenotype of leaves Chinese cabbage (Brassica campestris L. ssp.
pekinensis) line." Hortic Res 7(1): 8.
Chines Wang, B., et al. (2010). "Ectopic expression To regulate organ of a Chinese cabbage BrARGOS gene in BrARGOS size of Chinese cabbag Arabidopsis increases organ size." Transgenic cabbage Res 19(3): 461-472.
Chines Peng, S., etal. (2019). "Mutation of ACX1, a Relates to petal Jasmonic Acid Biosynthetic Enzyme, Leads Bra040093 development in to Petal Degeneration in Chinese Cabbage cabbag Chinese cabbage (Brassica campestris ssp. pekinensis)." Int J
Mol Sci 20(9).
Chines Wang, Y., et al. (2014). "BrpSPL9 (Brassica Early-maturing rapa ssp. pekinensis SPL9) controls the BrpSPL9-2 cabbag improvement earliness of heading time in Chinese cabbage." Plant Biotechnol J 12(3): 312-321.

Kim, H. S., et al. (2014). "Overexpression of Chines the Brassica rapa transcription factor Resistance to carrot WRKY12 results in reduced soft rot BrWRKY12 cabbag bacterial blight symptoms caused by Pectobacterium carotovorum in Arabidopsis and Chinese cabbage." Plant Biol (Stuttg) 16(5): 973-981.
Fan, L., et al. (2020). "A genome-wide Anthocyanin association study uncovers a critical role of Radish RsPAP2 accumulation the RsPAP2 gene in red-skinned Raphanus sativus L." Hortic Res 7: 164.
Wang, Y., et al. (2020). "Genome-Wide Identification and Functional Characterization RsCPA31 Radish Salt stress tolerance of the Cation Proton Antiporter (CPA) Family (RsNHX1) Related to Salt Stress Response in Radish (Raphanus sativus L.)." Int J Mol Sci 21(21).
Wang, Y., et al. (2020). "Characterization of Radish RsOFP2.3 To regulate the OFP Gene Family and its Putative tuberous root shape Involvement of Tuberous Root Shape in Radish." Int j Mol Sci 21(4).
Huang, J., et al. (2020). "CaASR1 promotes salicylic acid- but represses jasmonic Ralstonia acid-dependent signaling to enhance the Pepper CaASR1 solanacearum resistance of Capsicum annuum to bacterial resistance wilt by modulating CabZIP63." J Exp Bot 71(20): 6538-6554.
Ali, M., et al. (2020). "The CaChiVI2 Gene of Capsicum annuum L. Confers Resistance Thermo and Pepper CaChiVI2 Against Heat Stress and Infection of drought tolerance Phytophthora capsici." Front Plant Sci 11:
219.
Zhang, H., et al. (2020). "Molecular and Functional Characterization of CaNAC035, Tolerance to abiotic Pepper CaNAC035 an NAC Transcription Factor From Pepper stresses (Capsicum annuum L.)." Front Plant Sci 11:
14.
Table E lists the representative functional genes in soybean. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in soybean breeding program.
Table E: Important functional genes in soybean Gene Gene number Application Reference name Ma, X., et al. (2021). "Functional characterization of soybean (Glycine max) GmDIR27 Glyma.05g213400 Resistance toD RIGENT genes reveals an important role of pod cracking GmDIR27 in the regulation of pod dehiscence." Genomics 113(1 Pt 2): 979-990 Zhao, Y., et al. (2020). "Genome-Wide Analysis of the Glucose-6-Phosphate GmG6PD Dehydrogenase Family in Soybean and Glyma.19G082300 Salt tolerance H2 Functional Identification of GmG6PDH2 Involvement in Salt Stress." Front Plant Sci 11:214.
Zhang, G., et al. (2020). "Phospholipase D-and phosphatidic acid-mediated phospholipid GmPLDal Root nodule Glyma.01G215100 development interaction and signaling modulate symbiotic phal and nodulation in soybean (Glycine max)." Plant J.
Wei, Z., et al. (2020). "GmGPA3 is involved in Growth post-Golgi trafficking of storage proteins and GmGPA3 Glyma.20G32900 development cell growth in soybean cotyledons." Plant Sci 294: 110423.
Wang, W., et al. (2020). "GmNMHC5, A
GmNMHC Glyma.13G255200 Development Neoteric Positive Transcription Factor of stage Flowering and Maturity in Soybean." Plants (Basel) 9(6).
Wang, L., et al. (2020). "Natural variation and CRISPR/Cas9-mediated mutation in Development GmPRR37 Glyma.12G073900 GmPRR37 affect photoperiodic flowering and stage contribute to regional adaptation of soybean."
Plant Biotechnol J 18(9): 1869-1881.
Shi, Y., et al. (2020). "RNA
Sequencing-Associated Study Identifies Glyma.11G150400. Root nodule GmDRR1 GmDRR1 as Positively Regulating the 1 development Establishment of Symbiosis in Soybean." Mol Plant Microbe Interact 33(6): 798-807.
Jahan, M. A., et al. (2020). "Glyceollin Resistance to GmMYB2 Transcription Factor GmMYB29A2 Regulates Glyma.02G005600 phytophthora Soybean Resistance to Phytophthora sojae."
sojae Plant Physiol 183(2): 530-546.
He, Y., et al. (2020). "Functional activation of GmMYB6 Glyma.04G042300. Salt alkali a novel R2R3-MYB protein gene, GmMYB68, 8 1 tolerance confers salt-alkali resistance in soybean (Glycine max L.)." Genome 63(1): 13-26.
Zhang, W., et al. (2019). "A cation diffusion facilitator, GmCDF1, negatively regulates salt GmCDF1 Glyma.08G102000 Salt tolerance tolerance in soybean." PLoS Genet 15(1) e1007798.
Zhang, C., et al. (2019). "GmBTB/POZ, a Resistance to novel BTB/POZ domain-containing nuclear GmBTB /
Glyma.04G244900 phytophthora protein, positively regulates the response of POZ
sojae soybean to Phytophthora sojae infection." Mol Plant Pathol 20(1): 78-91.

Wang, L., etal. (2019). "GmSnRK1.1, a Resistance to Sucrose Non-fermenting-1(SNF1)-Related GmSnRK1 Glyma.08G240300 phytophthora Protein Kinase, Promotes Soybean Resistance .1 soj ae to Phytophthora sojae." Front Plant Sci 10:
996.
Li, S., et al. (2019). "A
GmSIN1/GmNCED3s/GmRbohBs Glyma.12G221500. Feed-Forward Loop Acts as a Signal Amplifier GmSIN1 Salt tolerance 1 That Regulates Root Growth in Soybean Exposed to Salt Stress." Plant Cell 31(9):
2107-2130.
GmHsp90 Thermo Huang, Y., et al. (2019). "GmHsp90A2 is Glyma.16G178800 involved in soybean heat stress as a positive A2 tolerance regulator." Plant Sci 285: 26-33.
Chen, X., etal. (2019). "Overexpression of a Resistance to soybean 4-coumaric acid: coenzyme A ligase GmPI4L NM.001256363.1 phytophthora (GmPI4L) enhances resistance to Phytophthora soj ae sojae in soybean." Funct Plant Biol 46(4):
304-313.
Chen, L., et al. (2019). "A nodule-localized Root nodule phosphate transporter GmPT7 plays an GmPT7 Glyma.14G188000 development; important role in enhancing symbiotic N2 increase yield fixation and yield in soybean." New Phytol 221(4): 2013-2025.
Xu, S., et al. (2021). "GmbZIP1 negatively Root nodule regulates ABA-induced inhibition of GmbZIP1 Glyma.02G131700 development nodulation by targeting GmENOD40-1 in soybean." BMC Plant Biol 21(1): 35.
Lyu, X., et al. (2021). "GmCRYls modulate GmCRY1 Tolerance to gibberellin metabolism to regulate soybean Glyma.06G103200 close planting shade avoidance in response to reduced blue light." Mol Plant 14(2): 298-314.
Li, M., et al. (2021). "GmNAC06, a NAC
GmNACO domain transcription factor enhances salt stress Glyma.06g21020.1 Salt tolerance tolerance in soybean." Plant Mol Biol 105(3):
333-345.
Salt and Yang, Y., et al. (2020). "The Soybean bZIP
GmbZIP2 Glyma.14G002300 drought Transcription Factor Gene GmbZIP2 Confers tolerance Drought and Salt Resistances in Transgenic Plants." Int .1- Mol Sci 21(2).
Yang, C., et al. (2020). "GmNAC8 acts as a Glyma.16G151500. Drought GmNAC8 1 tolerance positive regulator in soybean drought stress."
Plant Sci 293: 110442.
Wang, Y., et al. (2020). "GmPAP12 Is Root nodule Required for Nodule Development and GmPAP12 Glyma.06G028200 Nitrogen Fixation Under Phosphorus development Starvation in Soybean." Front Plant Sci 11:
450.

Ma, X. J., et al. (2020). "GmNFYA13 Salt and GmNFYA Glyma.13G202300 drought Improves Salt and Drought Tolerance in Transgenic Soybean Plants." Front Plant Sci tolerance 11: 587244.
Liu, S., et al. (2020). "Overexpression of GmAAP6a enhances tolerance to low nitrogen Tolerance to and improves seed nitrogen status by GmAAP6a Glyma.17g192000 nitrogen optimizing amino acid partitioning in deficiency soybean." Plant Biotechnol J 18(8):
1749-1762.
Li, C., et al. (2020). "A
To regulate Glyma.12G073900.
Domestication-Associated Gene GmPRR3b GmPRR3b development Regulates the Circadian Clock and Flowering stage Time in Soybean." Mol Plant 13(5): 745-759.
Chen, L., et al. (2020). "Overexpression of Tolerance to GmMYB14 improves high-density yield and GmMYB1 Glyma.15G259400 close planting drought tolerance of soybean through and drought regulating plant architecture mediated by the brassinosteroid pathway." Plant Biotechnol J.
Chen, L., et al. (2020). "Soybean AP1 To increase GmAP1 Glyma.16G091300 homologs control flowering time and plant yield height." J Integr Plant Biol 62(12): 1868-1879.
Chen, K., et al. (2020). "Overexpression of Drought GmUBC9 Gene Enhances Plant Drought GmUBC9 Glyma.03G199900 tolerance; late Resistance and Affects Flowering Time via maturing Histone H2B Monoubiquitination." Front Plant Sci 11 555794.
Zhang, D., et al. (2019). "Artificial selection GmOLE0 High seed oil on GmOLE01 contributes to the increase in Glyma.20G196600 1 content .. seed oil during soybean domestication." PLoS
Genet 15(7): e1008267.
Xun, H., et al. (2019). "Over-expression of Resistance to GmKR3, a TIR-NBS-LRR type R gene, GmKR3 Glyma.06G267300 viral diseases confers resistance to multiple viruses in soybean." Plant Mol Biol 99(1-2): 95-111.
Wang, Y., et al. (2019). "GmYUC2a mediates GmYUC2 Root nodule auxin biosynthesis during root development Glyma.08G038600 a development and nodulation in soybean." J Exp Bot 70(12):
3165-3176.
Indrasumunar, A., et al. (2011). "Nodulation GmNFRla Root nodule factor receptor kinase lalpha controls nodule Glyma.02G270800 1pha development organ number in soybean (Glycine max L.
Merr)." Plant J 65(1): 39-50.
Zhu, B., et al. (2006). "Identification and characterization of a novel heat shock Glyma.16G091800. Thermo GmHsfAl 1 tolerance transcription factor gene, GmHsfAl, in soybeans (Glycine max)." J Plant Res 119(3):
247-256.

To enhance resistance to Wu, D., et al. (2020). "Identification of a phytophthora candidate gene associated with isoflavone GmMPK1 Glyma.08G309500 sojae; to content in soybean seeds using genome-wide increase association and linkage mapping."
Plant J
isoflavone 104(4): 950-963.
content Resistance to Cheng, Q., et al. (2015). "Overexpression of phytophthora Soybean Isoflavone Reductase (GmIFR) GmIFR NM 001254100 sojae in Enhances Resistance to Phytophthora sojae in soybean Soybean." Front Plant Sci 6: 1024.
Zhou, Z., et al. (2015). "Overexpression of a Resistance to GmCnx1 gene enhanced activity of nitrate GmCnx1 NM 001255600 mosaic virus reductase and aldehyde oxidase, and boosted SMV
mosaic virus resistance in soybean." PLoS One 10(4): e0124273.
Resistance to Jiang, L., et al. (2015). "Isolation and phytophthora Characterization of a Novel sojae No.1 Pathogenesis-Related Protein Gene (GmPRP) GmPRP KM506762 physiological with Induced Expression in Soybean (Glycine race in max) during Infection with Phytophthora soybean sojae."
PLoS One 10(6): e0129932.
Resistance to Cheng, Q., et al. (2015). "Overexpression of phytophthora Soybean Isoflavone Reductase (GmIFR) GmIFR NM 001254100, sojae in Enhances Resistance to Phytophthora sojae in soybean Soybean." Front Plant Sci 6: 1024.
Hao, Q., et al. (2016). "Identification and Comparative Analysis of CBS
Nitrogen use Domain-Containing Proteins in Soybean GmCBS21 Glyma.06G032200 efficiency (Glycine max) and the Primary Function of GmCBS21 in Enhanced Tolerance to Low Nitrogen Stress." Int J Mol Sci 17(5).
Lu, X., et al. (2016). "The transcriptomic Seed weight and seed oil GA200X, G1yma07g08950, signature of developing soybean seeds reveals NFYA Glyma02g47380 the genetic basis of seed trait adaptation during content domestication." Plant J 86(6): 530-544.
Li, N., et al. (2017). "A Novel Soybean Resistance to Dirigent Gene GmDIR22 Contributes to GmDIR22 HQ 993047 phytophthora Promotion of Lignan Biosynthesis and sojae in Enhances Resistance to Phytophthora sojae."
soybean Front Plant Sci 8: 1185.
To increase Li, Q. T., et al. (2017). "Selection for a seed oil Zinc-Finger Protein Contributes to Seed Oil GmZF351 Glyma06g44440 content in Increase during Soybean Domestication." Plant soybean Physiol 173(4): 2208-2224.

Xu, Z., et al. (2017). "The Soybean Basic Helix-Loop-Helix Transcription Factor Resistance to ORG3-Like Enhances Cadmium Tolerance via GmORG3 Glyma03g28630 chromium Increased Iron and Reduced Cadmium Uptake stress and Transport from Roots to Shoots." Front Plant Sci 8: 1098.
To promote Zhang, C., et al. (2017). "Functional analysis GmESR1 JN590243.1 seed of the GmESR1 gene associated with soybean germination regeneration." PLoS One 12(4): e0175656.
To promote plant Zeng, X., et al. (2018). "Soybean MADS-box maturation for gene GmAGL1 promotes flowering via the GmAGL1 AW433203 early photoperiod pathway." BMC Genomics 19(1):
flowering and 51.
early maturing Zhou, L., et al. (2014). "Constitutive GmPIP1;6 Gm08g01860.1 Salt tolerance overexpression of soybean plasma membrane intrinsic protein GmPIP1;6 confers salt tolerance." BMC Plant Biol 14: 181.
Zhou, L., et al. (2014). "Overexpression of GmAKT2 potassium channel enhances GmAKT2 Glym08g20030.1 SMV tolerance resistance to soybean mosaic virus." BMC
Plant Biol 14: 154.
Table F lists the representative functional genes in corn. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in corn breeding program.
Table F: Important functional genes in corn Gene name Application Reference Cai, G., et al. (2014). "A maize mitogen-activated protein Drought and salt kinase kinase, ZmMKK1, positively regulated the salt and ZmMKK1 tolerance drought tolerance in transgenic Arabidopsis." J
Plant Physiol 171(12): 1003-1016.
To increase de Castro, M., et al. (2014). "Early cell-wall modifications of ZmCesA7 cellulose content in maize cell cultures during habituation to dichlobenil." J Plant cells Physiol 171(2): 127-135.
To increase de Castro, M., et al. (2014). "Early cell-wall modifications of ZmCesA8 cellulose content in maize cell cultures during habituation to dichlobenil " J Plant cells Physiol 171(2): 127-135.
To increase grain Guo, M., et al. (2014). "Maize ARGOS1 (ZAR1) transgenic ZmARGOS1 yield and improve alleles increase hybrid maize yield." J Exp Bot 65(1):
drought tolerance 249-260.
Li, C., et al. (2014). "Ectopic expression of a maize hybrid To control corn leaf down-regulated gene ZmARF25 decreases organ size by ZmARF25 size affecting cellular proliferation in Arabidopsis."
PLoS One 9(4): e94830.

Liu, Y., et al. (2014). "Group 5 LEA protein, ZmLEA5C, enhance tolerance to osmotic and low temperature stresses in ZmLEA5C Stress resistance transgenic tobacco and yeast." Plant Physiol Biochem 84:
22-31.
Suzuki, M., et al. (2014). "Distinct functions of COAR and B3 domains of maize VP1 in induction of ectopic gene ZmVP1 Seed development expression and plant developmental phenotypes in Arabidopsis." Plant Mol Biol 85(1-2): 179-191.
Wang, B., et al. (2014). "Maize ZmRACK1 is involved in the ZmRACK1 Disease resistance plant response to fungal phytopathogens." Int J
Mol Sci 15(6): 9343-9359.
Wu, L., et al. (2014). "Overexpression of the maize GRF10, To affect leaf size an endogenous truncated growth-regulating factor protein, ZmGRF 10 and plant height leads to reduction in leaf size and plant height." J Integr Plant Biol 56(11): 1053-1063.
Zm Zanin, L., et al. (2014). "Isolation and functional urea-proton To increase urea characterization of a high affinity urea transporter from roots symporter uptake of Zea mays." BMC Plant Biol 14: 222.

To participate in signal transduction Zhang, D., et al. (2014). "The overexpression of a maize pathway of salt mitogen-activated protein kinase gene (ZmMPK5) confers ZmMPK5 stress, oxidative salt stress tolerance and induces defence responses in stress and pathogen tobacco." Plant Biol (Stuttg) 16(3): 558-570.
defense Zhao, S., et al. (2014). "ZmS0C1, a MADS-box transcription ZmS0C1 Early flowering factor from Zea mays, promotes flowering in Arabidopsis."
Int J Mol Sci 15(11): 19987-20003.
Zhao, Y., et al. (2014). "A novel maize homeodomain-leucine Drought and salt zipper (HD-Zip) I gene, Zmhdz10, positively regulates Zmhdz10 tolerance drought and salt tolerance in both rice and Arabidopsis."
Plant Cell Physiol 55(6): 1142-1156.
Gao, Y., et al. (2015). "A maize phytochrome-interacting Drought and salt ZmPIF3 factor 3 improves drought and salt stress tolerance in rice."
tolerance Plant Mol Biol 87(4-5): 413-428.
Huo, Y., et al. (2015). "Overexpression of the Maize psbA
Gene Enhances Drought Tolerance Through Regulating ZmpsbA Drought tolerance Antioxidant System, Photosynthetic Capability, and Stress Defense Gene Expression in Tobacco." Front Plant Sci 6:
1223.
Li, S., et al. (2015). "Overexpression of ZmIRT1 and ZmIRT1 Iron uptake ZmZIP3 Enhances Iron and Zinc Accumulation in Transgenic Arabidopsis." PLoS One 10(8): e0136647.
Li, S., et al. (2015). "Overexpression of ZmIRT1 and ZmZIP3 Zinc uptake ZmZIP3 Enhances Iron and Zinc Accumulation in Transgenic Arabidopsis." PLoS One 10(8): e0136647.
Liu, Y., et al. (2015). "Characterization and functional Drought and salt ZmBDF analysis of a B3 domain factor from Zea mays." J
App! Genet tolerance 56(4): 427-438.

Shi, J., et al. (2015). "Overexpression of ARGOS Genes ZmARGOS8 Drought tolerance, Modifies Plant Sensitivity to Ethylene, Leading to Improved yield increase Drought Tolerance in Both Arabidopsis and Maize."
Plant Physiol 169(1): 266-282.
Weckwerth, P., et al. (2015). "ZmCPK1, a calcium-independent kinase member of the Zea mays CDPK
ZmCPK1 Cold stress gene family, functions as a negative regulator in cold stress signalling." Plant Cell Environ 38(3): 544-558.
Wu, L., et al (2015). "Overexpression of ZmMAPK1 Drought tolerance ZmMAPK1 enhances drought and heat stress in transgenic Arabidopsis and thermos stress thaliana." Plant Mol Biol 88(4-5): 429-443.
To promote plant flowering, stem Xu, M., et al. (2015). "ZmGRF, a GA regulatory factor from ZmGRF elongation and cell maize, promotes flowering and plant growth in Arabidopsis."
expansion, GA Plant Mol Biol 87(1-2): 157-167.
singal Yan, J., et al. (2015). "Calcium and ZmCCaMK are involved ZmCCaMK Antioxidant defense in brassinosteroid-induced antioxidant defense in maize leaves." Plant Cell Physiol 56(5) 883-896.
Drought tolerance Zhou, X., et al. (2015). "A maize jasmonate Zim-domain ZmJAZ14 and growth protein, ZmJAZ14, associates with the JA, ABA, and GA
promotion signaling pathways in transgenic Arabidopsis."
PLoS One regulation 10(3): e0121824.
Alter, P., et al. (2016). "Flowering Time-Regulated Genes in ZmMADS1 Early flowering Maize Include the Transcription Factor ZmMADS1." Plant Physiol 172(1): 389-404.
To adjust contents of stearic acid, oil acid and long chain Du, H., et al. (2016). "Modification of the fatty acid ZmSAD1 saturated acid and composition in Arabidopsis and maize seeds using a the proportion of stearoyl-acyl carrier protein desaturase-1 (ZmSAD1) gene."
saturated fatty acid BMC Plant Biol 16(1): 137.
and unsaturated fatty acid Gu, L., et al. (2016). "ZmGOLS2, a target of transcription ZmGOLS2 Stress resistance factor ZmDREB2A, offers similar protection against abiotic stress as ZmDREB2A." Plant Mol Biol 90(1-2): 157-170.
He, L., et al. (2016). "Maize OXIDATIVE STRESS2 Homologs Enhance Cadmium Tolerance in Arabidopsis ZmOXS2b Stress resistance through Activation of a Putative SAM-Dependent Methyltransferase Gene." Plant Physiol 171(3): 1675-1685.
He, L., et al. (2016). "Maize OXIDATIVE STRESS2 Homologs Enhance Cadmium Tolerance in Arabidopsis ZmO2L1 Stress resistance through Activation of a Putative SAM-Dependent Methyltransferase Gene." Plant Physiol 171(3): 1675-1685.
Huang, H., et al. (2016). "Sucrose and ABA regulate starch ZmEREB156 Starch synthesis biosynthesis in maize through a novel transcription factor, ZmEREB156." Sci Rep 6: 27590.
To stimulate Li, S., et al. (2016). "Constitutive expression of the ZmZIP7 ZmZIP7 endogenous iron and in Arabidopsis alters metal homeostasis and increases Fe and zinc uptake Zn content." Plant Physiol Biochem 106: 1-10.

To enhance Liu, Y., et al. (2016). "Group 3 LEA Protein, ZmLEA3, Is ZmLEA3 tolerance to cold Involved in Protection from Low Temperature Stress." Front stress Plant Sci 7: 1011.
To improve Lowe, K., et al. (2016). "Morphogenic Regulators Baby Baby boom transformation boom and Wuschel Improve Monocot Transformation." Plant (BBM) efficiency Cell 28(9): 1998-2015.
To improve Lowe, K., et al. (2016). "Morphogenic Regulators Baby Wuschel2 transformation boom and Wuschel Improve Monocot Transformation." Plant efficiency Cell 28(9): 1998-2015.
Ma, F., et al. (2016). "ZmABA2, an interacting protein of Drought and salt ZmABA2 ZmMPK5, is involved in abscisic acid biosynthesis and tolerance functions." Plant Biotechnol J 14(2): 771-782.
Mao, H., et al. (2016). "ZmNAC55, a maize stress-responsive ZmNAC55 Drought tolerance NAC transcription factor, confers drought resistance in transgenic Arabidopsis." Plant Physiol Biochem 105: 55-66.
Sun, X., et al. (2016). "Maize ZmVPP5 is a truncated To enhance salt ZmVPP5 Vacuole H(+) -PPase that confers hypersensitivity to salt sensitivity stress." J Integr Plant Biol 58(6): 518-528.
Active GTP
Wang, Q., et al. (2016). "A maize ADP-ribosylation factor combination, ZmArf2 ZmArf2 increases organ and seed size by promoting cell endosperm development expansion in Arabidopsis." Physiol Plant 156(1):
97-107.
Wang, X., et al. (2016). "Isolation and functional Cold stress characterization of a cold responsive phosphatidylinositol Zm SEC14p resistance transfer-associated protein, ZmSEC14p, from maize (Zea may L.)." Plant Cell Rep 35(8): 1671-1686.
Zhang, F., et al. (2016). "Characterization of the calcineurin B-Like (CBL) gene family in maize and functional analysis ZmCBL9 Stress resistance of ZmCBL9 under abscisic acid and abiotic stress treatments." Plant Sci 253: 118-129.
Brugiere, N., et al. (2017). "Overexpression of RING Domain ZmXericol Drought tolerance E3 Ligase ZmXericol Confers Drought Tolerance through Regulation of ABA Homeostasis." Plant Physiol 175(3):
1350-1369.
Brugiere, N., et al. (2017). "Overexpression of RING Domain ZmXerico2 Drought tolerance E3 Ligase ZmXericol Confers Drought Tolerance through Regulation of ABA Homeostasis." Plant Physiol 175(3):
1350-1369.
Cai, H., et al. (2017). "A novel GRAS transcription factor, ZmGRAS20 Starch synthesis ZmGRAS20, regulates starch biosynthesis in rice endosperm." Physiol Mol Biol Plants 23(1): 143-154.
Cai, R., et al. (2017). "The maize WRKY transcription factor ZmWRKY17 Salt stress response ZmWRKY17 negatively regulates salt stress tolerance in transgenic Arabidopsis plants." Planta 246(6): 1215-1231.
Cao, H., et al. (2017). "Overexpression of the Maize m Z NLP6 and ZmNLP8 Can Complement the Arabidopsis ZmNLP6 Nitrogen utilization Nitrate Regulatory Mutant n1p7 by Restoring Nitrate Signaling and Assimilation." Front Plant Sci 8: 1703.

Cao, H., et al. (2017). "Overexpression of the Maize ZmNLP6 and ZmNLP8 Can Complement the Arabidopsis ZmNLP8 Nitrogen utilization Nitrate Regulatory Mutant n1p7 by Restoring Nitrate Signaling and Assimilation." Front Plant Sci 8: 1703.
Dong, Z., et al. (2017). "Ideal crop plant architecture is To improve plant mediated by tassels replace upper earsl, a BTB/POZ ankyrin morphology repeat gene directly targeted by TEOSINTE BRANCHED1."
Proc Natl Acad Sci U S A 114(41) E8656-E8664 To regulate Du, Y., et al. (2017). "UNBRANCHED3 regulates branching UNBRANCH vegetative and by modulating cytokinin biosynthesis and signaling in maize ED3 /UB3 reproductive and rice." New Phytol 214(2): 721-733.
branching Hong, C., et al. (2017). "The role of ZmWRKY4 in ZmWRKY4 Oxidation resistance regulating maize antioxidant defense under cadmium stress."
Biochem Biophys Res Commun 482(4): 1504-1510.
Li, H., et al. (2017). "The maize CorA/MRS2/MGT-type Mg To enhance ZmMGT10 tolerance to Mg transporter, ZmMGT10, responses to magnesium deficiency and confers low magnesium tolerance in transgenic deficiency in corn Arabidopsis." Plant Mol Biol 95(3): 269-278 Li, T., et al. (2017). "Regulation of Seed Vigor by To increase seed ZmGOLS2 Manipulation of Raffinose Family Oligosaccharides in Maize vigor and Arabidopsis thaliana." Mol Plant 10(12): 1540-1555.
Li, T., et al. (2017). "Regulation of Seed Vigor by To reduce seed ZmRS
Manipulation of Raffinose Family Oligosaccharides in Maize vigor and Arabidopsis thaliana." Mol Plant 10(12): 1540-1555.
Liu, J., et al. (2017). "The Conserved and Unique Genetic To increase grain ZmINCW1 Architecture of Kernel Size and Weight in Maize and Rice."
size/weight Plant Physiol 175(2): 774-785.
To enhance Liu, Y., et al. (2017). "Functional characterization of KS-type ZmDHN13 tolerance to dehydrin ZmDHN13 and its related conserved domains under oxidative stress oxidative stress." Sci Rep 7(1): 7361.
Shi, Q., et al. (2017). "Functional Characterization of the To respond to ZmPIF4 Maize Phytochrome-Interacting Factors PIF4 and PIF5."
phytochrome singals Front Plant Sci 8:2273.
Shi, Q., et al. (2017). "Functional Characterization of the To respond to ZmPIF5 Maize Phytochrome-Interacting Factors PIF4 and PIF5."
phytochrome singals Front Plant Sci 8:2273.
Wang, C., et al. (2017). "ABP9, a maize bZIP transcription ABP9 Stress resistance factor, enhances tolerance to salt and drought in transgenic cotton." Planta 246(3): 453-469.
Wang, J., et al. (2017). "Overexpression of the protein Low phosphate phosphatase 2A regulatory subunit a gene ZmPP2AA1 ZmPP2AA1 response improves low phosphate tolerance by remodeling the root system architecture of maize." PLoS One 12(4): e0176538.
Xiao, Q., et al. (2017). "ZmMYB14 is an important transcription factor involved in the regulation of the activity ZmMYB14 Starch synthesis of the ZmBT1 promoter in starch biosynthesis in maize."
FEBS J 284(18): 3079-3099.
Zandvakili, N., et al. (2017). "Cloning, Overexpression and Resistance to plant ZmPR10 in vitro Antifungal Activity of Zea Mays PR10 Protein." Iran pathogenic fungi J Biotechnol 15(1): 42-49.

Zhu, L., et al. (2020). Overexpression of SFA1 in engineered S ccharomyces cerevisiae to increase xylose utilization and SFA1 Cellulose hydrolysis ethanol production from different lignocellulose hydrolysates. Bioresour Technol 313, 123724.
Wang, H.,et al. (2021). The maize SUMO conjugating ZmSCElb Paraquat resistance enzyme ZmSCElb protects plants from paraquat toxicity.
Ecotoxicol Environ Saf 211, 111909.
Fu, J., et al. (2021). Maize transcription factor ZmEREB20 ZmEREB20 Salt stress resistance enhanced salt tolerance in transgenic Arabidopsis. Plant Physiol Biochem 159, 257-267.
Zhu, D., et al. (2020). MAPK-like protein 1 positively ZmMPKL1 Drought tolerance regulates maize seedling drought sensitivity by suppressing ABA biosynthesis. Plant J 102, 747-760.
Zhong, Y., et al. (2020). ZmCCD10a Encodes a Distinct Type ZmCCD10a Phosphate stress of Carotenoid Cleavage Dioxygenase and Enhances Plant Tolerance to Low Phosphate. Plant Physiol 184, 374-392.
Zhang, X., Guo, W., Du, D., Pu, L., and Zhang, C. (2020).
Overexpression of a maize BR transcription factor ZmBZR1 ZmBZR1 Organ development .
in Arabidopsis enlarges organ and seed size of the transgenic plants. Plant Sci 292, 110378.
Zhang, L., et al. (2020). Overexpression of the maize ZmTMT Quality gamma-tocopherol methyltransferase gene (ZmTMT) improvement increases alpha-tocopherol content in transgenic Arabidopsis and maize seeds. Transgenic Res 29, 95-104.
Zhang, H., et al. (2020). Enhanced Vitamin C Production Mediated by an ABA-Induced PTP-like Nucleotidase ZmPTPN Drought tolerance Improves Plant Drought Tolerance in Arabidopsis and Maize.
Mol Plant 13, 760-776.
Zhai, K., et al. (2020). Overexpression of Maize ZmMYB59 Gene Plays a Negative Regulatory Role in Seed Germination ZmMYB59 Seed germination . . .
in Nicotiana tabacum and Oryza sativa. Front Plant Sci 11, 564665.
Resistance to Zang, Z., et al. (2020). A Novel ERF
Transcription Factor, ZmERF105 exserohilum ZmERF105, Positively Regulates Maize Resistance to turcicum Exserohilum turcicum. Front Plant Sci 11, 850.

Yang, Z., et al. (2020). The transcription factor ZmNAC126 To accelerate accelerates leaf senescence downstream of the ethylene ZmNAC126 maturation signalling pathway in maize. Plant Cell Environ 43, 2287-2300.
Yang, Y.Z., et al. (2020). EMP32 is required for the Seed development cis-splicing of nad7 intron 2 and seed development in maize.
RNA Biol, 1-11.
Phosphate Xu, Y., et al. (2020). Overexpression of a phosphate transportation to transporter gene ZmPt9 from maize influences growth of ZmPt9 promote crop transgenic Arabidopsis thaliana. Biochem Biophys Res growth Commun.
Xiang, Y.,et al. (2020). ZmNAC49 reduces stomatal density ZmNAC49 Drought tolerance to improve drought tolerance in maize. J Exp Bot.
Wang, X., et al. (2020). The Transcription Factor NIGT1.2 To maintain Modulates Both Phosphate Uptake and Nitrate Influx during NIGT1.2 nitrogen and Phosphate Starvation in Arabidopsis and Maize. Plant Cell phosphorus balance 32, 3519-3534.
Wang, C., et al.(2020). Functional characterization of a chloroplast-localized Mn(2+)(Ca(2+))/H(+) antiporter, ZmmCCHAl Photosynthesis ZmmCCHAl from Zea mays ssp. mexicana L. Plant Physiol Biochem 155, 396-405.
ZmBES1/BZ Grain development, Sun, F., et al. (2020). Maize transcription factor R1-5 yield increase ZmBES1/BZR1-5 positively regulates kernel size. J Exp Bot.
Simmons, C.R., et al. (2020). Maize BIG GRAIN' homolog ZM-BG1H1 Yield increase overexpression increases maize grain yield. Plant Biotechnol J 18, 2304-2315.
Shi, Y., et al. (2020). ZmCCAla on Chromosome 10 of Photoperiod ZmCCAla Maize Delays Flowering of Arabidopsis thaliana. Front Plant regulation Sci 11, 78.
Qin, X., et al. (2020). Q(Dtbn1), an F-box gene affecting To control tassel Dtbnl maize tassel branch number by a dominant model.
Plant branch number Biotechnol J.
Liu Y. et al. (2020). Involvement of a truncated MADS-box To regulate lateral ' ZmTMM1 transcription factor ZmTMM1 in root nitrate foraging. J Exp root development Bot 71, 4547-4561.

Liu, M* , et al. (2020). Analysis of the genetic architecture of To increase branch Zm-miR164e maize kernel size traits by combined linkage and association number mapping. Plant Biotechnol J 18, 207-221.
Li, T., et al. (2020). Raffinose synthase enhances drought tolerance through raffinose synthesis or galactinol hydrolysis ZmRAFS Drought tolerance in maize and Arabidopsis plants. J Biol Chem 295, 8064-8077.
Li, Q., et al. (2020). CRISPR/Cas9-mediated knockout and To drawf plant ZmPHYC1 height and spike overexpression studies reveal a role of maize phytochrome C
ZmPHYC2 in regulating flowering time and plant height.
Plant height Biotechnol J 18, 2520-2532.
Kong, J., et al. (2020). Overexpression of the Transcription To increase Factor GROWTH-REGULATING FACTORS Improves GRF5 transformation Transformation of Dicot and Monocot Species. Front Plant efficiency Sci 11, 572319.
Jia, H., et al. (2020). A serine/threonine protein kinase KNR6 Yield increase encoding gene KERNEL NUMBER PER ROW6 regulates maize grain yield. Nat Commun 11, 988.
He, C., et al. (2020). Overexpression of an Antisense RNA of To regulate plant Maize Receptor-Like Kinase Gene ZmRLK7 Enlarges the ZmRLK7 structure and organ Organ and Seed Size of Transgenic Arabidopsis Plants. Front size Plant Sci 11, 579120.
Han, Q., et al. (2020). ZmDREB1A Regulates RAFFINOSE
SYNTHASE Controlling Raffinose Accumulation and Plant ZmDREB1A Cold tolerance Chilling Stress Tolerance in Maize. Plant Cell Physiol 61, 331-341.
To regulate corn Han, Q., et al. (2020). ZmDREB2A regulates ZmGH3.2 and seed longevity and ZmDREB2A ZmRAFS, shifting metabolism towards seed aging tolerance increase aging over seedling growth. Plant J 104, 268-282.
tolerance To regulate JA
Fu J. et al. (2020). ZmMYC2 exhibits diverse functions and mediated growth,ZmMYC2 enhances JA signaling in transgenic Arabidopsis.
Plant Cell development and defensive reaction Rep 39, 273-288.
Development Feng, C., et al. (2020). The deposition of CENH3 in maize is regulation stringently regulated. Plant J 102, 6-17.
To enhance tolerance to Du, H., et al. (2020). A Maize ZmAT6 Gene Confers aluminum toxicity ZmAT6 . Aluminum Tolerance via Reactive Oxygen Species in corn to scavenge Scavenging. Front Plant Sci 11, 1016.
active oxygen species Drought tolerance Ding, L., et al. (2020). Modification of the Expression of the PIP2;5 Aquaporin ZmPIP2;5 Affects Water Relations and Plant and yield increase Growth. Plant Physiol 182, 2154-2165.
Chen, L., et al. (2020). The retromer protein ZmVPS29 ZmVPS29 To promote grain regulates maize kernel morphology likely through an development auxin-dependent process(es). Plant Biotechnol J 18, 1004-1014.
Cao, L., et al. (2020). Systematic Analysis of the Maize OSCA Genes Revealing ZmOSCA Family Members Involved ZmOSCA Drought tolerance in Osmotic Stress and ZmOSCA2.4 Confers Enhanced Drought Tolerance in Transgenic Arabidopsis. Int .1- Mol Sci 21.
To participate in salt stress tolerance Bo, C., et al. (2020). Maize WRKY114 gene negatively ZmWRKY11 through regulates salt-stress tolerance in transgenic rice. Plant Cell ABA-mediated Rep 39, 135-148.
pathways Zhu, G., et al. (2019). ZmPGIP3 Gene Encodes a Polygalacturonase-Inhibiting Protein that Enhances ZmPGIP3 Disease resistance Resistance to Sheath Blight in Rice. Phytopathology 109, 1732-1740.
Zhao, Y., et al. (2019). A cytosolic NAD( )-dependent Tolerance to salt ZmGPDH1 GPDH from maize (ZmGPDH1) is involved in conferring salt and osmotic stress and osmotic stress tolerance. BMC Plant Biol 19, 16.

Zhang, X., et al. (2019). A maize stress-responsive Di19 To respond to salt ZmDi19-1 stress transcription factor, ZmDi19-1, confers enhanced tolerance to salt in transgenic Arabidopsis. Plant Cell Rep 38, 1563-1578.
Zhan, W., et al. (2019). An allele of ZmPORB2 encoding a To increase protochlorophyllide oxidoreductase promotes tocopherol ZmPORB2 tocopherol accumulation in both leaves and kernels of maize. Plant J
accumulation 100, 114-127.
To participate in Yu, T., et al. (2019). Overexpression of the maize circadian rhythm ZmVQ52 and photosynthetic transcription factor ZmVQ52 accelerates leaf senescence in Arabidopsis. PLoS One 14, e0221949.
pathway To increase APA Yu, T., et al. (2019). ZmAPRG, an uncharacterized gene, and Pi enhances acid phosphatase activity and Pi concentration in ZmAPRG
concentration in maize leaf during phosphate starvation. Theor Appl Genet corn leaves 132, 1035-1048.
Yu, F., et al. (2019). A group VII ethylene response factor Waterlogging ZmEREB180 tolerance gene, ZmEREB180, coordinates waterlogging tolerance in maize seedlings. Plant Biotechnol J 17, 2286-2298.
To improve growth and photosynthetic Wu, J., et al. (2019). Overexpression of zmm28 increases Zmm28 capacity of corn maize grain yield in the field. Proc Natl Acad Sci U S A 116, plants and nitrogen 23850-23858.
use efficiency To regulate starch Wu, J., et al. (2019). The DOF-Domain Transcription Factor ZmD0F36 synthesis in corn ZmD0F36 Positively Regulates Starch Synthesis in endosperm Transgenic Maize. Front Plant Sci 10, 465.
Wang, H., et al. (2019). The Maize Class-I SUMO
ZmSCEld Drought tolerance Conjugating Enzyme ZmSCEld Is Involved in Drought Stress Response. Int J Mol Sci 21.
Wang, H., et al. (2019). Overexpression of a maize SUMO
ZmSCEle Stress resistance conjugating enzyme gene (ZmSCEle) increases Sumoylation levels and enhances salt and drought tolerance in transgenic tobacco. Plant Sci 281, 113-121.
To regulate leaf Wang, C., et al. (2019). ZmGLR, a cell membrane localized ZmGLR morphogenesis in microtubule-associated protein, mediated leaf morphogenesis corn in maize. Plant Sci 289, 110248.

Vi' = = =' = T X T et al (2019).
Overexpression of the ZmDEF1 Resistance to weevil . ZmDEF1 gene increases the resistance to weevil larvae in transgenic larvae maize seeds. Mol Biol Rep 46, 2177-2185 Stephenson, E., et al. (2019). Over-expression of the Corn vegetative and photoperiod response regulator ZmCCT10 modifies plant ZmCCT10 reproductive architecture, flowering time and inflorescence morphology in development maize. PLoS One 14, e0203728.
Qin, Y.J., et al. (2019). ZmHAK5 and ZmHAK1 function in ZmHAK1 Stress resistance K(+) uptake and distribution in maize under low K(+) conditions. J Integr Plant Biol 61, 691-705.
To enhance K(+) Qin, Y.J., et al. (2019). ZmHAK5 and ZmHAK1 function in ZmHAK5 uptake activity and K(+) uptake and distribution in maize under low K(+) promote growth conditions. J Integr Plant Biol 61, 691-705.
Peng, X., et al. (2019). A maize NAC transcription factor, ZmNAC34 Starch synthesis ZmNAC34, negatively regulates starch synthesis in rice.
Plant Cell Rep 38, 1473-1484.
To increase Meng, C., et al. (2019). Overexpression of maize ZmMYB-IF3 .
resistance to cold increases chilling tolerance in Arabidopsis.
Plant Physiol and oxidative stress Biochem 135, 167-173.
Liu, W., et al. (2019). Function analysis of ZmNAC33, a ZmNAC33 Drought tolerance positive regulator in drought stress response in Arabidopsis.
Plant Physiol Biochem 145, 174-183.
Liu, F., et al. (2019). DNA Repair Gene ZmRAD51A
ZmRAD51A Disease resistance Improves Rice and Arabidopsis Resistance to Disease. Int J
Mol Sci 20.
Liang, Y., et al. (2019). ZmMADS69 functions as a flowering activator through the ZmRap2.7-ZCN8 regulatory module ZmMADS69 Early flowering and contributes to maize flowering time adaptation. New Phytol 221, 2335-2347.
Liang, Y., et al. (2019). ZmASR3 from the Maize ASR Gene ZmASR3 Drought tolerance Family Positively Regulates Drought Tolerance in Transgenic Arabidopsis. Int J Mol Sci 20.
Li, Z., et al. (2019). The bHLH family member ZmPTF1 regulates drought tolerance in maize by promoting root ZmPTF1 .. Drought tolerance development and abscisic acid synthesis. J Exp Bot 70, 5471-5486.

To play a role in absorption and Li, S., et al. (2019). Improving Zinc and Iron Accumulation ZmZIP5 rhizome in Maize Grains Using the Zinc and Iron Transporter transformation of ZmZIP5.
Plant Cell Physiol 60, 2077-2085.
zinc and iron ZmUBP15 To respond to Kong, J., et al. (2019). Maize factors ZmUBP15, ZmUBP16 ZmUBP16Z cadium stress and and ZmUBP19 play important roles for plants to tolerance the mUBP19 salt stress cadmium stress and salt stress. Plant Sci 280, 77-89.
ZmCtll To improve stalk Jiao, S., et al. (2019). Chitinase-likel Plays a Role in Stalk tensile strength Tensile Strength in Maize. Plant Physiol 181, 1127-1147.
He, Z.,et al. (2019). The Maize Clade A PP2C Phosphatases ZmPP2C-A Drought tolerance Play Critical Roles in Multiple Abiotic Stress Responses. Int J Mol Sci 20.
To suppress He, Y., et al. (2019). A maize polygalacturonase functions as ZmPGH1 programmed cell a suppressor of programmed cell death in plants. BMC Plant death Biol 19, 310.
He, L., et al. (2019). Novel Maize NAC Transcriptional Repressor ZmNAC071 Confers Enhanced Sensitivity to ABA
ZmNAC071 Stress response and Osmotic Stress by Downregulating Stress-Responsive Genes in Transgenic Arabidopsis. J Agric Food Chem 67, 8905-8918.
Giuliani, R., et al. (2019). Transgenic maize ZmPEPC To improve carbon phosphoenolpyruvate carboxylase alters leaf-atmosphere metabolism CO2 and (13)CO2 exchanges in Oryza sativa.
Photosynth Res 142, 153-167.
To promote callus Du, X., et al. (2019). Transcriptome Profiling Predicts New ZmBBM2 induction and Genes to Promote Maize Callus Formation and transformation Transformation. Front Plant Sci 10, 1633.
Dong, Q.,et al. (2019). Overexpression of ZmbZIP22 gene To regulate starch ZmbZIP22 alters endosperm starch content and composition in maize synthesis and rice. Plant Sci 283, 407-415.
Dong, Q. et al. (2019). Functional analysis of ZmMADSla Positively regulates ZmMAD Sla reveals its role in regulating starch biosynthesis in maize starch synthesis endosperm. Sci Rep 9, 3253.
Ding, S.,et al. (2019). Genome-Wide Analysis of TCP Family ZmTCP42 Drought tolerance Genes in Zea mays L. Identified a Role for ZmTCP42 in Drought Tolerance. Int J Mol Sci 20.

To obviously Chen, Q., et al. (2019). Overexpression of ATG8 in improve nitrogen Arabidopsis Stimulates Autophagic Activity and Increases remobilization Nitrogen Remobilization Efficiency and Grain Filling. Plant efficiency Cell Physiol 60, 343-352 Chen, J.,et al. (2019). Overexpression of SUM01 located To regulate floral predominately to euchromatin of dividing cells affects development reproductive development in maize. Plant Signal Behav 14, e1588664.
Bhatia, R.,et al. (2019). Modified expression of ZmMYB167 ZmMYB167 To increase biomass in Brachypodium distachyon and Zea mays leads to increased cell wall lignin and phenolic content. Sci Rep 9, 8800.
Zhu, Y.,et al. (2018). A transgene design for enhancing oil ZmLEC1 Fatty acid synthesis content in Arabidopsis and Camelina seeds.
Biotechnol Biofuels 11, 46.
Zhou, L., et al. (2018). Overexpression of a maize plasma Drought tolerance ZmPIP1; 1 membrane intrinsic protein ZmPIP1;1 confers drought and and salt stress salt tolerance in Arabidopsis. PLoS One 13, e0198639.
Yang, L., et al. (2018). Overexpression of the maize E3 ZmAIRP4 Drought tolerance ubiquitin ligase gene ZmAIRP4 enhances drought stress tolerance in Arabidopsis. Plant Physiol Biochem 123, 34-42.
Xu, Y., et al. (2018). Expression of a maize NBS gene ZmNBS42 Disease resistance ZmNBS42 enhances disease resistance in Arabidopsis.
Plant Cell Rep 37, 1523-1532.
Xu, Y., et al. (2018). The Maize NBS-LRR Gene ZmNBS25 ZmNBS25 Disease resistance Enhances Disease Resistance in Rice and Arabidopsis. Front Plant Sci 9, 1033.
To increase Xu, Y.,et al. (2018). The mycorrhiza-induced maize ZmPt9 axial root length and ZmPt9 gene affects root development and phosphate availability in promote lateral root nonmycorrhizal plant. Plant Signal Behav 13, e1542240.
formation To increase influx of sugar to organ Xie, G.,et al. (2018). Over-expression of mutated ZmDA1 or ZmDA1 pool from corn grain ZmDAR1 gene improves maize kernel yield by enhancing ZmDAR1 and enhance starch starch synthesis. Plant Biotechnol J 16, 234-244.
synthesis To increase Xiang, X., et al. (2018). Overexpression of serine SAT prolamine acetyltransferase in maize leaves increases seed-specific accumulation methionine-rich zeins. Plant Biotechnol J 16, 1057-1067.
Xia, Z.,et al. (2018). Overexpression of the Maize Sulfite Oxidase Increases Sulfate and GSH Levels and Enhances ZmS0 Drought tolerance Drought Tolerance in Transgenic Tobacco. Front Plant Sci 9, 298.

Wang, C.T.,et al. (2018). The Maize WRKY Transcription ZmWRKY40 Drought tolerance Factor ZmWRKY40 Confers Drought Resistance in Transgenic Arabidopsis. Int J Mol Sci 19.
To participate in ZmWRKY10 several stress Wang, C.T., et al. (2018). Maize WRKY Transcription Factor ZmWRKY106 Confers Drought and Heat Tolerance in 6 response pathways of abiotic resistance Transgenic Plants. Int J Mol Sci 19.
Wang, B.,et al. (2018). ZmNF-YB16 Overexpression To increase corn Improves Drought Resistance and Yield by Enhancing ZmNF-YB16 yield Photosynthesis and the Antioxidant Capacity of Maize Plants.
Front Plant Sci 9, 709.
To increase Sun, Q., et al. (2018). MicroRNA528 Affects Lodging ZmLAC3 lignin content in Resistance of Maize by Regulating Lignin Biosynthesis under corn stalk Nitrogen-Luxury Conditions. Mol Plant 11, 806-814.
To positively regulate plant Ma, H.,et al. (2018). ZmbZIP4 Contributes to Stress abiotic stress ZmbZIP4 Resistance in Maize by Regulating ABA Synthesis and Root response and Development. Plant Physiol 178, 753-770.
participate in corn root development Liu, W.,et al. (2018). Over-Expression of a Maize ZmNAGK Drought tolerance N-Acetylglutamate Kinase Gene (ZmNAGK) Improves Drought Tolerance in Tobacco. Front Plant Sci 9, 1902.
Form well-developed root Li, Z., et al. (2018). Enhancing auxin accumulation in maize system to make ZmPINla root tips improves root growth and dwarfs plant height. Plant seminal root longer Biotechnol J 16, 86-99.
and lateral root denser Li, Y.J.,et al. (2018). The maize secondary metabolism To increase abiotic glycosyltransferase UFGT2 modifies flavonols and UFGT2 stress tolerance of contributes to plant acclimation to abiotic stresses. Ann Bot plants 122, 1203-1217.
To enhance resistance to salt Li, X.,et al. (2018). Maize similar to RCD1 gene induced by ZmSRO lb stress, cadmium salt enhances Arabidopsis thaliana abiotic stress resistance.
stress and oxidative Biochem Biophys Res Commun 503, 2625-2632.
stress Li, S.,et al. (2018). A DREB-Like Transcription Factor From Development ZmDREB4.1 Maize (Zea mays), ZmDREB4.1, Plays a Negative Role in regulation Plant Growth and Development. Front Plant Sci 9, 395.
To increase seed Li, N., et al. (2011). "Over-expression of AGPase genes Bt2 weight and starch enhances seed weight and starch content in transgenic Sh2 content maize." Planta 233(2): 241-250.
Le Gall, G., et al. (2003). "Characterization and content of LC Synthesis of flavonoid glycosides in genetically modified tomato Cl flavonoid (Lycopersicon esculentum) fruits." J Agric Food Chem 51(9):
2438-2446.

Ying, S., etal. (2012). "Cloning and characterization of a To increase stress maize bZIP transcription factor, ZmbZIP72, confers drought ZmbZIP72 resistance and salt tolerance in transgenic Arabidopsis."
Planta 235(2):
253-266.
Wang, M., et al. (2007). "Overexpression of a putative maize ZmCBL4 Salt tolerance calcineurin B-like protein in Arabidopsis confers salt tolerance." Plant Mol Biol 65(6): 733-746.
Zhao, J., etal. (2009). "Cloning and characterization of a To enhance salt ZmCIPK16 novel CBL-interacting protein kinase from maize."
Plant Mol tolerance Biol 69(6): 661-674.
Jiang, S., et al. (2013). "A maize calcium-dependent protein To enhance drought kinase gene, ZmCPK4, positively regulated abscisic acid ZmCPK4 tolerance signaling and enhanced drought stress tolerance in transgenic Arabidopsis." Plant Physiol Biochem 71: 112-120.
To enhance drought Qin, F., etal. (2004). "Cloning and functional analysis of a tolerance, salt novel DREB1/CBF transcription factor involved in ZmDREB1A
tolerance and cold cold-responsive gene expression in Zea mays L." Plant Cell tolerance Physiol 45(8): 1042-1052.
Fu, J. and Z. Ristic (2010). "Analysis of transgenic wheat To enhance thermo (Triticum aestivum L.) harboring a maize (Zea mays L.) gene ZmEF-Tul tolerance for plastid EF-Tu: segregation pattern, expression and effects of the transgene." Plant Mol Biol 73(3): 339-347.
ZmLEAFY
COTYLEDO
To increase seed oil Barthole, G., et al. (2012). "Controlling lipid accumulation in Ni content cereal grains." Plant Sci 185-186: 33-39 ZmWRINKL

Zou, H. W., et al. (2013). "Isolation and Functional Analysis ZmLTP3 Salt tolerance of ZmLTP3, a Homologue to Arabidopsis LTP3."
Int J Mol Sci 14(3): 5025-5035.
Kong, X., et al. (2011). "ZmMKK4, a novel group C
Salt and cold mitogen-activated protein kinase kinase in maize (Zea mays), ZmMKK4 tolerance confers salt and cold tolerance in transgenic Arabidopsis."
Plant Cell Environ 34(8): 1291-1303.
Wu, S., et al. (2007). "Cloning, characterization, and To promote root transformation of the phosphoethanolamine ZmPEAMT1 growth and enhance salt tolerance N-methyltransferase gene (ZmPEAMT1) in maize (Zea mays L.)." Mol Biotechnol 36(2): 102-112.
Zhai, S. M., et al. (2012). "Overexpression of the hosnhati dvl in ositol synthase gene from Zea mays in tobacco ZmPIS Drought tolerance -plants alters the membrane lipids composition and improves drought stress tolerance." Planta 235(1): 69-84 Hu, X., et al. (2010). "Enhanced tolerance to low temperature in tobacco by over-expression of a new maize protein ZmPP2C2 Cold tolerance phosphatase 2C, ZmPP2C2." J Plant Physiol 167(15):
1307-1315.
Liu, J., etal. (2013). "Overexpression of a maize E3 ubiquitin ligase gene enhances drought tolerance through regulating ZmRFP1 Drought tolerance stomatal aperture and antioxidant system in transgenic tobacco." Plant Physiol Biochem 73: 114-120.

Ying, S., etal. (2011). "Cloning and characterization of a maize SnRK2 protein kinase gene confers enhanced salt ZmSAPK8 Salt tolerance tolerance in transgenic Arabidopsis." Plant Cell Rep 30(9):
1683-1699.
Gu, L., et al. (2010). "Overexpression of maize ZmSIMK1 Salt tolerance mitogen-activated protein kinase gene, ZmSIMK1 in Arabidopsis increases tolerance to salt stress." Mol Biol Rep 37(8): 4067-4073 Shen, B., et al. (2010). "Expression of ZmLEC1 and ZmLEC1 To increase seed oil ZmWRI1 increases seed oil production in maize." Plant ZmWRI1 content Physiol 153(3): 980-987.
P uvreau, B., etal. (2011). "Duplicate maize Wrinkledl ZmWrinkled To increase seed oil 1 content transcription factors activate target genes involved in seed oil biosynthesis." Plant Physiol 156(2): 674-686.
Table G lists the representative functional genes in barley. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in barley breeding program.
Table G: Important functional genes in barley Gene Application Reference name HGGT Chen, J., et al. (2017). Overexpression of hvhggt enhances Grain size and (L00548 tocotrienol levels and antioxidant activity in barley. J. Agric.
weight 177) Food Chem..
Liu,Y.B., et al. (2018). Transient overexpression of hvserk2 HvSERK Resistance to improves barley resistance to powdery mildew. International 2 powdery mildew Journal of Molecular Sciences, 19(4), 1226.
Drought Feng, X., et al. (2020). Overexpression of hvaktl improves HvAKT1 barley drought tolerance by regulating root ion homeostasis tolerance and ros and no signaling. Journal of Experimental Botany.
HvADH-Kasbauer Christoph L,et al. (2017). Barley ADH-1 modulates 1 Disease susceptibility to Bgh and is involved in chitin-induced (L00548 resistance systemic resistance. Plant Physiology and Biochemistry.
236) Greenup, A. G.,et al. (2010). 0ddsoc2 is a MADS box floral To delay HvOS2 repressor that is down-regulated by vernalization in temperate blooming cereals. Plant physiology, 153(3), 1062-1073.
Mulki M A., Korff M V. (2015). Constans controls floral HvC01/ Vernalization repression by upregulating vernalization 2 (vrn-h2) in barley.
HvFT1 regulation Plant Physiology, 170(1), 325.
Drought Feng, X., et al. (2020). Hvakt2 and hvhakl confer drought Hvhakl tolerance in barley through enhanced leaf mesophyll h+
tolerance homoeostasis. Wiley-Blackwell Online Open, 18(8), 1683.
Xu, Z. S.,et al. (2009). Isolation and functional characterization of hvdrebl-a gene encoding a DREB1 Stress resistance dehydration-responsive element binding protein in hordeum vulgare. Journal of Plant Research, 122(1), 121-130.

Lim, W. L.,et al. (2019). Overexpression of hvcs1f6 in barley grain alters carbohydrate partitioning plus transfer tissue and Cs1F6 Yield increase endosperm development. Journal of Experimental Botany, 71(1).
HvPIP2;3 Lim, W. L., et al. (2019). Overexpression of hvcs1f6 in barley /HvPIP2;
grain alters carbohydrate partitioning plus transfer tissue and Salt tolerance 4/HvPIP2 endosperm development. Journal of Experimental Botany, ;1 71(1).
To increase zinc Hiroshi, Masuda.,et al. (2009). Overexpression of the Barley HvNAS1 and iron content Nicotianamine Synthase GeneHvNAS1Increases Iron and Zinc in grains Concentrations in Rice Grains., 2(4), 155-166.
Bayat F, et al. (2011). Overexpression of hvnhx2, a vacuolar na+/h+ antiporter gene from barley, improves salt tolerance in NHX2 Salt tolerance 'arabidopsis thaliana'. Australian Journal of Crop Science, 5(4), 428-432.
Daniel P Woods, et al. (2016). Evolution of vrn2/ghd7-like Vernalization genes in vernalization-mediated repression of grass flowering.
regulation Plant Physiology, 170 (4), 2124-2135.
Table H lists the representative functional genes in rice. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in rice breeding program.
Table H: Important functional genes in rice Gene name Application Reference Fan, T., et al. (2020). "A Rice Autophagy Gene OsATG8b Grain quality OsATG8b Is Involved in Nitrogen Remobilization and Control of Grain Quality." Front Plant Sci 11: 588.
Dong, N. Q., et al. (2020). "UDP-glucosyltransferase To increase grain size OsGsal and enhance abiotic regulates grain size and abiotic stress tolerance associated with metabolic flux redirection in rice."
stress tolerance Nat Commun 11(1): 2629.
Khew, C. Y., et al. (2015). "Brassinosteroid Grain filling and leaf insensitive 1-associated kinase 1 (OsI-BAK1) is OsI-BAK1 development associated with grain filling and leaf development in rice." J Plant Physiol 182: 23-32.
Suppression of phospholipase D genes improves OsCATA Grain development chalky grain production by high temperature during the grain-filling stage in rice Duan, P., et al. (2015). "Regulation of OsGRF4 by OsGRF4 Grain size and yield OsmiR396 controls grain size and yield in rice." Nat Plants 2: 15203.
Fang, N., et al. (2016). "SMALL GRAIN 11 Controls small grain Grain yield Grain Size, Grain Number and Grain Yield in Rice."

Rice (N Y) 9(1): 64.
Choi, J., et al. (2012). "Functional identification of OsHk6 Grain yield OsHk6 as a homotypic cytokinin receptor in rice with preferential affinity for iP." Plant Cell Physiol 53(7):

1334-1343.
Han, Y., et al. (2005). "Biochemical character of the Growth of axial root purified OsRAA1, a novel rice protein with OsRAA1 and lateral root GTP-binding activity, and its expression pattern in Oryza sativa." J Plant Physiol 162(9): 1057-1063.
Jong, I. C., et al. (2003). "Structure and expression of the rice class-I type histone deacetylase genes OsHDAC1 Plant architecture OsHDAC1-3: OsHDAC1 overexpression in transgenic plants leads to increased growth rate and altered architecture." Plant J 33(3): 531-541.
Lee, J., et al. (2020). "OsbHLH073 Negatively Regulates Internode Elongation and Plant Height by OsbHLH073 Plant architecture Modulating GA Homeostasis in Rice." Plants (Basel) 9(4).
Li, D., et al. (2009). "Engineering OsBAK1 gene as a OsBAK1 Plant architecture molecular tool to improve rice architecture for high yield." Plant Biotechnol J 7(8): 791-806.
Hakata, M., et al. (2012). "Overexpression of a rice Plant height and grain TIFY gene increases grain size through enhanced TIFYllb size accumulation of carbohydrates in the stem."
Biosci Biotechnol Biochem 76(11): 2129-2134.
Plant height and Huang, J. Y., et al. (2010). "[Over-expression of OsPSK3 OsPSK3 increases chlorophyll content of leaves in chlorophyll content rice]." Yi Chuan 32(12): 1281-1289.
Kurotani, K. I., et al. (2015). "Overexpression of a CYP94 family gene CYP94C2b increases internode CYP94 Plant height length and plant height in rice." Plant Signal Behav 10(7): e1046667.
Fu, F. F., et al. (2010). "Coexpression analysis identifies Rice Starch Regulatorl, a rice AP2/EREBP
OsRSR1 Seed quality and yield family transcription factor, as a novel rice starch biosynthesis regulator." Plant Physiol 154(2):
927-938.
Yamamoto, M. P.,et al. (2006)." Synergism between RPBF Dof and RISBZ1bZIP Activators in the RPBF Seed quality Regulation of Rice SeedExpression Genes. "Plant Physiol Hiroshi, Yasuda.,et al. (2009). "Overexpression of BiP
has Inhibitory Effects on theAccumulation of Seed PDI Seed storage proteins Storage Proteins in EndospermCells of Rice."Plant &
Cell Physiology, 50(8), 1532.
Hiroshi, Yasuda., et al. (2009). "Overexpression of BiP has Inhibitory Effects on the Accumulation of BiP Seed storage proteins Seed Storage Proteins in Endosperm Cells of Rice."
Plant & Cell Physiology, 50(8), 1532.
Ge, Z. L., et al. (2018)."Transcription factor To positively regulate WRKY22 promotes aluminum tolerance viaactivation OsWRKY22 tolerance to aluminum of OSFRDL4 expression and enhancement of citrate secretion in rice (oryza sativa) ". New Phytologist, 219.
To affect flowering Li, D., et al. (2009). "Functional characterization of OsDof12 under long day length rice OsDof12." Planta 229(6): 1159-1169.
conditions Kanda, Y., et al. (2019). "Broad-Spectrum Disease To enhance immune Resistance Conferred by the Overexpression of Rice response RLCK BSR1 Results from an Enhanced Immune Response to Multiple MAMPs." Int J Mol Sci 20(22).
Hu, F., et al. (2012). "Overexpression of OsTLP27 in To increase OsTLP27 rice improves chloroplast function and photochemical photosynthesis efficiency." Plant Sci 195: 125-134.
Huang, L., et al. (2007). "Down-regulation of a To enhance tolerance SILENT INFORMATION REGULATOR2-related OsSRT1 to oxidative histone deacetylase gene, OsSRT1, induces DNA
responsive stress fragmentation and cell death in rice." Plant Physiol 144(3): 1508-1519.
Zhang, G. H., et al. "LSCHL4 from Japonica Cultivar, LSCHL4 To increase yield Which Is Allelic to NAL1,Increases Yield of Indica Super Rice 93-11. 'Molecular Plant(8), 1350-1364.
Luo, B., et al. (2018). "Overexpression of a High-Affinity Nitrate Transporter OsNRT2.1 To increase yield and OsNRT2.1 Increases Yield and Manganese Accumulation in Rice weight UnderAlternating Wet and Dry Condition." Frontiers in Plant ence, 9, 1192.
Zhu, C., et al. (2020). "y-Aminobutyric Acid To maintain iron Suppresses Iron Transportation from Roots to Shoots GABA homeostasis in rice in Rice Seedlings by InducingAerenchyma seedlings Formation." International Journal of Molecular Sciences, 22(1), 220.
Zou, L. P., et al. (2011). "Leaf rolling controlled by Roc5 Leaf shape the homeodomain leucine zipper class IV gene Roc5 in rice." Plant Physiol 156(3): 1589-1602.
Yang, C., et al.(2013). "Overexpression of Leaf morphogenesis microRNA319 impacts leaf morphogenesis and leads OsPCF8 and cold tolerance to enhanced cold tolerance in rice (Oryza sativaL.)."
Plant Cell & Environment, 36(12).
Yang, C., et al. (2013). "Overexpression of Leaf morphogenesis microRNA319 impacts leaf morphogenesis and leads OsPCF5 and cold tolerance to enhanced cold tolerance in rice (Oryza sativaL.)".
Plant Cell & Environment, 36(12).
Yang, C., et al. (2013). "Overexpression of Osa-MIR31 Leaf morphogenesis microRNA319 impacts leaf morphogenesis and leads 9a and cold tolerance to enhanced cold tolerance in rice (Oryza sativaL.)."
Plant Cell & Environment, 36(12).
Zhao, X., et al. (2021). "OsNBL1, a Multi-Organelle Localized Protein, Plays Essential Roles in Rice OsClpP6 Leaf senescence Senescence, Disease Resistance, and Salt Tolerance."Rice, 14(1).
Leaf angle and seed Zhang, XQ., et al. (2015). Epigenetic mutation of size RAV6 affects leaf angle and seed size in rice.
PLANT

PHYSIOL, 2015,169(3), 2118-2128.
Zhao, J., et al. (2015). Functional inactivation of Chloroplast putative photosynthetic electron acceptor ferredoxin OsHDY1 development c2 (fdc2) induces delayed heading date and decreased photosynthetic rate in rice. Plos One, 10.
Youmei, Wang., et al. (2017). The 2'-o-methyladenosine nucleoside modification gene OsTRM13 Salt stress tolerance ostrm13 positively regulates salt stress tolerance in rice. Journal of Experimental Botany.
Chi, Zhang., et al. (2017). The rice high-affinity k+
OsHKT2;4 Salt balance transporter OsHKT2;4 mediates Mg2+
homeostasis under high-Mg2+ conditions in transgenic arabidopsis. Frontiers in Plant Science, 8.
Han, R., et al. (2020). "Enhancing xanthine To delay leaf dehydrogenase activity is an effective way to delay OsXDH senescence and leaf senescence and increase rice yield." Rice (NY) increase rice yield 13(1): 16.
Kang, K., et al. (2009). "Senescence-induced To delay leaf serotonin biosynthesis and its role in delaying TDC
senescence senescence in rice leaves." Plant Physiol 150(3):

Kong, Z., et al. (2006). "A novel nuclear-localized To delay leaf CCCH-type zinc finger protein, OsDOS, is involved OsDOS
senescence in delaying leaf senescence in rice." Plant Physiol 141(4): 1376-1388.
Ko, S. S., et al. (2017). "Tightly Controlled bHLH142 Male sterility Expression of bHLH142 Is Essential for Timely Tapetal Programmed Cell Death and Pollen Development in Rice." Front Plant Sci 8: 1258.
Lee, S., et al. (2010). "Zinc deficiency-inducible Zinc uptake and OsZIP8 OsZIP8 encodes a plasma membrane-localized zinc distribution transporter in rice." Mol Cells 29(6): 551-558.
Lee, S., et al. (2010). "OsZIP5 is a plasma membrane OsZIP5 Zinc distribution zinc transporter in rice." Plant Mol Biol 73(4-5):
507-517.
Ishimaru, Y., et al. (2007). "Overexpression of the OsZIP4 zinc transporter confers disarrangement of OsZIP4 Zinc distribution zinc distribution in rice plants." J Exp Bot 58(11):
2909-2915.
Ikeda, K., et al. (2007). "Rice ABERRANT PANICLE
AP01 Spikelet number ORGANIZATION 1, encoding an F-box protein, regulates meristem fate." Plant J 51(6): 1030-1040.
Feng, C., et al. (2016). "The Resistance to bacterial polygalacturonase-inhibiting protein 4 (OsPGIP4), a OsPGIP4 potential component of the qB1sr5a locus, confers leaf streak in rice resistance to bacterial leaf streak in rice." Planta 243(5): 1297-1308.
Ch eung, M. Y., et al. (2008). "Constitutive expression Resistance to bacterial OsGAP1 of a rice GTPase-activating protein induces defense pathogen responses." New Phytol 179(2): 530-545.

Khanday, I., et al. (2019). "A male-expressed rice Vegetative embryogenic trigger redirected for asexual propagation propagation through seeds." Nature 565(7737): 91-95.
Tiwari, M., et al. (2020). "Functional characterization Resistance to sheath of tau class glutathione-S-transferase in rice to OsGSTU5 blight disease provide tolerance against sheath blight disease." 3 Biotech 10(3): 84.
Chen, X. J., et al. (2016). "Overexpression of Resistance to sheath 0 sPGIP1 OsPGIP1 Enhances Rice Resistance to Sheath Blight."
blight disease Plant Dis 100(2): 388-395.
Swain, D. M., et al. (2019). "Concurrent RGG1 and overexpression of rice G-protein beta and gamma Sheath blight disease subunits provide enhanced tolerance to sheath blight disease and abiotic stress in rice." Planta 250(5):
1505-1520.
Pooja, S., et al. (2015). "Homotypic clustering of OsMYB4 binding site motifs in promoters of the rice OsMYB4 Sheath blight disease genome and cellular-level implications on sheath blight disease resistance." Gene 561(2): 209-218.
Yue, W., et al. (2017). Osnlal, a ring-type ubiquitin To maintain phosphate ligase, maintains phosphate homeostasis in oryza OsNLA1 homeostasis sativa via degradation of phosphate transporters. The Plant Journal, 90(6), 1040.
Lee, S., et al. (2009). "Disruption of OsYSL15 leads OsYSL15 Iron uptake to iron inefficiency in rice plants." Plant Physiol 150(2): 786-800.
Chang.,et al. (2018). OsYSL13 is involved in iron OsYSL13 Iron distribution distribution in rice. International Journal of Molecular Sciences.
Lee, S. and G. An (2009). "Over-expression of OsIRT1 leads to increased iron and zinc OsIRT1 Iron and zinc uptake accumulations in rice." Plant Cell Environ 32(4) 408-416.
Zhang, Y., et al.(2012). Vacuolar membrane Iron and zinc transporters osvitl and osvit2 modulate iron OsVIT2 translocation between flag leaves and seeds in rice.
translocation Plant Journal for Cell & Molecular Biology, 72(3), 400-410.
Zhang, Y., et al.(2012). Vacuolar membrane Iron and zinc transporters osvitl and osvit2 modulate iron OsVIT1 translocation between flag leaves and seeds in rice.
translocation Plant Journal for Cell & Molecular Biology, 72(3), 400-410.
Ishimaru, Y., et al. (2010). "Rice metal-nicotianamine Iron and manganese transporter, OsYSL2, is required for the long-distance OsYSL2 uptake transport of iron and manganese." Plant J 62(3):
379-390.
Zhao, N., et al.(2020). Over-expression of HDA710 To regulate leaf delays leaf senescence in rice (oryza sativa 1.).
OsGSTU12 senescence Frontiers in Bioengineering and Biotechnology, 8, 471.

Zhao, N., et al.(2020). Over-expression of HDA10 To regulate leaf delays leaf senescence in rice (oryza sativa 1.).

senescence Frontiers in Bioengineering and Biotechnology, 8, 471.
Qi, W., et al. (2017). Constitutive expression of osdof4, encoding a c2-c2 zinc finger transcription To regulate flowering OsDof4 factor, confesses its distinct flowering effects under period long- and short-day photoperiods in rice (oryza sativa 1.). BMC Plant Biology, 17.
Lichao Zhang., et al.(2016). The wheat MYB-related To regulate flowering transcription factor TaMYB72 promotes flowering in time rice. Journal of Integrative Plant Biology, 08(v.58), 7-10.
Lichao Zhang., et al.(2016). The wheat MYB-related To regulate flowering transcription factor TaMYB72 promotes flowering in Hd3a time rice. Journal of Integrative Plant Biology, 08(v.58), 7-10.
Yu, Y., et al. (2017). Laccase-13 regulates seed To regulate seed setting rate by affecting hydrogen peroxide dynamics OsLAC13 setting rate and mitochondrial integrity in rice.
Frontiers in Plant Science, 8.
Zheng, S., et al. (2019). Pnas plus: osago2 controls ros production and the initiation of tapetal pcd by To regulate OsHXKl epigenetically regulating oshxkl expression in rice anther development anthers. Proceedings of the National Academy of Sciences of the United States of America, 116(15).
Zheng, S., et al. (2019). Pnas plus: osago2 controls ros production and the initiation of tapetal pcd by To regulate OsAGO2 epigenetically regulating oshxkl expression in rice anther development anthers. Proceedings of the National Academy of Sciences of the United States of America, 116(15).
Yoshida, A.,et al (2013). TAWAWAl, a regulator of rice inflorescence architecture, functions through To regulate TAWAWA1 the suppression of meristem phase transition.
growth development Proceedings of the National Academy of Sciences, 110(2), 767-772.
C, Yong., et al. (2010). Overexpression of an f-box To regulate root protein gene reduces abiotic stress tolerance and growth promotes root growth in rice. Molecular Plant, 4(1), 190-197.
Tong, A., et al. (2017). "Altered accumulation of osa-miR171 osa-miR171b contributes to rice stripe virus infection Stripe virus by regulating disease symptoms." J Exp Bot 68(15):
4357-4367.
To generate somatic Hu, H., et al. (2005). "Rice SERK1 gene positively embryogenesis and regulates somatic embryogenesis of cultured cell and OsSERK1 enhance rice blast host defense response against fungal infection." Planta resistance 222(1): 107-117.
To improve crop yield Wang, W., et al. (2018). "Expression of the Nitrate OsNRT1.1A and shorten crop Transporter Gene OsNRT1.1A/OsNPF6.3 Confers maturation High Yield and Early Maturation in Rice."
Plant Cell 30(3): 638-651.
Jia, H., et al. (2011). "The phosphate transporter gene To improve inorganic OsPT8 OsPht1;8 is involved in phosphate homeostasis in phosphate uptake rice." Plant Physiol 156(3): 1164-1175.
Cao, Y., et al. (2008). "Overexpression of a rice To enhance disease defense-related F-box protein gene OsDRF1 in resistance (mosaic OsDRF1 tobacco improves disease resistance through virus and potentiation of defense gene expression." Physiol pseudomonas) Plant 134(3): 440-452.
To increase Li, C., et al. (2011). "A rice plastidial nucleotide sugar photosynthetic epimerase is involved in galactolipid biosynthesis and efficiency and crop improves photosynthetic efficiency." PLoS
Genet yield 7(7): e1002196.
Kim, S. G., et al. (2010). "Overexpression of rice To improve tolerance isoflavone reductase-like gene (OsIRL) confers OsIRL
to peroxides tolerance to reactive oxygen species." Physiol Plant 138(1): 1-9.
"Overexpression of the 16-kDa a-amylase/trypsin To increase yield and RAG2 inhibitor RAG2 improves grain yield and quality of quality rice"
Li, G., et al. (2018). "Overexpression of a rice BAHD
To enhance acyltransferase gene in switchgrass (Panicum OsAT10 saccharification .. virgatum L.) enhances saccharification." BMC
Biotechnol 18(1): 54.
Sun, Y., et al. (2015). "The OsSec18 complex To increase rice plant interacts with PO(P1-P2)2 to regulate vacuolar OsSec18 height and thousand morphology in rice endosperm cell." BMC Plant Biol kernel weight 15: 55.
Chen, X., et al. (2019). "Amino acid substitutions in a To enhance sheath polygalacturonase inhibiting protein (OsPGIP2) OsPGIP2 blight resistance in increases sheath blight resistance in rice." Rice (N Y) rice

12(1): 56.
Wang, H., et al. (2015). "Rice WRKY4 acts as a Sheath blight transcriptional activator mediating defense responses OsWRKY4 resistance in rice toward Rhizoctonia solani, the causing agent of rice sheath blight." Plant Mol Biol 89(1-2): 157-171.
Takahashi, A., et al. (2007). "Rice Ptila negatively Ptila Rice resistance regulates RAR1-dependent defense responses." Plant Cell 19(9): 2940-2951.
Shi, L., et al. (2019). "OsCDC48/48E complex is OsCDC48 Rice resistance required for plant survival in rice (Oryza sativa L.)."
Plant Mol Biol 100(1-2): 163-179.
Wang, S., et al. (2015) "Rice OsFLS2-Mediated Bacteria resistance in Perception of Bacterial Flagellins Is Evaded by OsFLS2 rice Xanthomonas oryzae pvs. oryzae and oryzicola."
Mol Plant 8(7): 1024-1037.
Drought tolerant and Fang, Y., et al. (2015). "A stress-responsive NAC
SNAC3 heat resistant gene in transcription factor SNAC3 confers heat and drought rice tolerance through modulation of reactive oxygen species in rice." J Exp Bot 66(21): 6803-6817.
Wang, S., et al. (2019). "Rice Homeobox Protein Lodging resistance KNAT7 Integrates the Pathways Regulating Cell and yield of rice Expansion and Wall Stiffness." Plant Physiol 181(2):
669-682.
Du, D., et al. (2020). "The CC-NB-LRR OsRLR1 OsRLRl&O Disease resistance in mediates rice disease resistance through interaction sWRKY19 rice with OsWRKY19." Plant Biotechnol J.
Prasad, B. D., et al. (2009). "Overexpression of rice Disease resistance and (Oryza sativa L.) OsCDR1 leads to constitutive OsCDR1 defensive mechanism activation of defense responses in rice and of rice Arabidopsis." Mol Plant Microbe Interact 22(12):
1635-1644.
Wang, H., et al. (2016). "A Signaling Cascade from Virus resistance in OsRDR1 miR444 to RDR1 in Rice Antiviral RNA
Silencing rice Pathway." Plant Physiol 170(4): 2365-2377.
Qiu, D., et al. (2007). "OsWRKY13 mediates rice Disease resistance in disease resistance by regulating defense-related genes OsWRKY13 rice in salicylate- and jasmonate-dependent signaling."
Mol Plant Microbe Interact 20(5): 492-499.
Rice grain-filling and Wang, E., et al. (2008). "Control of rice grain-filling GIF1 yield and yield by a gene with a potential signature of domestication." Nat Genet 40(11): 1370-1374.
Wang, J., et al. (2019) "The Amino Acid Permease 5 Rice tiller number and OsAAP5 (OsAAP5) Regulates Tiller Number and Grain Yield yield in Rice." Plant Physiol 180(2): 1031-1045.
Wytynck, P., et al.(2021). Effect of rip overexpression on abiotic stress tolerance and development of rice.
0 sRIP1 Rice development International Journal of Molecular Sciences, 22(3), 1434.
Kabin Xie., et al. (2006). Genomic organization, differential expression, and interaction of squamosa OsmiR156b Rice development promoter-binding-like transcription factors and microrna156 in rice. Plant Physiology, 142(1), 280-93.
Yin, X., et al. (2019). OsMADS18, a membrane-bound MADS -box transcription factor, OsMADS57 Rice development modulates plant architecture and the abscisic acid response in rice. Journal of Experimental Botany(15), 3895-3909.
Yin, X., et al. (2019). OsMADS18, a membrane-bound MADS -box transcription factor, OsMADS18 Rice development modulates plant architecture and the abscisic acid response in rice. Journal of Experimental Botany(15), Yin, X., et al (2019). OsMADS18, a OsMADS15 Rice development membrane-bound MADS -box transcription factor, modulates plant architecture and the abscisic acid response in rice. Journal of Experimental Botany(15), 3895-3909.
Yin, X., et al. (2019). OsMADS18, a membrane-bound MADS -box transcription factor, OsMADS14 Rice development modulates plant architecture and the abscisic acid response in rice. Journal of Experimental Botany(15), 3895-3909.
Xiong, Y., et al. (2019). NF-YC12 is a key multi-functional regulator of accumulation of seed NF-YC12 Rice development storage substances in rice. Journal of Experimental Botany(15), 15.
Yan, D., et al. (2015). Curved chimeric palea 1 encoding an EMF1-like protein maintains epigenetic CCP1 Rice development repression of OsMADS58 in rice palea development.
Plant Journal, 82(1), 12-24.
Sun, Q., et al. (2020). "Indeterminate Domain Proteins Resistance to sheath LPA1 Regulate Rice Defense to Sheath Blight Disease."
blight disease in rice Rice (N Y) 13(1): 15.
To improve Achary, V. M. M., et al. (2020). "Overexpression of glyphosate tolerance improved EPSPS gene results in field level glyphosate EPSPS
and increase grain tolerance and higher grain yield in rice." Plant yield in rice Biotechnol J 18(12): 2504-2519.
Dehydroasc Do, H., et al. (2016). "Structural understanding of the orbate Rice yield and recycling of oxidized ascorbate by dehydroascorbate reductase biomass reductase (0sDHAR) from Oryza sativa L. japonica."
OsDHAR Sci Rep 6: 19498.
Choe, Y. H., et al. (2013). "Homologous expression of Rice yield and its gamma-glutamylcysteine synthetase increases grain OsECS(gam tolerance to yield and tolerance of transgenic rice plants to ma-ecs) environmental stresses environmental stresses." J Plant Physiol 170(6):
610-618.
Ueno, Y., et al. (2017). "WRKY45 phosphorylation at threonine 266 acts negatively on WRKY45-dependent WRKY45 Rice blast resistance blast resistance in rice." Plant Signal Behav 12(8):
e13 56968.
Azizi, P., et al. (2016). "Over-Expression of the Pikh Gene with a CaMV 35S Promoter Leads to Improved Pikh Gene Rice blast resistance Blast Disease (Magnaporthe oryzae) Tolerance in Rice." Front Plant Sci 7: 773.
To improve nitrogen Tang, D., et al. (2018). "Ectopic expression of fungal EcGDH assimilation and grain EcGDH improves nitrogen assimilation and grain yield in rice yield in rice." J Integr Plant Biol 60(2): 85-88.
To improve nitrogen Tomoyuki Yamaya1,2,4, Mitsuhiro Obaral, Hiroyuki NADH-GO
utilization and grain Nakajimal, Shohei Sasakil, GAT
filling in rice Toshihiko Hayakawal and Tadashi 5ato3 Dhatt, B. K., et al. (2021). "Allelic variation in rice Fertilization Independent Endosperm 1 contributes to Fiel Rice yield (grain size) grain width under high night temperature stress." New Phytol 229(1): 335-350.

Wang, J., et al. (2016). "Overexpression of OsMYB1R1 OsMYB1R1-VP64 fusion protein increases grain yield Rice yield -VP64 in rice by delaying flowering time." FEBS
Lett 590(19): 3385-3396.
Sun, W., et al. (2020). "OsmiR530 acts downstream of OsMIR530 Rice yield OsPIL15 to regulate grain yield in rice." New Phytol 226(3): 823-837.
Wang, C., et al. (2020). "A cytokinin-activation enzyme-like gene improves grain yield under various OsLOGL5 Rice yield field conditions in rice." Plant Mol Biol 102(4-5):
373-388.
Doku, H. A., et al. (2019). "The expression pattern of OsDiml Rice yield OsDiml in rice and its proposed function."
Sci Rep 9(1): 18492.
Uji, Y., et al. (2016). "Overexpression of OsMYC2 Resistance to bacterial Results in the Up-Regulation of Early JA-Rresponsive OsMYC2 leaf blight in rice Genes and Bacterial Blight Resistance in Rice." Plant Cell Physiol 57(9): 1814-1827.
Bart, R. S., et al. (2010). "Rice Sn16, a cinnamoyl-CoA reductase-like gene family member, Resistance to bacterial Rice NH1 is required for NH1-mediated immunity to leaf blight in rice Xanthomonas oryzae pv. oryzae." PLoS Genet 6(9):
e1001123.
Sugio, A., et al. (2007). "Two type III effector genes of Xanthomonas oryzae pv. oryzae control the Resistance to bacterial OsTFX1 induction of the host genes OsTFIIAgammal and leaf blight in rice OsTFX1 during bacterial blight of rice." Proc Nat!
Acad Sci U S A 104(25): 10720-10725.
To improve auxin Zhao, Z., et al. (2013). A role for a dioxygenase in catabolism and DA0 auxin metabolism and reproductive development in maintain auxin rice. Developmental Cell, 27(1), 113-122.
homeostasis Zhou, Y., et al. (2014). Overexpression of OsSWEET5 Growth development OsSWEET5 in rice causes growth retardation and precocious senescence. Plos One, 9(4), e94210.
Wu, P., et al.(2008). Role of OsPHR2 on phosphorus OsPHR2 Growth development homeostasis and root hairs development in rice (oryza sativa.L.). Plant Signaling & Behavior, 3(9), 674-675.
Wu, P., et al.(2008). Role of OsPHR2 on phosphorus OsPHR1 Growth development homeostasis and root hairs development in rice (oryza sativa.L.). Plant Signaling & Behavior, 3(9), 674-675.
Wu, Z., et al. (2011). Investigating the contribution of the phosphate transport pathway to arsenic OsPHF1 Growth development accumulation in rice. Plant Physiology, 157(1), 498-508.
Vijayraghavan, U.. (2011). Auxin-responsive OsMGH3, a common downstream target of OsMGH3 Growth development OsMADS1 and OsMADS6, controls rice floret fertility. Plant & Cell Physiology, 52(12), 2123-2135.
Zhang, L. Y., et al. (2009). Antagonistic HLH/bHLH
BZR1 Growth development transcription factors mediate brassinosteroid regulation of cell elongation and plant development in rice and arabidopsis. Plant Cell, 21(12), 3767-3780.
Fu, L., et al. (2013). "Overexpression of constitutively Biotic and abiotic active OsCPK10 increases Arabidopsis resistance OsCPK10 stress (resistance to against Pseudomonas syringae pv. tomato and rice Magnaporthe grisea) resistance against Magnaporthe grisea." Plant Physiol Biochem 73: 202-210.
Kang, K., et al. (2011). "Methanol is an endogenous elicitor molecule for the synthesis of tryptophan and Synthesis of PME1 tryptophan-derived secondary metabolites upon tryptophan senescence of detached rice leaves." Plant J 66(2):
247-257.
Tolerance to Yang, W. T., et al. (2018). Rice OsMYB5P
improves OsMYB5P phosphorous plant phosphate acquisition by regulation of phosphate deficiency transporter. PloS one, 13(3), e0194628.
Zhang., et al. (2015)."TOND1 confers tolerance to Tolerance to nitrogen TOND1 nitrogen deficiency in rice."The Plant deficiency Journa1,81(3) :367-376.
Hsu, K. H., et al. (2014). "Expression of a gene To enhance stomata encoding a rice RING zinc-finger protein, OsRZFP34, OsRZFP34 opening enhances stomata opening." Plant Mol Biol 86(1-2):
125-137.
Kaikavoosi, K., et al. (2015). "2-Acetyl-1-pyrroline To increase synthesis augmentation in scented indica rice (Oryza sativa L.) PS CS of proline and varieties through Delta(1)-pyrroline-5-carboxylate augment rice scent synthetase (P5CS) gene transformation." Appl Biochem Biotechnol 177(7): 1466-1479.
Kumar, S., et al. (2019). "Arsenic-responsive Tolerance to heavy high-affinity rice sulphate transporter, OsSultr1;1, OsSultr1;1 mental provides abiotic stress tolerance under limiting sulphur condition." J Hazard Mater 373: 753-762.
Campo, S., et al. (2014). "Overexpression of a Salt and drought Calcium-Dependent Protein Kinase Confers Salt and OsCPK4 tolerance Drought Tolerance in Rice by Preventing Membrane Lipid Peroxidation." Plant Physiol 165(2): 688-704.
Asano, T., et al. (2012). "A rice calcium-dependent Salt tolerance and oscpk12 blast disease protein kinase OsCPK12 oppositely modulates salt-stress tolerance and blast disease resistance."
resistance Plant J 69(1): 26-36.
serine-threo Diedhiou, C. J., et al. (2008). "The SNF1-type nine protein serine-threonine protein kinase SAPK4 regulates Salt tolerance kinase stress-responsive gene expression in rice."
BMC Plant SAPK4 Biol 8: 49.
Ganguly, M., et al. (2012). "Overexpression of Rab16A gene in indica rice variety for generating Rab16A Salt tolerance enhanced salt tolerance." Plant Signal Behav 7(4):
502-509.

Zhou, Y., et al. (2018). The receptor-like cytoplasmic kinase STRK1 phosphorylates and activates Catc, STRK1 Salt stress tolerance thereby regulating H202 homeostasis and improving salt tolerance in rice. Plant Cell, tpc.01000.2017.
Zhang, X.X., et al. (2013). OsDREB2A, a rice OsDREB2A Salt stress tolerance transcription factor, significantly affects salt tolerance in transgenic soybean. Plos One, 8(12), e83011.
Worawat., et al. (2018). Downstream components of the calmodulin signaling pathway in the rice salt OsCaml Salt stress tolerance stress response revealed by transcriptome profiling and target identification. BMC Plant Biology.
Kanneganti, V. and A. K. Gupta (2008).
Salt, drought and cold "Overexpression of OsiSAP8, a member of stress OsiSAP8 tolerance associated protein (SAP) gene family of rice confers tolerance to salt, drought and cold stress in transgenic tobacco and rice." Plant Mol Biol 66(5): 445-462.
Jan, A., et al. (2013). "OsTZFl, a CCCH-tandem zinc Salt and drought finger protein, confers delayed senescence and stress OsTZF1 tolerance tolerance in rice by regulating stress-related genes."
Plant Physiol 161(3): 1202-1216.
Huang, L., et al. (2018). "An Atypical Late Salt and drought Embryogenesis Abundant Protein OsLEA5 Plays a OsLEA5 tolerance Positive Role in ABA-Induced Antioxidant Defense in Oryza sativa L." Plant Cell Physiol 59(5): 916-929.
Huang, J., et al (2007). A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif plays a ZFP182 Salt tolerance role in salt tolerance. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression, 1769(4), 220-227.
Kumar, M., et al. (2017). "Ectopic Expression of OsSta2 Salt tolerance 0s5ta2 Enhances Salt Stress Tolerance in Rice." Front Plant Sci 8:316.
Guo, X., et al. (2009). "OsMSRA4.1 and OsMSRB1.1, OsMSRA4.1 Salt tolerance two rice plastidial methionine sulfoxide reductases, are involved in abiotic stress responses." Planta 230(1): 227-238.
Kumar, R., et al. (2012). "Functional screening of cDNA library from a salt tolerant rice genotype Pokkali identifies mannose-l-phosphate guanyl OsMPG1 Salt tolerance transferase gene (0sMPG1) as a key member of salinity stress response." Plant Mob Biol 79(6):
555-568.
Kumar, K. and A. K. Sinha (2013). "Overexpression of constitutively active mitogen activated protein OsMKK6 Salt tolerance kinase kinase 6 enhances tolerance to salt stress in rice." Rice (N Y) 6(1): 25.
Chen, G., et al. (2015). "Rice potassium transporter OsHAK1 is essential for maintaining OsHAK1 Salt tolerance potassium-mediated growth and functions in salt tolerance over low and high potassium concentration ranges." Plant Cell Environ 38(12): 2747-2765.
Jadamba, C., et al. (2020). "Overexpression of Rice OsEXPA7 Salt tolerance Expansin7 (0sexpa7) Confers Enhanced Tolerance to Salt Stress in Rice." Int J Mol Sci 21(2).
Kusuda, H., et al. (2015). "Ectopic expression of MIPS Salt tolerance myo-inositol 3-phosphate synthase induces a wide range of metabolic changes and confers salt tolerance in rice." Plant Sci 232: 49-56.
Kurotani, K., et al. (2015). "Stress Tolerance Profiling of a Collection of Extant Salt-Tolerant Rice Varieties CYP94C2b Salt tolerance and Transgenic Plants Overexpressing Abiotic Stress Tolerance Genes." Plant Cell Physiol 56(10):

Kurotani, K., et al. (2015). "Elevated levels of CYP94 family gene expression alleviate the jasmonate CYP94C2b Salt tolerance response and enhance salt tolerance in rice." Plant Cell Physiol 56(4): 779-789.
Fukao, T., et al. (2011). "The submergence tolerance SUB 1 A Flooding tolerance regulator SUB 1A mediates crosstalk between submergence and drought tolerance in rice." Plant Cell 23(1): 412-427.
Ye, N. H., et al. (2018). Natural variation in the promoter of rice calcineurin b-like protein10 OsCBL10 Flooding tolerance (0sCBL10) affects flooding tolerance during seed germination among rice subspecies. Plant Journal for Cell & Molecular Biology.
Hu, H., et al. (2008). "Characterization of transcription factor gene SNAC2 conferring cold and SNAC2 Stress tolerance salt tolerance in rice." Plant Mol Biol 67(1-2):
169-181.
Huang, Y., et al. (2019). "OsNCED5, a 9-cis-epoxycarotenoid dioxygenase gene, regulates OsNCED5 Stress tolerance salt and water stress tolerance and leaf senescence in rice." Plant Sci 287: 110188.
Hu, T., et al. (2019). "Overexpression of OsLea14-A
OsLea14-A Stress tolerance improves the tolerance of rice and increases Hg accumulation under diverse stresses." Environ Sci Pollut Res Int 26(11): 10537-10551.
Kim, S. K., et al. (2012). "The rice thylakoid lumenal cyclophilin OsCYP20-2 confers enhanced OsCYP20-2 Stress tolerance environmental stress tolerance in tobacco and Arabidopsis." Plant Cell Rep 31(2): 417-426.
Ghosh, A., et al. (2014). "A glutathione responsive rice glyoxalase II, OsGLYII-2, functions in salinity OsGLYII-2 Salt tolerance adaptation by maintaining better photosynthesis efficiency and anti-oxidant pool." Plant J 80(1):
93-105.

Gutha, L. R. and A. R. Reddy (2008). "Rice DREB1B
Biotic and abiotic promoter shows distinct stress-specific responses, and 0 sDREB1B the overexpression of cDNA in tobacco confers stress tolerance improved abiotic and biotic stress tolerance." Plant Mol Biol 68(6): 533-555.
Kidwai, M., et al. (2019). "Oryza sativa class III
peroxidase (OsPRX38) overexpression in Arabidopsis OsPRX38 Arsenic tolerance thaliana reduces arsenic accumulation due to apoplastic lignification." J Hazard Mater 362:
383-393.
Hwang, S. G., et al. (2017). "Molecular characterization of rice arsenic-induced RING finger OsAIR2 Arsenic tolerance E3 ligase 2 (OsAIR2) and its heterogeneous overexpression in Arabidopsis thaliana." Physiol Plant 161(3): 372-384.
Hwang, S. G., et al. (2016). "Molecular characterization of Oryza sativa arsenic-induced OsAIR1 Arsenic tolerance RING E3 ligase 1 (OsAIR1): Expression patterns, localization, functional interaction, and heterogeneous overexpression." J Plant Physiol 191: 140-148.
Biswas, S., et al. (2019). "Overexpression of Thermo and salt heterotrimeric G protein beta subunit gene (0sRGB1) OsRGB1 tolerance confers both heat and salinity stress tolerance in rice."
Plant Physiol Biochem 144: 334-344.
Keke Yi., et al .0sPTF1, a Novel Transcription Factor Low Phosphate OsPTF1 Involved inTolerance to Phosphate Starvation in Rice tolerance Fang, C., et al. (2020). "Serine OsSHMT, hydroxymethyltransferase localised in the Lsil gene Chilling tolerance endoplasmic reticulum plays a role in scavenging (Lsil-OX) H202 to enhance rice chilling tolerance." BMC
Plant Biol 20(1): 236.
Deng, C., et al. (2017). "The rice transcription factors OsICE Chilling tolerance OsICE confer enhanced cold tolerance in transgenic Arabidopsis." Plant Signal Behav 12(5): e1316442.
Dong-Qing Xu., et al (2008). Overexpression of a Drought and salt ZFP252 tolerance TFIIIA-type zinc finger protein geneZFP252 enhances drought and salt tolerance in rice (Oryza sativa L.) Du, H., et al. (2014). "A homolog of ETHYLENE
Drought and flooding OVERPRODUCER, OsETOL1, differentially OsETOL1 tolerance modulates drought and submergence tolerance in rice." Plant J 78(5): 834-849.
El-Esawi, M. A. and A. A. Alayafi (2019).
To improve drought "Overexpression of Rice Rab7 Gene Improves OsRab7 and heat tolerance and Drought and Heat Tolerance and Increases Grain increase rice yield Yield in Rice (Oryza sativa L.)." Genes (Basel) 10(1).
Du, H., et al. (2012). "A GH3 family member, Drought and cold OsGH3-2, modulates auxin and abscisic acid levels OsGH3-2 tolerance and differentially affects drought and cold tolerance in rice." J Exp Bot 63(18): 6467-6480.

Dey, A., et al. (2016). "Enhanced Gene Expression Rather than Natural Polymorphism in Coding Drought tolerance and OsbZIP23 Sequence of the OsbZIP23 Determines Drought yield increase Tolerance and Yield Improvement in Rice Genotypes." PLoS One 11(3): e0150763.
Favero Peixoto-Junior, R., et al. (2018).
"Overexpression of ScMYBAS1 alternative splicing ScMYBAS1 Drought tolerance transcripts differentially impacts biomass accumulation and drought tolerance in rice transgenic plants." PLoS One 13(12): e0207534.
Bang, S. W., et al. (2019). "Overexpression of OsTF1L, a rice HD-Zip transcription factor, promotes OsTF1L Drought tolerance lignin biosynthesis and stomatal closure that improves drought tolerance." Plant Biotechnol J 17(1): 118-131.
Abreu, F. R. M., et al. (2018). "Overexpression of a phospholipase (OsPLDalphal) for drought tolerance OsPLDal Drought tolerance in upland rice (Oryza sativa L.)." Protoplasma 255(6):
1751-1761.
Guo, C., et al. (2013). "The rice OsDIL gene plays a OsDIL Drought tolerance role in drought tolerance at vegetative and reproductive stages." Plant Mol Biol 82(3): 239-253.
Cui, L. G., et al. (2015). "DCA1 Acts as a DST Drought and salt Transcriptional Co-activator of DST and Contributes &DCA1 tolerance to Drought and Salt Tolerance in Rice." PLoS Genet 11(10): e1005617.
Zhou, L., et al (2016). "A novel gene OsAHL1 OsAHL1 Drought tolerance improvesboth drought avoidance anddrought tolerance in rice."Scientific reports, 6(1), 1-15.
Jeong, J. S., et al. (2013). "OsNAC5 overexpression Drought tolerance and enlarges root diameter in rice plants leading to OsNAC5 yield increase enhanced drought tolerance and increased grain yield in the field." Plant Biotechnol J 11(1): 101-114.
Xiong, L., et al.(2003). "Disease Resistance and Drought, salt, and cold Abiotic Stress Tolerance in Rice Are Inversely OsMAPK5 tolerance; disease Modulated by an Abscisic Acid¨Inducible resistance Mitogen-Activated Protein Kinase." Plant Cell.
Jeong, J. S., et al. (2010). "Root-specific expression of OsNAC10 Drought, salt and cold OsNAC10 improves drought tolerance and grain yield tolerance in rice under field drought conditions." Plant Physiol 153(1): 185-197 Hong, Y., et al. (2016). "Overexpression of a Drought and salt Stress-Responsive NAC Transcription Factor Gene tolerance ONACO22 Improves Drought and Salt Tolerance in Rice." Front Plant Sci 7:4.
Huang, J., et al. (2009). "Increased tolerance of rice to Tolerance to drought, cold, drought and oxidative stresses mediated by the ZFP245 cold and oxidative overexpression of a gene that encodes the zinc finger stresses protein ZFP245." Biochem Biophys Res Commun 389(3): 556-561.

Joo, J., et al. (2013). "Abiotic stress responsive rice Drought and cold ASR1 and ASR3 exhibit different tissue-dependent OsASR1 tolerance sugar and hormone-sensitivities." Mol Cells 35(5):
421-435.
Kim, Y. S. and J. K. Kim (2009). "Rice transcription Drought, high salt and AP37 factor AP37 involved in grain yield increase under cold tolerance drought stress." Plant Signal Behav 4(8): 735-736.
Jiang, S. Y., et al. (2012). "Over-expression of Drought and heat OSRIP18 increases drought and salt tolerance in tolerance transgenic rice plants." Transgenic Res 21(4):
785-795.
Xiao, J., et al.(2013)."Rice WRKY13 Regulates Cross Talk between Abiotic and Biotic Stress Signaling WRKY13 Drought tolerance Pathways by Selective Binding to Different cis-Elements. "Plant Physiology, 163(4), 1868-1882.
Hu, H., et al. (2006). "Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought SNAC1 Drought tolerance resistance and salt tolerance in rice." Proc Natl Acad Sci U S A 103(35): 12987-12992 Lenka, S. K., et al. (2019). "Heterologous expression of rice RNA-binding glycine-rich (RBG) gene OsRBGD3 Drought tolerance OsRBGD3 in transgenic Arabidopsis thaliana confers cold stress tolerance." Funct Plant Biol 46(5):
482-491.
Kumar, V. V. S., et al. (2020). "ABA receptor OsPYL6 confers drought tolerance to indica rice OsPYL6 Drought tolerance through dehydration avoidance and tolerance mechanisms." J Exp Bot.
Lenka, S. K., et al. (2018). "Ectopic Expression of Rice PYL3 Enhances Cold and Drought Tolerance in OsPYL3 Drought tolerance Arabidopsis thaliana." Mol Biotechnol 60(5):
350-361.
Lee, D. K., et al. (2015). "The NF-YA transcription factor OsNF-YA7 confers drought stress tolerance of OsNF-YA7 Drought tolerance rice in an abscisic acid independent manner." Plant Sci 241: 199-210.
Wang, X., et al. (2020). "The NAD kinase OsNADK1 affects theintracellular redox balance and enhances OsNADK1 Drought tolerance the tolerance of rice to drought."BMC Plant Biology, 20.
Lee, D. K., et al. (2017). "The rice OsNAC6 transcription factor orchestrates multiple molecular OsNAC6 Drought tolerance mechanisms involving root structural adaptions and nicotianamine biosynthesis for drought tolerance."
Plant Biotechnol J 15(6): 754-764.
Jung, H., et al. (2015). "OsIAA6, a member of the rice Aux/IAA gene family, is involved in drought OsIAA6 Drought tolerance tolerance and tiller outgrowth." Plant Sci 236:
304-312.

Lee, D. K., et al. (2017). "Rice OsERF71-mediated OsERF71 Drought tolerance root modification affects shoot drought tolerance."
Plant Signal Behav 12(1): e1268311.
Huang, L., et al. (2018). "Characterization of OsDRAP1 Drought tolerance Transcription Factor Gene OsDRAP1 Conferring Drought Tolerance in Rice." Front Plant Sci 9: 94.
Lee, S. S., et al. (2015). "Rice cyclophilin OsCYP18-2 is translocated to the nucleus by an interaction with OsCYP18-2 Drought tolerance SKIP and enhances drought tolerance in rice and Arabidopsis." Plant Cell Environ 38(10): 2071-2087.
Shuya, Wei., et al.(2014). "A rice calcium-dependent protein kinase OsCPK9positively regulates drought OsCPK9 Drought tolerance stress tolerance andspikelet fertility."BMC Plant Biology, 14(1), 133-133.
Huang, Y. C., et al. (2012). "Comprehensive analysis of differentially expressed rice actin depolymerizing OsADF Drought tolerance factor gene family and heterologous overexpression of OsADF3 confers Arabidopsis Thaliana drought tolerance." Rice (NY) 5(1): 33.
Huang, Y., et al. (2007). "Characterization of a stress OCPI1 Drought tolerance responsive proteinase inhibitor gene with positive effect in improving drought resistance in rice." Planta 226(1): 73-85.
Komatsu, S., et al. (2007). "Over-expression of calcium-dependent protein kinase 13 and calreticulin CDPK13 Drought tolerance interacting protein 1 confers cold tolerance on rice plants." Mol Genet Genomics 277(6): 713-723.
Zhang, Y., et al. (2009). 'Expression of a rice DREB1 OsDREB1D Cold and salt tolerance gene, OsDREB1D, enhances cold and high-salt tolerance in transgenic Arabidopsis."Bmb Reports, 42(8), 486-492.
Kumar, M., et al. (2017). "Genome-Wide Identification and Analysis of Genes, Conserved OsWRKY71 Cold tolerance between japonica and indica Rice Cultivars, that Respond to Low-Temperature Stress at the Vegetative Growth Stage." Front Plant Sci 8: 1120.
Kim, S. H., et al. (2007). "Isolation of cold OsLti6b Cold tolerance stress-responsive genes in the reproductive organs, and characterization of the OsLti6b gene from rice (Oryza sativa L.)." Plant Cell Rep 26(7): 1097-1110.
Li, C. R., et al. (2013). "Overexpression of an alternative oxidase gene, OsA0X1a, improves cold OsA0X1a Cold tolerance tolerance in Oryza sativa L." Genet Mol Res 12(4):
5424-5432.
Kunihiro, S., et al. (2014). "Overexpression of rice OsREX1-S, encoding a putative component of the core general transcription and DNA repair factor IIH, OsREX1-S Cadmium tolerance renders plant cells tolerant to cadmium- and UV-induced damage by enhancing DNA excision repair." Planta 239(5): 1101-1111.

Hu, S., et al. (2017). "OsMYB45 plays an important OsMYB45 Cadmium tolerance role in rice resistance to cadmium stress." Plant Sci 264: 1-8.
Hwang, S. G., et al. (2016). "Molecular dissection of Tolerance to salinity Oryza sativa salt-induced RING Finger Protein 1 OsSIRP1 and other stresses (OsSIRP1): possible involvement in the sensitivity response to salinity stress." Physiol Plant 158(2):

He, X., et al. (2017). "A rice jacalin-related mannose-binding lectin gene, OsJRL, enhances Tolerance to salinity OsJRL
Escherichia coli viability under high salinity stress and other stresses and improves salinity tolerance of rice." Plant Biol (Stuttg) 19(2): 257-267.
Xu, Y., et al.(2020). "Natural variations of SLG1 SLG1 Heat tolerance confer high-temperaturetolerance in indica rice. "Nature Communications, 11(1), 5441.
Feng, L., et al. (2007). "Overexpression of SBPase SBPase Heat tolerance enhances photosynthesis against high temperature stress in transgenic rice plants." Plant Cell Rep 26(9):
1635-1646.
Ho, S. L., et al. (2013). "Sugar starvation- and GA-inducible calcium-dependent protein kinase 1 OsCDPK1 Drought tolerance feedback regulates GA biosynthesis and activates a 14-3-3 protein to confer drought tolerance in rice seedlings." Plant Mol Biol 81(4-5): 347-361.
Li, J., et al (2017)."OsASR5 enhances drought tolerance through a stomatal closure pathway OsASR5 Drought tolerance associated with ABA and H202 signalling in ri ce. "Plant Biotechnology Journal..
Kang, Z., et al. (2019). "Overexpression of the zinc Abiotic stress finger protein gene OsZFP350 improves root OsZFP350 tolerance development by increasing resistance to abiotic stress in rice." Acta Biochim Pol 66(2): 183-190.
Jain, M., et al. (2008). "Constitutive expression of a meiotic recombination protein gene homolog, Abiotic stress OsTOP6A1 OsTOP6A1, from rice confers abiotic stress tolerance tolerance in transgenic Arabidopsis plants." Plant Cell Rep 27(4): 767-778.
Kumar, S., et al. (2013). "Expression of a rice Lambda class of glutathione S-transferase, OsGSTL2, in Abiotic stress OsGSTL2 Arabidopsis provides tolerance to heavy metal and tolerance other abiotic stresses." J Hazard Mater 248-249:
228-237.
Kumari, S., et al. (2015). "Expression of a cyclophilin OsCyp2-P isolated from a salt-tolerant landrace of Abiotic stress OsCyp2-P
rice in tobacco alleviates stress via ion homeostasis tolerance and limiting ROS accumulation." Funct Integr Genomics 15(4): 395-412.

To enhance tolerance Huang, J., et al. (2008). "Expression analysis of rice to high and low A20/AN1-type zinc finger genes and characterization ZFP177 temperatures and of ZFP177 that contributes to temperature stress sensitivity to salt and tolerance." Gene 420(2): 135-144.
drought Fang, J. C., et al. (2021). "A CCR4-associated factor Low-temperature 1, OsCAF1B, confers tolerance of low-temperature OsCAF1B
tolerance stress to rice seedlings." Plant Mol Biol 105(1-2):
177-192.
Ke, S., et al. (2019). "Rice OsPEX1, an extensin-like OsPEX1 Lignin content protein, affects lignin biosynthesis and plant growth."
Plant Mol Biol 100(1-2): 151-161.
Liang, Z., et al. (2010). "A novel simple extracellular leucine-rich repeat (eLRR) domain protein from rice OsLRR1 Immune response (0sLRR1) enters the endosomal pathway and interacts with the hypersensitive-induced reaction protein 1 (0sHIR1)." Plant Cell & Environment, 32.
Liang, Z., et al. (2010). "A novel simple extracellular leucine-rich repeat (eLRR) domain protein from rice OsHIR1 Immune response (0sLRR1) enters the endosomal pathway and interacts with the hypersensitive-induced reaction protein 1 (0sHIR1)." Plant Cell & Environment, 32.
D Wu., et al.(2015). "Overexpressing OsPIN2 enhances aluminium internalization by elevating OsPIN2 Aluminium tolerance vesicular trafficking in rice root apex. 'Journal of Experimental Botany, 66(21), 6791-6801.
Heang, D. and H. Sassa (2012). "An atypical bHLH
protein encoded by POSITIVE REGULATOR OF
Grain length and GRAIN LENGTH 2 is involved in controlling grain weight length and weight of rice through interaction with a typical bHLH protein APG." Breed Sci 62(2):
133-141.
Heang, D. and H. Sassa (2012). "Antagonistic actions Grain length and PGL1 of HLH/bHLH proteins are involved in grain length weight and weight in rice." PLoS One 7(2): e31325.
Grain number and Yang, J., et al. (2018). "Chromatin interacting factor OsCKX2 OsVIL2 increases biomass and rice grain yield."Plant yield Biotechnology Journal.
Islam, M. A., et al. (2009). "Characterization of Wax accumulation and Glossy 1-homologous genes in rice involved in leaf OsGL1-2 drought resistance wax accumulation and drought resistance."
Plant Mol Biol 70(4): 443-456 Wang, T., et al. (2019). "GRAIN LENGTH AND
GLA1 To regulate grain size AWN 1 negatively regulates grain size in rice." J
Integr Plant Biol 61(10): 1036-1042.
Yang, B. J., et al. "Rice microtubule-associated To regulate grain protein IQ67-DOMAIN14 regulates grain shape by OsIQD14 shape modulating microtubule cytoskeleton dynamics. "Wiley-Blackwell Online Open, 18(5).
Guan, Q., et al. (2012). "Genetic transformation and OsAPx2 Salt tolerance analysis of rice OsAPx2 gene in Medicago sativa."
PLoS One 7(7): e41233.

Sun, Y., et al. (2017). "TP546, a Rice Terpene Synthase Conferring Natural Resistance to Bird TPS46 Aphid resistance Cherry-Oat Aphid, Rhopalosiphum padi (Linnaeus)."
Front Plant Sci 8: 110.
Huang, Y., et al. (2018). "9-cis-Epoxycarotenoid Dioxygenase 3 Regulates Plant Growth and Enhances OsNCED3 Stress resistance Multi-Abiotic Stress Tolerance in Rice." Front Plant Sci 9: 162.
Yuexing Yuan., et al.(2010). "Functional analysis of rice NPR1-like genes reveals that OsNPR1/NH1 is the Rice bacterial leaf OsNPR1 rice orthologue conferring disease resistance with blight resistance enhance herbivore susceptibility. "Plant Biotechnology Journal, 5(2), 313-324.
Kutubuddin A Molla., et al.(2013). "Rice oxalate oxidase gene driven by green tissue-specific promoter Sheath blight 0s0X04 increases tolerance to sheath blight pathogen resistance (Rhizoctonia solani) in transgenic rice. "Molecular Plant Pathology, 14(9).
Rice stripe disease Hong, W., et al. (2015). "OsRDR6 plays role in host RDR6 resistance defense against double-stranded RNA virus, Rice Dwarf Phytoreovirus." Sci Rep 5: 11324.
Kuang, J., et al. (2017). "A Class II small heat shock Biotic and abiotic protein OsHsp18.0 plays positive roles in both biotic OsHsp18.0 stress tolerance and abiotic defense responses in rice." Sci Rep 7(1):
11333.
Ge, L. F., et al. (2008). "Overexpression of the trehalose-6-phosphate phosphatase gene 0sTPP1 Salt stress, cold stress OsTPP1 confers stress tolerance in rice and results in the tolerance activation of stress responsive genes." Planta 228(1):
191-201.
Ye, Zhang., et al.(2016). "An A20/AN1-type zinc finger protein modulates gibberellins and abscisic acid ZFP185 Stress resistance contents and increases sensitivity to abiotic stress in rice (Oryza sativa). "Journal of Experimental Botany.
Choi, G. H. and K. Back (2019). "Suppression of Melatonin 2-Hydroxylase Increases Melatonin M2H Stress resistance Production Leading to the Enhanced Abiotic Stress Tolerance against Cadmium, Senescence, Salt, and Tunicamycin in Rice Plants." Biomolecules 9(10).
Kothari, K. S., et al. (2016). "Rice Stress Associated Protein 1 (OsSAP1) Interacts with Aminotransferase OsSAP1 Stress resistance (0sAMTR1) and Pathogenesis-Related la Protein (OsSCP) and Regulates Abiotic Stress Responses."
Front Plant Sci 7: 1057.
Lee, S., et al. (2012). "Activation of Rice nicotianamine synthase 2 (0sNAS2) enhances iron OsNAS2 Stress tolerance availability for biofortification." Mol Cells 33(3):
269-275.

Redillas, M. C., et al. (2012). "The overexpression of Drought tolerance and OsNAC9 alters the root architecture of rice plants OsNAC9 crop yield enhancing drought resistance and grain yield under field conditions." Plant Biotechnol J 10(7): 792-805.
Ahmad, I., et al. (2016). "Overexpression of the OsTPKb Drought tolerance potassium channel TPKb in small vacuoles confers osmotic and drought tolerance to rice." New Phytol 209(3): 1040-1048.
Fang, M., et al. (2019). "Overexpression of OsFTL10 OsFTL10 Drought tolerance induces early flowering and improves drought tolerance in Oryza sativa L." Peed 7: e6422.
Chen, H., et al. (2012). "Basic leucine zipper 0 sbZIP16 Drought tolerance transcription factor OsbZIP16 positively regulates drought resistance in rice." Plant Sci 193-194: 8-17.
Ahmad, I., et al. (2016). "Overexpression of the rice AKT1 potassium channel affects potassium nutrition OsAKT1 Drought tolerance and rice drought tolerance." J Exp Bot 67(9):
2689-2698.
Du, H., et al. (2011). "Characterization of an inositol Drought and salt 1,3,4-trisphosphate 5/6-kinase gene that is essential OsITPK2 tolerance for drought and salt stress responses in rice." Plant Mol Biol 77(6): 547-563.
You, J., et al.(2013) "The SNAC1-targeted gene Drought tolerance and OsSROlc modulates stomatal closure and oxidative OsSROlc oxidation resistance stress tolerance by regulating hydrogen peroxide in rice. 'Journal of Experimental Botany(2), 569.
Chang, Y., et al. (2017). "Co-overexpression of the Constitutively Active Form of OsbZIP46 and OsbZIP46C Drought and ABA-Activated Protein Kinase SAPK6 Improves A1&SAPK6 temperature tolerance Drought and Temperature Stress Resistance in Rice."
Front Plant Sci 8: 1102.
Du, H., et al. (2010). "Characterization of the beta-carotene hydroxylase gene DSM2 conferring DSM2 Drought tolerance and drought and oxidative stress resistance by increasing /0sBCH1 oxidation resistance xanthophylls and abscisic acid synthesis in rice." Plant Physiol 154(3): 1304-1318.
Zuluaga, A. P., et al. (2020). "The Rice DNA-Binding Drought tolerance and Protein ZBED Controls Stress Regulators and ZBED
disease resistance Maintains Disease Resistance After a Mild Drought."
Front Plant Sci 11: 1265.
Wang, Z., et al. (2018)."The E3 Ligase DROUGHT
HYPERSENSITIVE Negatively Regulates Cuticular ROC4 Drought tolerance Wax Biosynthesis by Promoting the Degradation of Transcription Factor ROC4 in Rice." Plant Cell, tpc.00823.2017.
You, J., et al. (2014). "A STRESS-RESPONSIVE
NAC1-Regulated Protein Phosphatase Gene Rice OsPP18 Drought tolerance Protein Phosphatase18 Modulates Drought and Oxidative Stress Tolerance through Abscisic Acid-Independent Reactive Oxygen Species Scavenging in Rice."Plant Physiology, 166(4), 2100-14.
Lee, D. K., et al. (2016). "Overexpression of the OsERF71 Transcription Factor Alters Rice Root OsERF71 Drought tolerance Structure and Drought Resistance." Plant Physiol 172(1): 575-588.
Wan, L., et al. (2011). "Transcriptional activation of OsDERF1 in OsERF3 and OsAP2-39 negatively 0 sDERF1 Drought tolerance modulates ethylene synthesis and drought tolerance in rice." PLoS One 6(9): e25216.
Kang, J., et al. (2017). "Overexpression of the leucine-rich receptor-like kinase gene LRK2 increases LRK2 Drought tolerance drought tolerance and tiller number in rice." Plant Biotechnol J 15(9): 1175-1185.
"The E3 Ligase DROUGHT HYPERSENSITIVE
Negatively Regulates Cuticular Wax Biosynthesis by DHS Drought tolerance Promoting the Degradation of Transcription Factor ROC4 in Rice"
Jin, Y. M., et al. (2018). "Overexpression of a New OsCTZFP8 Cold resistance Zinc Finger Protein Transcription Factor OsCTZFP8 Improves Cold Tolerance in Rice." Int J Genomics 2018: 5480617.
Kim, H., et al. (2014). "Overexpression of PYL5 in OsPYL/RC Abiotic stress rice enhances drought tolerance, inhibits growth, and AR5 tolerance modulates gene expression." J Exp Bot 65(2):
453-464.
Jan, R., et al. (2020). "Overexpression of OsF3H
modulates WBPH stress by alteration of Plant hopper OsF3H phenylpropanoid pathway at a transcriptomic and resistance metabolomic level in Oryza sativa." Sci Rep 10(1):
14685.
Helliwell, E. E., et al. (2013). "Transgenic rice with Magnaporthe oryzae inducible ethylene production exhibits broad-spectrum OsACS2 and Rhizoctonia solani disease resistance to the fungal pathogens disease resistance Magnaporthe oryzae and Rhizoctonia solani."
Plant Biotechnol J 11(1): 33-42.
Naoki, Y., et al. (2013)."WRKY76 is a rice Magnaporthe oryzae transcriptional repressor playing opposite roles in OsWRKY76 resistance and drought blast disease resistance and cold stress tolerance tolerance. "Journal of Experimental Botany(16), 5085-5097.
Magnaporthe oryzae Jisha, V., et al. (2015). "Overexpression of an and xanthomonas AP2/ERF Type Transcription Factor OsEREBP1 0 sEREBP1 oryzae resistance; Confers Biotic and Abiotic Stress Tolerance in Rice."
drought tolerance PLoS One 10(6): e0127831.
Juan., et al.(2008)"Constitutive expression of Magnaporthe oryzae pathogen-inducible OsWRKY31 enhances disease OsWRKY31 resistance resistance and affects root growth and auxin response in transgenic rice plants."Cell Research.

Han, Y., et al. (2019). "A Magnaporthe Chitinase Magnaporthe oryzae Interacts with a Rice Jacalin-Related Lectin to OsMBL1 resistance Promote Host Colonization." Plant Physiol 179(4):
1416-1430.
Shen, Q., et al. (2019). "CYP71Z18 overexpression Magnaporthe oryzae CYP71Z18 confers elevated blast resistance in transgenic rice."
resistance Plant Mol Biol 100(6): 579-589.
Fan, C., et al. (2018). "Ectopic expression of a novel OsExtensin-like gene consistently enhances plant Plant lodging OsEXTL lodging resistance by regulating cell elongation and resistance cell wall thickening in rice." Plant Biotechnol J 16(1):
254-263.
Qiao, L., et al. (2020). "Expression of rice siR109944 in Arabidopsis affects plant immunity to multiple siR109944 Disease resistance fungal pathogens." Plant Signal Behav 15(4):
1744347.
Wally, 0. and Z. K. Punja (2010). "Enhanced disease resistance in transgenic carrot (Daucus carota L.) OsPrx114 Disease resistance plants over-expressing a rice cationic peroxidase."
Planta 232(5): 1229-1239 Wang, H., et al. (2007). "Overexpression of rice WRKY89 enhances ultraviolet B tolerance and OsWRKY89 Disease resistance disease resistance in rice plants." Plant Mol Biol 65(6): 799-815.
Shengze, et al. (2019). Transcriptional regulation of miR528 Virus resistance mir528 by OsSPL9 orchestrates antiviral response in rice. -)-Y-fitt:AVIR.(8), 1114-1122.
He, S. L., et al. (2018). "Overexpression of a constitutively active truncated form of OsCDPK1 OsCDPK1 Disease resistance confers disease resistance by affecting OsPR10a expression in rice." Sci Rep 8(1): 403.
Huang, L. F., et al. (2016). "Multiple Patterns of Bacterial leaf blight Regulation and Overexpression of a OsPR10a and streak disease Ribonuclease-Like Pathogenesis-Related Protein resistance Gene, OsPR10a, Conferring Disease Resistance in Rice and Arabidopsis." PLoS One 11(6): e0156414.
Bacterial leaf blight Lee, H., et al. (2018). "Rice WRKY11 Plays a Role in OsWRKY11 Pathogen Defense and Drought Tolerance." Rice (N
resistance Y) 11(1): 5.
Kachewar, N. R., et al. (2019). "Overexpression of Bacterial leaf blight OsPUB41, a Rice E3 ubiquitin ligase induced by cell OsPUB41 resistance wall degrading enzymes, enhances immune responses in Rice and Arabidopsis." BMC Plant Biol 19(1): 530.
Li, B., et al. (2019). "Overexpression a "fruit-weight Bacterial leaf blight OsFWL5 2.2-like" gene OsFWL5 improves rice resistance."
resistance Rice (NY) 12(1): 51.

Jan, R., et al. (2020). "Overexpression of OsCM
Bacterial leaf blight alleviates BLB stress via phytohormonal accumulation OsCM
resistance and transcriptional modulation of defense-related genes in Oryza sativa." Sci Rep 10(1): 19520.
Elliott, C., et al. (2002). "Functional conservation of Powdery mildew wheat and rice Mb o orthologs in defense modulation to OsM1o2 resistance the powdery mildew fungus." Mol Plant Microbe Interact 15(10): 1069-1077.
Izawa, T., et al. (2000). "Phytochromes confer the SE5 Flowering photoperiodic control of flowering in rice (a short-day plant)." Plant J 22(5): 391-399.
Lee, S., et al. (2004). "Functional analyses of the flowering time gene OsMADS50, the putative OsMADS50 Flowering SUPPRESSOR OF OVEREXPRESSION OF CO
1/AGAMOUS-LIKE 20 (SOC1/AGL20) ortholog in rice." Plant J 38(5): 754-764.
Jeon, J. S., et al. (2000). "leafy hull sterilel is a OsMADS1 Flowering homeotic mutation in a rice MADS box gene affecting rice flower development." Plant Cell 12(6): 871-884.
Hayama, R., et al. (2003). "Adaptation of OsGI Flowering photoperiodic control pathways produces short-day flowering in rice." Nature 422(6933): 719-722.
Zhang, Z., et al.(2020). Two glyoxylate reductase isoforms are functionally redundant but required OsGR2 Detoxication under high photorespiration conditions in rice. BMC
Plant Biology, 20(1).
Zhang, Z., et al.(2020). Two glyoxylate reductase isoforms are functionally redundant but required OsGR1 Detoxication under high photorespiration conditions in rice. BMC
Plant Biology, 20(1).
Jain, M., et al. (2020). "A D-lactate dehydrogenase To relieve biotic stress from rice is involved in conferring tolerance to OsD-LDH2 tolerance multiple abiotic stresses by maintaining cellular homeostasis." Sci Rep 10(1): 12835.
Yang A. et al. (2016). "A Small GTPase, OsRab6a, i Environment singal i OsRab6a s Involved n the Regulation of Iron Homeostasis in (iron) response Rice." Front Plant Sci 11: 595439.
Broad, R. C., et al. (2020). "Effect of Rice Overexpression on GDP-L-Galactose Phosphorylase Constitutive ascorbate OsGGP Overexpression on Ascorbate Concentration, Stress concentration; stress Tolerance, and Iron Bioavailability in Rice." Front tolerance Plant Sci 11: 595439.
Ming, Zheng ., et al.(2015). "DEFORMED FLORAL
ORGAN1 (DF01) regulates floral organ identity by Floral organ OsMADS58 epigenetically repressing the expression of development OsMADS58 in rice (Oryza sativa). "New Phytologist, 206(4).
Ming,Zheng., et al.(2015). "DEFORMED FLORAL
Floral organ ORGAN1 (DF01) regulates floral organ identity by development epigenetically repressing the expression of OsMADS58 in rice (Oryza sativa). "New Phytologist, 206(4).
Zhang, Y. C., et al.(2019). "OsmiR528 regulates rice-pollen intine formationby targeting an uclacyanin OsUCL23 Pollen development to influence flavonoid metabolism. "Proceedings of the National Academy of Sciences, 117(1), 201810968.
Chu, H., et al. (2013). "A CLE-WOX signalling allene oxide Brown planthopper module regulates root meristem maintenance and cyclase resistance vascular tissue development in rice." J Exp Bot 64(17): 5359-5369.
Chen, L., et al. (2020). "Overexpression of a Cytosolic 6-Phosphogluconate Dehydrogenase Gene Enhances 0s6PGDH1 Brown planthopper the Resistance of Rice to Nilaparvata lugens." Plants (Basel) 9(11).
Chen, L., et al. (2018). "Overexpression of OsGID1 OsGID1 Brown planthopper Enhances the Resistance of Rice to the Brown Planthopper Nilaparvata lugens." Int j Mol Sci 19(9).
Hydrogen peroxide accumulation, rice Hoang, T. V., et al. (2019). "Heat stress transcription blast resistance, factor OsSPL7 plays a critical role in reactive oxygen OsSPL7 bacterial blight species balance and stress responses in rice."
Plant Sci resistance, cold 289: 110273.
tolerance Moreno-Moyano, L. T., et al.(2016). "Association of zinc and ironconten Increased Grain Iron and Zinc Concentrations with OsNAS2 in rice gains Agro-morphological Traits ofBiofortified Rice."Frontiers in Plant Science, 7, 1463.
Liu, S., et al. (2019). "Overexpression of a CPYC-Type Glutaredoxin, OsGrxC2.2, Causes OsGrxC2.2 increasegrain weight Abnormal Embryos and an Increased Grain Weight in Rice"
Wei Li., et al (2011). "Rice RING protein OsBBIl broad spectrum with E3 ligase activity confers broad-spectrum OsBBIl resistance to resistance against Magnaporthe oryzae by modifying Magnaporthe oryzae the cell wall defence."Cell Research, 21(5), 835-848.
Liu, X., et al. (2015)."Regulation of Histone Methylation and Reprogramming of Gene Expression SDG711 large inflorescence in the Rice Inflorescence Meristem."Plant Cell, 27(5), 1428-44.
Li, Y., et al.(2018). "Panicle Morphology Mutant 1 increaseyield and (PMM1) determines the inflorescence architecture of grain weight rice by controlling brassinosteroid biosynthesis."BMC
Plant Biology, 18(1).
Liu, K. P., et al.(2017). "SET DOMAIN GROUP701 encodes a H3K4-methytransferase and regulates SDG701 early flowering multiple key processes of rice plant development. "NEW PHYTOL, 2017,215(2)(-), 609-623.
Xixi, Liu., et al. (2019)."Protein Interactomic Analysis of SAPKs and ABA-Inducible bZIPs SAPK10 early flowering Revealed Key Roles of SAPK10 in Rice Flowering "International Journal of Molecular Sciences.
Lu, L., et al. (2016) "OsPAP10c, a novel secreted acid phosphatase in rice, plays an important role in the OsPAP10c phosphorus utilization utilization of external organic phosphorus. "Plant, Cell & Environment.
Liu, A. L., et al. (2013). "Over-expression of salt and drought OsHsfA7 OsHsfA7 enhanced salt and drought tolerance in tolerance transgenic rice."BMB Reports, 46(1).
Qibin Ma., et al.(2009). "Enhanced T olerance to Chilling Stress in OsMYB3R-2T ransgenic Rice Is OsMYB3R-cold tolerance Mediated by Alteration in Cell Cycle and Ectopic Expression of Stress Genes." Plant Physiology, 150(1), 244-256.
Moon, S. J., et al.(2019)."Ectopic Expression of OsDREB1G, a Member of the OsDREB1 Subfamily, 0 sDREB1G cold tolerance Confers Cold Stress Tolerance in Rice."Frontiers in plant science, 10.
Lou, D., et al.(2018)."The sucrose non-fermenting-1-related protein kinases SAPK1 and salt tolerance SAPK2 function collaboratively as positive regulators of saltstress tolerance in rice."BMC Plant Biology, 18(1).
Min, L., et al.(2010). Rice gtpase osracb: potential OsRacB salt tolerance accessory factor in plant salt-stress signaling. Acta Biochimica Et Biophysica Sinica, 38(6), 393-402.
Xin Liu., et al.(2018). Identification and characterization of the rice pre-harvest sprouting OsCNX6 salt tolerance mutants involved in molybdenum cofactor biosynthesis The New Phytologist.
Liu, Y., et al. (2020). "Overexpression of OsCIPK30 tolerance to rice OsCIPK30 Enhances Plant T olerance to Rice stripe stripe virus virus 'Frontiers in Microbiology, 8, 2322.
"Proteomic Analysis of Rice Subjected to Low Light low light OsGAPB Stress and Overexpression of OsGAPB Increases the stresstolerance Stress Tolerance." Rice, 13(1).
Eng, L., et al. (2011)."An EAR-motif-containing ERF
OsERF3 stress resistance transcription factor affects herbivore-induced signaling, defense and resistance in rice." Plant Journal, 68(4), 583-596.
Liang, S., et al. (2019). "Overexpression of OsARD1 Improves Submergence, Drought, and Salt Tolerances 0 sARD1 stress resistance of Seedling Through the Enhancement of Ethylene Synthesis in Rice "Frontiers in Plant Science, 10.
Liu, W. Y., et al.(2009). "The OsDHODH1 Gene is drought and salt Involved in Salt and Drought Tolerance in OsDHODH1 tolerance Rice. "Journal of Integrative Plant Biology, 51(009), 825-833.

Lian, H. L., et al.(2004). "The Role of Aquaporin RWC3 drought tolerance RWC3 in Drought A voidance in Rice."Plant &
Cell Physiology.
Liu, C., et al. (2019). "The bZIP73 transcription factor bZIP73 cold tolerance controls rice cold tolerance at the reproductive stage "Plant Biotechnology Journal, 17(9).
rice blast disease Hirochika, H., et al. (2010)."Pdkl Kinase Regulates resistance and Basal Disease Resistance Through the OsPdkl bacterial leaf blight OsOxil¨OsPtila Phosphorylation Cascade in disease Rice."Plant & Cell Physiology, 51(12), 2082-91.
Mou, S., et al.(2015). Over-expression of rice CBS
domain containing protein, OsCBSX3, confers rice rice blast disease OsCBSX3 resistance to magnaporthe oryzae inoculation.
resistance International Journal of Molecular Sciences, 16(7), 15903-15917.
Liu, X., et al. (2020). Rice OsAAA-ATPasel is induced during blast infection in a salicylic OsAAA-AT rice blast disease acid-dependent manner, and promotes blast fungus Pasel resistance resistance International Journal of Molecular Sciences, 21(4), 1443.
Liu, F., et al. (2020). The rice xa3 gene confers bacterial leaf blight resistance to xanthomonas oryzae pv. oryzae in the disease resistance model rice kitaake genetic background.
Frontiers in Plant Science, 11.
Seok-Jun., et al.(2018). OsTGA2 confers disease bacterial leaf blight resistance to rice against leaf blight by regulating OsTGA2 disease resistance expression levels of disease related genes via interaction with NH1. PloS one, 13(11), e0206910.
Wenqi, L., et al.(2019). Overexpressing CYP71z2 bacterial leaf blight OsCYP71Z2 enhances resistance to bacterial blight by suppressing disease resistance auxin biosynthesis in rice. PloS one.
Mou, S., et al., (2013). Functional analysis and bacterial leaf blight expressional characterization of rice ankyrin 0 sPIANK1 diseaseresi stance repeat-containing protein, ospiankl, in basal defense against magnaporthe oryzae attack. Plos One, 8.
Runlong,M., et al.(2013).Nitric Oxide and Protein NOE1/0sC
programmed cell death S-Nitrosylation Are Integral to Hydrogen ATC
Peroxide-Induced Leaf Cell Death in Rice Ma, N., et al, (2013). Overexpression of OsEXPA8, a facilitating cell root-specific gene, improves rice growth and root OsEXPA8 extension system architecture by facilitating cell extension.
PLOS ONE, 8(10), e75997-.
Broad spectrum Filipe, 0., et al. (2018). "The energy sensor OsSnRKla disease resistance OsSnRKla confers broad-spectrum disease resistance (rice blast) in rice." Sci Rep 8(1): 3864.
Ning Xu., et al.(2018). Rice transcription factor OsMADS25 modulates root growth and confers OsMADS25 Root development salinity tolerance via the ABA-mediated regulatory pathway and ROS scavenging. PLoS genetics.
MHZ5 Root and coleoptile Yin, C. C., et al. (2015). Ethylene responses in rice growth roots and coleoptiles are differentially regulated by a carotenoid isomerase-mediated abscisic acid pathway.
Plant Cell, 27(4), 1061-1081.
Xu, M., et al.(2005)A pinl family gene, ospinl, Root development and involved in auxin-dependent adventitious root OsPIN1 tillering emergence and tillering in rice. Plant &
Cell Physiology(10), 1674.
Bae, H., et al. (2011). "Overexpression of OsRDCP1, Drought stress a rice RING domain-containing E3 ubiquitin ligase, OsRDCP1 tolerance increased tolerance to drought stress in rice (Oryza sativa L.)." Plant Sci 180(6): 775-782.
Zou, Y., et al. (2014). "OsRPK1, a novel leucine-rich Negatively regulate OsRPK1 plant height and tiller repeat receptor-like kinase, negatively regulates polar auxin transport and root development in rice."
number Biochim Biophys Acta 1840(6): 1676-1685.
Negatively regulates Huang, L., et al. (2016). "Rice NAC transcription drought tolerance and ONAC095 factor ONAC095 plays opposite roles in drought and positively regulates cold stress tolerance." BMC Plant Biol 16(1): 203.
cold tolerance Fang, Z., et al. (2021). "The Amino Acid Transporter OsAAP4 Contributes to Rice Tillering and Grain OsAAP4 Tillering and yield Yield by Regulating Neutral Amino Acid Allocation through Two Splicing Variants." Rice (N Y) 14(1): 2.
Zang, A., et al. (2010). Overexpression of OsRAN2 in rice and Arabidopsis renders transgenic plants OsRAN2 Abiotic stress hypersensitive to salinity and osmotic stress. Journal of experimental botany, 61(3), 777-789.
Zhou, J., et al (2020). CYP71D8L is a key regulator OsCYP71D
involved in growth and stress responses by mediating Abiotic stress gibberellin homeostasis in rice. Journal of experimental botany, 71(3), 1160-1170.
Zhang, C. et al (2011). An apoplastic h-type Development and thioredoxin is involved in the stress response through OsTRXhl stress response regulation of the apoplastic reactive oxygen species in rice Plant Physiology, 157(4), 1884-1899.
To exert strong Petruccelli, S., et al. (2001).
"Transcription factor negative effect on the RF2a alters expression of the rice tungro bacilliform RF2a development of virus promoter in transgenic tobacco plants."
Proc transgenic plants Natl Acad Sci U S A 98(13): 7635-7640.
Yao, L., et al. (2018). The AWPM-19 family protein OsPM1 Response to drought OsPM1 mediates abscisic acid influx and drought response in rice. The Plant Cell, 30(6), 1258-1276.
Kim, S. K., et al. (2008). "OsCO3, a To delay flowering in CONSTANS-LIKE gene, controls flowering by OsCO3 the conditions of short daylight negatively regulating the expression of FT-like genes under SD conditions in rice." Planta 228(2): 355-365 Fang, C., et al. (2017). "Overexpression of Lsil in Resistance to cold cold-sensitive rice mediates transcriptional regulatory OsLsil stress networks and enhances resistance to chilling stress."
Plant Sci 262: 115-126.
Zhu, Z., et al. (2020). "New insights into Perox3 Rice blast resistance bsr-dl-mediated broad-spectrum resistance to rice blast." Mol Plant Pathol 21(7): 951-960.
Chujo, T., et al. (2014). "Overexpression of phosphomimic mutated OsWRKY53 leads to OsWRKY53 Rice blast resistance enhanced blast resistance in rice." PLoS One 9(6):
e98737.
Wang, Q., et al. (2018). "Resistance protein Pit interacts with the GEF OsSPK1 to activate OsRacl OsSPK1 Rice blast resistance and trigger rice immunity." Proc Natl Acad Sci U S A
115(49): E11551-E11560.
Xu, G., et al. (2020). "A fungal effector targets a heat shock-dynamin protein complex to modulate OsDjA9 Rice blast resistance mitochondrial dynamics and reduce plant immunity."
Sci Adv 6(48).
Bundo, M. and M. Coca (2016). "Enhancing blast disease resistance by overexpression of the OsCPK4 Rice blast resistance calcium-dependent protein kinase OsCPK4 in rice."
Plant Biotechnol J 14(6): 1357-1367.
Li, X. P., et al. (2020). "Osa-miR162a fine-tunes rice Osa-miR162 Rice blast resistance resistance to Magnaporthe oryzae and Yield." Rice (N
Y) 13(1): 38.
Zhang, C., et al. (2020). "A fungal effector and a rice APIP4 Rice blast NLR protein have antagonistic effects on a Bowman-Birk trypsin inhibitor." Plant Biotechnol J
18(11): 2354-2363.
Chen, X., et al. (2018). "The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase OsTPS19 Rice blast in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae."
Plant Biotechnol J 16(10): 1778-1787.
Qu, L. J., et al. (2003). "Molecular cloning and functional analysis of a novel type of Bowman-Birk RBBI2-3 Rice blast inhibitor gene family in rice." Plant Physiol 133(2):
560-570.
Rehmeyer, C., et al. (2006). "Organization of chromosome ends in the rice blast fungus, TLH Rice blast Magnaporthe oryzae." Nucleic Acids Res 34(17):
4685-4701.
Schaffrath, U., et al. (2000). "Constitutive expression of the defense-related Rirlb gene in transgenic rice Rirlb Rice blast plants confers enhanced resistance to the rice blast fungus Magnaporthe grisea." Plant Mol Biol 43(1):
59-66.
Wang, C., et al. (2019). "Overexpression of MoSDT1 Rice blast Magnaporthe Oryzae Systemic Defense Trigger 1 (MoSDT1) Confers Improved Rice Blast Resistance in Rice." Int J Mol Sci 20(19).
Saint-Macary, M. E., et al. (2015). "Methionine biosynthesis is essential for infection in the rice blast Met6 Rice blast fungus Magnaporthe oryzae." PLoS One 10(4):
e0111108.
Selvaraj, P., et al. (2017). "Cpk2, a Catalytic Subunit Cpk2 Rice blast of Cyclic AMP-PKA, Regulates Growth and Pathogenesis in Rice Blast." Front Microbiol 8: 2289.
Tang, M., et al. (2017). "The Nup98 Homolog APIP12 Targeted by the Effector AvrPiz-t is Involved in Rice APIP12 Rice blast Basal Resistance Against Magnaporthe oryzae." Rice (N Y) 10(1): 5.
Saunders, D. G., et al. (2010). "Spatial uncoupling of mitosis and cytokinesis during appressorium-mediated SEP1 Rice blast plant infection by the rice blast fungus Magnaporthe oryzae." Plant Cell 22(7): 2417-2428.
Yu, J., eta! (2019). Increased autophagy of rice can Nitrogen use OsATG8a efficiency increase yield and nitrogen use efficiency (NUE).
Frontiers in plant science, 10, 584.
Iwamoto M. and A. Tagiri (2016).
To improve nutrient ' "MicroRNA-targeted transcription factor gene RDD 1 RDD1 uptake and increase yield promotes nutrient ion uptake and accumulation in rice." Plant J 85(4): 466-477.
Zhang, L., et al (2015). Three CCT domain-containing genes were identified to regulate heading date by OsCCT19 Head sprouting candidate gene-based association mapping and transformation in rice. Scientific reports, 5(1), 1-11.
Zhang, L., et al (2015). Three CCT domain-containing genes were identified to regulate heading date by OsCCT11 Head sprouting candidate gene-based association mapping and transformation in rice. Scientific reports, 5(1), 1-11.
Zhang, L., et al (2015). Three CCT domain-containing OsCCTO1 Head sprouting genes were identified to regulate heading date by candidate gene-based association mapping and transformation in rice. Scientific reports, 5(1), 1-11.
Itoh, H., et al. (2005). "Overexpression of a GRAS
Gibberellin signaling SLRL1 protein lacking the DELLA domain confers altered repressor gibberellin responses in rice." Plant J 44(4): 669-679.
He, Z., et al. (2017). "OsGIF1 Positively Regulates Yield and plant OsGIF1 the Sizes of Stems, Leaves, and Grains in Rice." Front morphology Plant Sci 8: 1730.
Kim, Y. S., et al. (2013). "Homologous expression of cytosolic dehydroascorbate reductase increases grain OsDHAR1 Yield and biomass yield and biomass under paddy field conditions in transgenic rice (Oryza sativa L. japonica)." Planta 237(6): 1613-1625.
Huang, Y., et al. (2020). "Wide Grain 7 increases grain width by enhancing H3K4me3 enrichment in the WG7 Yield OsMADS1 promoter in rice (Oryza sativa L.)." Plant J
102(3): 517-528 Sahoo, R. K., et al. (2012). "Pea DNA helicase 45 PDH45 Yield promotes salinity stress tolerance in IR64 rice with improved yield." Plant Signal Behav 7(8): 1042-1046.
Fan, C., et al. (2019). "Sucrose Synthase Enhances Hull Size and Grain Weight by Regulating Cell OsSUS3 Yield Division and Starch Accumulation in Transgenic Rice." Int J Mol Sci 20(20).
Ye, Y., et al (2018). OsSND2, a NAC family transcription factor, is involved in secondary cell wall OsSND2 Yield biosynthesis through regulating MYBs expression in rice. Rice, 11(1), 1-14.
Wang, M., et al (2016). "OsSGL, a novel pleiotropic OsSGL Yield stress-related gene enhances grain length and yield in rice." Sci Rep 6: 38157.
Zhang, Y., et al (2019). The Rho-family GTPase OsRacl controls rice grain size and yield by OsRacl Yield regulating cell division. Proceedings of the National Academy of Sciences, 116(32), 16121-16126 Fu, X., et al. (2019). "Enhanced Expression of QTL
OsqLL9 Yield qLL9/DEP1 Facilitates the Improvement of Leaf Morphology and Grain Yield in Rice." Int J Mol Sci 20(4).
Fan, X., et al. (2016). "Overexpression of a pH-sensitive nitrate transporter in rice increases crop OsNRT2.3b Yield yields." Proc Natl Acad Sci USA 113(26):
7118-7123.
Wang, J., et al. (2018). "Rice nitrate transporter OsNPF7.2 Yield OsNPF7.2 positively regulates tiller number and grain yield." Rice (N Y) 11(1): 12.
Wu, J.,et al (2021). Rice NIN-LIKE PROTEIN 4 plays OsNLP4 Yield a pivotal role in nitrogen use efficiency.
Plant biotechnology journal, 19(3), 448-461.
Yang, C., et al(2014). OsMYB103L, an R2R3-MYB
OsMYB103 Yield transcription factor, influences leaf rolling and mechanical strength in rice (Oryza sativa L.). BMC
plant biology, 14(1), 1-15.
Zhang, Y., et al(2017). OsMPH1 regulates plant OsMPH1 Yield height and improves grain yield in rice. PLoS
one, 12(7), e0180825.
Zhao, M.,et al (2015). Regulation of OsmiR156h OsmiR156 Yield through alternative polyadenylation improves grain yield in rice. PloS one, 10(5), e0126154.
Zou, X., et al. (2015). "Over-expression of an S-domain receptor-like kinase extracellular domain OsLSK1 Yield improves panicle architecture and grain yield in rice."
J Exp Bot 66(22): 7197-7209.
Qi, W., et al. (2011). "Rice ethylene-response AP2/ERF factor OsEATB restricts internode OsEATB Yield elongation by down-regulating a gibberellin biosynthetic gene." Plant Physiol 157(1): 216-228.

Guan, Q., et al. (2017). "Tolerance analysis of OsCu/Zn-S chloroplast 0 sCu/Zn-SOD overexpressing rice under Yield OD NaCl and NaHCO3 stress." PLoS One 12(10):
e0186052.
Yang, X.,et al (2018). Overexpression of OsbHLH107, a member of the basic helix-loop-helix OsbHLH107 Yield transcription factor family, enhances grain size in rice (Oryza sativa L.). Rice, 11(1), 1-12.
Seo, H., et al. (2020). "The Rice Basic OsbHLH079 Yield Helix-Loop-Helix 79 (OsbHLH079) Determines Leaf Angle and Grain Shape." Int J Mol Sci 21(6).
Zhen, X., et al(2019). OsATG8c-mediated increased OsATG8c Yield autophagy regulates the yield and nitrogen use efficiency in rice. International journal of molecular sciences, 20(19), 4956.
Lee, S., et al. (2020). "OsASN1 Overexpression in Rice Increases Grain Protein Content and Yield under OsASN1 Yield Nitrogen-Limiting Conditions." Plant Cell Physiol 61(7): 1309-1320.
Yaish, M. W., et al(2010). The APETALA-2-like OsAP2-39 Yield transcription factor OsAP2-39 controls key interactions between abscisic acid and gibberellin in rice. PLoS Genet, 6(9), el001098.
He, Q., et al. (2018). "Overexpression of an auxin receptor OsAFB6 significantly enhanced grain yield OsAFB6 Yield by increasing cytokinin and decreasing auxin concentrations in rice panicle." Sci Rep 8(1): 14051.
Guo, Z. H., et al. (2019). "The overexpression of rice ACYL-CoA-BINDING PROTEIN2 increases grain OsACBP2 Yield size and bran oil content in transgenic rice." Plant J
100(6): 1132-1147.
Zhao, J.,et al (2019). ABC transporter OsABCG18 controls the shootward transport of cytokinins and OsABCG18 Yield grain yield in rice. Journal of experimental botany, 70(21), 6277-6291.
Ji, Y., et al. (2020). "The amino acid transporter AAP1 mediates growth and grain yield by regulating OsAAP6 Yield neutral amino acid uptake and reallocation in Oryza sativa." J Exp Bot 71(16): 4763-4777.
Zhang, M.,et al (2021). Plasma membrane H+-ATPase overexpression increases rice yield via simultaneous OSA1 Yield enhancement of nutrient uptake and photosynthesis.
Nature communications, 12(1), 1-12.
Huo, X., et al. (2017). "NOG1 increases grain NOG1 Yield production in rice." Nat Commun 8(1): 1497 Zhao, Y. F., et al(2019). "miR1432-0sACOT
(Acyl-CoA thioesterase) module determines grain miR1432 Yield yield via enhancing grain filling rate in rice." Plant biotechnology journal, 17(4), 712-723.
LRK1 Yield Zha, X.,et.al (2009). "Overexpression of the rice LRK1 gene improves quantitative yield components."
Plant biotechnology journal, 7(7), 611-620.
Wang, Y.,et al (2018). "Overexpressing lncRNA
LAIR Yield LAIR
increases grain yield and regulates neighbouring gene cluster expression in rice." Nature communications, 9(1), 1-9.
Piao, R., et al. (2014). "Isolation and characterization HD1 Yield of a dominant dwarf gene, d-h, in rice." PLoS
One 9(2) e86210.
Shi, C. L., et al. (2020). "A quantitative trait locus GW6 Yield GW6 controls rice grain size and yield through the gibberellin pathway." Plant J 103(3): 1174-1188.
Zhou, Y., et al (2017). "GNS4, a novel allele of GNS4 Yield DWARF11, regulates grain number and grain size in a high-yield rice variety." Rice, 10(1), 1-11.
Swamy, B. P., et al. (2013). "Genetic, physiological, DEGs Yield and gene expression analyses reveal that multiple QTL enhance yield of rice mega-variety IR64 under drought." PLoS One 8(5): e62795.
Wu, Y., et al (2016). "CLUSTERED PRIMARY
BRANCH 1, a new allele of DWARF 11, controls CPB1/D11 Yield panicle architecture and seed size in rice." Plant biotechnology journal, 14(1), 377-386.
Liu, L., et al. (2015). "Activation of big grainl Bi Grain 1 Yield significantly improves grain size by regulating auxin g transport in rice." Proc Natl Acad Sci U S A.
112:11102-11107.
Selvaraj, M. G., et al. (2017). "Overexpression of an Arabidopsis thaliana galactinol synthase gene AtGolS2 Yield improves drought tolerance in transgenic rice and increased grain yield in the field." Plant Biotechnol J
15(11): 1465-1477.
0 sNLP1(NI Alfatih, A., et al. (2020). "Rice NIN-LIKE
PROTEIN
N-LIKE Yi eld 1 rapidly responds to nitrogen deficiency and PROTEIN improves yield and nitrogen use efficiency." J Exp 1) Bot 71(19): 6032-6042.
Qu, M., et al. (2020). "Alterations in stomatal OsNHX1 Yield response to fluctuating light increase biomass and yield of rice under drought conditions." Plant J
104(5): 1334-1347.
Qian, W., et al. (2017). "Novel rice mutants CYP734A4 Yield overexpressing the brassinosteroid catabolic gene CYP734A4." Plant Mol Biol 93(1-2): 197-208.
Verma, R. K., et al. (2020). "Overexpression of AtICE1 Yield Arabidopsis ICE1 enhances yield and multiple abiotic stress tolerance in indica rice." Plant Signal Behav 15(11): 1814547.
Domingo, C., et al. (2009). "Constitutive expression O sGH3. 1 Resistance to a fungal of OsGH3.1 reduces auxin content and enhances pathogen defense response and resistance to a fungal pathogen in rice." Mol Plant Microbe Interact 22(2): 201-210.

Alam, M. M., etal. (2015). "Overexpression of a rice Tolerance to heme activator protein gene (0sHAP2E) confers OsHAP2E pathogens, salinity resistance to pathogens, salinity and drought, and and drought increases photosynthesis and tiller number."
Plant Biotechnol J 13(1): 85-96.
Dai, M., etal. (2008). "Functional analysis of rice Semi-dwarfing HOMEOBOX4 (0shox4) gene reveals a negative Oshox4 phenotype function in gibberellin responses." Plant Mol Biol 66(3): 289-301.
Yang, D. L., et al (2008). "Altered Disease Resistance to bacterial Development in the eui Mutants EUI leaf blight and leaf and Eui Overexpressors Indicates that Gibberellins blast in rice Negatively Regulate Rice Basal Disease Resistance. "Molecular plant, 1(3), 528-537.
Caddell, D. F., et al. (2017). "Silencing of the Rice Resistance to bacterial Gene LRR1 Compromises Rice Xa21 Transcript leaf blight in rice Accumulation and XA21-Mediated Immunity."
Rice (NY) 10(1): 23.
Ding, X., et al. (2008). "Activation of the indole-3-acetic acid-amido synthetase GH3-8 Resistance to bacterial GH3-8, suppresses expansin expression and promotes leaf blight in rice salicylate- and jasmonate-independent basal immunity in rice." Plant Cell 20(1): 228-240.
Tran, T. T., et al. (2018). "Functional analysis of OsSWEET1 Resistance to bacterial African Xanthomonas oryzae pv. oryzae TALomes 4 leaf blight in rice reveals a new susceptibility gene in bacterial leaf blight of rice." PLoS Pathog 14(6): e1007092.
Sharma, A., et al. (2000). "Transgenic expression of Resistance to bacterial cecropin B, an antibacterial peptide from Bombyx cecropin B
leaf blight in rice mori, confers enhanced resistance to bacterial leaf blight in rice." FEBS Lett 484(1): 7-11.
Hogue, M. S., et al. (2006). "Over-expression of the rice OsAMT1-1 gene increases ammonium uptake and OsAMT1-1 Ammonium uptake content, but impairs growth and development of plants under high ammonium nutrition." Funct Plant Biol 33(2): 153-163.
Lan, J., etal. (2020). "Small grain and semi-dwarf 3, a WRKY transcription factor, negatively regulates plant OsWRKY36 Dwarfing height and grain size by stabilizing SLR1 expression in rice." Plant Mol Biol 104(4-5): 429-450 He, Q., et al. (2020). "OsbHLH6 interacts with bHLH6 Pi uptake OsSPX4 and regulates the phosphate starvation response in rice.' Plant J.
Huang, W., et al. (2018) "Two Splicing Variants of Nitrogen uptake and OsNPF7.7 OsNPF7.7 Regulate Shoot Branching and Nitrogen utilization Utilization Efficiency in Rice." Front Plant Sci 9: 300.
Kobayashi, T., et al. (2020). "Iron deficiency-inducible peptide coding genes OsIMA1 OsIMA1 Fe uptake and OsIMA2 positively regulate a major pathway of iron uptake and translocation in rice." J Exp Bot.

Dey, A., et al. (2016). "The sucrose non-fermenting 1-related kinase 2 gene SAPK9 improves drought Drought tolerance and tolerance and grain yield in rice by modulating grain yield cellular osmotic potential, stomatal closure and stress-responsive gene expression." BMC Plant Biol 16(1): 158.
La, H., et al. (2011). "A 5-methylcytosine DNA
glycosylase/lyase demethylates the retrotransposon DNG701 DNA methylation Tos17 and promotes its transposition in rice." Proc Natl Acad Sci USA 108(37): 15498-15503.
Feng, Z., et al. (2016). "SLG controls grain size and OsSLG grain yield leaf angle by modulating brassinosteroid homeostasis in rice." J Exp Bot 67(14): 4241-4253.
Table I lists the representative functional genes in wheat. Methods in the present invention can be used to edit such genes and create new genes by designing new combinations of different gene elements or different protein domain, and can be utilized in wheat breeding program.
Table I: Important functional genes in wheat Gene name Application Reference Ashikawa I, et al. (2010). Ectopic expression of wheat and barley TaDOG1L Seed dogl-like genes promotes seed dormancy in arabidopsis.
Plant 1 dormancy Science An International Journal of Experimental Plant Biology, 179(5), 536-542.
Cai-Li B I, et al. (2010). Cloning and characterization of a Salt CTR1 putative ctrl gene from wheat. Journal of Integrative Agriculture, resistance 9(009), 1241-1250.
Dong N, et al. (2010). Overexpression of tapiepl, a Pathogenic TaPIEP1 bacteria pathogen-induced erf gene of wheat, confers host-enhanced resistance to fungal pathogen bipolaris sorokiniana. Functional &
resistance Integrative Genomics, 10(2), 215-226.
Valquiria R M Pierucci, et al. (2009). Effects of overexpression of Flour 1Dy12 high molecular weight glutenin subunit 1 dy10 on wheat tortilla quality properties. J Agric Food Chem, 57(14), 6318-6326.
Zhou W, et al. (2009). Overexpression of tastrg gene improves Salt STRP salt and drought tolerance in rice. Journal of Plant Physiology, resistance 166(15), 1660-1671.
Xu Z S, et al. (2008). Characterization of the taaidfa gene Signal encoding a crt/dre-binding factor responsive to drought, high-salt, TaAIDFa transductio and cold stress in wheat. Molecular Genetics & Genomics, 280(6), 497-508.
Sugie A, et al. (2006). Overexpression of wheat alternative Cold oxidase gene waoxla alters respiration capacity and response to Waoxla tolerance reactive oxygen species under low temperature in transgenic arabidopsis. Genes & Genetic Systems, 81(5), 349-354.
Li C, et al. (2006). Cloning and expression analysis of tskl, a Promotion wheat skpl homologue, and functional comparison with skpl of cell division arabidopsis askl in male meiosis and auxin signalling.
Functional Plant Biology, 33(4), 381-390.

Drought Mao, H., et al. (2020). "Regulatory changes in TaSNAC8-6A are TaSNAC8- tolerance in associated with drought tolerance in wheat seedlings." Plant 6A seedling Biotechnol J 18(4): 1078-1092.
stage Sheath Lu, L., et al. (2019). "TaCML36, a wheat calmodulin-like protein, TaCML36 blight positively participates in an immune response to Rhizoctonia disease cerealis." Crop Journal 7(5): 608-618.
resistance Salt and Ayadi, M., et al (2019). "Overexpression of a Wheat Aquaporin TdPIP2;1 drought Gene, TdPIP2;1, Enhances Salt and Drought Tolerance in tolerance Transgenic Durum Wheat cv. Maali." Int J Mol Sci 20(10).
Liu, P., et al. (2019). "TaCIPK10 interacts with and Stripe rust TaCIPK10 phosphorylates TaNH2 to activate wheat defense responses to resistance stripe rust." Plant Biotechnol J 17(5): 956-968.
Drought Kalaipandian, S., et al. (2019). "Overexpression of TaCML20, a tolerance TaCML20 calmodulin-like gene, enhances water soluble carbohydrate and growth accumulation and yield in wheat." Physiol Plant 165(4): 790-799.
promoting Powdery Jing, Y., et al. (2019). "Overexpression of TaJAZ1 increases TaJAZ1 mildew powdery mildew resistance through promoting reactive oxygen resistance species accumulation in bread wheat." Sci Rep 9(1):
5691.
Reduced Dong, H., et al. (2019). "TaCOLD1 defines a new regulator of TaCOLD1 height of plant height in bread wheat." Plant Biotechnol J 17(3): 687-699.
plant Salt and TaMYB86 drought Song, Y., et al. (2020). "TaMYB86B encodes a R2R3-type MYB
tolerance transcription factor and enhances salt tolerance in wheat." Plant Sci 300: 110624.
He, Y., et al. (2020). "TaUGT6, a Novel FHB
TaUGT6 UDP-Glycosyltransferase Gene Enhances the Resistance to FHB
resistance and DON Accumulation in Wheat." Front Plant Sci 11: 574775.
Yang, J. J., et al. (2020) "Expansin gene TaEXPA2 positively TaEXP A2 Drought regulates drought tolerance in transgenic wheat (Triticum tolerance aestivum L.)." Plant Science 298: 14.
Hasnain, A., et al. (2020). "Transcription Factor TaDofl N and C
TaDofl assimilatio Improves Nitrogen and Carbon Assimilation Under Low-Nitrogen Conditions in Wheat." Plant Molecular Biology Reporter 38(3):
441-451.
Su, P., et al. (2020). "A member of wheat class III peroxidase Salt TaPRX-2A gene family,TaPRX-2A,enhanced the tolerance of salt stress."
tolerance BMC Plant Biol 20(1).
Salt Wang, W., et al. (2020). "The involvement of wheat U-box E3 TaPUB1 ubiquitin ligase TaPUB1 in salt stress tolerance." J
Integr Plant tolerance Biol 62(5): 631-651.
Cheuk, A., et al. (2020). "The barley stripe mosaic virus Drought expression system reveals the wheat C2H2 zinc finger protein TaZFP1B
tolerance TaZFP1B as a key regulator of drought tolerance." BMC Plant Biol 20(1): 144.

Dmochowska-Boguta, M., et al. (2020). "TaWAK6 encoding Leaf rust TaWAK6 wall-associated kinase is involved in wheat resistance to leaf rust resistance similar to adult plant resistance." PLoS One 15(1): e0227713.
sheath Liu, X., et al. (2020). "The wheat LLM-domain-containing blight TaGATA1 disease transcription factor TaGATA1 positively modulates host immune response to Rhizoctonia cerealis." J Exp Bot 71(1): 344-355.
resistance Zhao, Y. J., et al. (2020). "Characterization on the water TaMAPK1 Drought deprivation-associated physiological traits as well as the related 6 tolerance differential genes during seed filling stage in wheat (T. aestivum L.)." Plant Cell Tissue and Organ Culture 140(3): 605-618.
Heat and Zang, X., et al. (2018). "Overexpression of the Wheat (Triticum TaPEPKR aestivum L.) TaPEPKR2 Gene Enhances Heat and Dehydration drought 2 Tolerance in Both Wheat and Arabidopsis." Front Plant Sci 9:
tolerance 1710.
Drought Gao, H., et al. (2018). "Overexpression of a WRKY Transcription TaWRKY2 Factor TaWRKY2 Enhances Drought Stress Tolerance in tolerance Transgenic Wheat." Front Plant Sci 9: 997.
Liu, Z., et al. (2018). "TaNBP1, a guanine nucleotide-binding Low subunit gene of wheat, is essential in the regulation of N
TaNBP1 nitrogen starvation adaptation via modulating N acquisition and ROS
tolerance homeostasis." BMC Plant Biol 18(1): 167.
Qiao, Q. H., et al. (2018). "Wheat miRNA member TaMIR2275 Low TaMIR227 involves plant nitrogen starvation adaptation via enhancement of nitrogen the N acquisition-associated process." Acta Physiologiae tolerance Plantarum 40(10): 13.
Bi, H., et al. (2018). "Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf surface Drought TaSHN1 modifications, improved drought tolerance, and no yield penalty tolerance under controlled growth conditions." Plant Cell Environ 41(11):
2549-2566.
Promoting Hu, M., et al. (2018). "Transgenic expression of plastidic TaGS2-2A nitrogen use glutamine synthetase increases nitrogen uptake and yield in wheat." Plant Biotechnol J 16(11): 1858-1867.
efficiency To enhance Chen, D., et al. (2018). "Overexpression of a predominantly drought TaRNAC1 tolerance root-expressed NAC transcription factor in wheat roots enhances of root root length, biomass and drought tolerance." Plant Cell Rep 37(2) 225-237.
system Powdery Chen, G., et al. (2018). "TaEDS1 genes positively regulate TaED S1 mildew resistance to powdery mildew in wheat." Plant Mol Biol 96(6):
resistance 607-625.
Xing, L. P., et al. (2018). "Over-expressing a Ta-UGT Head blight UDP-glucosyltransferase gene (Ta-UGT (3) ) enhances Fusarium (3) resistance Head Blight resistance of wheat." Plant Growth Regulation 84(3):
561-571.
Sheath Wang, M., et al. (2018). "A wheat caffeic acid aCOMT-3 blight 3-0-methyltransferase TaCOMT-3D positively contributes to disease both resistance to sharp eyespot disease and stem mechanical resistance strength." Sci Rep 8(1): 6543.

Cui, X. Y., et al. (2018). "Wheat CBL-interacting protein kinase TaCIPK23 Drought23 positively regulates drought stress and ABA responses."
BMC
tolerance Plant Biol 18(1): 93.
Drought Zhang, N., et al. (2017). "The E3 Ligase TaSAP5 Alters Drought TaSAP5 Stress Responses by Promoting the Degradation of DRIP
tolerance Proteins." Plant Physiol 175(4): 1878-1892.
TaTAR2.1- To increase Shao, A., et al. (2017). "The Auxin Biosynthetic TRYPTOPHAN
yield and AMINOTRANSFERASE RELATED TaTAR2.1-3A Increases biomass Grain Yield of Wheat." Plant Physiol 174(4): 2274-2288.
Sheath Zhu, X., et al. (2017). "The wheat NB-LRR gene TaRCR1 is blight required for host defence response to the necrotrophic fungal TaRCR1 disease pathogen Rhizoctonia cerealis." Plant Biotechnol J
15(6):
resistance 674-687.
Wei, X., et al. (2017). "TaPIMP2, a pathogen-induced MYB
root rot TaPIMP2 protein in wheat, contributes to host resistance to common root resistance rot caused by Bipolaris sorokiniana." Sci Rep 7(1): 1754.
Yang, M. Y., et al. (2017). "Wheat nuclear factor Y (NF-Y) B
TaNF-YB3 Drought subfamily gene TaNF-YB3;1 confers critical drought tolerance ;1 tolerance through modulation of the ABA-associated signaling pathway."
Plant Cell Tissue and Organ Culture 128(1): 97-111.
Zang, X., et al. (2017). "Overexpression of wheat ferritin gene Heat and TaFER-5B enhances tolerance to heat stress and other abiotic TaFER-5B other stresses associated with the ROS scavenging." BMC Plant Biol tolerance 17(1): 14.
Sheath Rong, W., et al. (2016). "A Wheat Cinnamyl Alcohol TaCAD12 blightDehydrogenase TaCAD12 Contributes to Host Resistance to the disease Sharp Eyespot Disease." Front Plant Sci 7: 1723.
resistance Sheath Wei, X., et al. (2016). "The wheat calcium-dependent protein blight TaCPK7-D kinase TaCPK7-D positively regulates host resistance to sharp disease eyespot disease." Mol Plant Pathol 17(8): 1252-1264.
resistance Nitrogen Yang, T., et al. (2016). "TabHLH1, a bHLH-type transcription and factor gene in wheat, improves plant tolerance to Pi and N
TabHLH1 phosphorus deprivation via regulation of nutrient transporter gene stress transcription and ROS homeostasis." Plant Physiol Biochem 104:
tolerance 99-113.
Sheath Shan, T., et al. (2016). "The wheat R2R3-MYB
transcription blight factor TaRIM1 participates in resistance response against the TaRIM1 disease pathogen Rhizoctonia cerealis infection through regulating resistance defense genes." Sci Rep 6: 28777.
Zhao, Y., et al. (2016). "A putative pyruvate transporter Salt TaBASS2 TaBASS2 positively regulates salinity tolerance in wheat via tolerance modulation of ABI4 expression." BMC Plant Biol 16(1): 109.
Wang, M., et al. (2016). "A wheat superoxide dismutase gene Salt stress TaSOD2 enhances salt resistance through modulating redox TaSOD2 and other homeostasis by promoting NADPH oxidase activity." Plant Mol stresses Biol 91(1-2): 115-130.
Powdery Chen, T., et al. (2016). "Two members of TaRLK family confer TaRLK1/T
mildew powdery mildew resistance in common wheat." BMC Plant Biol aRLK2 resistance 16: 27.

Ryoko Morimoto, et al. (2005)Intragenic diversity and functional Formation conservation of the three homoeologous loci of the KN1 -type Wknoxl of leaf homeobox gene Wknoxl in common wheat. Plant Molecular blade Biology, 57(6).
Stress response Kurek I., et al. (2002) Overexpression of the wheat fk506-binding FKBP and protein 73 (fkbp73) and the heat-induced wheat fkbp77 in photosynth transgenic wheat reveals different functions of the two isoforms.
esis Transgenic Res, 11(4): 373-9.
enhancing TaMloA/B Powdery Elliott C., et al. (2002) Functional conservation of wheat and rice mildew mlo orthologs in defense modulation to the powdery mildew /D
resistance fungus. Mol Plant Microbe Interact, 15(10): 1069-77.
Christensen A. B., et al.(2004), The germinlike protein g1p4 Disease exhibits superoxide dismutase activity and is an important GLP
resistance component of quantitative resistance in wheat and barley[J]. Mob Plant Microbe Interact, 17(1): 109-17.
wide adaptabilit Simons K. J., et al. (2006),Molecular characterization of the Q gene y, plant morpholog major wheat domestication gene q. Genetics, 172(1): 547-55.
Flowering Zhao X. Y., et al. (2005), The wheat tagil, involved in TaGI1 time photoperiodic flowering, encodes an arabidopsis gi ortholog[J].
regulation Plant Mob Biol, 58(1): 53-64..
Bahrini, I., et al. (2011). "Overexpression of the TaWRKY4 Head blight pathogen-inducible wheat TaWRKY45 gene confers disease resistance resistance to multiple fungi in transgenic wheat plants." Breed Sci 61(4): 319-326.
Regulation Pearce, S., et al. (2011). "Molecular characterization of Rht-1 Rht-Al of plant dwarfing genes in hexaploid wheat." Plant Physiol 157(4):
height 1820-1831.
Zhang, H., et al. (2011). "Characterization of a common wheat TaSnRK2. Abio-stress (Triticum aestivum L.) TaSnRK2.7 gene involved in abiotic stress 7 tolerance responses." J Exp Bot 62(3): 975-988.
Head blight Han' J.' et al. (2012). "Transgenic expression of lactoferrin BLF imparts enhanced resistance to head blight of wheat caused by resistance Fusarium graminearum." BMC Plant Biol 12: 33.
Kikuchi, R., et al. (2012). "The differential expression of HvC09, Flowering a member of the CONSTANS-like gene family, contributes to the HvC09 time control of flowering under short-day conditions in barley." J Exp regulation Bot 63(2): 773-784.
Saville, R. J., et al. (2012). "The 'Green Revolution' dwarfing Disease DELLA genes play a role in disease resistance in Triticum aestivum and resistance Hordeum vulgare." J Exp Bot 63(3): 1271-1283.
Stripe rust Wang, X., et al. (2012). "Wheat BAX inhibitor-1 contributes to TaBI-1 wheat resistance to Puccinia striiformis." J Exp Bot 63(12):
resistance 4571-4584.

Anther Wang, Y., et al. (2012). "TamiR159 directed wheat TaGAMYB
TaGAMY developme nt and heat cleavage and its involvement in anther development and heat response." PLoS One 7(11): e48445.
response Salt Zhang, L., et al. (2012). "Molecular characterization of 60 TaMYB32 isolated wheat MYB genes and analysis of their expression during tolerance abiotic stress." J Exp Bot 63(1): 203-214.
Dong, W., et al. (2013). "Wheat oxophytodienoate reductase gene Salt Ta0PR1 confers salinity tolerance via enhancement of abscisic Ta0PR1 tolerance acid signaling and reactive oxygen species scavenging." Plant Physiol 161(3): 1217-1228.
Fusarium Kim, H. K., et al. (2013). "Functional roles of FgLaeA in graminearu FgLaeA controlling secondary metabolism, sexual development, and -m virulence in Fusarium graminearum." PLoS One 8(7): e68441 resistance Liu, X., et al. (2013). "Transgenic wheat expressing Thinopyrum TiMYB2R full rot intermedium MYB transcription factor TiMYB2R-1 shows -1 disease enhanced resistance to the take-all disease." J Exp Bot 64(8):
2243-2253.
Pasquali, M., et al. (2013). "FcStuA from Fusarium culmorum Fusarium FgStuA culmorum controls wheat foot and root rot in a toxin dispensable manner."
PLoS One 8(2): e57429.
Qin, Z., et al. (2013). "Ectopic expression of a wheat WRKY
TaWRKY7 Dormancy 1-1 regulation transcription factor gene TaWRKY71-1 results in hyponastic leaves in Arabidopsis thaliana." PLoS One 8(5): e63033.
Fusarium Son, H., et al. (2013). "AbaA regulates conidiogenesis in the graminearu AbaA ascomycete fungus Fusarium graminearum." PLoS One 8(9):
-m e72915.
resistance Gulyas, Z., et al. (2014). "Central role of the flowering repressor Flowering ZCCT2 in the redox control of freezing tolerance and the initial ZCCT
regulation development of flower primordia in wheat." BMC Plant Biol 14:
91.
Liu, S., et al. (2014). "A wheat SIMILAR TO RCD-ONE gene Abio-stress enhances seedling growth and abiotic stress resistance by Ta-srol tolerance modulating redox homeostasis and maintaining genomic integrity." Plant Cell 26(1): 164-180.
Zheng, J., et al. (2014). "TEF-7A, a transcript elongation factor TaTEF-7A Yield gene, influences yield-related traits in bread wheat (Triticum aestivum L.)." J Exp Bot 65(18): 5351-5365.
He, X., et al. (2015). "The Nitrate-Inducible NAC Transcription TaNAC2-5 Yield Factor TaNAC2-5A Controls Nitrate Response and Increases A
Wheat Yield." Plant Physiol 169(3): 1991-2005.
Fusarium Perochon, A., et al. (2015). "TaFROG Encodes a Pooideae TaFROG graminearu Orphan Protein That Interacts with SnRK1 and Enhances -m Resistance to the Mycotoxigenic Fungus Fusarium graminearum."
resistance Plant Physiol 169(4): 2895-2906.
Tang, C., et al. (2015). "PsANT, the adenine nucleotide Disease PsANT translocase of Puccinia striiformis, promotes cell death and resistance fungal growth." Sci Rep 5: 11241.

Salt Yu, G.
H., et al. (2015). "Changes in the Physiological SbPIP1 Parameters of SbPIP1-Transformed Wheat Plants under Salt tolerance Stress." Int J Genomics 2015: 384356.
Ab io-stress Zhang, L., et al. (2015). "The Novel Wheat Transcription Factor TaNAC47 TaNAC47 Enhances Multiple Abiotic Stress Tolerances in tolerance Transgenic Plants." Front Plant Sci 6: 1174.
A Zhou, S. M., et al. (2015). "The involvement of wheat F-box nti-oxid at TaFBA1 protein gene TaFBA1 in the oxidative stress tolerance of plants."
ion PLoS One 10(4) e0122117.
Powdery Zhu, Y., et al. (2015). "E3 ubiquitin ligase gene CMPG1-V from CMPG1-V mildew Haynaldia villosa L. contributes to powdery mildew resistance in resistance common wheat (Triticum aestivum L.)." Plant J 84(1): 154-168.
Rhizoctoni Zhu, X., et al. (2015). "The wheat AGC kinase TaAGC1 is a TaAGC1 a cerealis positive contributor to host resistance to the necrotrophic resistance pathogen Rhizoctonia cerealis." J Exp Bot 66(21): 6591-6603.
Late maturing Zhao, D., et al. (2015). "Overexpression of a NAC transcription TaNAC-S ,improve factor delays leaf senescence and increases grain nitrogen grain seed concentration in wheat." Plant Biol (Stuttg) 17(4):
904-913.
quality Abio-stress Zhang, L., et al. (2015). "A novel wheat bZIP transcription factor, TabZIP60 tolerance TabZIP60, confers multiple abiotic stress tolerances in transgenic Arabidopsis." Physiol Plant 153(4): 538-554.
Yadav, D., et al. (2015). "Constitutive overexpression of the TaNF-YB4 Promoting TaNF-YB4 gene in transgenic wheat significantly improves grain Y ield yield." J Exp Bot 66(21): 6635-6650.
Xue, G. P., et al. (2015). "TaHsfA6f is a transcriptional activator TaHsfA6f Heat that regulates a suite of heat stress protection genes in wheat response (Triticum aestivum L.) including previously unknown Hsf targets." J Exp Bot 66(3): 1025-1039.
Salt Xu, Z., et al. (2015) "Wheat NAC transcription factor TaNAC29 TaNAC29 is involved in response to salt stress." Plant Physiol Biochem 96:
tolerance 356-363.
Wagatsuma, T., et al. (2015). "Higher sterol content regulated by CYP51 Aluminum CYP51 with concomitant lower phospholipid content in tolerance membranes is a common strategy for aluminium tolerance in several plant species." J Exp Bot 66(3): 907-918.
Blue light TaGBF1 response Sun, Y., et al. (2015). "The wheat TaGBF1 gene is involved in the and salt blue-light response and salt tolerance." Plant J 84(6): 1219-1230.
tolerance Schoonbeek, H. J., et al. (2015). "Arabidopsis EF-Tu receptor Disease EF-Tu enhances bacterial disease resistance in transgenic wheat." New resistance Phytol 206(2): 606-613.
Cheng, W., et al. (2015). "Host-induced gene silencing of an Chs3b Disease essential chitin synthase gene confers durable resistance to resistance Fusarium head blight and seedling blight in wheat." Plant Biotechnol J 13(9): 1335-1345.
Fusarium Cheng, Y., et al. (2015). "Characterization of protein kinase PsSRPKL head blight PsSRPKL, a novel pathogenicity factor in the wheat stripe rust resistance fungus." Environ Microbiol 17(8): 2601-2617.

Djemal, R. and H. Khoudi (2015). "Isolation and molecular Abio-stress characterization of a novel WIN1/SHN1 ethylene-responsive TdSHN1 tolerance transcription factor TdSHN1 from durum wheat (Triticum turgidum. L. subsp. durum)." Protoplasma 252(6): 1461-1473.
Abio-stress Kong, D., et al. (2015). "Identification of TaWD40D, a wheat WD40 tolerance WD40 repeat-containing protein that is associated with plant tolerance to abiotic stresses." Plant Cell Rep 34(3): 395-410.
Ma, M., et al. (2015). "Expression of TaCYP78A3, a gene TaCYP78 Grain size encoding cytochrome P450 CYP78A3 protein in wheat (Triticum A3 regulation aestivum L.), affects seed size." Plant J 83(2): 312-325.
Seed Ashikawa, I., et al. (2014). "A transgenic approach to controlling TaDOG1L
dormancy wheat seed dormancy level by using Triticeae DOG1-like genes."

regulation Transgenic Res 23(4): 621-629.
Han, Y. Y., et al. (2014). "The involvement of expansins in Promoting TaEXPB23 uptake of responses to phosphorus availability in wheat, and its potentials phosphorus in improving phosphorus efficiency of plants." Plant Physiol Biochem 78: 53-62.
Lu, W., et al. (2014). "Overexpression of TaNHX3, a vacuolar Salt Na(+)/H(+) antiporter gene in wheat, enhances salt stress TaNHX3 tolerance tolerance in tobacco by improving related physiological processes." Plant Physiol Biochem 76: 17-28.
Abio-stress Rong, W., et al. (2014). "The ERF transcription factor TaERF3 TaERF3 promotes tolerance to salt and drought stresses in wheat." Plant tolerance Biotechnol J 12(4): 468-479.
Xu, D. B., et al. (2014). "ABI-like transcription factor gene Abio-stress TaABL1 TaABL1 from wheat improves multiple abiotic stress tolerances tolerance in transgenic plants." Funct Integr Genomics 14(4): 717-730.
Xue, G. P., et al. (2014). "The heat shock factor family from Thermo Triticum aestivum in response to heat and other major abiotic TaHsfC2a tolerance stresses and their role in regulation of heat shock protein genes."
J Exp Bot 65(2): 539-557.
Yu, G., et al. (2014). "Identification of wheat non-specific lipid Chilling TaLTP transfer proteins involved in chilling tolerance."
Plant Cell Rep tolerance 33(10): 1757-1766.
Feng, H., et al. (2013). "Target of tae-miR408, a Stripe rust chemocyanin-like protein gene (TaCLP1), plays positive roles in TaCLP1 resistance wheat response to high-salinity, heavy cupric stress and stripe rust." Plant Mol Biol 83(4-5): 433-443.
Guo, J., et al. (2013). "Wheat zinc finger protein TaLSD1, a Stripe rust negative regulator of programmed cell death, is involved in wheat TaLSD1 resistance resistance against stripe rust fungus." Plant Physiol Biochem 71:
164-172.
Starch Kang, G., et al. (2013). "Increasing the starch content and grain TaLSU I weight of common wheat by overexpression of the cytosolic content AGPase large subunit gene." Plant Physiol Biochem 73: 93-98.
Kovalchuk, N., et al. (2013). "Optimization of TaDREB3 gene Chilling TaDREB3 tolerance expression in transgenic barley using cold-inducible promoters."
Plant Biotechnol J 11(6): 659-670.
Powdery Li, S., et al. (2013). "Wheat gene TaS3 contributes to powdery TaS3 mildew mildew susceptibility." Plant Cell Rep 32(12): 1891-1901.

Heavy-met Tan, J., et al. (2013). "Functional analyses of TaHMA2, a TaHMA2 al tolerance P(1B)-type ATPase in wheat." Plant Biotechnol J 11(4): 420-431.
Tian, S., et al. (2013). "Cloning and characterization of TaSnRK2. Abio-stress TaSnRK2.3, a novel SnRK2 gene in common wheat." J Exp Bot 3 tolerance 64(7): 2063-2080.
Cai' H et al. (2011). "Identification of a MYB3R gene involved TaMYB3R Abio-stress 1 tolerance in drought, salt and cold stress in wheat (Triticum aestivum L.)."
Gene 485(2): 146-152.
Fusarium Zhu, X., et al. (2012). "Overexpression of wheat lipid transfer graminearu protein gene TaLTP5 increases resistances to Cochliobolus TaLTP5 -m sativus and Fusarium graminearum in transgenic wheat."
Funct resistance Integr Genomics 12(3): 481-488.
Salt Zhao, X., et al. (2012). "The role of TaCHP in salt stress TaCHP
resistance responsive pathways." Plant Signal Behav 7(1): 71-74.
Wang, X., et al. (2011). "TaDAD2, a negative regulator of Stripe rust programmed cell death, is important for the interaction between TaDAD2 resistance wheat and the stripe rust fungus." Mol Plant Microbe Interact 24(1): 79-90.
Table J lists some representative functional genes in tomato.
Table J: Important functional genes in in tomato Gene name Application Reference S1WRKY3 as a positive Chinnapandi, B., et al. (2019). "Tomato regulator of induced S1WRKY3 acts as a positive regulator for resistance in response S1WRKY3 to nematode invasion resistance against the root-knot nematode and infection, mostly Meloidogyne javanica by activating lipids and hormone-mediated defense-signaling pathways."
during the early stages of nematode infection. Plant Signal Behav 14(6): 1601951.
Gong, B., et al. (2014). "Overexpression of tolerance to alkali S-adenosyl-L-methionine synthetase increased S1SAMS1 tomato tolerance to alkali stress through stress polyamine metabolism." Plant Biotechnol J
12(6): 694-708.
Hu, S., et al. (2020). "Regulation of fruit ripening by the brassinosteroid biosynthetic gene 51CYP90B3 BR biosynthesis S1CYP90B3 via an ethylene-dependent pathway in tomato." Hortic Res 7: 163.
Li, S., et al. (2020). "S1TLFP8 reduces water loss decreased stomatal to improve water-use efficiency by modulating S1TLFP8 cell size and stomatal density via density endoreduplication." Plant Cell Environ 43(11):
2666-2679.
Li, X. J., et al. (2016). "DWARF overexpression improved seed induces alteration in phytohormone homeostasis, germination, root DWARF development, architecture and carotenoid development and early accumulation in tomato." Plant Biotechnol J
growth vigour 14(3): 1021-1033.

Lin, D., et al. (2016). "Ectopic expression of S1AG07 alters leaf pattern and inflorescence SIAGO7 increased fruit yield architecture and increases fruit yield in tomato."
Physiol Plant 157(4): 490-506.
Maach, M., et al. (2020). "Overexpression of LeNHX4 improved yield, fruit quality and salt LeNHX4 increased fruit size tolerance in tomato plants (Solanumlycopersicum L.)." MolBiol Rep 47(6):
4145-4153.
Nie, S., et al. (2017). "Enhancing B assinosteroid Signaling via Overexpression of improve multiple major S1BRI1 Tomato (Solanumlycopersicum) S1BRI1 agronomic traits Improves Major Agronomic Traits." Front Plant Sci 8: 1386.
Renau-Morata, B., et al. (2020). "The targeted S1CDF4 increased yield overexpression of S1CDF4 in the fruit enhances tomato size and yield involving gibberellin signalling." Sci Rep 10(1): 10645.
Thirumalaikumar, V. P., et al. (2018). "NAC
transcription factor JUNGBRUNNEN1 enhances S1JUB1 drought tolerance drought tolerance in tomato." Plant Biotechnol J
16(2): 354-366.
Wang, J., et al. (2020). "Transcriptomic and genetic approaches reveal an essential role of the S1NAP1 drought tolerance NAC
transcription factor S1NAP1 in the growth and defense response of tomato." Hortic Res 7(1): 209.
Ahammed, G. J., et al. (2020). "Overexpression of tomato RING E3 ubiquitin ligase gene cadmium (Cd) confers cadmium tolerance by tolerance attenuating cadmium accumulation and oxidative stress." Physiol Plant.
Bastias, A., et al. (2014). "The transcription regulates primary factor AREB1 regulates primary metabolic SlAREB1 metabolic pathways pathways in tomato fruits." J Exp Bot 65(9):
2351-2363.
Cai, S. Y., et al. (2017). "HsfAla upregulates cadmium (Cd) HsfA 1 a melatonin biosynthesis to confer cadmium tolerance tolerance in tomato plants." J Pineal Res 62(2) Cui, B., et al. (2016). "Overexpression of regulation of plant SlUPA-like induces cell enlargement, aberrant SlUPA-like development and stress development and low stress tolerance through tolerance phytohormonal pathway in tomato." Sci Rep 6:

Cui, J., et al. (2018). "Tomato MYB49 enhances tolerance to drought resistance to Phytophthorainfestans and and salt stresses tolerance to water deficit and salt stress." Planta 248(6): 1487-1503.
Duan, M., et al. (2012). "Overexpression of tolerance to chilling thylakoidalascorbate peroxidase shows enhanced LetAPX
stress resistance to chilling stress in tomato." J Plant Physiol 169(9): 867-877.

Jia, C., et al. (2021). "Tomato BZR/BES
regulates BR signaling S1BZR1D and transcription factor S1BZR1 positively regulates BR signaling and salt stress tolerance in tomato salt tolerance and Arabidopsis." Plant Sci 302: 110719.
Li, F., et al. (2020). "Overexpression of S1MBP22 in Tomato Affects Plant Growth and S1MBP22 drought tolerance Enhances Tolerance to Drought Stress." Plant Sci 301: 110672.
Liu, D. D., et al. (2019). "Overexpression of the Melatonin Synthesis-Related Gene SlCOMT1 S1COMT1 salt tolerance Improves the Resistance of Tomato to Salt Stress." Molecules 24(8).
enhances tolerance to Liu, Y., et al. (2017). "Overexpression of Abiotic Stresses and S1GRAS40 in Tomato Enhances Tolerance to influences Auxin and Abiotic Stresses and Influences Auxin and Gibberellin signaling Gibberellin Signaling." Front Plant Sci 8: 1659.
Zhang, C., et al. (2011). "Overexpression of increased ascorbate S1GMEs leads to ascorbate accumulation with accumulation and S1GMEs enhanced oxidative stress, cold, and salt improved tolerance to tolerance in tomato." Plant Cell Rep 30(3):
abiotic stresses 389-398.
Muhammad, T., et al. (2019). "Overexpression regulates tolerance to of a Mitogen-Activated Protein Kinase S1MAPK3 Cd(2+) and drought S1MAPK3 Positively Regulates Tomato stress Tolerance to Cadmium and Drought Stress."
Molecules 24(3).
Table K lists some representative functional genes in potato and sweet potato.

Table K: Important functional genes in potato and sweetpotato Crop Gene name Application Reference Charfeddine M, et al.(2019) . "Investigation of Salt the response to salinity of transgenic potato potato StERF94 tolerance plants overexpressing the transcription factor StERF94". Journal of Biosciences, 44(6).
To reduce Brummell D A, et al.
(2015)."Overexpression STARCH gelatinization of STARCH BRANCHING ENZYME II
BRANCHING temperature increases short-chain branching of potato ENZYME ,to change amylopectin and alters the physicochemical II(SBEII) starch properties of starch from potato tuber". BMC
properties Biotechnology.
Dong T, et al. (2020). "Cysteine protease Reduced inhibitors reduce enzymatic browning of potato protease potato inhibitors (StPIs) enzymatic potato by lowering the accumulation of free browning amino acids". Journal of Agricultural and Food Chemistry.
Chang Y, et al. (2020). "NAC transcription NAC family Wilt factor involves in regulating bacterial wilt potato transcription resistance in resistance in potato". Functional Plant factor (StNACb4) potato Biology, 47.
Increased KLAAS SEN M T, et al. (2020).
nitrate transporter potato gene(StNPF1.11) nitrogen use "Overexpression of a putative nitrate efficiency, transporter (StNPF1.11) increases plant height, plant height, leaf chlorophyll content and tuber protein leaf content of young potato plants". Funct Plant chlorophyll Biol, 47(5): 464-472 content and tuber protein content eukaryotic Sanchez P A G, et al.
(2020)."Overexpression translation PVY of a modified eIF4E regulates potato virus Y
potato initiation factor 4E resistance resistance at the transcriptional level in (eIF4E) potato".
BMC Genomics, 21.
Chen Q, et al. (2018). "StPOTHR1, a NDR1/HIN1-like gene in Solanumtuberosum, Late blight enhances resistance against potato StPOTHR1 resistance Phytophthorainfestans". Biochemical &
Biophysical Research Communications,1155-1161.
NATALIA, et al. (2008). "Overexpression of Enhance snakin-1 gene enhances resistance to resistance to potato Snakin-1 (SN1) Rhizoctoniasolani and Erwiniacarotovora in bacterial disease transgenic potato plants". Molecular Plant Pathology, 9(3):329-338.
Cao M, et al. (2020). "Functional Analysis of Phosphate Growth StPHT1;7, a Solanumtuberosum L. Phosphate potato Transporter promoting Transporter Gene, in Growth and Drought PHT1; 7 Tolerance". Plants, 9(10):1384.
Tolerance to Varun Dwivedi, et al. (2020)."Functional certain characterization of a defense-responsive potato StBUS/ELS
bacteria and bulnesol/elemol synthase from potato".
fungi PhysiologiaPlantarum.
Donia Bouaziz, et al. (2013). "Overexpression Increase of StDREB1 Transcription Factor Increases potato StDREB1 tolerance to Tolerance to Salt in Transgenic Potato Plants".
salt Molecular Biotechnology, 54(3):803-817 To promote Zhu X, et al. (2021)."Mitogen-activated growth under protein kinase 11 (MAPK11) maintains growth potato StMAPK11 drought and photosynthesis of potato plant under condition drought condition". Plant Cell Reports,1-16.
Rosin FM, et al. (2003)."Overexpression of a Knotted-like Homeobox Gene of Potato Alters Enlarged potato POTH1 tube Vegetative Development by Decreasing Gibberellin Accumulation". Plant Physiology, 132(1):106-117.
Yamamizo C, et al. (2006). "Rewiring Late blight Mitogen-Activated Protein Kinase Cascade by potato StMPK1 resistance Positive Feedback Confers Potato Blight Resistance". Plant Physiology, 140(2):681-692 S. Lee HE, et al. (2007). 'Ethylene responsive tuberosumethylene element binding protein 1 (StEREBP1) from Cold and salt responsive Solanumtuberosum increases tolerance to potato stress element binding abiotic stress in transgenic potato plants".
tolerance protein Biochemical & Biophysical Research (StEREBP1) Communications, 353(4):863-868.

Mithu Chatterjee, et al, (2007)."A
Enlarged BELL1-Like Gene of Potato Is Light Activated potato StBEL5 tube and Wound Inducible". Plant Physiology, Volume 145, Issue 4, 1435-1443, Ni X, et al. (2010)."Cloning and molecular Broad characterization of the potato RING
finger potato StRFP1 spectrum protein gene StRFP1 and its function in potato resistance to broad-spectrum resistance against late blight Phytophthorainfestans". Journal of Plant Physiology, 167(6):488-496.
Shin D, et al. (2011)."Expression of Drought StMYB1R-1, a novel potato single MYB-like potato StMYB1R-1 tolerance domain transcription factor, increases drought tolerance". Plant Physiology, 155(1):421-432.
Liu X, et al. (2013)."StInvInh2 as an inhibitor Reduced of StvacINV1 regulates the cold-induced StInvInh2A cold-induced potato sweetening of potato tubers by specifically StInvInh2B sweetening of potato capping vacuolar invertase activity".
Plant Biotechnology Journal, 11(5):640-647.
Li W, et al. (2013)."Cloning and Increased characterization of a potato StAN11 gene potato StAN11 anthocyanin involved in anthocyanin biosynthesis accumulation regulation". Journal of Integrative Plant Biology, 56(4):364-372.
Michal, et al. (2015)."Potato Annexin Drought STANN1 Promotes Drought Tolerance and potato STANN1 tolerance Mitigates Light Stress in Transgenic Solanumtuberosum L. Plants". Plos One.
Increased Goo Y M, et al. (2015). "Overexpression of accumulation the sweet potato IbOr gene results in the sweet of carotenoid IbOr increased accumulation of carotenoid and potato and confers confers tolerance to environmental stresses in tolerance to salt stress transgenic potato". ComptesRendusBiologi es.
Yu Y, et al. (2020)."Overexpression of phosphatidylserine synthase IbPSS1 affords Increased sweet cellular Na+ homeostasis and salt tolerance by IbPSS1 salt tolerance potato activating plasma membrane Na+/H+
antiport in root activity in sweet potato roots". Horticulture Research, 7:131.
Kim S H, et al. (2013)."Downregulation of the lycopene -cyclase gene increases carotenoid sweet Increased synthesis via the 13-branch-specific pathway IbLCY-e potato salt tolerance and enhances salt-stress tolerance in sweet potato transgenic calli". Physiologia Plantarum, 147(4):432-442.
Liu, D.G.,et al (2014b) sweet Increased AnIpomoeabatatasiron-sulfur cluster scaffold IbNFUl potato salt tolerance protein gene,IbNFUl, is involved in salt tolerance.PLoS One,9, e93935 sweet Increased Liu, D.G.et al (2014a) Overexpression IbP5CR
potato salt tolerance ofIbP5CRenhances salt tolerance in transgenicsweetpotato.Plant Cell, Tissue Organ Cult.117(1),1-16 Liu, D.G., et al (2014c) A novela/b-hydrolase sweet Increased IbMas geneIbMasenhances salt tolerance in potato salt tolerance transgenic sweetpotatoPLoS One,9, el 15128.
Liu, D.G., et al (2015)IbSIMT1, a novel salt-induced methyltransferase gene from sweet Increased Ib SIMT1 Ipomoea batatas, is involved in salt potato salt tolerance tolerance.Plant Cell, Tissue Organ Cult.
120, 701-715 Hong, et al. (2016)."A
Increased sweet salt and myo-inositol-l-phosphate synthase gene, IbMIPS1 potato drought IbMIPS1, enhances salt and drought tolerance and stem nematode resistance in transgenic tolerance sweet potato". Plant Biotechnology Journal.
Table L: List of herbicide resistance genes Gene Crop Gene name Reference number Perez-Jones, A., et al. (2006). "Introgression of an imidazolinone-resistance gene from winter wheat wheat Imil 7.1 (Triticum aestivum L.) into jointed goatgrass (Aegilops cylindrica Host)." Theor Appl Genet114(1): 177-186.
Theodoulou, F. L., et al. (2003). "Co-induction of AY06448 glutathione-S-transferases and multidrug resistance wheat GST Cla47 0.1 associated protein by xenobiotics in wheat." Pest Manag Sci59(2): 202-214.
Theodoulou, F. L., et al. (2003). "Co-induction of AY06448 glutathione-S-transferases and multidrug resistance wheat GST 19E50 1.1 associated protein by xenobiotics in wheat." Pest Manag Sci59(2): 202-214.
Theodoulou, F. L., et al. (2003). "Co-induction of AF479764 glutathione-S-transferases and multidrug resistance wheat GST 28e45 .1 associated protein by xenobiotics in wheat." Pest Manag Sci59(2): 202-214.
Theodoulou, F. L., et al. (2003). "Co-induction of AY06447 glutathione-S-transferases and multidrug resistance wheat MRP1 9.1 associated protein by xenobiotics in wheat." Pest Manag Sci59(2): 202-214.
Busi, R., et al. (2020). "Cinmethylin controls multiple cytochrome L005431 herbicide-resistant Lolium rigidum and its wheat wheat selectivity is P450-based." Pest Manag Sci76(8):
2601-2608.
Wang, H., et al. (2021). "The maize SUMO conjugating corn ZmSCElb enzyme ZmSCElb protects plants from paraquat toxicity." Ecotoxicol Environ Saf 211: 111909.

Sun, L., etal. (2018). "The expression of detoxification corn ZmGSTIV genes in two maize cultivars by interaction of isoxadifen-ethyl and nicosulfuron." Plant Physiol Biochem 129: 101-108.
Sun, L., etal. (2018). "The expression of detoxification corn ZmGST6 genes in two maize cultivars by interaction of isoxadifen-ethyl and nicosulfuron." Plant Physiol Biochem 129: 101-109.
Sun, L., etal. (2018). "The expression of detoxification corn ZmGST31 genes in two maize cultivars by interaction of isoxadifen-ethyl and nicosulfuron." Plant Physiol Biochem 129: 101-110.
Sun, L., etal. (2018). "The expression of detoxification corn ZmMRP1 genes in two maize cultivars by interaction of isoxadifen-ethyl and nicosulfuron " Plant Physiol Biochem 129: 101-111.
Li, D., et al. (2017). "Characterization of glutathione S-transferases in the detoxification of metolachlor in corn GSTI
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271 Li, D., et al. (2017). "Characterization of glutathione S-transferases in the detoxification of metolachlor in corn GSTIII
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione S-transferases in the detoxification of metolachlor in corn GSTIV
two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione S-transferases in the detoxification of metolachlor in corn GST5 two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione S-transferases in the detoxification of metolachlor in corn GST6 two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271.
Li, D., et al. (2017). "Characterization of glutathione S-transferases in the detoxification of metolachlor in corn GST7 two maize cultivars of differing herbicide tolerance."
Pestic Biochem Physiol 143: 265-271 bifunctional Mahmoud, M., et al. (2020). "Identification of 3-dehydroqu Structural Variants in Two Novel Genomes of Maize corn mate Inbred Lines Possibly Related to Glyphosate dehydratase Tolerance." Plants (Basel) 9(4).

Mahmoud, M. et al. (2020). "Identification of shikimate Structural Variants in Two Novel Genomes of Maize corn dehydrogena Inbred Lines Possibly Related to Glyphosate se Tolerance." Plants (Basel) 9(5).
Mahmoud, M., et al. (2020). "Identification of chori smate Structural Variants in Two Novel Genomes of Maize corn synthase Inbred Lines Possibly Related to Glyphosate Tolerance." Plants (Basel) 9(6).
Yu, Q., et al. (2015). "Evolution of a double amino acid (T102I+P10 substitution in the 5-enolpyruvylshikimate-3-phosphate corn 6S [TIPS]) synthase in Eleusine indica conferring high-level (EPSPS) glyphosate resistance." Plant Physiol 167(4):
1440-1447.
Liu, X., et al. (2019). "Rapid identification of a Zm00001 candidate nicosulfuron sensitivity gene (Nss) in maize corn CYP81A9 d013230 (Zea mays L.) via combining bulked segregant analysis and RNA-seq." Theor Appl Genet 132(5): 1351-1361.
Mathesius, C. A., et al. (2009). "Safety assessment of a modified acetolactate synthase protein (GM-HRA) used soybean GmHRA
as a selectable marker in genetically modified soybeans." Regul Toxicol Pharmacol 55(3): 309-320.
"The expression level of a new gene is upregulated" in the present invention means that the expression level of a new gene relative to the endogenous wild-type gene of the corresponding organism is increased, preferably the expression level is increased by at least 0.5 times, at least 1 time, at least 2 times, at least 3 times, at least 4 times or at least 5 times.
The term "gene editing" refers to strategies and techniques for targeted specific modification of any genetic information or genome of living organisms. Therefore, the term includes editing of gene coding regions, but also includes editing of regions other than gene coding regions of the genome. It also includes editing or modifying other genetic information of nuclei (if present) and cells.
The term "CRISPR/Cas nuclease" may be a CRISPR-based nuclease or a nucleic acid sequence encoding the same, including but not limited to: 1) Cas9, including SpCas9, ScCas9, SaCas9, xCas9, VRER-Cas9, EQR-Cas9, SpG-Cas9, SpRY-Cas9, SpCas9-NG, NG-Cas9, NGA-Cas9 (VQR), etc.; 2) Cas12, including LbCpfl, FnCpfl, AsCpfl, MAD7, etc., or any variant or derivative of the aforementioned CRISPR-based nuclease; preferably, wherein the at least one CRISPR-based nuclease comprises a mutation compared to the corresponding wild-type sequence, so that the obtained CRISPR-based nuclease recognizes a different PAM sequence. As used herein, "CRISPR-based nuclease" is any nuclease that has been identified in a naturally occurring CRISPR system, which is subsequently isolated from its natural background, and has preferably been modified or combined into a recombinant construct of interest, suitable as a tool for targeted genome engineering. As long as the original wild-type CRISPR-based nuclease provides DNA recognition, i.e., binding properties, any CRISPR-based nuclease can be used and optionally reprogrammed or otherwise mutated so as to be suitable for various embodiments of the invention.
The term "CRISPR" refers to a sequence-specific genetic manipulation technique that relies on clustered regularly interspaced short palindromic repeats, which is different from RNA
interference that regulates gene expression at the transcriptional level.
"Cas9 nuclease" and "Cas9" are used interchangeably herein, and refer to RNA-guided nuclease comprising Cas9 protein or fragment thereof (for example, a protein containing the active DNA cleavage domain of Cas9 and/or the gRNA binding domain of Cas9).
Cas9 is a component of the CRISPR/Cas (clustered regularly interspaced short palindrome repeats and associated systems) genome editing system. It can target and cut DNA target sequences under the guidance of guide RNA to form DNA double-strand breaks (DSB).
"Cas protein" or "Cas polypeptide" refers to a polypeptide encoded by Cas(CRISPR-associated) gene. Cas protein includes Cas endonuclease. Cas protein can be a bacterial or archaeal protein. For example, the types I to III CRISPR Cas proteins herein generally originate from prokaryotes; the type I and type III Cas proteins can be derived from bacteria or archaea species, and the type II Cas protein (i.e., Cas9) can be derived from bacterial species. "Cas proteins" include Cas9 protein, Cpfl protein, C2c1 protein, C2c2 protein, C2c3 protein, Cas3, Cas3-HD, Cas5, Cas7, Cas8, Cas10, Cas12a, Cas12b, or a combination or complex thereof.
"Cas9 variant" or "Cas9 endonuclease variant" refers to a variant of the parent Cas9 endonuclease, wherein when associated with crRNA and tracRNA or with sgRNA, the Cas9 endonuclease variant retains the abilities of recognizing, binding to all or part of a DNA target sequence and optionally unwinding all or part of a DNA target sequence, nicking all or part of a DNA target sequence, or cutting all or part of a DNA target sequence. The Cas9 endonuclease variants include the Cas9 endonuclease variants described herein, wherein the Cas9 endonuclease variants are different from the parent Cas9 endonuclease in the following manner: the Cas9 endonuclease variants (when complexed with gRNA to form a polynucleotide-directed endonuclease complex capable of modifying a target site) have at least one improved property, such as, but not limited to, increased transformation efficiency, increased DNA editing efficiency, decreased off-target cutting, or any combination thereof, as compared to the parent Cas9 endonuclease (complexed with the same gRNA to form a polynucleotide-guided endonuclease complex capable of modifying the same target site).
The Cas9 endonuclease variants described herein include variants that can bind to and nick double-stranded DNA target sites when associated with crRNA and tracrRNA or with sgRNA, while the parent Cas endonuclease can bind to the target site and result in double strand break (cleavage) when associated with crRNA and tracrRNA or with sgRNA.
"Guide RNA" and "gRNA" are used interchangeably herein, and refer to a guide RNA
sequence used to target a specific gene for correction using CRISPR
technology, which usually consists of crRNA and tracrRNA molecules that are partially complementary to form a complex, wherein crRNA contains a sequence that has sufficient complementarity with the target sequence so to hybridize with the target sequence and direct the CRISPR complex (Cas9+crRNA+tracrRNA) to specifically bind to the target sequence. However, it is known in the art that a single guide RNA (sgRNA) can be designed, which contains both the properties of crRNA and tracrRNA.
The terms "single guide RNA" and "sgRNA" are used interchangeably herein, and refer to the synthetic fusion of two RNA molecules, which comprises a fusion of a crRNA
(CRISPR
RNA) of a variable targeting domain (linked to a tracr pairing sequence hybridized to tracrRNA) and a tracrRNA (trans-activating CRISPR RNA). The sgRNA may comprise crRNA or crRNA
fragments and tracrRNA or tracrRNA fragments of the type II CRISPR/Cas system that can form a complex with the type II Cas endonuclease, wherein the guide RNA/Cas endonuclease complex can guide the Cas endonuclease to a DNA target site so that the Cas endonuclease can recognize, optionally bind to the DNA target site, and optionally nick the DNA target site or cut (introduce a single-strand or double-strand break) the DNA target site.
In certain embodiments, the guide RNA(s) and Cas9 can be delivered to a cell as a ribonucleoprotein (RNP) complex. RNP is composed of purified Cas9 protein complexed with gRNA, and it is well known in the art that RNP can be effectively delivered to many types of cells, including but not limited to stem cells and immune cells (Addgene, Cambridge, MA, Mirus Bio LLC, Madison, WI).
The protospacer adjacent motif (PAM) herein refers to a short nucleotide sequence adjacent to a (targeted) target sequence (prespacer) recognized by the gRNA/Cas endonuclease system. If the target DNA sequence is not adjacent to an appropriate PAM sequence, the Cas endonuclease may not be able to successfully recognize the target DNA sequence. The sequence and length of PAM herein can be different depending on the Cas protein or Cas protein complex in use. The PAM sequence can be of any length, but is typically in length of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,

13, 14, 15, 16, 17, 18, 19 or 20 nucleotides.
Cytochrome P450enzyme system (CYP) is discovered as a protein that can be bound to CO. In 1958, Klingenberg discovered this pigment protein in rat liver microsomes.
Cytochrome P450was so named because of its maximum absorption value at 450nm wavelength when combined with CO in its reduced state. As the largest superfamily of oxidoreductases, P450 is widely distributed in the vast majority of organisms, including but not limited to animals, plants, fungi, bacteria, archaea and viruses.
Cytochrome P450 enzymes include those reviewed in the following literature: Van Bogaert et al, 2011, FEBS J.
278(2): 206-221, or Urlacherand Girhard, 2011, Trends in Biotechnology 30(1):
26-36, or the following web sites: http : //drnel s on .uthsc . edu/Cytochrom eP45 0.
html and http://p450.riceblast.snusacskr/index.php?a=view. Its naming is based on the English abbreviation CYP (Cytochrome P450) with numbers + letters + numbers, respectively representing the family, subfamily and individual enzymes.
For some embodiments, the said cytochrome P450s include but not limited to the following as per list:

GE:ne CYPI CYP1 AI,cP1Ar.C8PE
aP2 CYP2AL, CfP2A7, CYP2A13: CY.P2B6, CYP2.01 CYP2C9, CYP2C1e, CfP2C1S, CYPZDE, CfP2Et CYPa-1, CYP:212, CYP2R CIP2S1. CYP2U1, CYP2W1 0T3 CYPIlet CYP3A.S. CYPW, 0P3M3 aP4 CYNA 1 1. (VNA22, CW4i. CSP4F-2, CIP4F3, CYP4F8.. CfP*11: CY.P4F12, CiP4F22, CYP412,CW.4X-1, CfP4.1.1 CtfP5 CYP5A1 CYP7 reP7A1, CYPTE
CYP8 CW8A1 =;prostacytiin Ertn3358), CYPHI
g.)e add biCcynther.is?
CYP11 (WI Th't CYP'11 CYP1.7 CYPI7A1 CYP19 CiPI9A1 CYP20 C'eP2DA1 cxv21 CYP21A2 C'eF24 CY.P24A1 CYF26 a.P2:5A/. C172:6131.. c?-nrycl CYP27 aP27A1 {be acid bissyritnizais. CYP27E1 (vitamin D3 1-aipria hydamytase, 3ctiqates vitamin D3). Cii"-27C1 kincttcsr4 C.".(#339 CYP.39241 cypz..1 14-ai0a demet',Oase) For some embodiments, the rice cytochrome P450s include but not limited to the following as per list:
MSU/TIGR locus ID CYP name LOC OsOlg08800 CYP96D1 LOC OsOlg08810 CYP96E1 LOC OsOlg10040 CYP90D2v1 LOC OsOlg10040 CYP90D2V2 LOC OsOlg11270 CYP710A5 LOC OsOlg11280 CYP710A6 LOC OsOlg11300 CYP710A7 LOC OsOlg11340 CYP710A8 LOC OsOlg12740 CYP71T1 LOC OsOlg12750 CYP71T2 LOC OsOlg12760 CYP71T3 LOC OsOlg12770 CYP71T4 LOC OsOlg24780 CYP709D1 LOC OsOlg24810 CYP89D1 LOC OsOlg27890 CYP71K1 LOC OsOlg29150 CYP734A6 LOC OsOlg36294 CYP71C19P
LOC OsOlg38110 CYP76M14 LOC OsOlg41800 CYP72A31P
LOC OsOlg41810 CYP72A32 LOC OsOlg41820 CYP72A33 LOC OsOlg43700 CYP72A17v1 LOC OsOlg43700 CYP72A17v2 LOC OsOlg43710 CYP72A18 LOC OsOlg43740 CYP72A20 LOC OsOlg43750 CYP72A21 LOC OsOlg43760 CYP72A22 LOC OsOlg43774 CYP72A23 LOC OsOlg43844 CYP72A24 LOC OsOlg43851 CYP72A25 LOC OsOlg50490 CYP706C2 LOC OsOlg50530 CYP711A2 LOC OsOlg50580 CYP711A3 LOC OsOlg50590 CYP711A4 LOC OsOlg52790 CYP72A35 LOC OsOlg58950 CYP94D13 LOC OsOlg58960 CYP94D12 LOC OsOlg58970 CYP94D11 LOC OsOlg58990 CYP94D10 LOC OsOlg59000 CYP94D9 LOC OsOlg59020 CYP94D7 LOC OsOlg59050 CYP94D6 LOC OsOlg60450 CYP73A35P
LOC OsOlg63540 CYP86A9 LOC OsOlg63930 CYP94C3v1 LOC OsOlg63930 CYP94C3v2 LOC OsOlg72260 CYP94E2 LOC OsOlg72270 CYP94E1 LOC OsOlg72740 CYP71AA3 LOC OsOlg72760 CYP71AA2 LOC 0s02g01890 CYP89E1 LOC 0s02g02000 CYP74F1 LOC 0s02g02230 CYP51H5 LOC 0s02g07680 CYP97B4v1 LOC 0s02g07680 CYP97B4v2 LOC 0s02g07680 CYP97B4v3 LOC 0s02g07680 CYP97B4v4 LOC 0s02g07680 CYP97B4v5 LOC 0s02g09190 CYP71X12 LOC 0s02g09200 CYP71X11 LOC 0s02g09220 CYP71X10 LOC 0s02g09240 CYP71X8 LOC 0s02g09250 CYP71X7 LOC 0s02g09290 CYP71X4 LOC 0s02g09310 CYP71X3 LOC 0s02g09320 CYP71X2 LOC 0s02g09330 CYP71X1P
LOC 0s02g09390 CYP71K3 LOC 0s02g09400 CYP71K4 LOC 0s02g09410 CYP71K5 LOC 0s02g11020 CYP734A2 LOC 0s02g12540 CYP71V5 LOC 0s02g12550 CYP71V4 LOC 0s02g12680 CYP74E1 LOC 0s02g12690 CYP74E2 LOC 0s02g12890 CYP711A5v1 LOC 0s02g12890 CYP711A5v2 LOC 0s02g17760 CYP71U3 LOC 0s02g21810 CYP51H4 LOC 0s02g26770 CYP73A40 LOC 0s02g26810 CYP73A39 LOC 0 sO2g29720 CYP76N1P
LOC 0s02g29960 CYP92A15 LOC 0s02g30080 CYP81L5 LOC 0s02g30090 CYP81L4 LOC 0s02g30100 CYP81L3 LOC 0s02g30110 CYP81L2 LOC 0s02g32770 CYP71Z5 LOC 0s02g36030 CYP76M5 LOC 0s02g36070 CYP76M8 LOC 0s02g36110 CYP76M17 LOC 0s02g36150 CYP71Z6 LOC 0s02g36190 CYP71Z7 LOC 0s02g36280 CYP76M6 LOC 0s02g38290 CYP86E1v1 LOC 0s02g38290 CYP86E1v2 LOC 0s02g38930 CYP71X13P
LOC 0 sO2g38940 CYP71X14 LOC 0s02g44654 CYP86A10v1 LOC 0s02g44654 CYP86A10v2 LOC 0s02g45280 CYP87A5 LOC 0 sO2g47470 CYP707A5v1 LOC 0 sO2g47470 CYP707A5v2 LOC 0 sO2g47470 CYP707A5v3 LOC 0s02g57290 CYP97A4v1 LOC 0s02g57290 CYP97A4v2 LOC 0s02g57290 CYP97A4v3 LOC 0s02g57290 CYP97A4v4 LOC 0s02g57810 CYP715B1 LOC 0s03g02180 CYP84A6 LOC 0s03g04190 CYP78A17 LOC 0s03g04530 CYP96B6 LOC 0s03g04630 CYP96B2 LOC 0 sO3g04640 CYP96B9 LOC 0s03g04650 CYP96B3 LOC 0s03g04660 CYP96B5 LOC 0s03g04680 CYP96B4 LOC 0s03g07250 CYP704B2 LOC 0s03g12260 CYP94D15 LOC 0s03g12500 CYP74A5 LOC 0s03g12660 CYP90B2 LOC 0s03g14400 CYP76H4 LOC 0s03g14420 CYP76H5 LOC 0s03g14560 CYP76Q1 LOC 0s03g21400 CYP714B2 LOC 0s03g25150 CYP75A11 LOC 0s03g25480 CYP709E1 LOC 0s03g25490 CYP709E2Pv1 LOC 0s03g25490 CYP709E2Pv2 LOC 0 sO3g30420 CYP78Al2 LOC 0s03g37080 CYP71E6P
LOC 0s03g37290 CYP79A7 LOC 0s03g39540 CYP71AC3P
LOC 0s03g39650 CYP71W1 LOC 0s03g39690 CYP71W3 LOC 0s03g39760 CYP71W4 LOC 0s03g40540 CYP85A1 LOC 0s03g40600 CYP78A14 LOC 0 sO3g44740 CYP92C21 LOC 0s03g45619 CYP87C2v1 LOC 0s03g45619 CYP87C2v2 LOC 0s03g55240 CYP81A6 LOC 0s03g55260 CYP81A8 LOC 0s03g55800 CYP74A4 LOC 0s03g61980 CYP733A1 LOC 0s03g63310 CYP71E4 LOC 0s04g01140 CYP93G1v1 LOC 0s04g01140 CYP93 Glv2 LOC 0s04g03870 CYP723A2 LOC 0s04g03890 CYP723A3 LOC 0s04g08824 CYP79A10 LOC 0s04g08828 CYP79A9 LOC 0s04g09430 CYP79A9P
LOC 0 sO4g09920 CYP99A3 LOC 0s04g10160 CYP99A2 LOC 0s04g18380 CYP81M1 LOC 0 sO4g27020 CYP71Z1 LOC 0s04g33370 CYP77A18 LOC 0s04g39430 CYP724B1 LOC 0 sO4g40460 CYP71 S2 LOC 0 sO4g40470 CYP71S1 LOC 0s04g47250 CYP86A11 LOC 0s04g48170 CYP87A6 LOC 0s04g48200 CYP87B4 LOC 0s04g48210 CYP87A4v1 LOC 0s04g48210 CYP87A4v2 LOC 0s04g48460 CYP704A3 LOC 0s05g01120 CYP722B1 LOC 0s05g08850 CYP96D2 LOC 0s05g11130 CYP90D3 LOC 0s05g12040 CYP51G3 LOC 0s05g25640 CYP73A38 LOC 0s05g30890 CYP72A34 LOC 0s05g31740 CYP94E3 LOC 0s05g33590 CYP721B2 LOC 0s05g33600 CYP721B1 LOC 0s05g34325 CYP51H6 LOC 0s05g34330 CYP51H7P
LOC 0s05g34380 CYP51H8 LOC 0s05g35010 CYP71AD1 LOC 0s05g37250 CYP94C4 LOC 0s05g40384 CYP714D1 LOC 0s05g41440 CYP98A4v1 LOC 0s05g41440 CYP98A4v2 LOC 0s05g43910 CYP71R1 LOC 0s06g01250 CYP93 G2 LOC 0s06g02019 CYP88A5 LOC 0s06g03930 CYP704A4 LOC 0s06g09210 CYP709C10 LOC 0 sO6g09220 CYP709C11 LOC 0s06g15680 CYP71R2P
LOC 0s06g19070 CYP76Q2 LOC 0 sO6g22020 CYP71C20 LOC 0 sO6g22340 CYP89C1 LOC 0s06g24180 CYP84A7 LOC 0s06g30179 CYP71AB3 LOC 0s06g30500 CYP71AB2 LOC 0 sO6g30640 CYP76M9 LOC 0 sO6g36920 CYP711A6 LOC 0 sO6g37224 CYP701A9 LOC 0s06g37300 CYP701A8 LOC 0s06g37330 CYP701A19 LOC 0s06g37364 CYP701A6v1 LOC 0s06g37364 CYP701A6v2 LOC 0s06g37364 CYP701A6v3 LOC 0s06g39780 CYP76M7 LOC 0s06g39880 CYP734A4 LOC 0s06g41070 CYP93F1 LOC 0s06g42610 CYP89B12P
LOC 0s06g43304 CYP71Y7 LOC 0s06g43320 CYP71Y6 LOC 0s06g43350 CYP71Y5 LOC 0s06g43370 CYP71Y4 LOC 0s06g43384 CYP71Y3 LOC 0s06g43410 CYP71Y1P
LOC 0 sO6g43420 CYP71K10 LOC 0s06g43430 CYP71K9 LOC 0 sO6g43440 CYP71K8 LOC 0s06g43480 CYP71K7P
LOC 0s06g43490 CYP71K6 LOC 0s06g43520 CYP71AF1 LOC 0s06g45960 CYP71AC2 LOC 0s06g46680 CYP77B2 LOC 0s07g11739 CYP71Z2 LOC 0s07g11870 CYP71Z21 LOC 0s07g11970 CYP71Z22 LOC 0s07g19130 CYP71Q2 LOC 0s07g19210 CYP71Q1 LOC 0s07g23570 CYP709C9 LOC 0s07g23710 CYP709C12P
LOC 0s07g26870 CYP89G1 LOC 0s07g28160 CYP51H1 LOC 0s07g29960 CYP87B5 LOC 0s07g33440 CYP728B3 LOC 0s07g33480 CYP728C9v1 LOC 0s07g33480 CYP728C9v2 LOC 0s07g33540 CYP728C7 LOC 0s07g33550 CYP728C5 LOC 0s07g33560 CYP728C4 LOC 0s07g33580 CYP728C3 LOC 0s07g33610 CYP728C1v1 LOC 0s07g33610 CYP728C1v2 LOC 0s07g33620 CYP728B1 LOC 0s07g37970 CYP51H9 LOC 0s07g37980 CYP51G4P
LOC 0s07g41240 CYP78A13 LOC 0s07g44110 CYP709C8 LOC 0s07g44130 CYP709C6 LOC 0s07g44140 CYP709C5 LOC 0s07g45000 CYP727A1 LOC 0s07g45290 CYP734A5 LOC 0s07g48330 CYP714B1 LOC 0s08g01450 CYP71C12 LOC 0s08g01470 CYP71C13P
LOC 0s08g01490 CYP71C17 LOC 0s08g01510 CYP71C15 LOC 0s08g01520 CYP71C16 LOC 0s08g03682 CYP703A3 LOC 0s08g05610 CYP89C8P
LOC 0s08g05620 CYP89C9 LOC 0s08g12990 CYP76H11 LOC 0s08g16260 CYP96B8 LOC 0s08g16430 CYP96B7 LOC 0s08g33300 CYP735A3 LOC 0s08g35510 CYP92Al2 LOC 0s08g36310 CYP76M1 LOC 0s08g36860 CYP707A6 LOC 0s08g39640 CYP76M11P
LOC 0s08g39660 CYP76M10 LOC 0s08g39694 CYP76M4Pv1 LOC 0s08g39694 CYP76M4Pv2 LOC 0s08g39694 CYP76M4Pv3 LOC 0s08g39730 CYP76M2 LOC 0s08g43390 CYP78A15 LOC 0s08g43440 CYP706C1 LOC 0s09g08920 CYP92A13 LOC 0s09g08990 CYP92A14 LOC 0s09g10340 CYP71V2 LOC 0s09g21260 CYP728A1 LOC 0s09g23820 CYP735A4 LOC 0s09g26940 CYP92A11 LOC 0s09g26960 CYP92A9 LOC 0s09g26970 CYP92A8 LOC 0s09g26980 CYP92A7 LOC 0s09g27500 CYP76L1 LOC 0s09g27510 CYP76K1 LOC 0s09g28390 CYP707A37 LOC 0s09g35940 CYP78A16 LOC 0s09g36070 CYP71T8 LOC 0s09g36080 CYP71AK2 LOC OslOg05020 CYP89B11 LOC OslOg05490 CYP76P1 LOC OslOg08319 CYP76H9 LOC OslOg08474 CYP76H8 LOC OslOg08540 CYP76H6 LOC OslOg09090 CYP76V1 LOC OslOg09160 CYP71AB1 LOC OslOg16974 CYP75B11 LOC OslOg17260 CYP75B3 LOC OslOg21050 CYP76P3 LOC OslOg23130 CYP729A2 LOC OslOg23180 CYP729A1v1 LOC OslOg23180 CYP729A1v2 LOC OslOg26340 CYP78A11 LOC OslOg30380 CYP71Z3 LOC OslOg30390 CYP71Z4 LOC OslOg30410 CYP71Z8 LOC OslOg34480 CYP86B3 LOC OslOg36740 CYP89F1 LOC OslOg36848 CYP84A5 LOC OslOg36960 CYP89B10 LOC OslOg36980 CYP89B9 LOC OslOg37020 CYP89B8P
LOC OslOg37034 CYP89B7P
LOC OslOg37050 CYP89B6 LOC OslOg37070 CYP89B5P
LOC OslOg37100 CYP89B4 LOC OslOg37110 CYP89B3 LOC OslOg37120 CYP89B2 LOC OslOg37160 CYP89B1 LOC OslOg38090 CYP704A7 LOC OslOg38110 CYP704A5v1 LOC OslOg38110 CYP704A5v2 LOC OslOg38120 CYP704A6 LOC OslOg39930 CYP97C2v1 LOC OslOg39930 CYP97C2v2 LOC 0s11g02710 CYP714C16P
LOC 0s11g04290 CYP94D5 LOC 0s11g04310 CYP94D4 LOC 0s11g04710 CYP90A3 LOC 0s11g05380 CYP94C2 LOC 0s11g18570 CYP87B1 LOC 0s11g27730 CYP71C32 LOC 0s11g28060 CYP71C33 LOC 0s11g29290 CYP94B4 LOC 0s11g29720 CYP78D1 LOC 0s11g32240 CYP51G1 LOC 0s11g41680 CYP71K11 LOC 0s11g41710 CYP71K12 LOC 0s12g02630 CYP714C1 LOC 0s12g02640 CYP714C2 LOC 0s12g04100 CYP94D63 LOC 0s12g04110 CYP94D64 LOC 0s12g04480 CYP90A19 LOC 0s12g05440 CYP94C79 LOC 0s12g09500 CYP76P2 LOC 0s12g09790 CYP76M13 LOC 0s12g16720 CYP71P1 LOC 0s12g18820 CYP87C5P
LOC 0s12g25660 CYP94B5 LOC 0s12g32850 CYP71E5 LOC 0s12g39240 CYP81N1 LOC 0s12g39300 CYP81N1P
LOC 0s12g39310 CYP81P1 LOC 0s12g44290 CYP71V3 As used herein,ATP-binding cassette (ABC) transporter family are a family of membrane transporter proteins that regulate the transport of a wide variety of pharmacological agents, potentially toxic drugs, and xenobiotics, as well as anions. ABC
transporters are homologous membrane proteins that bind and use cellular adenosine triphosphate (ATP) for their specific activities. And the ATP-binding cassette (ABC) transporter proteins comprise a large family of prokaryotic and eukaryotic membrane proteins involved in the energy-dependent transport of a wide range of substrates across membranes (Higgins, C. F. et al., Ann. Rev. Cell Biol., 8:67-113 (1992)). In eukaryotes, ABC transport proteins typically consist of four domains that include two conserved ATP-binding domains and two transmembrane domains (Hyde et al., Nature, 346:362-5 (1990)).
As used herein, NAC transcription factors are unique transcription factors in plants and are numerous and widely distributed in terrestrial plants. They constitute one of the largest transcription factor families and play an important role in multiple growth development and stress response processes. Wherein, NAC is an acronym derived from the names of the three genes first described as containing a NAC domain, namely NAM (no apical meristem), ATAF1,2 and CUC2 (cup-shaped cotyledon).
As used herein, wherein, the Myb gene was found to encode a transcription factor (Biedenkapp H., et al., 1988, Nature, 335: 835-837), represent a family comprising many related genes, and exist in a wide variety of species, including yeast, nematodes, insects and plants, as well as vertebrates (Masaki Iwabuchi and Kazuo Shinozaki, Shokubutsu genomu kinou no dainamizumu: tensha inshi ni yoru hatsugen seigyo (Dynamism of Plant Genome functions: Expression control by transcriptional factor), Springer Japan, 2001). Plant transcription factor MYB (v-myb avian myeloblastosis viral oncogene homolog) is a type of transcription factor discovered in recent years that is related to the regulation of plant growth and development, physiological metabolism, cell morphology and pattern formation and other physiological processes. It is ubiquitous in plants and is also one of the largest transcription families in plants, MYB transcription factors play an important role in plant metabolism and regulation. Most MYB proteins contain a Myb domain composed of amino acid residues at the N-terminus. According to the structural characteristics of this highly conserved domain, MYB transcription factors can be divided into four categories:
1R-MYB/MYB-related; R2R3-MYB; 3R-MYB; 4R-MYB (4 repetitions of R1/R2). MYB
transcription factors have a variety of biological functions and are widely involved in the growth and development of plant roots, stems, leaves, and flowers. At the same time, the MYB gene family also responds to abiotic stress processes such as drought, salinity, and cold damage. In addition, MYB transcription factors are also closely related to the quality of certain cash crops.
As used herein, the family of MADS transcription factors that play critical roles in diverse developmental process in plants including flower and seed development (Minster, et al., 2002; Parenicova, et al., 2003). MADS protein is composed of domains such as MADS
(M), Intervening (I), Keratin 2 like (K) and C2 terminal (C), which belong to domain proteins.
As used herein, the DREB (dehydration responsive element binding protein) type transcription factor is a subfamily of the AP2/EREBP (APETALA2/an ethylene-responsive element binding protein) transcription factor family. It has a conserved AP2 domain and can specifically combine with DRE cis-acting elements in the promoter region of stress resistance genes to regulate the expression of a series of downstream stress response genes under conditions of low temperature, drought, saline-alkali and so on. It is a key regulatory factor in stress adaptation.
As used herein, the bZIP (basic region/leucine zipper) family of transcription factors comprises the simplest motif that nature uses for targeting specific DNA
sites: a pair of short a-helices that recognize the DNA major groove with sequence-specificity and high affinity (Struhl, K., Ann. Rev. Biochem., 1989, 58,1051; Landschulz, W. H., et al., Science, 1988, 240, 1759-1764).
As used herein, plant bZIP transcription factors are a class of proteins that are widely distributed in eukaryotes and relatively conserved. Its basic region is highly conserved and contains about 20 amino acid residues. According to the difference in the structure of bZIP, it can be divided into 10 subfamilies The transcription factors of different subgroups perform different functions, mainly including the expression of plant seed storage genes, the regulation of plant growth and development, light signal transduction, disease prevention, stress response and ABA sensitivity and other signal responses.
As used herein, Glutathione-S-Transferases (GSTs) family are a large family of enzymes ubiquitously expressed in animals, plants and microorganism. It is a superfamily of enzymes that are encoded by multiple genes and have multiple functions. They are combined with harmful heterologous substances or oxidation products through glutathione to promote the metabolism, regional isolation or elimination of such substances, and involved in cellular defense against a broad spectrum of cytotoxic agents (see Gate and Tew, Expert Op/n. Ther. Targets 5: 477, 2001). Over 400 different GST sequences have been identified and based on their genetic characteristics and substrate specificity can be classified in four different classes a, [t, it, and 0 (see Mannervik et al., Biochem. 1 282:305, 1992). Each allelic variant encoded at the same gene locus is distinguished by a letter.
According to the homology and gene structure characteristics of plant proteins, the GST
family is divided into 8 subfamilies: F (Phi), U (Tau), T (Theta), Z (Zeta), L
(Lambda), DHAR, EF1By and TCHQD . The F and U families are unique to plants. Compared with other subfamilies, they have the most members and the most abundant content.
Soluble GST
is mainly distributed in the cytoplasm, a few in chloroplasts and microbodies, and a small amount in the nucleus and apoplasts. Plant GST was first discovered in corn (Zea mays L.), and subsequently found in plants such as Arabidopsis thaliana, soybean (Glycinemax), rice (Oryza sativa L.), and tobacco (Nicotiana tabacum L.) .
As used herein, the term "organism" includes animals, plants, fungi, bacteria, and the like.
As used herein, the term "host cell" includes plant cells, animal cells, fungal cells, bacterial cells, and the like.
In the present invention, the term "animal" includes any member of the animal kingdom, for example, invertebrates and vertebrates. Invertebrates include but not limited to protozoa (such as amoeba), helminthes, molluscs (such as escargots, snails, freshwater mussels, oysters and devilfishes), arthropods (such as insects, spiders, and crabs), etc.;
vertebrates include but not limited to fishes (such as zebrafish, salmon, crucian carp, carp or tilapia and other edible economic fish that can be raised artificially), amphibians (such as frogs, toads and newts), reptiles (such as snakes, lizards, iguanas, turtles and crocodiles), birds (such as chickens, geese, ducks, turkeys, ostriches, quails, pheasants, parrots, finches, hawks, eagles, kites, vultures, harriers, ospreys, owls, crows, guinea fowls, pigeons, emus and cassowaries), mammals (such as humans, non-human primates (such as lemurs, tarsier, monkeys, apes and orangutans), pigs, cattle, sheep, horses, camels, rabbits, kangaroos, deer, polar bears, canines (such as dogs, wolves, foxes and jackals), felines (such as lions, tigers, cheetahs, lynxes and cats) and rodents (such as mice, rats, hamsters and guinea pigs)] etc. The term "non-human" does not include humans.
The term "animal" also includes individual animals at every developmental stage (including newborn, embryo, and fetus stage).
The term "fungus" refers to any member of eukaryotic organisms generated by saprophytic and parasitic spores. Generally, they are filamentous organisms and previously they are classified as chlorophyll deficiency plants, including but not limited to basidiomycotina, deuteromycotina, ascomycotina, mastigomycotina, zygomycotina, etc. However, it should be understood that the fungal classification is constantly evolving, and as a result, the specific definition of the fungal kingdom might be adjusted in the future. The macro-fungi can be divided into four categories:
edible fungi, medicinal fungi, poisonous fungi and fungi with unknown uses.
Most of the edible fungi and medicinal fungi belong to basidiomycotina, for example, Tremella fuciformis, Phlogiotis helvelloides, Tremella aurantialba, Auricularia auricular, Auricularia polytricha, Auricularia delicate, Auricularia messenterica, Auricularia rugosissima, Calocera cornea, Fistulina hepatica, Poria cocos, Grifola frondosa, Grifola umbellate, Ganoderma applanatum, Coriolus versicolor, , Ganoderma capense, Ganoderma lucifum, Ganoderma cochlear, Ganoderma lobatum, Ganoderma tsugae, Ganderma sinense, Polyporus rhinoceros, Omphalia lapidescens, Phellinus baumii, Cryptoporus volvatus, Pycnoporus cinnabarinus, Fuscoporus obliqus, Sparassis crispa, Hericium erinaceus, Thelephora via/is, Ramaria flava, Ramaria botrytoides, Ramaria stricta, Ramaria botrytis, Clavicorona pyxidata, Clavulina cinerea, Cantharellus cibarius, Hydnum repandum, Lycoperdon perlatum, Lycoperdon Polymorphum, Lycoperdon pus//urn, Lycoperdon aurantium, Lycoperdon flavidum, Lycoperdon poleroderma, Lycoperdon verrucosum, Boletus albidus, Boletus aereus, Boletus rube//us, Sullins grevillea, Suillus granulatus, Sullins luteus, Fistulina hepatica, Russula integra, Russula alutacea, Russula zoeteus, Russula Viresceu, Pleurotus citrinopileatus, Pleurotus ostreatus, Pleurotus sapidus, Pleurotus ferulae, Pleurotus abalonus, Pleurotus cornucopiae, Pleurotus cystidiosus, Pleurotus djamor, Pleurotus salmoneostramineus, Pleurotus eryngii (DC. ex Fr.) Quel.
var. eryngii, Pleurotus eryngii (DC. ex Fr.) Quel.varferu/ae Lanzi, Pleurotus nebrodensis, Pleurotus ostreatus, Pleurotus florida, Pleurotus pulmonarius, Pleurotus tuber-regium, Hohenbuchelia serotine, Agaricus bisporus, Agaricus arvensis, Agaricus blazei, Tricholoma matsutake, Tricholoma gambosum, Tricholoma conglobatum, Tricholoma album, Tricholoma mongolicum, Armillaria me/lea, Arm//lane/la ventricosa, Armillariella mucida, Armillariella tabescens, Collybia radicata, Collybia radicata (Relh.ex Fr.) Quel. var. furfuracea PK., Marasmius androsaceus, Termitomyces albuminosus, Tricholoma giganteum, Hypsizigus marmoreus, Lepista sordida, Lyophyllum ulmarium, Lyophyllum shimeji, Flammulina velutipes, Cortinarius armillatus, Amanita caesarea, Amanita caesarea ( Scop. ex Fr. ) Pers. ex Schw. var. alba Gill, Amanita strobiliformis, Amanita vaginata, Volvariella volvacea, Pholiota adiposa, Pholiot squarrosa, Pholiot mutabilis, Pholiota nameko, Strop haria rugoso-annulata, Coprinus sterquilinus, Coprinus fuscesceus, Coprinus atramentarius, Coprinus comatus, Coprinus ovatus, Dictyophora indusiata, Dictyophora duplicate, Dictyophora echino-volvata, Schizphylhls commne, Agrocybe cylindracea, Lentinus edodes; some are Ascomycotina, for example, Morchella esculenta, Cordyceps sinensis, Cordyceps militaris, Claviceps purpurea, Cordyceps sobolifera, Engleromyces geotzii, Podostroma yunnansis, Shiraia bambusiicola, Hypocrella bambusea, Xylaria nigripes, Tuber spp..
In the present invention, the "plant" should be understood to mean any differentiated multicellular organism capable of performing photosynthesis, in particular monocotyledonous or dicotyledonous plants, for example, (1) food crops: Oryza spp., like Oryza sativa, Oryza latifolia, Oryza sativa, Oryza glaberrima; Triticum spp., like Triticum aestivum, T.
Turgidumssp. durum;
Hordeum spp., like Hordeum vulgare, Hordeum arizonicum; Secale cereale; Avena spp., like Avena sativa, Avena fatua, Avena byzantine, Avena fatua var. sativa, Avena hybrida; Echinochloa spp., like Pennisetum glaucum, Sorghum, Sorghum bicolor, Sorghum vulgare, Triticale, Zea mays or Maize, Millet, Rice, Foxtail millet, Proso millet, Sorghum bicolor, Panicum, Fagopyrum spp., Panicum miliaceum, Setaria italica, Zizania palustris, Eragrostis tef, Panicum miliaceum, Eleusine coracana; (2) legume crops: Glycine spp. like Glycine max, Soja hispida, Soja max, Vicia spp., Vigna spp., Pisum spp., field bean, Lupinus spp., Vicia, Tamarindus indica, Lens culinaris, Lathyrus spp., Lablab, broad bean, mung bean, red bean, chickpea;
(3) oil crops:
Arachis hypogaea, Arachis spp, Sesamum spp., Helianthus spp. like Helianthus annuus, Elaeis like Eiaeis guineensis, Elaeis oleifera, soybean, Brassicanapus, Brassica oleracea, Sesamum orientale, Brassica juncea, Oilseed rape, Camellia oleifera, oil palm, olive, castor-oil plant, Brassica napus L., canola; (4) fiber crops: Agave sisalana, Gossypium spp.
like Gossypium, Gossypium barbadense, Gossypium hirsutum, Hibiscus cannabinus, Agave sisalana, Musa textilis Nee, Linum usitatissimum, Corchorus capsularis L, Boehmeria nivea (L.), Cannabis sativa, Cannabis sativa; (5) fruit crops: Ziziphus spp., Cucumis spp., Passiflora edulis, Vitis spp., Vaccinium spp., Pyrus communis, Prunus spp., Psidium spp., Punica granatum, Malus spp., Citrullus lanatus, Citrus spp., Ficus carica, Fortunella spp., Fragaria spp., Crataegus spp., Diospyros spp., Eugenia unifora, Eriobotrya japonica, Dimocarpus longan, Carica papaya, Cocos spp., Averrhoa carambola, Actinidia spp., Prunus amygdalus, Musa spp. (musa acuminate), Persea spp. (Persea Americana), Psidium guajava, Mammea Americana, Mangifera indica, Canarium album (Oleaeuropaea), Caricapapaya, Cocos nucifera, Malpighia emarginata, Manilkara zapota, Ananas comosus, Annona spp., Citrus reticulate (Citrus spp.), Artocarpus spp., Litchi chinensis, Ribes spp., Rubus spp., pear, peach, apricot, plum, red bayberry, lemon, kumquat, durian, orange, strawberry, blueberry, hami melon, muskmelon, date palm, walnut tree, cherry tree; (6) rhizome crops: Manihot spp., Ipomoea batatas, Colocasia esculenta, tuber mustard, Allium cepa (onion), eleocharis tuberose (water chestnut), Cyperus rotundus, Rhizoma dioscoreae; (7) vegetable crops: Spinacia spp., Phaseolus spp., Lactuca sativa, Momordica spp, Petroselinum crispum, Capsicum spp., Solanum spp. (such as Solanum tuberosum, Solanum integrifolium, Solanum lycopersicum), Lycopersicon spp. (such as Lycopersicon esculentum, Lycopersicon lycopersicum, Lycopersicon pyriforme), Macrotyloma spp., Kale, Luffa acutangula, lentil, okra, onion, potato, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, carrot, cauliflower, celery, collard greens, squash, Benincasa hispida, Asparagus officinalis, Apium graveolens, Amaranthus spp., Allium spp., Abelmoschus spp., Cichorium endivia, Cucurbita spp., Coriandrum sativum, B.carinata, Rapbanus sativus, Brassica spp. (such as Brassica napus, Brassica rapa ssp., canola, oilseed rape, turnip rape, turnip rape, leaf mustard, cabbage, black mustard, canola (rapeseed), Brussels sprout, Solanaceae (eggplant), Capsicum annuum (sweet pepper), cucumber, luffa, Chinese cabbage, rape, cabbage, calabash, Chinese chives, lotus, lotus root, lettuce; (8) flower crops: Tropaeolum minus, Tropaeolum majus, Canna indica, Opuntia spp., Tagetes spp., Cymbidium (orchid), Crinum asiaticum L., Clivia, Hippeastrum rutilum, Rosa rugosa, Rosa Chinensis, Jasminum sambac, Tulipa gesneriana L., Cerasus sp., Pharbitis nil (L.) Choisy, Calendula officinalis L., Nelumbo sp., Bellis perennis L., Dianthus caryophyllus, Petunia hybrida, Tulipa gesneriana L., Lilium brownie, Prunus mume, Narcissus tazetta L., Jasminum nudiflorum Lindl., Primula malacoides, Daphne odora, Camellia japonica, Michelia alba, Magnolia liliiflora, Viburnum macrocephalum, Clivia miniata, Malus spectabilis, Paeonia suffruticosa, Paeonia lactiflora, Syzygium aromaticum, Rhododendron simsii, Rhododendron hybridum, Michelia figo (Lour.) Spreng., Cercis chinensis, Kerria japonica, Weigela florida, Fructus forsythiae, Jasminum mesnyi, Parochetus communis, Cyclamen persicum Mill., Phalaenophsis hybrid, Dendrobium nobile, Hyacinthus orientalis, Iris tectorum Maxim, Zantedeschia aethiopica, Calendula officinalis, Hippeastrum rutilum, Begonia semperflorenshybr, Fuchsia hybrida, Begonia maculataRaddi, Geranium, Epipremnum aureum; (9) medicinal crops:
Carthamus tinctorius, Mentha spp., Rheum rhabarbarum, Crocus sativus, Lycium chinense, Polygonatum odoratum, Polygonatum Kingianum, Anemarrhena asphodeloides Bunge, Radix ophiopogonis, Fritillaria cirrhosa, Curcuma aromatica, Amomum villosum Lour., Polygonum multiflorum, Rheum officinale, Glycyrrhiza uralensis Fisch, Astragalus membranaceus, Panax ginseng, Panax notoginseng, Acanthopanax gracilistylus, Angelica sinensis, Ligusticum wallichii, Bupleurum sinenses DC., Datura stramonium Linn., Datura metel L., Mentha haplocalyx, Leonurus sibiricus L., Agastache rugosus, Scutellaria baicalensis, Prunella vulgaris L., Pyrethrum carneum, Ginkgo biloba L., Cinchona ledgeriana, Hevea brasiliensis (wild), Medicago sativa Linn, Piper Nigrum L., Radix Isatidis, Atractylodes macrocephala Koidz; (10) raw material crops:
Hevea brasiliensis, Ricinus communis, Vernicia fordii, Moms alba L., Hops Humulus lupulus, Betula, Alnus cremastogyne Burk., Rhus verniciflua stokes; (11) pasture crops:
Agropyron spp., Trifolium spp., Miscanthus sinensis, Pennisetum sp., Phalaris arundinacea, Panicum virgatum, prairiegrasses, Indiangrass, Big bluestem grass, Phleum pratense, turf, cyperaceae (Kobresia pygmaea, Carex pediformis, Carex humilis), Medicago sativa Linn, Phleum pratense L., Medicago sativa, Melilotus suavcolen, Astragalus sinicus, Crotalaria juncea, Sesbania cannabina, Azolla imbircata, Eichhornia crassipes, Amorpha fruticosa, Lupinus micranthus, Trifolium, Astragalus adsurgens pall, Pistia stratiotes linn, Alternanthera philoxeroides, Lolium; (12) sugar crops: Saccharum spp., Beta vulgaris; (13) beverage crops: Camellia sinensis, Camellia Sinensis, tea, Coffee (Coffea spp.), Theobroma cacao, Humulus lupulus Linn.; (14) lawn plants:
Ammophila arenaria, Poa spp.(Poa pratensis (bluegrass)), Agrostis spp.
(Agrostis matsumurae, Agrostis palustris), Lolium spp. (Lolium), Festuca spp. (Festuca ovina L.), Zoysia spp.
(Zoysiajaponica), Cynodon spp. (Cynodon dactylon/bermudagrass), Stenotaphrum secunda tum (Stenotaphrum secundatum), Paspalum spp., Eremochloa ophiuroides (centipedegrass), Axonopus spp. (carpetweed), Bouteloua dactyloides (buffalograss), Bouteloua var. spp.
(Bouteloua gracilis), Digitaria sanguinalis, Cyperusrotundus, Kyllingabrevifolia, Cyperusamuricus, Erigeron canadensis, Hydrocotylesibthorpioides, Kummerowiastriata, Euphorbia humifusa, Viola arvensis, Carex rigescens, Carex heterostachya, turf; (15) tree crops:
Pinus spp., Salix spp., Acer spp., Hibiscus spp., Eucalyptus spp., Ginkgo biloba, Bambusa sp., Populus spp., Prosopis spp., Quercus spp., Phoenix spp., Fagus spp., Ceiba pentandra, Cinnamomum spp., Corchorus spp., Phragmites australis, Physalis spp., Desmodium spp., Populus, Hedera helix, Populus tomentosa Can, Viburnum odoratissinum, Ginkgo biloba L., Quercus, Ailanthus altissima, Schima superba, Ilex pur-purea, Platanus acerifolia, ligustrum lucidum, Buxus megistophylla Levl., Dahurian larch, Acacia mearnsii, Pinus massoniana, Pinus khasys, Pinus yunnanensis, Pinus fmlaysoniana, Pinus tabuliformis, Pinus koraiensis, Juglans nigra, Citrus limon, Platanus acerifolia, Syzygium jambos, Davidia involucrate, Bombax malabarica L., Ceiba pentandra (L.), Bauhinia blakeana, Albizia saman, Albizzia julibrissin, Erythrina corallodendron, Erythrina indica, Magnolia gradiflora, Cycas revolute, Lagerstroemia indica, coniferous, macrophanerophytes, Frutex; (16) nut crops: Bertholletia excelsea, Castanea spp., Corylus spp., Carya spp., Juglans spp., Pistacia vera, Anacardium occidentale, Macadamia (Macadamia integrifolia), Carya illinoensis Koch, Macadamia, Pistachio, Badam, other plants that produce nuts; (17) others: arabidopsis thaliana, Bra chiaria eruciformis, Cenchrus echinatus, Setaria faberi, eleusine indica, Cadaba farinose, algae, Carex elata, ornamental plants, Carissa macrocarpa, Cynara spp., Daucus carota, Dioscorea spp., Erianthus sp., Festuca arundinacea, Hemerocallis fulva, Lotus spp., Luzula sylvatica, Medicago sativa, Melilotus spp., Moms nigra, Nicotiana spp., Olea spp., Ornithopus spp., Pastinaca sativa, Sambucus spp., Sinapis sp., Syzygium spp., Tripsacum dactyloides, Triticosecale rimpaui, Viola odorata, and the like.
In a specific embodiment, the plant is selected from rice, maize, wheat, soybean, sunflower, sorghum, rape, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, potato, sweet potato, Chinese cabbage, cabbage, cucumber, Chinese rose, Scindapsus aureus, watermelon, melon, strawberry, blueberry, grape, apple, citrus, peach, pear, banana, etc.
As used herein, the term "plant" includes a whole plant and any progeny, cell, tissue or part of plant. The term "plant part" includes any part of a plant, including, for example, but not limited to: seed (including mature seed, immature embryo without seed coat, and immature seed); plant cutting; plant cell; plant cell culture; plant organ (e.g., pollen, embryo, flower, fruit, bud, leaf, root, stem, and related explant). Plant tissue or plant organ can be seed, callus tissue, or any other plant cell population organized into a structural or functional unit. Some plant cells or tissue cultures can regenerate a plant that has the physiological and morphological characteristics of the plant from which the cell or tissue is derived, and can regenerate a plant that has substantially the same genotype as the plant. In contrast, some plant cells cannot regenerate plants. The regenerable cells in plant cells or tissue cultures can be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, silks, flowers, kernels, ears, cobs, husks, or stems.
The plant parts comprise harvestable parts and parts that can be used to propagate offspring plants. The plant parts that can be used for propagation include, for example, but not limited to:
seeds, fruits, cuttings, seedlings, tubers and rootstocks. The harvestable parts of plants can be any of useful parts of plants, including, for example, but not limited to:
flowers, pollen, seedlings, tubers, leaves, stems, fruits, seeds and roots.
The plant cells are the structural and physiological units of plants. As used herein, the plant cells include protoplasts and protoplasts with partial cell walls. The plant cells may be in a form of isolated single cells or cell aggregates (e.g., loose callus and cultured cells), and may be part of higher order tissue units (e.g., plant tissues, plant organs, and intact plants). Therefore, the plant cells can be protoplasts, gamete-producing cells, or cells or collection of cells capable of regenerating a whole plant. Therefore, in the embodiments herein, a seed containing a plurality of plant cells and capable of regenerating into a whole plant is considered as a "plant part".
As used herein, the term "protoplast" refers to a plant cell whose cell wall is completely or partially removed and whose lipid bilayer membrane is exposed. Typically, the protoplast is an isolated plant cell without cell wall, which has the potential to regenerate a cell culture or a whole plant.
The plant "offspring" includes any subsequent generations of the plant.
The terms "inhibitory herbicide tolerance" and "inhibitory herbicide resistance" can be used interchangeably, and both refer to tolerance andresistance to an inhibitory herbicide .
"Improvement in tolerance to inhibitory herbicide " and "improvement in resistance to inhibitory herbicide" mean that the tolerance or resistance to the inhibitory herbicide is improved as compared to a plant containing the wild-type gene.
Generally, if the herbicidal compounds as described herein, which can be employed in the context of the present invention are capable of forming geometrical isomers, for example E/Z
isomers, it is possible to use both, the pure isomers and mixtures thereof, in the compositions according to the invention. If the herbicidal compounds as described herein have one or more centers of chirality and, as a consequence, are present as enantiomers or diastereomers, it is possible to use both, the pure enantiomers and diastereomers and their mixtures, in the compositions according to the invention. If the herbicidal compounds as described herein have ionizable functional groups, they can also be employed in the form of their agriculturally acceptable salts. Suitable are, in general, the salts of those cations and the acid addition salts of those acids whose cations and anions, respectively, have no adverse effect on the activity of the active compounds. Preferred cations are the ions of the alkali metals, preferably of lithium, sodium and potassium, of the alkaline earth metals, preferably of calcium and magnesium, and of the transition metals, preferably of manganese, copper, zinc and iron, further ammonium and substituted ammonium in which one to four hydrogen atoms are replaced by Ci-C4-alkyl, hydroxy-C I-C4-alkyl, C t-C4-al koxy-C 1-C 4-al kyl, hydroxy-C i-C4-al koxy-C
i-C 4-al kyl, phenyl or benzyl, preferably ammonium, methyl ammonium, isopropylammonium, dimethylammonium, diisopropylammonium, trimethylammonium, heptylammonium, dodecylammonium, tetradecyl ammonium, tetramethylammonium, tetraethylammonium, tetrabutylammonium, 2-hydroxyethylammonium (olamine salt), 2-(2-hydroxyeth-1 -oxy)eth-l-ylammonium (diglycolamine salt), di(2-hydroxyeth-1-yl)ammonium (diolamine salt), tri s(2-hydroxyethyl)ammonium (trol amine salt), tris(2-hydroxypropyl)ammonium, benzyltrimethylammonium, benzyltriethylammonium, N,N,N-trimethylethanolammonium (choline salt), furthermore phosphonium ions, sulfonium ions, preferably tri(Ct-C4-alkyl)sulfonium, such as tri-methylsulfonium, and sulfoxonium ions, preferably tri(Ct-C4-alkyl)sulfoxonium, and finally the salts of polybasic amines such as N,N-bis-(3-aminopropyl)methylamine and diethylenetri amine. Anions of useful acid addition salts are primarily chloride, bromide, fluoride, iodide, hydrogensulfate, methylsulfate, sulfate, dihydrogenphosphate, hydrogenphosphate, nitrate, bi-carbonate, carbonate, hexafluorosilicate, hexafluorophosphate, benzoate and also the anions of C1-C4-alkanoic acids, preferably formate, acetate, propionate and butyrate.
The herbicidal compounds as described herein having a carboxyl group can be employed in the form of the acid, in the form of an agriculturally suitable salt as mentioned above or else in the form of an agriculturally acceptable derivative, for example as amides, such as mono- and di-Ci-C6-alkylamides or arylamides, as esters, for example as allyl esters, propargyl esters, Ci-C10-alkyl esters, alkoxyalkyl esters, tefuryl ((tetra-hydrofuran-2-yl)methyl) esters and also as thioesters, for example as Ci-Cio-alkylthio esters. Preferred mono- and di-Ci-C6-alkylamides are the methyl and the dimethylamides. Preferred arylamides are, for example, the anilides and the 2-chloroanilides.
Preferred alkyl esters are, for example, the methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, mexyl (1-methyl hexyl), meptyl (1-methylheptyl), heptyl, octyl or isooctyl (2-ethylhexyl) esters. Preferred C1-C4-alkoxy- Ci-C4-alkyl esters are the straight-chain or branched Ci-C4-alkoxy ethyl esters, for example the 2-methoxyethyl, 2-ethoxyethyl, 2-butoxyethyl (butotyl), 2-butoxypropyl or 3-butoxypropyl ester. An example of a straight-chain or branched Ci-C6-alkylthio ester is the ethylthio ester.
(1) Inhibition of HPPD (Hydroxyphenyl Pyruvate Dioxygenase). a substance that has herbicidal activity per se or a substance that is used in combination with other herbicides and/or additives which can change its effect, and the substance can act by inhibiting HPPD.
Substances which are capable of producing herbicidal activity by inhibiting HPPD are well known in the art, including but not limited to the following types:
1) triketones, e.g., sulcotrione (CAS NO.: 99105-77-8), mesotrione (CAS NO.:
104206-82-8), bicyclopyrone (CAS NO.: 352010-68-5), tembotrione (CAS NO.:
335104-84-2), tefuryltrione (CAS NO.: 473278-76-1), benzobicyclon (CAS NO.:
156963-66-5);
2) diketonitriles, e.g., 2-cyano-3-cyclopropy1-1-(2-methylsulfony1-4-trifluoromethylphenyl)propane-1,3-dione (CAS NO.: 143701-75-1), 2-cyano-3-cyclopropy1-1-(2-methylsulfony1-3,4- dichlorophenyl)propane-1,3-dione (CAS
NO.:
212829-55-5), 2-cyano-1- [4-(methylsulfony1)-2-trifluoromethylpheny1]-3-(1-methyl cycloprop-yl)propane-1,3-dione (CAS NO.: 143659-52-3);

3) isoxazoles, e.g., isoxaflutole (CAS NO.: 141112-29-0), isoxachlortole (CAS
NO.:
141112-06-3), clomazone (CAS NO.: 81777-89-1);
4) pyrazoles, e.g., topramezone (CAS NO.: 210631-68-8); pyrasulfotole (CAS
NO.:
365400-11-9), pyrazoxyfen (CAS NO.: 71561-11-0); pyrazolate (CAS NO.: 58011-68-0), benzofenap (CAS NO.: 82692-44-2), bipyrazone (CAS NO.: 1622908-18-2), tolpyralate (CAS NO.: 1101132-67-5), fenpyrazone (CAS NO.: 1992017-55-6), cypyrafluone (CAS
NO.: 1855929-45-1), tripyrasulfone (CAS NO.: 1911613-97-2);
5) benzophenons;
6) others: lancotrione (CAS NO.: 1486617-21-3), fenquinotrione (CAS NO.:
1342891-70-6), fufengcao'an(CAS NO:2421252-30-2);
and those mentioned in patent CN105264069A.
(2) Inhibition of EPSPS (Enolpyruvyl Shikimate Phosphate Synthase): e.g., sulphosate, Glyphosate, glyphosate-isopropylammonium, and glyphosate-trimesium.
(3) Inhibition of PPO (Protoporphyrinogen Oxidase) can be divided into pyrimidinediones, diphenyl-ethers, phenylpyrazoles, N-phenylphthalimides, thiadiazoles, oxadiazoles, triazolinones, oxazolidinedionesand other herbicides with different chemical structures.
In an exemplary embodiment, pyrimidinediones herbicides include but not limited to butafenacil (CAS NO: 134605-64-4), saflufenacil (CAS NO: 372137-35-4), benzfendizone (CAS
NO: 158755-95-4), tiafenacil (CAS NO: 1220411-29-9), ethyl [3-[2-chloro-4-fluoro-5-(1-methy1-6-trifluoromethyl -2,4-dioxo-1,2,3,4-tetrahydropyrimidin-3-yl)phenoxy]-2- pyridyloxy]acetate (Epyrifenacil, CAS NO:
353292-31-6), 1 -Methyl-6-thfluoromethy1-3-(2,2,7- thfluoro-3-oxo-4- prop-2-ynyl -3,4-dihydro-2H-benzo[1,4]oxazin-6-y1)- 1H-pyrimidine-2,4-dione (CAS NO: 1304113-05-0), 3-[7-Chloro-5- fluoro-2-(trifluoromethyl)-1 H-benzimidazol-4-y1]-1 -methy1-6-(trifluoromethyl)-1 H-pyrimidine-2,4- dione (CAS NO: 212754-02-4), flupropacil (CAS NO: 120890-70-2), uracil containing isoxazoline disclosed in CN105753853A
(for o F CI
)L 0 0 example, the compound 0-/), uracil pyridines disclosed in W02017/202768 and uracils disclosed in W02018/019842;
Diphenyl-ethers herbicides include but not limited to fomesafen (CAS NO: 72178-02-0), oxyfluorfen (CAS NO: 42874-03-3), aclonifen (CAS NO: 74070-46-5), ethoxyfen-ethyl (CAS
NO: 131086-42-5), lactofen (CAS NO: 77501-63-4), chlomethoxyfen (CAS NO: 32861-85-1), chlornitrofen (CAS NO: 1836-77-7), fluoroglycofen-ethyl (CAS NO: 77501-90-7), Acifluorfen or Acifluorfen sodium (CAS NO: 50594-66-6 or 62476-59-9), Bifenox (CAS NO:
42576-02-3), ethoxyfen (CAS NO: 188634-90-4), fluoronitrofen (CAS NO: 13738-63-1), furyloxyfen (CAS
NO: 80020-41-3), nitrofluorfen (CAS NO: 42874-01-1), and halosafen (CAS NO:
77227-69-1);

Phenylpyrazoles herbicides include but not limited to pyraflufen-ethyl (CAS
NO:
129630-19-9), and fluazolate (CAS NO: 174514-07-9);
N-phenylphthalimides herbicides include but not limited to flumioxazin (CAS
NO:
103361-09-7), cinidonethyl (CAS NO: 142891-20-1), Flumipropyn (CAS NO: 84478-52-4), and flumiclorac-pentyl (CAS NO: 87546-18-7);
Thiadiazoles herbicides include but not limited tofluthiacet-methyl (CAS NO:
117337-19-6), fluthiacet (CAS NO: 149253-65-6), and thidiazimin (CAS NO: 123249-43-4);
Oxadiazoles herbicides include but not limited to Oxadiargyl (CAS NO: 39807-15-3), and Oxadiazon (CAS NO: 19666-30-9);
Triazolinones herbicidesinclude but not limited to carfentrazone (CAS NO:
128621-72-7), carfentrazone-ethyl (CAS NO: 128639-02-1), sulfentrazone (CAS NO: 122836-35-5), azafenidin (CAS NO: 68049-83-2), and bencarbazone (CAS NO: 173980-17-1);
Oxazolidinediones herbicides include but not limited to pentoxazone (CAS NO:
110956-75-7);
Other herbicides include but not limited to pyraclonil (CAS NO: 158353-15-2), flufenpyr-ethyl (CAS NO: 188489-07-8), profluazol (CAS NO: 190314-43-3), trifludimoxazin (CAS NO: 1258836-72-4), N-ethyl-3-2,6-dichloro-4-t fluoromethylphenoxy)-5-methyl-1 H-pyrazole-l-carboxamide (CAS NO: 452098-92-9), N-tetrahydrofurfury1-3-(2,6-dichloro-4-trifluoromethylphenoxy)-5-methy1-1 H-pyrazole-l-carboxamide (CAS NO: 915396-43-9), N-ethyl-3-(2- chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methyl -1H-pyrazole-1-carboxamide (CAS NO: 452099-05-7), N-tetrahydrofurfury1-3-(2-chloro-6-fluoro-4-trifluoromethylphenoxy)-5-methy1-1 H-pyrazole-1-carboxamide (CAS
NO: 452100-03-7), 3-[7-fluoro-3-oxo-4-(prop-2-ynyl) -3,4-dihydro-2H-benzo[1,4]oxazin-6-y1]-1,5-dimethy1-6-thioxo -[1,3,5]triazinan-2,4-dione (CAS
NO:
451484-50-7), 2-(2,2,7-Trifluoro-3-oxo-4- prop-2-yny1-3,4-dihydro-2H-benzo[1,4]oxazin-6-y1)-4,5,6,7-tetrahydro -isoindole-1,3-dione (CAS NO:
1300118-96-0), methyl (E)-4-[2-chloro-5- [4-chloro-5-(difluoromethoxy)-1H-methyl-pyrazol-3-y1]-4-fluoro-phenoxy] -3-methoxy-but-2-enoate (CAS NO: 948893-00-3), phenylpyridines disclosed in W02016/120116, benzoxazinone derivatives disclosed in EP09163242.2, and x4 compounds represented by general formula I I (See patent CN202011462769.7);

NN' Th\JA02: 'I\JAN"\
SNOSN SONO
In another exemplary embodiment, Q represents I , I , 0 o A) III 0 ) 7:' 1 N `V Nk CNANk F3C 0, F3C S, F3C S F3C 0 F3C 0 \ N, (E3c,Tro NANA õk-/L-0 3,, ,o,k(NyNes,.
70 0, 0 0,F3c , or \ 0 H2N __ 0 ;
Y represents halogen, halo C1-C6 alkyl or cyano;
Z represents halogen M represents CH or N;
X represents -CXIX2-(C1-C6 alkyl)õ-, -(C1-C6 alkyl)-CX1X2-(C1-C6 alkyl)õ- or n represents 0 or 1; r represents an integer of 2 or more, Xi, X2 each independently represent H, halogen, C1-C6 alkyl, C2-C6 alkenyl, C2-alkynyl, halo C1-C6 alkyl, halo C2-C6 alkenyl, halo C2-C6 alkynyl, C3-C6 cycloalkyl, C3-C6 cycloalkyl C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, hydroxy C1-C6 alkyl, C1-C6 alkoxy C1-C6 alkyl, phenyl or benzyl;
X3, X4 each independently represent 0 or S;
W represents hydroxy, C1-C6 alkoxy, C2-C6 alkenyloxy, C2-C6 alkynyloxy, halo C1-C6 alkoxy, halo C2-C6 alkenyloxy, halo C2-C6 alkynyloxy, C3-C6 cycloalkyloxy, phenyloxy, sulfhydryl, C1-C6 alkylthio, C2-C6 alkenylthio, C2-C6 alkynylthio, halo C1-C6 alkylthio, halo C2-C6 alkenylthio, halo C2-C6 alkynylthio, C3-C6 cycloalkylthio, phenylthio, amino or C1-C6 alkylamino.
In another exemplary embodiment, the compound represented by the general formula I

is selected from compound A: Q represents I ; Y represents chlorine; Z
represents fluorine; M represents CH; X represents - C*XiX2-(C1-C6 alkyl)õ-(C* is the chiral center, R
configuration), n represents 0; Xi represents hydrogen; X2 represents methyl;
X3 and X4 each independently represent 0; W represents methoxy.
4) Inhibition of ALS (Acetolactate Synthase) including but not limited to the following herbicides or their mixtures:

(1) sulfonylureas such as amidosulfuron, azimsulfuron, bensulfuron, bensulfuron-methyl, chlorimuron, chlorimuron-ethyl, chlorsulfuron, cinosulfuron, cyclosulfamuron, ethametsulfuron, ethametsulfuron-methyl, ethoxysulfuron, flazasulfuron, flucetosulfuron, flupyrsulfuron, flupyrsulfuron-methyl-sodium, foramsulfuron, halosulfuron, halosulfuron- methyl, imazosulfuron, iodosulfuron, iodosulfuron-methyl-sodium, iofensulfuron, iofensulfuron-sodium, mesosulfuron, metazosulfuron, metsulfuron, metsulfuron-methyl, nicosulfuron, orthosulfamuron, oxasulfuron, primisulfuron, primisulfuron-methyl, propyrisulfuron, prosulfuron, pyrazosulfuron, pyrazosulfuron-ethyl, rim sulfuron, sulfometuron, sulfometuron-methyl, sulfosulfuron, thifensulfuron, thifensulfuron-methyl, triasulfuron, tribenuron, tribenuron-methyl, trifloxysulfuron, trifloxysulfuron-sodium, triflusulfuron, triflusulfuron-methyl and tritosulfuron;
(2) imidazolinones such as imazamethabenz, imazamethabenz-methyl, imazamox, imazapic, imazapyr, imazaquin and imazethapyr;
(3) triazolopyrimidine herbicides and sulfonanilides such as cloransulam, cloransulam-methyl, diclosulam, flumetsulam, florasulam, metosulam, penoxsulam, pyroxsulam, pyrimisulfan and triafamone;
(4) pyrimidinylbenzoates such as bispyrib ac, bispyribac-sodium, pyribenzoxim, pyriftalid, pyriminob ac, pyriminobac-methyl, pyrithiobac, pyrithiobac-sodium, 4-[[[24(4,6-dimethoxy-2- pyrimidinyl)oxy]phenyl]methyliaminoi-benzoic acid-1 -methylethyl ester (CAS NO.: 420138-41 -6), 4-[[[2-[(4,6-dimethoxy-2-pyrimidinyl) oxy]
phenyl]methyl]amino]-benzoic acid propyl ester (CAS NO.: 420138-40-5), N-(4-bromopheny1)-2-[(4,6-dimethoxy-2- pyrimidinyl)oxy]benzenemethanamine (CAS
NO.:
420138-01 -8);
(5) sulfonylaminocarbonyl-triazolinone herbicides such as flucarbazone, flucarbazone-sodium, propoxycarbazone, propoxycarbazone-sodium, thiencarbazone and thiencarbazone-methyl;
5) Inhibition of ACCase (Acetyl CoA Carboxylas): Fenthiaprop, alloxydim, alloxydim-sodium, butroxydim, clethodim, clodinafop, clodinafop-propargyl, cycloxydim, cyhalofop, cyhalofop-butyl, diclofop, diclofop-methyl, fenoxaprop, fenoxaprop-ethyl, fenoxaprop-P, fenoxaprop-P-ethyl, fluazifop, fluazifop-butyl, fluazifop-P, fluazifop-P-butyl, haloxyfop, haloxyfop-methyl, haloxyfop-P, haloxyfop-P-methyl, metamifop, pinoxaden, profoxydim, propaquizafop, quizalofop, quizalofop-ethyl, quizalofop-tefuryl, quizalofop-P, quizalofop-P-ethyl, quizalofop-P-tefuryl, sethoxydim, tepraloxydim, tralkoxydim, 4-(4'-Chloro-4-cycl opropy1-2'-fluoro[1, 1'-biphenyl 1-3 -y1)-5 -hydroxy-2,2,6,6-tetram ethy1-2H-pyran-3(6H)-one(CAS NO. 1312337-72-6); 4-(2',4'-Dichloro-4-cyclopropyl[1,1'-biphenyl] -3-y1) -5-hydroxy-2,2,6,6-tetramethy1-2H-pyran-3(6H)-one(CAS NO.: 1312337-45-3);

4-(4'-Chloro-4-ethyl-2'-fluoro[1,1'-bipheny1]-3-y1)-5-hydroxy-2,2,6,6-tetramethyl -2H-pyran-3(6H)-one(CAS NO.: 1033757-93-5); 4-(2',4'-Dichloro-4-ethyl[1, l'-bipheny1]-3-y1)-2,2,6,6-tetramethy1-2H-pyran-3,5(4H,6H)-dione (CAS NO.:
1312340-84-3);
5-(Acetyloxy)-4-(4'-chloro-4-cyclopropy1-2'-fluoro[1,1'-biphenyl]
-3-y1)-3,6-dihydro-2,2,6,6-tetramethy1-2H-pyran-3-one (CAS NO.: 1312337- 48-6);
5-(Acetyloxy)-4-(2',4'-dichloro-4-cyclopropy141,1'-bipheny1]-3-y1)-3,6-dihydro -2,2,6,6-tetramethy1-2H-pyran-3-one; 5-(Acetyloxy)-4-(4'-chloro-4-ethy1-2'-fluoro [1,1'-bipheny1]-3-y1)-3,6-dihydro-2,2,6,6-tetramethy1-2H-pyran-3-one(CAS NO.:
1312340-82-1); 5-(Acetyloxy)-4-(2',4'-dichloro -4-ethyl[1,1'-bipheny1]-3-y1)-3,6-dihydro-2,2,6,6-tetramethyl-2H-pyran-3-one (CAS NO.: 1033760-55-2); 4-(4'-Chloro -4-cyclopropy1-2'-fluoro[1,11-biphenyl] -3 -y1)-5,6-dihydro-2,2,6,6-tetram ethy1-5 -oxo-2H-pyran-3-y1 carbonic acid methyl ester (CAS NO.: 1312337-51-1); 4-(2',4'-Dichloro-4-cyclopropy141,11-biphenyl]-3-y1)-5,6-dihydro-2,2,6,6-tetramethyl-5-oxo -2H-pyran-3-y1 carbonic acid methyl ester; 4-(4'-Chloro-4-ethyl-2'-fluoro [1,1'-bipheny1]-3-y1)-5,6-dihydro-2,2,6,6-tetramethy1-5-oxo-2H-pyran-3-y1 carbonic acid methyl ester (CAS NO.: 1312340-83-2); 4-(2',4'-Dichloro-4-ethyl [1,1'-biphenyl]
-3-y1)-5,6-dihydro-2,2,6,6-tetramethy1-5-oxo-2H-pyran-3-y1 carbonic acid methyl ester (CAS NO.: 1033760-58-5).
(6) Inhibition of GS (Glutamine Synthetase):e.g., Bialaphos/bilanafos, Bilanaphos-natrium, Glufosinate-ammonium, Glufosinate, and glufosinate-P.
(7) Inhibition of PDS(Phytoene Desaturase): e.g., flurochlori done, flurtamone, beflubutamid, norflurazon, fluridone, Diflufenican,Picolinafen, and 4-(3-trifluoromethylphenoxy) -2-(4-trifluoromethylphenyl)pyrimidine (CAS NO:
180608-33-7).
(8) Inhibition of DHPS (Dihydropteroate Synthase): e.g., Asulam.
(9) Inhibition of DXPS (Deoxy-D-Xyulose Phosphate Synthase): e.g., Bixlozone, and Clomazone.
(10) Inhibition of HST (Homogentisate Solanesyltransferase):
e.g.,Cyclopyrimorate.
(11) Inhibition of SPS (Solanesyl Diphosphate Synthase): e.g., Aclonifen.
(12) Inhibition of Cellulose Synthesis: e.g., Indaziflam, Triaziflam, Chlorthiamid, Dichlobenil, Isoxaben, Flupoxam, 1-cyclohexy1-5-pentafluorphenyloxy-1441,2,4,6]
thiatriazin-3-ylamine (CAS NO: 175899-01-1), and the azines disclosed in CN109688807A.
(13) Inhibition of VLCFAS (Very Long-Chain Fatty Acid Synthesis) include but not limited to the following types:
1) a-Chloroacetamides: e.g., acetochlor, alachlor, butachlor, dimethachlor, dimethenamid, dimethenamid-P, metazachl or, metolachlor, metolachlor-S, pethoxamid, pretilachlor, propachlor, propisochlor, and thenylchlor;

2) a-Oxyacetamides e.g., flufenacet, and mefenacet;
3) a-Thioacetamides: e g , anilofos, and piperophos;
4) Azolyl-carboxamides: e.g., cafenstrole, fentrazamide, and ipfencarbazone;
5) Benzofuranes e.g., Benfuresate, and Ethofumesate;
6) Isoxazolines: e.g., fenoxasulfone, and pyroxasulfone;
7) Oxiranes e.g., Indanofan, and Tridiphane;
8) Thiocarbamates: e.g., Cycloate,Dimepiperate,EPTC,Esprocarb,Molinate,Orbencarb,Prosulfocarb,Thiobencar b/Be nthiocarb,Tri-allate,Vernolate, and isoxazoline compounds of the formulae 11.1, 11.2, 11.3, 11 4, 11.5, 11.6, 11.7, 11.8 and II.9,and other isoxazoline compounds mentioned in patent WO
2006/024820, WO 2006/037945, WO 2007/071900, WO 2007/096576, etc F3C N F,C N
F I1/41.-OH P .-V-CH
P \s:' õ., 3 HHat>cf\-- cyN FtIr OCHF.z iiHt>ellsi F OCH F2 0,1 11,2 F,C ts,1 Fr N F,C ki iisC o.N 14 C ,..t4 F

11,3 114 11,5 FAC F,C ki rs A \--At "'lir' N-CH
ii3C.,f-ir -A 4N
HH:CC)(11:),N F-.' 'F OCHF2 tie 11,7 F3C N, F C

F 0,. p --- N-CH F a\ P 1 NH
Nst. 4, 3 H e' -NI
F F 0CHF2 3 a F F
11,9 11.6

(14) Inhibition of fatty acid thioesterase: e.g., Cinmethylin, and Methiozolin;

(15) Inhibition of serine threonine protein phosphatase: e.g., Endothall.

(16) Inhibition of lycopene cyclase: e.g., Amitrole The term "wild-type" refers to a nucleic acid molecule or protein that can be found in nature.
In the present invention, the term "cultivation site" comprises a site where the plant of the present invention is cultivated, such as soil, and also comprises, for example, plant seeds, plant seedlings and grown plants. The term "weed-controlling effective amount"
refers to an amount of herbicide that is sufficient to affect the growth or development of the target weed, for example, to prevent or inhibit the growth or development of the target weed, or to kill the weed.
Advantageously, the weed-controlling effective amount does not significantly affect the growth and/or development of the plant seeds, plant seedlings or plants of the present invention. Those skilled in the art can determine such weed-controlling effective amount through routine experiments.
The term "gene" comprises a nucleic acid fragment expressing a functional molecule (such as, but not limited to, specific protein), including regulatory sequences before (5' non-coding sequences) and after (3' non-coding sequences) a coding sequence.
The DNA sequence that "encodes" a specific RNA is a DNA nucleic acid sequence that can be transcribed into RNA. The DNA polynucleotides can encode a RNA (mRNA) that can be translated into a protein, or the DNA polynucleotides can encode a RNA that cannot be translated into a protein (for example, tRNA, rRNA, or DNA-targeting RNA; which are also known as "non-coding" RNA or " ncRNA").
The terms "polypeptide", "peptide" and "protein" are used interchangeably in the present invention, and refer to a polymer of amino acid residues. The terms are applied to amino acid polymers in which one or more amino acid residues are artificially chemical analogs of corresponding and naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence" and "protein" may also include their modification forms, including but not limited to glycosylation, lipid linkage, sulfation, 7-carboxylation of glutamic acid residue, hydroxylation and ADP-ribosylation.
The term "biologically active fragment" refers to a fragment that has one or more amino acid residues deleted from the N and/or C-terminus of a protein while still retaining its functional activity.
The terms "polynucleotide" and "nucleic acid" are used interchangeably and comprise DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.
The terms "nucleotide sequence" and "nucleic acid sequence" both refer to the sequence of bases in DNA or RNA.
Those of ordinary skill in the art can easily use known methods, such as directed evolution and point mutation methods, to mutate the DNA fragments as shown in SEQ ID No.
9 to SEQ ID
No. 17 of the present invention. Those artificially modified nucleotidesequences that have at least 75% identity to any one of the foregoing sequences of the present invention and exhibit the same function are considered as derivatives of the nucleotide sequence of the present invention and equivalent to the sequences of the present invention.
The term "identity" refers to the sequence similarity to a natural nucleic acid sequence.
Sequence identity can be evaluated by observation or computer software. Using a computer sequence alignment software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences. "Partial sequence" means at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% of a given sequence.
The stringent condition may be as follows: hybridizing at 50 C in a mixed solution of 7%
sodium dodecyl sulfate (SDS), 0.5M NaPO4, and 1 mM EDTA, and washing at 50 C
in 2x SSC
and 0.1% SDS; or alternatively: hybridizing at 50 C in a mixed solution of 7%
SDS, 0.5M
NaPO4 and 1mM EDTA, and washing at 50 C in 1x SSC and 0.1% SDS; or alternatively:
hybridizing at 50 C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 50 C in 0.5x SSC and 0.1% SDS; or alternatively: hybridizing at 50 C in a mixed solution of 7% SDS, 0.5M NaPat and 1mM EDTA, and washing at 50 C in 0.1x SSC and 0.1% SDS;
or alternatively: hybridizing at 50 C in a mixed solution of 7% SDS, 0.5M NaPO4 and 1mM EDTA, and washing at 65 C in 0.1x SSC and 0.1% SDS; or alternatively: hybridizing at 65 C in a solution of 6x SSC, 0.5% SDS, and then membrane washing with 2x SSC, 0.1% SDS
and lx SSC, 0.1% SDS each once; or alternatively: hybridizing and membrane washing twice in a solution of 2x SSC, 0.1% SDS at 68 C, 5 min each time, and then hybridizing and membranewashing twice in a solution of 0.5x SSC, 0.1% SDS at 68 C, 15min each time; or alternatively: hybridizing and membrane washing in a solution of 0.1x SSPE (or 0.1x SSC), 0.1%
SDS at 65 C.
As used in the present invention, "expression cassette", "expression vector"
and "expression construct" refer to a vector such as a recombinant vector suitable for expression of a nucleotide sequence of interest in a plant. The term "expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence may refer to the transcription of the nucleotide sequence (such as transcription to generate mRNA or functional RNA) and/or the translation of RNA into a precursor or mature protein.
The "expression construct" of the present invention can be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, can be an RNA (such as mRNA) that can be translated.
The "expression construct" of the present invention may comprise regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a way different from those normally occurring in nature.
The "highly-expressing gene" in the present invention refers to a gene whose expression level is higher than that of a common gene in a specific tissue.
The terms "recombinant expression vector" or "DNA construct" are used interchangeably herein and refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are usually produced for the purpose of expression and/or propagation of the insert or for the construction of other recombinant nucleotide sequences. The insert may be operably or may be inoperably linked to a promoter sequence and may be operably or may be inoperably linked to a DNA regulatory sequence.
The terms "regulatory sequence" and "regulatory element" can be used interchangeably and refer to a nucleotide sequence that is located at the upstream (5' non-coding sequence), middle or downstream (3' non-coding sequence) of a coding sequence, and affects the transcription, RNA
processing, stability or translation of a related coding sequence. Plant expression regulatory elements refer to nucleotide sequences that can control the transcription, RNA
processing or stability or translation of a nucleotide sequence of interest in plants.
The regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyA recognition sequences.
The term "promoter" refers to a nucleic acid fragment capable of controlling the transcription of another nucleic acid fragment. In some embodiments of the present invention, the promoter is a promoter capable of controlling gene transcription in plant cells, regardless of whether it is derived from plant cells. The promoter can be a constitutive promoter or a tissue-specific promoter or a developmentally regulated promoter or an inducible promoter.
The term "strong promoter" is a well-known and widely used term in the art.Many strong promoters are known in the art or can be identified by routine experiments.
The activity of the strong promoter is higher than the activity of the promoter operatively linked to the nucleic acid molecule to be overexpressed in a wild-type organism, for example, a promoter with an activity higher than the promoter of an endogenous gene. Preferably, the activity of the strong promoter is higher by about 2%, 5%, 8%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 700%, 800%, 900%, 1000% or more than 1000% than the activity of the promoter operably linked to the nucleic acid molecule to be overexpressed in the wild-type organism. Those skilled in the art know how to measure the activity of apromoter and compare the activities of different promoters.
The term "constitutive promoter" refers to a promoter that will generally cause gene expression in most cell types in most cases. "Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably, and refer to a promoter that is mainly but not necessarily exclusively expressed in a tissue or organ, and also expressed in a specific cell or cell type.
"Developmentally regulated promoter" refers to a promoter whose activity is determined by a developmental event. "Inducible promoter" responds to an endogenous or exogenous stimulus (environment, hormone, chemical signal, etc.) to selectively express an operably linked DNA
sequence.
As used herein, the term "operably linked" refers to a connection of a regulatory element (for example, but not limited to, promoter sequence, transcription termination sequence, etc.) to a nucleic acid sequence (for example, a coding sequence or open reading frame) such that the transcription of the nucleotide sequence is controlled and regulated by the transcription regulatory element. The techniques for operably linking regulatory element region to nucleic acid molecule are known in the art.
The "introducing" a nucleic acid molecule (such as a plasmid, linear nucleic acid fragment, RNA, etc.) or protein into a plant refers to transforming a cell of the plant with the nucleic acid or protein so that the nucleic acid or protein can function in the plant cell.
The term "transformation"
used in the present invention comprises stable transformation and transient transformation.
The term "stable transformation" refers to that the introduction of an exogenous nucleotide sequence into a plant genome results in a stable inheritance of the exogenous gene. Once stably transformed, the exogenous nucleic acid sequence is stably integrated into the genome of the plant and any successive generations thereof The term "transient transformation" refers to that the introduction of a nucleic acid molecule or protein into a plant cell to perform function does not result in a stable inheritance of the foreign gene. In transient transformation, the exogenous nucleic acid sequence is not integrated into the genome of the plant.
Changing the expression of endogenous genes in organisms includes two aspects:
intensity and spatial-temporal characteristics. The change of intensity includes the increase (knock-up), decrease (knock-down) and/or shut off the expression of the gene (knock-out);
the spatial-temporal specificity includes temporal (growth and development stage) specificity and spatial (tissue) specificity, as well as inducibility. In addition, it includes changing the targeting of a protein, for example, changing the feature of cytoplasmic localization of a protein into a feature of chloroplast localization or nuclear localization.
Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now described.
All publications and patents cited in this description are incorporated herein by reference as if each individual publication or patent is exactly and individually indicated to be incorporated by reference, and is incorporated herein by reference to disclose and describe methods and/or materials related to the publications cited. The citation of any publication which it was published before the filing date should not be interpreted as an admission that the present invention is not eligible to precede the publication of the existing invention. In addition, the publication date provided may be different from the actual publication date, which may require independent verification.
Unless specifically stated or implied, as used herein, the terms "a", "a/an"
and "the" mean "at least one." All patents, patent applications, and publications mentioned or cited herein are incorporated herein by reference in their entirety, with the same degree of citation as if they were individually cited.
The present invention has the following advantageous technical effects:
The present invention comprehensively uses the information of the following two different professional fields to develop a method for directly creating new genes in organisms, completely changing the conventional use of the original gene editing tools (i.e., knocking out genes), realizing a new use thereof for creating new genes, in particular, realizing an editing method for knocking up endogenous genes by using gene editing technology to increase the expression of target genes. The first is the information in the field of gene editing, that is, when two or more different target sites and Cas9 simultaneously target the genome or organism, different situations such as deletion, inversion, doubling or inversion-doubling may occur. The second is the information in the field of genomics, that is, the information about location and distance of different genes in the genome, and specific locations, directions and functions of different elements (promoter, 5'UTR, coding region (CDS), different domain regions, terminator, etc.) in genes, and expression specificity of different genes, etc By combining the information in these two different fields, breaks are induced at specific sites of two or more different genes or at two or more specific sites within a single gene (specific sites can be determined in the field of genomics), a new combination of different gene elements or functional domains can be formed through deletion, inversion, doubling, and inversion-doubling or chromosome arm exchange, etc.
(the specific situations would be provided in the field of gene editing), thereby specifically creating a new gene in the organism.
The new genes created by the present invention are formed by the fusion or recombination of different elements of two or more genes under the action of the spontaneous DNA repair mechanism in the organism to change the expression intensity, spatial-temporal specificity, special functional domains and the like of the original gene without an exogenous transgene or synthetic gene elements. Because the new gene has the fusion of two or more different gene elements, this greatly expands the scope of gene mutation, and will produce more abundant and diverse functions, thus it has a wide range of application prospects. At the same time, these new genes are not linked to the gene editing vectors, so the vector elements can be removed through genetic segregation, and thereby resulting in non-transgenic biological materials containing the new genes for animal and plant breeding. Alternatively, non-integrated transient editing can be performed by delivery of mRNA or ribonucleic acid protein complex (RNP) to create non-genetically modified biological materials containing the new genes. This process is non-transgenic and the resultant edited materials would contain no transgene as well. In theory and in fact, these new genes can also be obtained through traditional breeding techniques (such as radiation or chemical mutagenesis). The difference is that the screening with traditional techniques requires the creation of libraries containing a huge number of random mutants and thus it is time-consuming and costly to screen new functional genes. While in the present invention, new functional genes can be created through bioinformatics analysis combined with gene editing technology, the breeding duration can be greatly shortened. The method of the present invention is not obliged to the current regulations on gene editing organisms in many countries.
In addition, the new gene creation technology of the present invention can be used to change many traits in organisms, including the growth, development, resistance, yield, etc., and has great application value. The new genes created may have new regulatory elements (such as promoters), which will change the expression intensity and and/or spatial-temporal characteristics of the original genes, or will have new amino acid sequences and thus have new functions. Taking crops as an example, changing the expression of specific genes can increase the resistance of crops to noxious organisms such as pests and weeds and abiotic stresses such as drought, waterlogging, and salinity, and can also increase yield and improve quality. Taking fish as an example, changing the expression characteristics of growth hormone in fish can significantly change its growth and development speed.
Brief Description of Drawings Figure 1 shows a schematic diagram of creating a new HPPD gene in rice.
Figure 2 shows a schematic diagram of creating a new EPSPS gene in rice.
Figure 3 shows a schematic diagram of creating a new PPDX gene in Arabidopsis thaliana.
Figure 4 shows a schematic diagram of creating a new PPDX gene in rice.
Figure 5 shows the sequencing results for the HPPD-duplication Scheme tested with rice protoplast.
Figure 6 shows the map of the Agrobacterium transformation vector pQY2091 for rice.
Figure 7 shows the electrophoresis results of the PCR products for the detection of new gene fragments in pQY2091 transformed hygromycin resistant rice callus. The arrow indicates the PCR band of the new gene created by the fusion ofthe promoter of the UBI2 gene with the coding region of the HPPD. The numbers are the numbers of the different callus samples. M represents DNA Marker, and the band sizes are 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp in order.

Figure 8 shows the electrophoresis results of the PCR products for the detection of new gene fragments in pQY2091 transformed rice TO seedlings. The arrow indicates the PCR band of the new gene created by the fusion of the promoter of the UBI2 gene with the coding region of the HPPD. The numbers are the serial numbers of the different TO seedlings. M
represents DNA
Marker, and the band sizes are sequentially 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp.
Figure 9 shows the test results for the resistance to Bipyrazone of the QY2091 TO generation of the HPPD gene doubling strain. In the same flowerpot, the wild-type Jinjing 818 is on the left, and the HPPD doubling strain is on the right.
Figure 10 shows the relative expression levels of the HPPD and UBI2 genes in the QY2091 TO generation of the HPPD gene doubling strain. 818CK1 and 818CK3 represent two control plants of the wild-type Jinjing 818; 13M and 20M represent the primary tiller leaf samples of the QY2091-13 and the QY2091-20 TO plants; 13L and 20L represent the secondary tiller leaf samples of the QY2091-13 and the QY2091-20 TO plants used in the herbicide resistance test.
Figure 11 shows a schematic diagram of the possible genotypes of QY2091 Ti generation and the binding sites of the molecular detection primers.
Figure 12 shows the comparison of the sequencing results detecting the HPPD
doubling and the predicted doubled sequences for QY2091-13 and QY2091-20.
Figure 13 shows the results of the herbicide resistance test for the Ti generation of the QY2091 HPPD doubling strain at the seedling stage.
Figure 14 shows a schematic diagram of the types of the possible editing event of rice PPO1 gene chromosome fragment inversion and the binding sites of molecular detection primers.
Figure 15 shows the sequencing results of the EPSPS-inversion detection.
Figure 16 shows the map of the rice Agrobacterium transformation vector pQY2234.
Figure 17 shows the electrophoresis results of the PCR products for the detection of new gene fragments of hygromycin resistant rice callus transformed with pQY2234.
The arrow indicates the PCR band of the new gene created by the fusion ofthe promoter of the CP12 genewith the coding region of the PPO1. The numbers are the serial numbers of different callus samples. M represents DNA Marker, and the band sizes are sequentially 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 2500bp, 5000bp, 7500bp.
Figure 18 shows the resistance test results of the PPO1 gene inversion strain to Compound A
of the QY2234 TO generation. Under the same treatment dose, the left flowerpot is the wild-type Huaidao No.5 control, and the right is the PPO1 inversion strain.
Figure 19 shows the relative expression levels of PPO1 and CP12 genes in the generation PPO1 inversion strain. H5CK1 and H5CK2 represent two wild-type Huaidao No.5 control plants; 252M, 304M and 329M represent the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 TO plants; 252L, 304L and 329L represent secondary tiller leaf samples.
Figure 20 shows the comparison of the sequencing result of the PPO1 inversion with the predicted inversion sequence in the Huaidao 5 background.
Figure 21 shows the comparison of the sequencing result of the PPO1 inversion with the predicted inversion sequence in the Jinjing 818 background.

Figure 22 shows the herbicide resistance test results for the Ti generation of the QY2234 PPO1 inversion strain at seedling stage.
Figure 23 Duplication created a new GH1 gene cassette in zebrafish embryos.
The GH1 gene is the growth hormone gene in zebrafish. CollAla is collagen type I alpha la gene.
CollAla-GH1 fusion was the new gene cassette as a result of the duplication.
DNA
template used for PCR amplification in the Control group (CK) was extracted from young zebrafish without microinjection. DNA template used for PCR amplification in theTreatment group (RNP treat) was DNA sample extracted from young zebrafish after microinjection.
Figure 24 PPO1 inversion event lines were tested for herbicide resistance in the field at Ti generation of QY2234 rice plants. WT is wild-type Jinjing 818. 5# and 42#
represent samples from the PPO1 inversion event lines of QY2234/818-5 and QY2234/818-42, respectively. The herbicide tested was PPO inhibitor compound A.
Figure 25 shows the Western Blot detection of PPO1 protein in the Ti rice plants of the QY2234 lines. 5#, 42#, 114#, and 257# represent the samples from the inversion event lines of QY2234/818-5, QY2234/818-42, QY2234/818-144, and QY2234/818-257, respectively.
Figure 26 shows the field assay of HPPD inhibitor herbicide resistance under field conditions at Ti generation of QY2091 rice plants. 12# and 21# represent QY2091-12 and QY2091-21 duplication event lines, respectively. The herbicide tested was HHPD
inhibitor Bipyrazone.
Figure 27 A schematic diagram of the duplicated DNA fragment harboring PPO1 gene in rice, and 4 duplicated events were detected in rice protoplast cells using sequencing peak comparison. pQY2648, pQY2650, pQY2651, pQY2653 are the vector numbers tested.
R2, F2 were used as sequencing primers.The diagram is not in proportion with DNA
segment lengths.
Figure 28 A schematic diagram of fragment translocation between chromosomel and chromosome2 that up-regulates HPPD gene expression in rice. After targeted fragment translocation, CP12 gene promoter drives HPPD CDS expression; at the same time, HPPD
gene promoter drives CP12 CDS expression. The diagram is not in proportion with DNA
segment lengths.
Figure 29 Fusion of the promoter of CP12 and the coding region of HPPD was detected in rice protoplast cells transformed with pQY2257.The diagram is not in proportion with DNA segment lengths.
Figure 30 Fusion of the promoter of HPPD and the coding region of CP12 was detected in rice protoplast cells transformed with pQY2259. The diagram is not in proportion with DNA segment lengths.
Figure 31 A schematic diagram of knocking-up HPPD gene expression as a result of the duplication of the segment between the two targeted cuts in rice, which was mediated by CRISPR/LbCpfl. The diagram is not in proportion with DNA segment lengths.
Figure 32 A schematic diagram of fusing the OsCATC gene with a chloroplast signal peptide domain (LOC4331514CTP) through the deletion of the segment between the two targeted cuts in rice protoplast,which results in OsCATC protein have achloroplast signal peptide domain and thus could go to chloroplast after expressed; and the positive events were detected in rice protoplast cells, which was demonstrated by sequencing.
CTP stands for chloroplast signal peptide domain. The diagram is not in proportion with DNA segment lengths.
Figure 33 A schematic diagram of the OsGLO3 gene linking the chloroplast signal peptide domain (L0C4337056CTP) through chromosome fragment inversion between the targeted cuts, which results in OsGLO3 protein have a chloroplast signal peptide domain and thus could go to chloroplast after expressed;while L0C4337056 gene drops its CTP;and the detection results of positive event rice protoplasts.CTP stands for chloroplast signal peptide domain. The diagram is not in proportion with DNA segment lengths.
Figure 34 A schematic diagram showing knock-up of PPO2 gene by duplication of the DNA fragments between the two targeted cuts in rice. A new gene is produced wherethe SAMDC strong promoter drives the expression of PPO2. The diagram is not in proportion with DNA segment lengths.
Figure 35 Positive duplication events were detected in pQY1386-transformed rice calli as indicated by alignment of sequencing data. 28#, 62# are two duplication-positive calli.
The diagram is not in proportion with DNA segment lengths.
Figure 36 Positive duplication events were detected in pQY1387-transformed rice calli as indicated by alignment of sequencing data. 64#, 824, 110#, 145# are duplication-positive calli. The diagram is not in proportion with DNA segment lengths.
Figure 37 Positive duplication events were detected in TO rice plants (QY1387/818-2) emerged from pQY1387-transformed calli. The repair outcomes of two targets as well as the duplication joint were aligned with Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.
Figure 38 The detection results of the relative expression level of PPO2 in QY1387/818 TO rice plants.As expected, PPO2 expression significantly increased meanwhile SAMDC expression significantly reduced.
Figure 39 Herbicide resistance assay of rice QY1387 TO plants. 2# represents the 1387/818-2 line, 4# represents the 1387/818-4 line, and WT is the wild type of Jinjing 818.
The herbicide tested is PPO inhibitor compound A
Figure 40 A schematic diagram of creation of new PPO2 genes by DNA fragment inversion between the two targeted cuts in rice. The diagram is not in proportion with DNA
segment lengths.

Figure 41 Positive inversion events were detected in QY2611-transformed rice calli as indicated by alignment of sequencing data. 10# represents the QY2611/818-10 callus, 13#
represents the QY2611/818-13 callus. The diagram is not in proportion with DNA
segment lengths.
Figure 42 Positive inversion events were detected in QY2612-transformed rice calli as indicated by alignment of sequencing data. 5# represents the QY2612/818-5 callus, 34#
represents the QY2612/818-34 callus. The diagram is not in proportion with DNA
segment lengths.
Figure 43 A schematic diagram of successful generation of new PPO2 gene cassette in maize protoplast cells, through duplication of the segment between the two targeted cutsand demonstrated by alignment of Sanger sequencing data. pQY1340 and pQY1341 are test vectors. The diagram is not in proportion with DNA segment lengths.
Figure 44 A schematic diagram of successful generation of new PP02-2A gene cassette in wheat protoplast cells transfected with pQY2626 vector, through inversion of the segment between the two targeted cuts, anddemonstrated by alignment of Sanger sequencing data.
The diagram is not in proportion with DNA segment lengths.
Figure 45 A schematic diagram of successful generation of new PP02-2B gene cassette in wheat protoplast cells transfected with pQY2631 vector, through duplication of the segment between the two targeted cuts, and demonstrated by alignment of Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.
Figure 46 A schematic diagram of successful generation of new PP02-2D gene cassette in wheat protoplast cells transfected with pQY2635 vector, through duplication of the segment between the two targeted cuts, and demonstrated by alignment of Sanger sequencing data. The diagram is not in proportion with DNA segment lengths.
Figure 47 Sequencing results of chromosome fragment inverted rice Line QY1085/818-23.
Figure 48 Sequencing results of chromosome fragment duplicatedrice Line QY1089/818-321.
Figure 49 A schematic diagram of successful generation of new IGF2 (Insulin-like growth factor 2) gene cassette driven by TNNI2 gene promoter, through inversion of the segment between the two targeted cuts, and demonstrated the detection of the positive fusion event of Pig TNNI2 promoter and IGF2 genein pig primary fibroblast cells. The diagram is not in proportion with DNA segment lengths.
Figure 50 A schematic diagram of successful generation of new TNNI3 (muscle troponin T) gene cassette driven by IGF2 gene promoter, through inversion of the segment between the two targeted cuts, and demonstrated thedetection of the fusion event of Pig IGF2 promoter and TNNT3 gene in pig primary fibroblast cells. The diagram is not in proportion with DNA segment lengths.
Figure 51 shows the sequencing result of forward and reverse primers. The experiment result shows that the fragments between ghl gene and collal a gene in zebra fish embryo are doubled.
Figure 52 is the sequencing result. The experiment result shows that the coding area and the coding area & promotor of ddx5 gene and the coding area & the promotor of ghl gene are exchanged due to the inversion of chromosome fragments;
Figure 53 is the comparison diagram of inversion and wild type zebra fish. The result shows that the growth of zebra fish with upregulated expression is obviously accelerated.
Figure 54 is a schematic diagram of Ubi2 promoter translocation to knock-up gene in rice.
Figure 55 shows the herbicide resistance test results for the Ti generation of the QY378-16 translocation rice at seedling stage.
Specific Models for Carrying Out the Invention The present invention is further described in conjunction with the examples as follows. The following description is just illustrative, and the protection scope of the present invention should not be limited to this.
Example 1: An editing method for knocking up the expression of the endogenous HPPD gene by inducing doubling of chromosome fragment in plant ¨ rice protoplast test HPPD was a key enzyme in the pathway of chlorophyll synthesis in plants, and the inhibition of the activity of the HPPD would eventually lead to albino chlorosis and death of plants. Many herbicides, such as mesotrione and topramezone, were inhibitors with the HPPD as the target protein, and thus increasingthe expression level of the endogenous HPPD gene in plants could improve the tolerance of the plants to these herbicides. The rice HPPD
gene (as shown in SEQ ID NO: 6, in which 1-1067bp is the promoter, and the rest is the expression region) locates on rice chromosome 2. Through bioinformatic analysis, it was found that rice Ubiquitin2 (hereinafter referred to as UBI2) gene (as shown in SEQ ID NO: 5, in which 1-2107bp was the promoter, and the rest was the expression region) locates about 338 kb downstream of HPPD
gene, and the UBI2 gene and the HPPD gene were in the same direction on the chromosome.
According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the expression intensity of the UBI2 gene in rice leaves was 3 to 10 times higher than that of the HPPD gene, and the UBI2 gene promoter was a strong constitutively expressed promoter.
As shown in Figure 1, Scheme 1 shows that double-strand breaks were simultaneously generated at the sites between the promoters and the CDS region of the HPPD
and UBI2 genes respectively, the event of doubling the region between the two breaks were obtained after screening and identification, and a new gene could be formed by fusing the promoter of UBI2 and the coding region of HPPD together. In addition, according to Scheme 2 as shown in Figure 1, a new gene in which the promoter of UBI2 and the coding region of HPPD were fused could also be formed by two consecutive inversions. First, the schemes as shown in Figure 1 were tested in the rice protoplast system as follows:

1. Firstly, the genomic DNA sequencesof the rice HPPD and UBI2 geneswere input into the CRISPOR online tool (http://crispor.tefor.net/) to search for available editing target sites. After online scoring, the following target sites between the promoters and the CDS
regions of HPPD
and UBI2 genes were selected for testing:
0 sHPPD-gui d e RNA1 GTGCTGGTTGCCTTGGCTGC
0 sHPPD-gui d e RNA2 CACAAATTCACCAGCAGCCA
0 sHPPD-gui d e RNA3 TAAGAACTAGCACAAGATTA
0 sHPPD-gui d e RNA4 GAAATAATC AC CAAAC AGAT
The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the HPPD gene, close to the start codon of the HPPD protein, and the guide RNA3 and guide RNA4 located between the promoter and CDS region of the UBI2 gene, close to the UBI2 protein initiation codon.
pHUE411 vector (https://www.addgene.org/62203/) is used as the backbone, and the following primers were designed for the above-mentioned target sites to perform vector construction as described in "Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR/Cas9 Toolkit for multiplex genome editing in plants. BMC
Plant Biol. 2014 Nov 29; 14(1): 327".
Primer No. DNA sequence (5 to 3') OsHPPD-sgRN ATATGGTC T CGGGCGGTGC T GGTTGC C TT GGC T GCGT TTTAGAGC
Al -F TAGAAATAGCAAG
OsHPPD-sgRN ATATGGTC T CGGGCGC AC AAATT C ACCAGC AGC C AGT T TTAGAG

OsHPPD-sgRN TATTGGTCTCTAAACTAATCTTGTGCTAGTTCTTAGCTTCTTGGT

OsHPPD-sgRN TATTGGTCTCTAAACATCTGTTTGGTGATTATTTCGCTTCTTGGTG

gene editing vectors for the following dual-target combination were constructed following the method provided in the above-mentioned literature. Specifically, with the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) as the template, sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 double target fragments were amplified respectively for constructing the sgRNA
expression cassettes. The vectorbackbone of pHUE411 was digested with BsaI, and recovered from the gel, and the target fragment was digested and directly used for the ligation reaction. T4 DNA ligase was used to ligate the vector backbone and the target fragment, and the ligation product was transformed into Trans5a competent cells. Different monoclones were picked and sequenced The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids from the clones with correct sequences, thereby obtaining recombinant plasmids, respectively named as pQY002065, pQY002066, pQY002067, and pQY002068, as follows:
pQY002065 pHUE411-HPPD-sgRNA1+3 combination of OsHPPD-guide RNA1, guide RNA3 pQY002066 pHUE411-HPPD-sgRNA1+4 combination of OsHiPPD-guide RNA1, guide RNA4 pQY002067 pHUE411-HPPD-sgRNA2+3 combination of OsHPPD-guide RNA2, guide RNA3 pQY002068 pHUE411-HPPD-sgRNA2+4 combination of OsHPPD-guide RNA2, guide RNA4 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002065-002068 vectors as follows:
Plasmids were extracted with the Promega Medium Plasmid Extraction Kit (Midipreps DNA
Purification System, Promega, A7640) according to the instructions. The specific steps were:
(1) Adding 5 ml of Escherichia coli to 300 ml of liquid LB medium containing kanamycin, and shaking at 200 rpm, 37 C for 12 to 16 hours;
(2) Placing the above bacteria solution in a 500 ml centrifuge tube, and centrifuging at 5,000 g for 10 minutes, discarding the supernatant;
(3) Adding 3 ml of Cell Resuspension Solution (CRS) to resuspend the cell pellet and vortexing for thorough mixing;
(4) Adding 3 ml of Cell Lysis Solution (CLS) and mixing up and down slowly for no more than 5 minutes;
(5) Adding 3 ml of Neutralization Solution and mixed well by overturning until the color become clear and transparent;
(6) Centrifuging at 14,000g for 15 minutes, and further centrifuging for 15 minutes if precipitate was not formed compact;
(7) Transferring the supernatant to a new 50 ml centrifuge tube, avoiding to suck in white precipitate into the centrifuge tube;
(8) Adding 10 ml of DNA purification resin (Purification Resin, shaken vigorously before use) and mixing well;
(9) Pouring the Resin/DNA mixture was poured into a filter column, and treating by the vacuum pump negative pressure method (0.05 MPa);
(10) Adding 15 ml of Column Wash Solution (CWS) to the filter column, and vacuuming.
(11) Adding 15 ml of CWS, and repeating vacuuming once; vacuuming was extended for 30 s after the whole solution passed through the filter column;
(12) Cutting off the filter column, transferring to a 1.5 ml centrifuge tube, centrifuging at 12,000 g for 2 minutes, removing residual liquid, and transferring the filter column to a new 1.5 ml centrifuge tube;
(13) Adding 200 pL of sterilized water preheated to 70 C, and keeping rest for 2 minutes;
(14) Centrifuging at 12,000 g for 2 minutes to elute the plasmid DNA; and the concentration was generally about 1 pg/pL.
3. Preparing rice protoplasts and performing PEG-mediated transformation:
First, rice seedlings for protoplasts were prepared, which is of the variety Nipponbare. The seeds were provided by the Weeds Department of the School of Plant Protection, China Agricultural University, and expanded in house. The rice seeds were hulled first, and the hulled seeds were rinsed with 75% ethanol for 1 minute, treated with 5% (v/v) sodium hypochlorite for 20 minutes, then washed with sterile water for more than 5 times. After blow-drying in an ultra-clean table, they were placed in a tissue culture bottle containing 1/2 MS medium, 20 seeds for each bottle. Protoplasts were prepared by incubating at 26 C for about 10 days with 12 hours light.
The methods for rice protoplast preparation and PEG-mediated transformation were conducted according to "Lin et al., 2018 Application of protoplast technology to CRISPR/Cas9 mutagenesis: from single-cell mutation detection to mutant plant regeneration.
Plant Biotechnology Journal https://doi.org /10.1111/pbi.12870". The steps were as follows:
(1) the leaf sheath of the seedlings was selected, cut into pieces of about 1 mm with a sharp Geely razor blade, and placed in 0.6 M mannitol and MES culture medium (formulation: 0.6 M
mannitol, 0.4 M MES, pH 5.7) for later use. All materials were cut and transferred to 20 ml of enzymatic hydrolysis solution (formulation: 1.5% Cellulase R10/RS (YaKult Honsha), 0.5%
Mecerozyme R10 (YaKult Honsha), 0.5M mannitol, 20mM KC1, 20mM MES, pH 5.7, 10mM
CaCl2, 0.1% BSA, 5 mM 13-mercaptoethanol), wrapped in tin foil and placed in a 28 C shaker, enzymatically hydrolyzed at 50 rpm in the dark for about 4 hours, and the speed was increased to 100 rpm in the last 2 minutes;
(2) after the enzymatic lysis, an equal volume of W5 solution (formulation:
154mM NaCl, 125mM CaCl2, 5mM KC1, 15mM IVIES) was added, shaken horizontally for 10 seconds to release the protoplasts. The cells after enzymatic lysis were filtered through a 300-mesh sieve and centrifuged at 150 g for 5 minutes to collect protoplasts;
(3) the cells were rinsed twice with the W5 solution, and the protoplasts were collected by centrifugation at 150 g for 5 minutes;
(4) the protoplasts were resuspended with an appropriate amount of MMG
solution (formulation: 3.05g/L MgCl2, lg/L MES, 91.2g/L mannitol), and the concentration of the protoplasts was about 2x 106 cell s/mL.
The transformation of protoplasts was carried out as follows:
(1) to 200 RL of the aforementioned Mi1VIG resuspended protoplasts, endotoxin-free plasmid DNA of high quality (10-20m) was added and tapped to mix well;
(2) an equal volume of 40% (w/v) PEG solution (formulation: 40% (w/v) PEG, 0.5M
mannitol, 100mM CaCl2) was added, tapped to mix well, and kept rest at 28 C in the dark for 15 minutes;
(3) after the induction of transformation, 1.5 ml of W5 solution was added slowly, tapped to mix the cells well. The cells were collected by centrifugation at 150 g for 3 minutes. This step was repeated once;
(4) 1.5 ml of W5 solution was added to resuspend the cells, and placed in a 28 C incubator and cultured in the dark for 12-16 hours. For extracting protoplast genomic DNA, the cultivation should be carried out for 48-60 hours.
4. Genome targeting and detecting new gene:
(1) First, protoplast DNAs were extracted by the CTAB method with some modifications.
The specific method was as follows: the protoplasts were centrifuged, then the supernatant was discarded. 500 iaL of DNA extracting solution (formulation: CTAB 20g/L, NaCl 81.82g/L, 100mM Tris-HC1 (pH 8.0), 20 mM EDTA, 0.2% 13-mercaptoethanol) was added, shaken to mix well, and incubated in a 65 C water bath for 1 hour; when the incubated sample was cooled, 500 of chloroform was added and mixed upside down and centrifuged at 10,000 rpm for 10 minutes; 400 tL of the supernatant was transferred to a new 1.5 ml centrifuge tube, 1 ml of 70%
(v/v) ethanol was added and the mixture was kept at -20 C for precipitating for 20 minutes; the mixture was centrifuged at 12,000 rpm for 15 minutes to precipitate the DNA;
after the precipitate was air dried, 50 [IL of ultrapure water was added and stored at -20 C for later use.

(2) The detection primers in the following table were used to amplify the fragments containing the target sites on both sides or the predicted fragmentsresulting from the fusion of the UBI2 promoter and the HPPD coding region. The lengths of the PCR products were between 300-1000 bp, in which the primer8-F + primer6-R combination was used to detect the fusion fragment at the middle joint after the doubling of the chromosome fragment, and the product length was expected to be 630bp.
Primer Sequence (5' to 3') OsHPPDduplicated-primerl-F CACTACCATCCATCCATTTGC
OsHPPDduplicated-primer6-R GAGTTCCCCGTGGAGAGGT
OsHPPDduplicated-primer3-F TCCATTACTACTCTCCCCGATT
OsHPPDduplicated-primer7-R GTGTGGGGGAGTGGATGAC
OsHPPDduplicated-primer5-F TGTAGCTTGTGCGTTTCGAT
OsHPPDduplicated-primer2-R
GGGATGCCCTCTTTGTCC
OsHPPDduplicated-primer8-F TCTGTGTGAAGATTATTGCCACT
OsHPPDduplicated-primer4-R GGGATGCCCTCCTTATCTTG
The PCR reaction system was as follows:
Components Volume 2 x IS buffer solution 5 1_, Forward primer (10 M) 2 I.
Reverse primer (10 M) 2 1_, Template DNA 2 I.
Ultrapure water Added to 50 litt (3) A PCR reaction was conducted under the following general reaction conditions:
Step Temperature Time Denaturation 98 C 30 s 98 C 15s Amplification for 30-35 cycles 58 C 15 s 72 C 30s Final extension 72 C 3 min Finished 16 C 5min (4) The PCR reaction products were detected by 1% agarose gel electrophoresis.
The results showed that the 630 bp positive band for the predicted fusion fragment of the UBI2 promoter and the HPPD coding region could be detected in the pQY002066 and pQY002068 transformed samples.
5. The positive samples of the fusion fragment of the UBI2 promoter and the HPPD coding region were sequenced for verification, and the OsHPPDduplicated-primer8-F and OsHPPDduplicated-primer6-R primers were used to sequence from both ends. As shown in Figure 5, the promoterof the UBI2 gene and the expression region of the HPPD
gene could be directly ligated, and the editing event of the fusion of the promoter of rice UBI2 gene and the expression region of the HPPD gene could be detected in the protoplast genomic DNA of the rice transformed with pQY002066 and pQY002068 plasmids, indicating that the scheme of doubling the chromosome fragments to form a new HPPD gene was feasible, a new HPPD gene which expression was driven by a strong promoter could be created, and this was defined as an HPPD
doubling event. The sequencing result of the pQY002066 vector transformed protoplast for testing HPPD doubling event was shown in SEQ ID NO: 9; and the sequencing result of the pQY002068 vector transformed protoplast for testing HPPD doubling event was shown in SEQ
ID NO: 10.
Example 2: Creation of herbicide-resistant rice with knock-up expression of endogenous HPPD gene by chromosome fragment doubling through Agrobacterium-mediated transformation 1. Construction of knock-up editing vector: Based on the results of the protoplast test in Example 1, the dual-target combination OsHPPD-guide RNAl:
5'GTGCTGGTTGCCTTGGCTGC3' and OsHPPD-guide RNA4:
5'GAAATAATCACCAAACAGAT3' with a high editing efficiency was selected. The Agrobacterium transformation vector pQY2091 was constructed according to Example 1.
pHUE411 was used as the vector backbone and subjected to rice codon optimization. The map of the vector was shown in FIGURE 6.
2. Agrobacterium transformation of rice callus:
1) Agrobacterium transformation: lm of the rice knock-up editing vector pQY2091 plasmid was added to 100 of Agrobacterium EHA105 heat-shock competent cells (Angyu Biotech, Catalog No. G6040), placed on ice for 5 minutes, immersed in liquid nitrogen for quick freezing for 5 minutes, then removed and heated at 37 C for 5 minutes, and finally placed on ice for 5 minutes. 500111 of YEB liquid medium (formulation: yeast extract lg/L, peptone 5g/L, beef extract 5g/L, sucrose 5g/L, magnesium sulfate 0.5g/L) was added. The mixture was placed in a shaker and incubated at 28 C, 200 rpm for 2-3 hours; the bacteria were collected by centrifugation at 3500 rpm for 30 seconds, the collected bacteria were spread on YEB
(kanamycin 50 mg/L + rifampicin 25 mg/L) plate, and incubated for 2 days in an incubator at 28 C; the single colonies were picked and placed into liquid culture medium, and the bacteria were stored at -80 C.
2) Cultivation of Agrobacterium: The single colonies of the transformed Agrobacterium on the YEB plate was picked,added into 20 ml of YEB liquid medium (kanamycin 50 mg/L +
rifampicin 25 mg/L), and cultured while stirring at 28 C until the 0D600 was 0.5, then the bacteria cells were collected by centrifugation at 5000 rpm for 10 minutes, 20-40 ml of AAM
(Solarbio, lot number LA8580) liquid medium was added to resuspend the bacterial cells to reach 0D600 of 0.2-0.3, and then acetosyringone (Solarbio, article number A8110) was added to reach the final concentration of 20011M for infecting the callus.
3) Induction of rice callus: The varieties of the transformation recipient rice were Huaidao 5 and Jinjing 818, purchased from the seed market in Huai'an, Jiangsu, and expanded in house.
800-2000 clean rice seeds were hulled, then washed with sterile water until the water was clear after washing. Then the seeds were disinfected with 70% alcohol for 30 seconds, then 30 ml of 5% sodium hypochlorite was added and the mixture was placed on a horizontal shaker and shaken at 50 rpm for 20 minutes, then washed with sterile water for 5 times.
The seeds were placed on sterile absorbent paper, air-dried to remove the water on the surface of the seeds, inoculated on an induction medium and cultivated at 28 C to obtain callus.

The formulation of the induction medium: 4.1g/L N6 powder + 0.3 g/L hydrolyzed casein +
2.878 g/L proline + 2 mg/L 2,4-D + 3% sucrose + 0.1g/L inositol + 0.5 g glutamine + 0.45%
phytagel, pH 5.8.
4) Infection of rice callus with Agrobacterium: The callus of Huaidao No. 5 or Jinjing 818 subcultured for 10 days with a diameter of 3 mm was selected and collected into a 50 ml centrifuge tube; the resuspension solution of the Agrobacterium AAM with the 0D600 adjusted to 0.2-0.3 was poured into the centrifuge tube containing the callus, placed in a shaker at 28 C at a speed of 200 rpm to perform infection for 20 minutes; when the infection was completed, the bacteria solution was discarded, the callus was placed on sterile filter paper and air-dried for about 20 minutes, then placed on a plate containing co-cultivation medium to perform co-cultivation, on which the plate was covered with a sterile filter paper soaked with AAM liquid medium containing 100 jiM acetosyringone; after 3 days of co-cultivation, the Agrobacterium was removed by washing (firstly washing with sterile water for 5 times, then washing with 500mg/L cephalosporin antibiotic for 20 minutes), and selective cultured on 50mg/L hygromycin selection medium.
The formulation of the co-cultivation medium: 4.1g/L N6 powder + 0.3 g/L
hydrolyzed casein + 0.5 g/L proline + 2 mg/L 2,4-D + 200 1.1M AS + 10 g/L glucose + 3%
Sucrose + 0.45%
phytagel, pH 5.5.
3. Molecular identification and differentiation into seedlings of hygromycin resistant callus:
Different from the selection process of conventional rice transformation, with specific primers of the fusion fragments generated after the chromosome fragment doubling, hygromycin resistant callus could be molecularly identified during the callus selection and culture stage in the present invention, positive doubling events could be determined, and callus containing new genes resulting from fusion of different gene elements was selected for differentiation cultivation and induced to emerge seedlings. The specific steps were as follows:
1) The co-cultured callus was transferred to the selection medium for the first round of selection (2 weeks). The formulation of the selection medium is: 4.1g/L N6 powder + 0.3 g/L
hydrolyzed casein + 2.878 g/L proline + 2 mg/L 2,4-D + 3% sucrose + 0.5g glutamine + 30 mg/L
hygromycin (HYG) + 500 mg/L cephalosporin (cef) + 0.1 g/L inositol + 0.45%
phytagel, pH 5.8.
2) After the first round of selection was completed, the newly grown callus was transferred into a new selection medium for the second round of selection (2 weeks). At this stage, the newly grown callus with a diameter greater than 3 mm was clamped by tweezers to take a small amount of sample, the DNA thereof was extracted with the CTAB method described in Example 1 for the first round of molecular identification. In this example, the primer pair of OsHPPDduplicated-primer8-F (8F) and OsHPPD duplicated-primer6-R (6R) was selected to perform PCR identification for the callus transformed with the pQY2091 vector, in which the reaction system and reaction conditions were similar to those of Example 1.Among the total of 350 calli tested, no positive sample was detected in the calliof Huaidao 5, while 28 positive samples were detected in the calli of Jinjing 818.The PCR detection results of some calli were shown in Figure 7.
3) The calli identified as positive by PCR were transferred to a new selection medium for the third round of selection and expanding cultivation; after the diameter of the calli was greater than mm, the callus in the expanding cultivation was subjected to the second round of molecular identification using 8F+6R primer pair, the yellow-white callus at good growth status that was identified as positive in the second round was transferred to a differentiation medium to perform differentiation, and the seedlings of about 1 cm could be obtained after 3 to 4 weeks; the differentiated seedlings were transferred to a rooting medium for rooting cultivation, after the seedlings of the rooting cultivation were subjected to hardening off, they were transferred to a flowerpot with soil and placed in a greenhouse for cultivation. The formulation of the differentiation medium is: 4.42g/L MS powder + 0.5 g/L hydrolyzed casein + 0.2 mg/L NAA + 2 mg/L KT + 3% sucrose+ 3% sorbito1+30 mg/L hygromycin + 0.1 g/L inositol +
0.45% phytagel, pH 5.8. The formulation of the rooting medium is: 2.3g/L MS powder + 3%
sucrose + 0.45%
phytagel.
4. Molecular detection of HPPD doubling seedlings (TO generation):
After the second round of molecular identification, 29 doubling event-positive calli were co-differentiated to obtain 403 seedlings of TO generation, and the 8F+6R
primer pair was used for the third round of molecular identification of the 403 seedlings, among which 56 had positive bands.The positive seedlings were moved into a greenhouse for cultivation.The PCR detection results of some TO seedlings were shown in Figure 8.
5. HPPD inhibitory herbicide resistance test for HPPD doubled seedlings (TO
generation):
The transformation seedlings of TO generation identified as doubling event positive were transplanted into large plastic buckets in the greenhouse for expanding propagation to obtain seeds of Ti generation. After the seedlings began to tiller, the tillers were taken from vigorously growing strains, and planted in the same pots with the tillers of the wild-type control varieties at the same growth period. After the plant height reached about 20 cm, the herbicide resistance test was conducted. The herbicide used was Bipyrazone (CAS No. 1622908-18-2) produced by our company, and its field dosage was usually 4 grams of active ingredients per mu (4g a.i./mu). In this experiment, Bipyrazone was applied at adosage gradient of 2g a.i./mu, 4g a.i./mu, 8g a.i./mu and 32g a.i./muwith a walk-in spray tower.
The resistance test results were shown in Figure 9. After 5-7 days of the application, the wild-type control rice seedlings began to show albino, while the strains of the HPPD doubling events all remained normally green. After 4 weeks of the application, the wild-type rice seedlings were close to death, while the strains of the doubling events all continued to remain green and grew normally. The test results showed that the HPPD gene-doubled strains had a significantly improved tolerance to Bipyrazone.
6. Quantitative detection of the relative expression of the HPPD gene in the HPPD doubled seedlings (TO generation):
It was speculated that the improved resistance of the HPPD gene doubled strain to Bipyrazone was due to the fusion of the strong promoter of UBI2 and the HPPD
gene CDS that increased the expression of HPPD, so the TO generation strains QY2091-13 and QY2091-20 were used to take samples from the primary tillers and the secondary tillers used for herbicide resistance test to detect the expression levels of the HPPD and UBI2 genes, respectively, with the wild-type Jinjing 818 as the control. The specific steps were as follows:
1) Extraction of total RNA (Trizol method):

0.1-0.3g of fresh leaves were taken and ground into powder in liquid nitrogen.
lml of Trizol reagent was added for every 50-100mg of tissue for lysis; the Trizol lysate of the above tissue was transferred into a 1.5m1 centrifuge tube, stood at room temperature (15-30 C) for 5 minutes;
chloroform was added in an amount of 0.2m1 per lml of Trizol; the centrifuge tube was capped, shaken vigorously in hand for 15 seconds, stood at room temperature (15-30 C) for 2-3 minutes, then centrifuged at 12000g (4 C) for 15 minutes; the upper aqueous phase was removed and placed in a new centrifuge tube, isopropanol was added in an amount of 0.5 ml per 1 ml of Trizol, the mixture was kept at room temperature (15-30 C) for 10 minutes, then centrifuged at 12000g (2-8 C) for 10 minutes; the supernatant was discarded, and 75% ethanol was added to the pellet in an amount of lml per lml of Trizol for washing. The mixture was vortexed, and centrifuged at 7500g (2-8 C) for 5 minutes. The supernatant was discarded; the precipitated RNA was dried naturally at room temperature for 30 minutes; the RNA precipitate was dissolved by 50 [El of RNase-free water, and stored in the refrigerator at -80 C after electrophoresis analysis and concentration determination.
2) RNA electrophoresis analysis:
An agarose gel at a concentration of 1% was prepared, then 1 pi of the RNA was taken and mixed with 1 tl of 2X Loading Buffer. The mixture was loaded on the gel. The voltage was set to 180V and the time for electrophoresis was 12 minutes. After the electrophoresis was completed, the agarose gel was taken out, and the locations and brightness of fragments were observed with a UV gel imaging system.
3) RNA purity detection:
The RNA concentration was measured with a microprotein nucleic acid analyzer.
RNA with a good purity had an 0D260/0D280 value between 1.8-2.1. The value lower than 1.8 indicated serious protein contamination, and higher than 2.1 indicated serious RNA
degradation.
4) Real-time fluorescence quantitative PCR
The extracted total RNA was reverse transcribed into cDNA with a special reverse transcription kit. The main procedure comprised: first determining the concentration of the extracted total RNA, and a portion of 1-4 vg of RNA was used for synthesizing cDNA by reverse transcriptase synthesis. The resulting cDNA was stored at -20 C.
CAsolution of the RNA template was prepared on ice as set forth in the following table and subjected to denaturation and annealing reaction in a PCR instrument. This process was conducive to the denaturation of the RNA template and the specific annealing of primers and templates, thereby improving the efficiency of reverse transcription.
Table 1: Reverse transcription, denaturation and annealing reaction system Component Amounts (al) Oligo dT primer (50.t.M) 1 IA
dNTP mixture (10mM each) 1 RNA Template 1-4 lag RNase free water Added to 10 tL
Reaction conditions for denaturation and annealing:
65 C 5 min 4 C 5 min The reverse transcription reaction system was prepared as set forth in Table 2for synthesizing cDNA:
Table 2: Reverse transcription reaction system Component Amount (il) Reaction solution after the above denaturation and annealing 10 tl 5X RTase Plus Reaction Buffer 4 pi RNase Inhibitor 0.5 pi Evo M-MLV Plus RTase (200 U/Ial ) 1 jtl RNase free water Added to 20 !.IL
Reaction conditions for cDNA synthesis:
42 C 60 min 95 C 5 min The UBQ5 gene of rice was selected as the internal reference gene, and the synthesized cDNA was used as the template to perform fluorescence quantitative PCR. The primers listed in Table 3 were used to prepare the reaction solution according to Table 4.
Table 3: Sequence 5'-3' of the primer for Fluorescence quantitative PCR

RT-OsHPPD-F CAGATCTTCACCAAGCCAGTAG
RT-OsHPPD-R GAGAAGTTGCCCTTCCCAAA
RT-OsUbi2-F CCTCCGTGGTGGTCAGTAAT
RT-OsUbi2-R GAACAGAGGCTCGGGACG
Table 4: Reaction solution for real-time quantitative PCR (Real Time PCR) Component of mixture Amount (11) SYBR Premix ExTaq II 5 Forward primer (10[iM) 0.2 jtl Reverse primer (101AM) 0.2 cDNA 1 il Rox II 0.2p1 Ultrapure water 3.4 jtl In total 10 pi 0 The reaction was performed following the real-time quantitative PCR reaction steps in Table 5. The reaction was conducted for 40 cycles.
Table 5: Real-time quantitative PCR reaction steps Temperature ( C) Time 50 C 2 min 95 C 10 min 95 C 15 s 60 C 20 s 95 C 15 s 60 C 20 s 95 C 15 s 5) Data processing and experimental results As shown in Table 6, UBQ5 was used as an internal reference, ACt was calculated by subtracting the Ct value of 1.JBQ5from the Ct value of the target gene, and then 2-Act was calculated, which represented the relative expression level of the target gene. The 818CK1 and 818CK3 were two wild-type Jinjing 818 control plants; 13M and 20M represented the primary tiller leaf samples of QY2091-13 and QY2091-20 TO plants; 13L and 20L
represented the secondary tiller leaf samples of QY2091-13 and QY2091-20 TO plants used for herbicide resistance testing.
Table 6: Ct values and relative expressionfolds of different genes UBQ5 Mean UBI2 ACt 2-Act Mean HPPD ACt 2-Act Mean 23.27 17.56 -5.88 58.95 20.81 -2.63 6.20 23.55 17.71 -5.73 53.09 21.01 -2.43 5.40 818CK1 23.51 23.44 17.66 -5.78 55.06 55.70 20.98 -2.47 5.52 5.71 23.45 17.88 -5.50 45.20 20.93 -2.44 5.43 23.19 17.94 -5.44 43.41 21.13 -2.24 4.74 818CK3 23.49 23.37 17.72 -5.65 50.26 46.29 21.14 -2.24 4.72 4.96 24.61 19.56 -4.92 30.32 2023. -4.25 19.07 24.27 19.52 -4.96 31.05 20.29 -4.19 18.28 13M 24.56 24.48 19.16 -5.32 39.97 33.78 20.48 -4.00 15.99 17.78 23.98 18.76 -5.20 36.70 19.02 -4.94 30.64 23.89 18.52 -5.43 43.19 19.07 -4.89 29.56 13L 24.00 23.96 18.81 -5.14 35.34 38.41 19.07 -4.88 29.45 29.88 24.34 19.01 -5.40 42.30 19.37 -5.04 32.98 24.41 19.07 -5.34 40.64 1933. -5.09 34.05 20M 24.49 24.41 19.29 -5.13 35.00 39.32 19.26 -5.16 35.65 34.22 24.63 19.46 -5.11 34.52 19.88 -4.69 25.83 24.67 19.38 -5.19 36.48 19.91 -4.66 25.31 20L 24.41 24.57 19.42 -5.15 35.61 35.54 19.86 -4.71 26.16 25.77 The results were shown in Figure 10.The rice UBQ5 was used as an internal reference gene to calculate the relative expression levels of the OsHPPD and UBI2 genes. The results showed that the HPPD expression level of the HPPD doubled strain was significantly higher than that of the wild type, indicating that the fused UBI2 strong promoter did increase the expression level of HPPD, thereby creating a highly-expressing HPPD gene, with the HPPD gene knocked up. The slight decrease in the expression level of UBI2 could be due to the small-scale mutations resulting from the edition of the promoter region, and we had indeed detected base insertions, deletions or small fragment deletions at the UBI2 target site. Compared with the wild type, the expression levels of UBI2 and HPPD significantly tended to be consistent and met the oretical expectations; among them, the HPPD expression level of the 20M sample was about 6 times higher than that of the wild type CK3 group.
The above results proved that, following the effective chromosome fragment doubling program as tested in protoplasts, calli and transformed seedlings with doubling events could be selected by multiple rounds of molecular identification during theAgrobacterium transformation and tissue culturing, and the UBI2 strong promoter in the new HPPD gene fusion generated in the transformed seedlings did increase the expression level of HPPD gene, rendering the plants to get resistance to HPPD inhibitory herbicideBipyrazone, up to 8 times the field dose, and thus a herbicide-resistant rice with knock-up endogenous HPPD gene was created.
Taking this as an example, using the chromosome fragment doubling technical solution of Example 1 and Example 2, a desired promoter could also be introduced into an endogenous gene which gene expression pattern should be changed to create a new gene, and a new variety of plants with desired gene expression pattern could be created through Agrobacterium-mediated transformation.
Example 3: Molecular detection and herbicide resistance test of Ti generation of herbicide-resistant rice strain with knock-up expression of the endogenous HPPD gene caused by chromosome fragment doubling The physical distance between the HPPD gene and the UBI2 gene in the wild-type rice genome was 338 kb, as shown in Scheme 1 in Figure 1.The length of the chromosome was increased by 338 kb after the chromosome fragment between them was doubled by duplication, and a highly-expressing new HPPD gene was generated with a UBI2 promoter at the joint of the duplicated fragment to drive the expression of the HPPD CDS region. In order to determine whether the new gene could be inherited stably and the effect of the doubling chromosome fragment on the genetic stability, molecular detection and herbicide resistance test was conducted for the Ti generation of the HPPD doubled strains.
First of all, it was observed that the doubling event had no significant effect on the fertility of TO generation plants, as all positive TO strains were able to produce normal seeds. Planting test of Ti generation seedlings were further conducted for the QY2091-13 and QY2091-20 strains.
1. Sample preparation:
For QY2091-13, a total of 36 Ti seedlings were planted, among which 27 grew normally and 9 were albino. 32 were selected for DNA extraction and detection, where No.1-24 were normal seedlings, and No.25-32 were albino seedlings.
For QY2091-20, a total of 44 Ti seedlings were planted, among which 33 grew normally and 11 were albino. 40 were selected for DNA extraction and detection, where No.1-32 were normal seedlings, and No.33-40 were albino seedlings.
Albino seedlings were observed in the Ti generation plants. It was speculated that, since HPPD was a key enzyme in the chlorophyll synthesis pathway of plants, and the TO generation plants resulting from the dual-target edition possibly could be chimeras of many genotypes such as doubling, deletion, inversion of chromosome fragments, or small fragment mutation at the edited target site.The albino phenotype could be generated in the plants where the HPPD gene was destroyed, for example, the HPPD CDS region was deleted. Different primer pairs were designed for PCR to determine possible genotypes.

2. PCR molecular identification:
1) Sequences ofdetection primers: sequence 5'-3' Primer 8F: TCTGTGTGAAGATTATTGCCACTAGTTC
Primer 6R: GAGTTCCCCGTGGAGAGGT
Test 141-F: CCCCTTCCCTCTAAAAATCAGAACAG
Primer 4R: GGGATGCCCTCCTTATCTTGGATC
Primer 3F: CCTCCATTACTACTCTCCCCGATTC
Primer 7R: GTGTGGGGGAGTGGATGACAG
pg-Hyg-Rl : TCGTCCATCACAGTTTGCCA
pg-35S-F: TGACGTAAGGGATGACGCAC
2) The binding sites of the above primers were shown in Figure 11. Among them, the Primer 8F + Primer 6R were used to detect the fusion fragment of the UBI2 promoter and the HPPD
CDS after the chromosome fragment doubling, and the length of the product was 630 bp; the Test 141-F + Primer 4R were used to detect chromosome fragment deletion event, and the length of the product was 222bp; and the pg-Hyg-R1+ pg-355-F were used to detect the T-DNA fragment of the editing vector, and the lengthof the product was 660bp.
3) PCR reaction system, reaction procedure and gel electrophoresis detection were performed according to Example 1.
3. Molecular detection results:
The detection results of doubling and deletion events were shown in Table 7.
It could be noted that the chromosome fragment doubling events and deletion events were observed in the Ti generation plants, with different rations among different lines. The doubling events in the QY2091-13 (29/32)were higher than that in the QY2091-20 (21/40), possibly due to the different chimeric ratios in the TO generation plants. The test results indicated that the fusion gene generated by the doubling was heritable.
Table 7: Detection results of doubling and deletion events Doubling + - - - + + + - - - + -----+ + + -Deletion -----+ - - + - - + - - ----- -Doubling - + - - + - + + + - + + + - + + + + + -Deletion - - + + - + - - - + + - + - + - - - - +

Doubling + - + + + + + - + + + + + + + + + + + +
Deletion - + - + + + - + - - + --------+

Doubling - + + + + + + + + + + +
Deletion - - + - - + - - + + - +
The pg-Hyg-R1+ pg-35S-F primers were used to detectthe T -DNA fragmentof the editing vector for the above Ti seedlings. The electrophoresis results of the PCR
products of QY2091-20-17 and QY2091-13-7 were negative for the T-DNA fragment, indicating that it was a homozygous doubling. It could be seen that doubling-homozygous non-transgenic strains could be segregated from the Ti generationof the doubling events.
4. Detection of editing events by sequencing:
The doubling fusion fragments were sequenced for the doubling-homozygous positive Ti generation samples 1, 5, 7, 11, 18 and 19 for QY2091-20 and for the doubling-homozygous positive Ti samples 1, 3, 7, 9, 10 and 12 for QY2091-13.The left target site of the HPPD gene and the right target site of the UBI2 were amplified at the same time for sequencing to detect the editing events at the target sites. Among them, the Primer 3F + Primer 7R were used to detect the editing event of the left HPPD target site, where the wild-type control product was 48 lbp in length; the Primer 8F+Primer 4R were used to detect the editing event of the right UBI2 target site, where the wild-type control product was 329bp in length.
1) Genotype of the doubling events:
The sequencing result of the HPPD doubling in QY2091-13 was shown in SEQ ID
NO: 18, and the sequencing result of the HPPD doubling in QY2091-20 was shown in SEQ
ID NO: 19, see Figure 12. Compared with the predicted linker sequences of the doubling, one T base was inserted at the linker in QY2091-13, 19 bases were deleted from the linker in QY2091-20, and both of the insertion and deletion occurred in the promoter region of UBI2 and had no effect on the coding region of the I-113PD protein. From the detection results on the expression levels of the HPPD gene in Example 2, it can be seen that the expression levels of these new HPPD genes where the UBI2 promoters were fused to the HPPD CDS region was significantly increased.
2) Editing events at the original HPPD and UBI2 target sites on both sides:
There were more types of editing events at the target sites on both sides. In two lines, three editing types occurred in the HPPD promoter region, namely insertion of single base, deletion of

17 bases, and deletion of 16 bases; and two editing types occurred in the UBI2 promoter region, namely insertion of 7 bases and deletion of 3 bases. The Ti plants used for testing and sampling were all green seedlings and grew normally, indicating that small-scale mutations in these promoter regions had no significant effect on gene function, and herbicide-resistant rice varieties could be selected from their offspring.
5. Herbicide resistance test on seedlings of Ti generation:
The herbicide resistance of the Ti generation of the QY2091 HPPD doubled strain was tested at the seedling stage. After the Ti generation seeds were subjected to surface disinfection, they germinated on 1/2 MS medium containing 1.211M Bipyrazone, and cultivated at 28 C, 16 hours light/8 hours dark, in which wild-type Jinjing 818 was used as a control.
The test results of resistance were shown in Figure 13. After 10 days of cultivation in light, the wild-type control rice seedlings showed phenotypes of albinism and were almost all albino, while the lines of the HPPD doubling events QY2091-7, 13, 20, 22 showed phenotype segregation of chlorosis and green seedlings. According to the aforementioned molecular detection results, there was genotype segregation in the Ti generation.Albino seedlings appeared in the absence of herbicide treatment, while green seedlings continued to remain green and grew normally after the addition of 1.2 [iM Bipyrazone. The test results indicated that the high resistance to Bipyrazone of the HPPD gene-doubled lines could be stably inherited to the Ti generation.

Example 4: An editing method for knocking up the expression of the endogenous PPO
gene by inducing chromosome fragment inversion ¨ rice protoplast test The rice PPO1 (also known as PPDX1) gene (as shown in SEQ ID NO: 7, in which 1-1065bp was the promoter, the rest was the coding region) was located on chromosome 1, and the calvin cycle protein CP12 gene (as shown in SEQ ID NO: ID NO: 8, in which 1-2088bp was the promoter, and the rest was the coding region) was located 911kb downstream of the PPO1 gene with opposite directions. According to the rice gene expression profile data provided by the International Rice Genome Sequencing Project (http://rice.plantbiology.msu.edu/index.shtml), the expression intensity of the CP12 gene in rice leaves was 50 times that of the PPO1 gene, and the CP12 gene promoter was a strong promoter highly expressing in leaves.
As shown in Scheme 1 of Figure 4, by simultaneously inducing double-strand breaks between the respective promoters and the CDS region of the two genes and screening, the region between the two breaks could be reversed, with the promoter of PPO1 gene replaced with the promoter of CP12 gene, increasing the expression level of the PPO1 gene and achieving the resistance to PPO inhibitory herbicides, thereby herbicide-resistant lines could be selected. In addition, as shown in Scheme 2 of Figure 4, a new gene of PPO1 driven by the promoter of CP12 gene could also be created by first inversion and then doubling.
1. First, the rice PPO1 and CP12 genomic DNA sequences were input into the CRISPOR
online tool (http://crispor.tefor.net/) to search for available editing target sites. After online scoring, the following target sites were selected between the promoters and the CDS regions of the PPO1 and CP12 genes for testing:
Name of target sgRNA Sequence (5' to 3) OsPPO-guide RNA1 CCATGTCCGTCGCTGACGAG
OsPPO-guide RNA2 CC GC TC GTC AGC GAC GGACA
OsPPO-guide RNA3 GCCATGGCTGGCTGTTGATG
OsPPO-guide RNA4 C GGAT T TC T GC GT GT GATGT
The guide RNA1 and guide RNA2 located between the promoter and the CDS region of the PPO1 gene, close to the PPO1 start codon, and the guide RNA3 and guide RNA4 located between the promoter and the CDS region of the CP12 gene, close to the CP12 start codon.
As described in Example 1, primers were designed for the above target sites to construct dual-target vectors, with pHUE411 as the backbone:
Primer No. DNA sequence (5' to 3') 0 sPP 0 1 -sgRN ATATGGTC TCGGGC GCC ATGTCCGTC GC T GACGAGGTT TTAGAGC
Al -F TAGAAATAGCAAG
0 sPP 0 1 -sgRN ATATGGTC TCGGGC GCC GC TC GTC AGC GAC GGACAGT TTTAGAG

OsPP01-sgRN TATTGGTCTCTAAACCATCAACAGCCAGCCATGGCGCTTCTTGGT

OsPP01-sgRN TATTGGTCTCTAAACACATCACACGCAGAAATCCGGCTTCTTGGT

Specifically, the pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) was used as the template to amplify the sgRNA1+3, sgRNA1+4, sgRNA2+3, sgRNA2+4 dual-target fragments and construct sgRNA expression cassettes, respectively. The pHUE411 vector backbone was digested with BsaI and recovered from gel, and the target fragment was directly used for the ligation reaction after digestion. T4 DNA ligase was used to ligate the vector backbone and the target fragment, the ligation product was transformed into Trans5a competent cells, different monoclones were selected and sequenced. The Sparkjade High Purity Plasmid Mini Extraction Kit was used to extract plasmids with correct sequencing results, thereby obtaining recombinant plasmids, respectively named as pQY002095, pQY002096, pQY002097, pQY002098, as shown below:
pQY002095 pHUE411-PPO-sgRNA1+3 containing OsPPO-guide RNA1, guide RNA3 combination pQY002096 pHUE411-PPO-sgRNA2+3 containing OsPPO-guide RNA2, guide RNA3 combination pQY002097 pHUE411-PPO-sgRNA1+4 containing OsPPO-guide RNA1, guide RNA4 combination pQY002098 pHUE411-PPO-sgRNA2+4 containing OsPPO-guide RNA2, guide RNA4 combination 2. Plasmids of high-purity and high-concentration were prepared for the above-mentioned pQY002095-002098 vectors as described in the step 2 of Example 1.
3. Rice protoplasts were prepared and subjected to PEG-mediated transformation with the above-mentioned vectors as described in step 3 of Example 1.
4. Genomic targeting and detection of new genewith the detection primers shown in the table below for the PCR detection as described in the step 4 of Example 1.
Primer Sequence (5' to 3') 0 sPPOi nversi on-checkF 1 (PPO-F 1) GCTATGCCGTCGCTCTTTCTC
0 sPP Oi nversi on- ch eckF 2 (PPO-F2) CGGACTTATTCCCACCAGAA
0 sPPOinversion-checkR1(PPO-R1) GAGAAGGGGAGCAAGAAGACGT
0 sPP Oinversion-checkR2(PPO-R2) AAGGCTGGAAGCTGTTGGG
0 sCPinversi on-checkF 1(CP-F 1) CATTCCACCAAACTCCCCTCTG
0 sCP inversi on- ch eckF 2(CP -F2 ) AGGTCTCCTTGAGCTTGTCG
0 sCPinversi on-checkR1(CP-R1) GTCATCTGCTCATGTTTTCACGGTC
0 sCPinversi on-che ckR2(CP -R2) C
TGAGGAGGCGATAAGAAACGA
Among them, the combination of PPO-R2 and CP-R2 was used to amplify the CP12 promoter-driven PPO1 CDS new gene fragment that was generated on the right side after chromosome fragment inversion, and the combination of PPO-F2 and CP-F2 was used to amplify the PPO1 promoter-driven CPU CDS new gene fragment that was generated on the left side after inversion. The possible genotypes resulting from the dual-target editing and the binding sites of the molecular detection primers were shown in Figure 14.
5. The PCR and sequencing results showed that the expected new gene in which the CP12 promoter drove the expression of PPO1 was created from the transformation of rice protoplasts.
The editing event where the rice CP12 gene promoter was fused to the PPO1 gene expression region could be detected in the genomic DNA of the transformed rice protoplasts. This indicated that the scheme to form a new PPO gene through chromosome fragment inversion was feasible, and a new PPO gene driven by a strong promoter could be created, which was defined as a PPO1 inversion event. The sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 15; the sequencing results for the chromosome fragment deletion in protoplasts transformed with the pQY002095 vector were shown in SEQ ID NO: 16; and the sequencing results for the chromosome fragment inversion in protoplasts transformed with the pQY002098 vector were shown in SEQ ID NO: 17.
Example 5: Creation of herbicide-resistant rice with knock-up expression of the endogenous PPO gene caused by chromosome fragment inversion through Agrobacterium-mediated transformation 1. Construction of knock-up editing vector: Based on the results of the protoplast testing, the dual-target combination of OsPPO-guide RNAl: 5'CCATGTCCGTCGCTGACGAG3' and OsPPO-guide RNA4: 5'CGGATTTCTGCGT-GTGATGT3' with high editing efficiency was selected to construct the Agrobacterium transformation vector pQY2234. pHUE411 was used as the vector backbone and the rice codon optimization was performed. The vector map was shown in Figure 16.
2. Agrobacterium transformed rice callus and two rounds of molecular identification:
The pQY2234 plasmid was used to transform rice callus according to the method described in step 2 of Example 2. The recipient varieties were Huaidao No.5 and Jinjing 818. In the callus selection stage, two rounds of molecular identification were performed on hygromycin-resistant callus, and the calli positive in inversion event were differentiated. During the molecular detection of callus, the amplification of the CP12 promoter-driven PPO1 CDS
new gene fragment generated on the right side after chromosome fragment inversion by the combination of PPO-R2 and CP-R2 was deemed as the positive standard for the inversion event, while the CP12 new gene generated on the left side after inversion was considered after differentiation and seedling emergence of the callus. A total of 734 calli from Huaidao No.5 were tested, in which 24 calli were positive for the inversion event, and 259 calli from Jinjing 818 were tested, in which 29 calli were positive for the inversion event. Figure 17 showed the PCR detection results of Jinjing 818 calli No.192-259.
3. A total of 53 inversion event-positive calli were subjected to two rounds of molecular identification and then co-differentiated, and 9 doubling event-positive calli were identified, which were subjected to two rounds of molecular identification and then co-differentiated to produce 1,875 TO seedlings, in which 768 strains were from Huaidao No.5 background, and 1107 strains were from Jinjing 818 background. These 1875 seedlings were further subjected to the third round of molecular identification with the PPO-R2 and CP-R2 primer pair, in which 184 lines from Huaidao No.5 background showedinversion-positive bands, 350 strains from Jinjing 818 background showed inversion-positive bands. The positive seedlings were moved to the greenhouse for cultivation.
4. PPO inhibitory herbicide resistance test of PPO1 inversion seedlings (TO
generation):
Transformation seedlings of QY2234 TO generation identified as inversion event-positive were transplanted into large plastic buckets in the greenhouse to grow seeds of Ti generation.
There were a large number of positive seedlings, so some TO seedlings and wild-type control lines with similar growth period and status were selected. When the plant height reached about 20 cm, the herbicide resistance test was directly carried out. The herbicide used was a high-efficiency PPO inhibitory herbicideproduced by the company ("Compound A"). In this experiment, the herbicide was applied at the gradients of three levels, namely 0.18, 0.4, and 0.6 g ai/mu, by a walk-in type spray tower.
The resistance test results were shown in Figure 18. 3-5 days after the application, the wild-type control rice seedlings began to wither from tip of leaf, necrotic spots appeared on the leaves, and the plants gradually withered, while most of the lines of the PPO1 inversion event maintained normal growth, the leaves had no obvious phytotoxicity. In addition, some lines showed phytotoxicity, probably due to the polygenotypic mosaicism of editing events and the low expression level of PPO1 in the TO generation lines. Two weeks after the application, the wild-type rice seedlings died, and most of the inversion event strains continued to remain green and grew normally. The test results showed that the PPO1 inversion lines could significantly improve the tolerance of plants to Compound A.
5. Quantitative detection of relative expression level of PPO1 gene in PPO1 inversion seedlings (TO generation):
It was speculated that the increased resistance of the PPO1 gene inversion lines to Compound A was due to the fusion of the strong CP12 promoter and the CDS of the PPO1 gene which would increase the expression level of PPO1. Therefore, the lines of TO
generation QY2234-252, QY2234-304 and QY2234-329 from Huaidao No.5 background were selected, their primary tillers and secondary tillers were sampled and subjected to the detection of expression levels of PPO1 and CP12 genes.The wild-type Huaidao No.5 was used as the control.
The specific protocols followed step 6 of Example 2, with the rice UBQ5 gene as the internal reference gene. the fluorescence quantitative primers were as follows: 5'-3' RT-0 sPP 01-F GC AGCAGAT GCTC TGTCAATA
RT-OsPP01-R CTGGAGCTCTCCGTCAATTAAG
RT -0 sCP 12-Fl CC GGAC ATC TC GGACAA
RT-OsCP12-R1 CTCAGCTCCTCCACCTC
The UBQ5 was used as an internal reference. ACt was calculated by subtracting the Ct value of UBQ5 from the Ct value of the target gene.Then 2-Act was calculated, which represented the relative expression level of the target gene. The H5CK1 and H5CK2 were two wild-type control plants of Huaidao No.5, the 252M, 304M and 329M represented the primary tiller leaf samples of QY2234-252, QY2234-304 and QY2234-329 TO plants, and the 252L, 304L, and 329L
represented their secondary tiller leaf samples. The results were shown in Table 8 below:
Table 8: Ct values and relative expression folds of different genes UBQ5 Mean PPO1 ACt 2-Act Mean CP12 ACt 2-Act Mean 28.18 25.83 -2.43 5.39 22.28 -3.98 15.77 28.37 25.98 -2.28 4.85 22.06 -4.20 18.44 H5CK1 28.23 28.26 25.93 -2.33 5.03 5.09 22.11 -4.15 17.76 17.32 28.23 25.73 -2.36 5.15 21.63 -6.47 88.58 27.98 26.02 -2.07 4.20 21.53 -6.57 94.87 H5CK2 28.07 28.09 25.92 -2.18 4.52 4.62 21.54 -6.55 93.83 92.43 25.51 25.17 -0.54 1.45 22.26 -3.45 10.95 25.82 25.22 -0.49 1.41 22.36 -3.36 10.23 252M 25.80 25.71 25.22 -0.49 1.41 1.42 22.43 -3.29 9.76 10.31 26.41 23.36 -3.14 8.84 22.30 -4.21 18.49 26.64 23.41 -3.10 8.56 21.95 -4.56 23.55 252L 26.47 26.51 23.46 -3.05 8.28 8.56 21.78 -4.73 26.47 22.84 25.74 24.55 -1.29 2.44 22.51 -3.32 10.02 25.99 24.53 -1.31 2.48 22.45 -3.39 10.47 304M 25.78 25.84 24.48 -1.36 2.57 2.50 22.56 -3.28 9.71 10.07 25.97 23.63 -2.36 5.14 21.60 -4.39 20.97 26.00 23.75 -2.25 4.74 21.43 -4.56 23.55 304L 26.00 25.99 23.56 -2.43 5.39 5.09 22.32 -3.68 12.78 19.10 26.94 23.11 -3.89 14.84 22.23 -4.76 27.16 26.99 23.25 -3.75 13.42 21.85 -5.15 35.39 329M 27.07 27.00 23.22 -3.78 13.71 13.99 21.82 -5.18 36.29 32.95 26.50 23.64 -2.63 6.19 22.00 -4.27 19.30 26.52 23.74 -2.53 5.79 21.97 -4.30 19.71 329L 25.79 26.27 23.77 -2.50 5.65 5.87 22.15 -4.12 17.42 18.81 The relative expression levels of PPO1 and CP12 in different strains were shown in Figure 19. As the results showed, unlike the doubling event in Example 2, the gene expression levels of these inversion event strains were significantly different. The expression levels of CP12 are very different between the two Huaidao No.5 CK groups, possibly because of the different growth rates of the seedlings. Compared with the H5CK2 control group, the expression levels of CP12 in the experimental groups all showed a tendency of decrease, while the expression levels of PPO1 for 252L and 329M increased significantly, and the expression levels of PPO1 for 304L and 329L
modestly increased, and the expression levels of PPO1 for 252M and 304M
decreased. Different from the doubling of chromosome fragments which mainly increased the gene expression level, the inversion of chromosome fragments generated new genes on both sides, so various editing events might occur at the targets on both sides, and the changes in the transcription direction might also affect gene expression level at the same time. That is to say, the TO generation plants were complex chimeras. There might also be significant differences in gene expression levels between primary and secondary tillers of the same plant. It could be seen from the results of quantitative PCR that the PPO1 inversion events showed a higher likelihood of increasing the PPO1 gene expression level, and thus herbicide-resistant strains with high expression level of PPO1 could be selected out by herbicide resistance selection for the inversion events.
The above results proved that,following the scheme of detecting effective chromosome fragment inversion in protoplasts, calli and transformed seedlings with inversion events could be selected through the multiple rounds of molecular identification during theAgrobacterium transformation and tissue culturing, and the CP12 strong promoter fused with the new PPO1 gene generated in the transformant seedlings could indeed increase the expression level of the PPO1 gene, which could confer the plants with resistance to the PPO inhibitory herbicideCompound A, thereby herbicide-resistant rice with knock-up endogenous PPO gene was created. Taking this as an example, the chromosome fragment inversion protocol of Example 4 and Example 5 also applied to other endogenous genes which gene expression pattern needed to be changed by introducing and fusing with a required promoter, thereby a new gene can be created, and new varieties with a desired gene expression pattern could be created through Agrobacterium-mediated transformation in plants.
Example 6: Molecular detection and herbicide resistance test of the Ti generation plants of the herbicide-resistant rice lines with knock-up expression of the endogenous PPO1 gene through chromosome fragment inversion The physical distance between the wild-type rice genome PPO1 gene and CP12 gene was 911 kb. As shown in Figure 14, a highly-expressing PPO1 gene with a CP12 promoter-driven PPO1 CDS region was generated on the right side after the inversion of the chromosome fragment between the two genes. A deletion of chromosome fragment could also occur. In order to test whether the new gene could be inherited stably and the influence of the chromosome fragment inversion on genetic stability, molecular detection and herbicide resistance test was carried out on the Ti generation of the PPO1 inversion strain.
First of all, it was observed that the inversion event had no significant effect on the fertility of the TO generation plants, as all positive TO strains were able to produce seeds normally. The Ti generations of QY2234/H5-851 strains with the Huaidao No.5 background were selected for detection.
1. Sample preparation:
For QY2234/H5-851, a total of 48 Ti seedlings were planted. All the plants grew normally.
2. PCR molecular identification:
1) Detection primer sequence: 5'-3' PPO-R2: AAGGCTGGAAGCTGTTGGG
CP-R2: CTGAGGAGGCGATAAGAAACGA
PPO-F2: CGGACTTATTTCCCACCAGAA
CP-F2: AGGTCTCCTTGAGCTTGTCG
pg-Hyg-R1: TCGTCCATCACAGTTTGCCA
pg-35 S -F : TGACGTAAGGGATGACGCAC
2) The binding sites of the above primers were shown in Figure 14, wherein the PPO-R2 +
CP-R2 was used to detect the fusion fragment of the right CP12 promoter and the PPO1 coding region after the inversion of the chromosome fragment, and the length of the product was 507bp;
the PPO-F2 + CP-F2 was used to detect the fusion fragment of the left PPO1 promoter and the CP12 coding region after the inversion of the chromosome fragment, and the length of the product was 560bp; the PPO-F2 + PPO-R2 was used to detect the left PPO target site before the inversion, and the length of the product in the wild-type control was 586bp;
the CP-F2 + CP-R2 was used to detect the right CP12 target site before the inversion, and the length of the product in the wild-type control was 481bp. The pg-Hyg-R1 + pg-35S-F was used to detect theT-DNA
fragment of the editing vector, and the length of the product was 660bp.
3) PCR reaction system and reaction conditions:
Reaction system (10[tL system):

2*KOD buffer 5pL
2mM dNTPs 2pL
KOD enzyme 0.2pL
Primer F
Primer R 0.2pt Water Sample Reaction conditions:
94 C 2 minutes 98 C 20 seconds 60 C 20 seconds 40 cycles 68 C 20 seconds 68 C 2 minutes 12 C 5 minutes The PCR products were subjected to electrophoresis on a 1% agarose gel with a voltage of 180V for 10 minutes.
3. Molecular detection results:
The detection results were shown in Table 9. A total of 48 plants were detected, of which 12 plants (2/7/11/16/26/36/37/40/41/44/46/47) were homozygous in inversion, 21 plants (1/3/4/5/6/8/9/15/17/20/22/23/24/27/30/31/33/34/39/42/43) were heterozygous in inversion, and 15 plants (10/12/13/14/18/19/21/25/28/29/32/35/38/45/48) were homozygous in non-inversion.
The ratio of homozygous inversion: heterozygous inversion: homozygous non-inversion was 1:1.75:1.25, approximately 1:2:1. So the detection results met the Mendel's law of inheritance, indicating that the new PPO1 gene generated by inversion was heritable.
Table 9: Results of molecular detection Right side of + + + + + + + + + - + - - - + + + - - +
inversion Left side of + + + + + + + + + - + - - - + + + - - +
inversion PPO WT + - + + + + - + + + - + + + + - + + + +
CP12 WT + - + + + + - + + + - + + + + - + + + +

Right side of - + + + - + + - - + + - + + - + + - + +
inversion Left side of - + + + - + + - - + + - + + - + + - + +
inversion PPO WT + + + + + - + + + + + + + + + - - + + -CP12 WT + + + + + - + + + + + + + + + - - + + -Right side of + + + + - + + -inversion Left side of + + + + - + + -inversion PPO WT - + + - + - - +
CP12 WT - + + - + - - +
For the above Ti seedlings, the Pg-Hyg-R1 + pg-35S-F primers were used to detect the T-DNA fragmentof the editing vector.The electrophoresis results of 16 and 41 were negative for T-DNA fragment, indicating homozygous inversionit could be seen that non-transgenic strains of homozygous inversion could be segregated from the Ti generationof the inversion event.
4. Sequencing detection of the editing events:
The genotype detection of the inversion events focused on the editing events of the new PPO
gene on the right side. The mutation events with the complete protein coding frame of the PPO1 gene were retained.The CP12 site editing events on the left side that did not affect the normal growth of plants through the phenotype observation in the greenhouse and field were retained.
The genotypes of the editing events detected in the inversion event-positive lines were listed below, in which seamless indicated identical to the predicted fusion fragment sequence after inversion. The genotypes of the successful QY2234 inversion events in Huaidao No.5 background were as follows:
No. Genotype No. Genotype Right side -lbp; left side Right side seamless; left side +lbp -32bp (G) Right side seamless; left side 2234/H5-381 Right side +18bp 2234/H5-263 seamless Right side -lbp; left side 2234/H5-410 2234/H5-555 Right side -23bp +1bp 2234/H5-159 Right side -16bp 2234/H5-645 Right side -5bp, +20bp, 2234/H5-232 Right side -4bp Some of the sequencing peak maps and sequence comparison results were shown in Figure 20.
The genotypes of the successful QY2234 inversion in the Jinjing818 background were as follows:
No. Right side PPO genotype No. Right side PPO genotype 2234/818-5 Right side seamless 2234/818-144 Right side +lbp Sight side +2bp, -26bp, pure 2234/818-42 Right side -16bp 2234/818-151 peak 2234/818-108 Right side -15bp 2234/818-257 Sight side +lbp 2234/818-134 Right side +5bp, -15bp Some of the sequencing peak maps and sequence comparison results were shown in Figure 21.
The sequencing results of the above different new PPO1 geneswith the CP12 promoter fused to the PPO1 coding regionwere shown in SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO : 25, and SEQ ID NO: 26.

5. Herbicide resistance test of Ti generation seedlings:
The herbicide resistance test was performed on the Ti generation of the PPO1 inversion lines at seedling stage.The wild-type Huaidao No.5 was used as a control, and planted simultaneously with the Ti generation seeds of the inversion lines.
When the seedlings reached a plant height of 15 cm, Compound A was applied by spraying at four levels of 0.3, 0.6, 0.9 and 1.2 g a.i./mu. The culture conditions were 28 C, with 16 hours of light and 8 hours of darkness.
The resistance test results were shown in Figure 22. After 5 days of the application, the wild-type control rice seedlings showed obvious phytotoxicity at a dose of 0.3 g a.i./mu.They began to wither from the tip of leaf, and necrotic spots appeared on the leaves; at a dose of 0.6 g a.i./mu, the plants died quickly. However, QY2234/H5-851 Ti seedlings could maintain normal growth at a dose of 0.3 g a.i./mu, and no obvious phytotoxicity could be observed on the leaves;
at doses of 0.6 and 0.9 g ai/mu, some Ti seedlings showed dry leaf tips, but most Ti seedlings could keep green and continue to grow, while the control substantially died off. At a dose of 1.2 g a.i./mu, the control plants were all dead, while some of the Ti seedlings could keep green and continue to grow. The test results indicated that the resistance of the PPO1 gene inversionlines to Compound A could be stably inherited to their Ti generation.
Example 7: An editing method for knocking up the expression of theendogenous EPSPS gene in plant EPSPS was a key enzyme in the pathway of aromatic amino acid synthesis in plants and the target site of the biocidal herbicide glyphosate. The high expression level of EPSPS gene could endow plants with resistance to glyphosate. The EPSPS gene (as shown in SEQ ID
NO: 4, in which 1-1897bp was the promoter, and the rest was the expression region) was located on chromosome 6 in rice. The gene upstream was transketolase (TKT, as shown in SEQ ID NO: 3, in which 1-2091bp was the promoter, and the rest was the expression region) with an opposite direction. The expression intensity of TKT gene in leaves was 20-50 times that of the EPSPS
gene. As shown in Figure 2, by simultaneously inducing double-strand breaks between the promoter and the CDS region of the two genes respectively, the inversion (Scheme 1) or inversion doubling (Scheme 2) of the region between the two breaks could be obtained after screening. In both cases, the promoter of the EPSPS gene would be replaced with the promoter of the TKT gene, thereby increasing the expression level of the EPSPS gene and obtaining the resistance to glyphosate. In addition, the Schemes 3, 4 and 5 as shown in Figure 2 could also create new EPSPS genes driven by the TKT gene promoter. The gene structure of EPSPS
adjacent to and opposite in direction relative to TKTwas conserved in monocotyledonous plants (Table 10). While in dicotyledonous plants,both genes were also adjacent yet in the same direction; therefore, this method was universal in plants.
Table 10: Distance between the EPSPS gene and the adjacent TKT gene in different plants Location Distance from CDS
Species Direction (chromosome) region start site (kb) Rice 6 4 Reverse <TKT-EPSPS>
7A 35 Reverse <TKT-EPSPS>
Wheat 7D 15 Reverse <TKT-EPSPS>

4A? 50 Reverse <TKT-EPSPS>
Maize 9 22 Reverse <TKT-EPSPS>
Brachypodium 1 5 Reverse <TKT-EPSPS>
distachyon Sorghum 10 15 Reverse <TKT-EPSPS>
Millet 4 5 Reverse <TKT-EPSPS>
Soybean 3 6 Forward TKT>EPSPS>
Tomato 5 6 Forward TKT>EPSPS>
2 6 Forward TKT>EPSPS>
Peanut 12 5 Forward TKT>EPSPS>
Cotton 9 22 Forward TKT>EPSPS>
Alfalfa 4 8 Forward TKT>EPSPS>
Arabidopsis 2 5 Forward TKT>EPSPS>
Grape 15 17 Forward TKT>EPSPS>
To this end, pHUE411 was used as the backbone, and the following as targets:
Name of target sgRNA Sequence (5' to 3) OsEPSPS-guide RNA1 CCACACCACTCCTCTCGCCA
OsEPSPS-guide RNA2 CCATGGCGAGAGGAGTGGTG
OsEPSPS-guide RNA3 ATGGTCGCCGCCATTGCCGG
OsEPSPS-guide RNA4 GACCTCCACGCCGCCGGCAA
OsEPSPS-guide RNA5 TAGTCATGTGACCATCCCTG
OsEPSPS-guide RNA6 TTGACTCTTTGGTTCATGCT
Several different dual-target vectors had been constructed:
pQY002061 pHUE411-EPSPS-sgRNA1+3 pQY002062 pHUE411-EPSPS-sgRNA2+3 pQY002063 pHUE411-EPSPS-sgRNA1+4 pQY002064 pHUE411-EPSPS-sgRNA2+4 pQY002093 pHUE411-EPSPS-sgRNA2+5 pQY002094 pHUE411-EPSPS-sgRNA2+6 (2) With the relevant detection primers shown in the following table, the fragments containing the target sites on both sides or the predicated fragments generated by the fusion of the TKT promoter and the EPSPS coding region were amplified, and the length of the productsis between 300-1000 bp.
Primer Sequence (5' to 3') EPSPSinversion checkFl ATCCAAGTTACCCCCTCTGC
EPSPSinversion checkR1 CACAAACACAGCCACCTCAC
EPSPSinversion check-nestF2 ATGTCCACGTCCACACCATA
EPSPSinversion check-nestR2 AATGGAATTCACGCAAGAGG
EPSPSinversion checkF3 GTAGGGGTTCTTGGGGTTGT
EPSPSinversion checkR3 CGCATGCTAACTTGAGACGA
EPSPSinversion check-nestF4 GGATCGTGTTCACCGACTTC

EPSP Sinversion check-nestR4 C C GGTAC AAC GC ACGAGTAT
EP SP Sinversion checkF5 GGCGTCATTCCATGGTTGATTGT
EP SP Sinversion checknestF6 GATAGACCCAGATGGGCATAGAATC
EP SP Sinversion checkR5 TGCATGCATTGATGGTTGGTGC
EP SP Sinversion checknestR6 CC GGCCC TTAGAATAAAGGTAGTAG
After protoplast transformation, the detection results showed that the expected inversion events were obtained. As shown in Figure 15, the sequencing result of the inversion detection of pQY002062 vector transformed protoplast was shown in SEQ ID NO: 11; the sequencing result of the deletion detection of pQY002062 vector transformed protoplast was shown in SEQ ID No:
12; the sequencing result of the inversion detection of the pQY002093 vector transformed protoplast was shown in SEQ ID NO: 13; and the sequencing result of the deletion detection of pQY002093 vector transformed protoplast was shown in SEQ ID NO: 14.
These vectors were transferred into Agrobacterium for transforming calli of rice. Plants containing the new EPSPS gene were obtained.The herbicide bioassay results showed that the plants had obvious resistance to glyphosate herbicide.
Example 8: An editing method for knocking up the expression of the endogenous PPO
gene in Arabidopsis Protoporphyrinogen oxidase (PPO) was one of the main targets of herbicides. By highly expressing plant endogenous PPO, the resistance to PPO inhibitory herbicides could be significantly increased. The Arabidopsis PPO gene (as shown in SEQ ID NO: 1, in which 1-2058bp was the promoter, and the rest was the expression region) located on chromosome 4, and the ubiquitin10 gene (as shown in SEQ ID NO: 2, in which 1-2078bp was the promoter, and the rest was the expression region) located 1.9M downstream with the same direction as the PPO
gene.
As shown in the Scheme as shown in Figure 3, simultaneously generating double-strand breaks at the sites between the promoter and the CDS region of the PPO and the ubiquitin10 genes respectively. Doubling events of the region between the two breaks could be obtained by screening, namely a new gene generated by fusing the ubiquitin10 promoter and the PPO coding region. In addition, following Scheme 2 as shown in Figure 1, a new gene in which the ubiquitin10 promoter and the PPO coding region were fused together could also be created.
To this end, pHEE401E was used as the backbone (https://www.addgene.org/71287/), and the following locations were used as target sites:
Name of target sgRNA Sequence (5' to 3) AtPPO-guide RNA1 CAAACCAAAGAAAAAGTATA
AtPPO-guide RNA2 GGTAATCTTCTTCAGAAGAA
AtPPO-guide RNA3 ATCATCTTAATTCTCGATTA
AtPPO-guide RNA4 TTGTGATTTCTATCTAGATC
The dual-target vectors were constructed following the method described by "Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC, Chen QJ. Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol . 2015 Jul 21;16:144.":
pQY002076 pHEE401E-AtPPO-sgRNA1+3 pQY002077 pHEE401E-AtPPO- sgRNA1+4 pQY002078 pHEE401E-AtPPO- sgRNA2+3 pQY002079 pHEE401E-AtPPO- sgRNA2+4 Arabidopsis was transformed according to the method as follows:
(1) Agrobacterium transformation Agrobacterium GV3101 competent cells were transformed with the recombinant plasmidsto obtain recombinant Agrobacterium.
(2) Preparation of Agrobacterium infection solution 1) Activated Agrobacterium was inoculated in 30m1 of YEP liquid medium (containing 25mg/L Rif and 50mg/L Kan), cultured at 28 C under shaking at 200 rpm overnight until the 0D600 value was about 1.0-1.5.
2) The bacteria were collected by centrifugation at 6000 rpm for 10 minutes, and the supernatant was discarded.
3) The bacteria were resuspended in the infection solution (no need to adjust the pH) to reach 0D600=0.8 for later use.
(3) Transformation of Arabidopsis 1) Before the plant transformation, the plants shouldgrow well with luxuriant inflorescence and no stress response. The first transformation could be carried out as long as the plant height reached 20cm. When the soil was dry, watering was carried out as appropriate.
On the day before the transformation, the grown siliques were cut with scissors.
2) The inflorescence of the plant to be transformed was immersed in the above solution for 30 seconds to 1 minute with gentle stirring.The infiltrated plant should have a layer of liquid film thereon.
3) After transformation, the plant was cultured in the dark for 24 hours, and then removed to a normal light environment for growth.
4) After one week, the second transformation was carried out in the same way.
(4) Seed harvest Seeds were harvested when they were mature. The harvested seeds were dried in an oven at 37 C for about one week.
(5) Selection of transgenic plants The seeds were treated with disinfectant for 5 minutes, washed with ddH20 for 5 times, and then evenly spread on MS selection medium (containing 30pg/m1 Hyg, 100 g/m1 Cef). Then the medium was placed in a light incubator (at a temperature of 22 C, 16 hours of light and 8 hours of darkness, light intensity 100-150 umol/m2/s, and a humidity of 75%) for cultivation. The positive seedlings were selected and transplanted to the soil after one week.
(6) Detection of Ti mutant plants (6.1) Genomic DNA extraction 1) About 200 mg of Arabidopsis leaves was cut and placed into a 2 ml centrifuge tube.
Steel balls were added, and the leaves were ground with a high-throughput tissue disruptor.
2) After thorough grinding, 400pL of SDS extraction buffer was addedand mixed upside down. The mixture was incubated in 65 C water bath for 15 minutes, and mixed upside down every 5 minutes during the period.

3) The mixture was centrifuged at 13000rpm for 5 minutes.
4) 3004, of supernatant was removed and transferred to a new 1.5m1 centrifuge tube, an equal volume of isopropanol pre-cooled at -20 C was added into the centrifuge tube, and then the centrifuge tube was kept at -20 C for 1 hour or overnight.
5) The mixture was centrifuged at 13000rpm for 10 minutes, and the supernatant was discarded.
6) 500[EL of 70% ethanol was added to the centrifuge tube to wash the precipitate, the washing solution was discarded after centrifugation (carefully not discarding the precipitate).
After the precipitate was dried at room temperature, 300_, of ddH20 was added to dissolve the DNA, and then stored at -20 C.
(6.2) PCR amplification With the extracted genome of the Ti plant as template, the target fragment was amplified with the detection primers. 5 pL of the amplification product was taken and detected by 1%
agarose gel electrophoresis, and then imaged by a gel imager. The remaining product was directly sequenced by a sequencing company.
The sequencing results showed that the AtPPO1 gene doubling was successfully achieved in Arabidopsis, and the herbicide resistance test showed that the doubling plant had resistance to PPO herbicides.
Example 9: Creation of GH1 gene with new expression characteristics in zebrafish The growth hormone (GH) genes in fishes controlled their growth and development speed.
At present, highly expressingthe GH gene in Atlantic salmons through the transgenic technology could significantly increase their growth rates. The technique was of great economical value, but only approved for marketing after decades. The GH1 gene was the growth hormone gene in zebrafish. In the present invention, suitable promoters in zebrafish (suitable in terms of continuous expression, strength, and tissue specificity) were fused together with the CDS region of GH1 gene in vivo through deletion, inversion, doubling, inversion doubling, chromosome transfer, etc. ,to create a fast-growing fish variety.
The experiment procedure was as follows:
1. Breeding of Zebra fish:
1) Preparation of paramecia: The mother liquor of paramecia was purchased online (http s: //item .taob ao. com/item .htm? spm=a23 Or. 1 .14 .49. 79f774c6C6 elpL8thd=573612042855 &ns=18zabbucket=18#detail). A 2L beaker was washed, sterilized and filled with 200 mL of paramecia mother liquor; two yeast pieces and two sterilized grains of wheat were added thereto; sterile water was added until the volume reaches 2L; then the opening was covered and sealed with sterilized kraft paper; stationary culture was performed at 25-28 C for 3-5 d;
the mixture was used to feed the juvenile zebra fish when the usable concentration was reached. Each time the paramecia solution was taken, a dense filter screen was used to remove impurities.
2) Incubation of brine shrimp: Brine shrimp, also known as fairy shrimp and artemia, was a marine plankton. Brine shrimp eggs were purchased and stored at 4 C. For the incubation, the mixture was prepared at a ratio of 1L deionized water: 32 g NaC1:3.5 g brine shrimp eggs; oxygenation was performed at 28.5 C for 25-30h; the incubated brine shrimps were collected. The incubated brine shrimps were kept in a small amount of 3.2% NaCl solution, where they could be kept for 2-3 d at 4 C.
3) The standardized large-scale breeding of zebra fish was realized with anindependent zebrafish farming system manufactured by Shanghai Haisheng. The tap water treated with a water purifier was kept in a dosing barrel, where an appropriate amount of NaCl and NaHCO3 was added to maintain a specific conductivity of 500 us/cm and a pH of 7Ø The water circulation system ensured all breeding tanks maintain a constant water level and flow state. A waste treatment system automatically filters the fish feces and remaining fish food;
the fish culture water was reused after being sterilized by UV exposure and heated (28.5 C);
the fresh water was automatically replenished after the wastewater was discharged. The lighting was controlled with an automatic timer in fish house to maintain the "14h-light +
10h-dark cycles"; an air conditioning system kept the indoor temperature at 28 C; an exhaust fan removed indoor moisture at regular intervals to avoid excessively high humidity.
Zebra fish embryos were subjected to stationary culture in a biochemical incubator at 28.5 C, and could be fed with paramecia 5 days after fertilization. Feeding was performed 3-4 times a day. Fresh brine shrimp started to be supplemented gradually after about 13 days.
When the bodies of all juveniles became red, it means the zebra fish can completely eat brine shrimp. The juvenile zebra fish was then transferred to the breeding tank. A moderate amount of fresh brine shrimp was fed 3 times a day.
AB varieties of zebra fish were transferred into an incubation box on a 2-female :
2-male basis on the afternoon of the day before reproduction of zebra fish;
they were separated by a baffle. The baffle was removed the next morning; the zebra fish generally began to lay eggs in about 10 minutes; embryos were collected within 30 minutes after egg laying and rinsed with E3 culture medium (mass ratio29.3 % NaCl, 3.7 % CaCl2, 4% MgSO4, 1.3% KCl, pH7.2) to remove dead eggs.
4) Preparation of injection dish: 1.5% agarose was prepared; 30-40 ml of agarose melt was poured into each plastic culture dish. The surface of agarose was gently covered with the mold to avoid bubbles. The mold was removed after the gel got completely solidified to attain a "V-shaped" groove; a small amount of E3 culture medium was added into the prepared culture dish; it was sealed and kept at 4 C.
2. Preparation of RNP sample:
For zebrafish GH1 gene initiation codon upstream 100bp DNA sequence designed sgRNA-GH1 target: 5'aagaacgagtttgtctatct3', for zebrafish collala gene termination codon designed sgRNA-collala target: 5'atgtagactctttgaggcga3', and for zebrafish ddx5 gene initiation codon upstream designed sgRNA-ddx5 target:
5'gcaccatcactgcgcgtaca3'.
Genscript was entrusted to synthesize the EasyEdit sgRNA. The synthetic sgRNA
and the purified Cas9 were mixed at a ratio of 1:3; 10xCas9 buffer solution (200 mM
HEPES, 100 mM MgCl2, 5 mM DTT, 1.5 M KC1) was added and RNase-free ultra-pure water was used to dilute it to 1X so that the Cas9 protein concentration was 600 ng/uL, and the sgRNA
concentration was 200 ng/uL; after 10 minutes of incubation at 25 C, a small amount of phenol red was added to dye the injection sample for convenient observation during injection; the volume of phenol red was normally less than 10% of the total volume. In the experiment, sgRNA-GH1 combined with sgRNA-collala and sgRNA-ddx5, respectively and the RNP complex was prepared at equal ratio, and the mixture was injected into fish eggs.
3. Microinjection:
Under a stereomicroscope, the tip of injection needle was fractured slightly in a beveled manner using medical pointed toothless forceps for convenient injection. 4 pL of sample containing phenol red was taken by a micro loading tip; the pipette tip inserts into the needle from the end of needle to the tip reaching the point of injection needle; the tip was gently pushed to inject the sample into the needle while the tip was gently pulled out so that the front end of injection needle was filled with the red RNP sample; the injection needle with sample was then inserted into the holder for fixation. The quantitative capillary was 33 mm in length and 1 pL in total volume. The injection pressure was adjusted to increase the length of the liquid column in the capillary by 1 mm after 15 injections; then, each sample injection volume was 1 nL. The injection dish was taken out of the refrigerator in advance, and set aside until the room temperature was reached. The collected one-cell stage fertilized eggs were arranged in the groove of dish; a small amount of E3 culture medium was added so that the liquid level was just over the fertilized eggs.
Under a stereomicroscope, the tip of the injection needle was gently penetrated into the membrane of the fertilized egg and reaches the yolk close to the animal pole; RNP sample was injected by stepping on the pedal. Due to the small amount of phenol red in the RNP
sample, the light red sample liquid can be clearly observed during the injection. The injected embryos were placed in a disposable plate containing E3 culture medium and cultured in a constant temperature incubator at 28.5 C. The culture medium needs to be replaced every 24 hours to ensure the ion concentration and oxygen content.
4. DNA extraction:
After each set of injections, the tail fin of survived zebrafish at about 2-3 months old were treated with cell lysate buffer(10 mmol/L Tris, 10 mmol/L EDTA, 200 mmol/L NaCl, 0.5% SDS, 200 pgimL Proteinase K, pH 8.2). Each tube was filled with 200 pL of lysate and held overnight at 50 C; they were violently shaken 2-3 times during this period. The tube was centrifuged at 1200 r/min for 5 min at room temperature, and then 200 pL of supernatant was taken. Equal volume of phenol: chloroform: isoamyl alcohol (25:24:1) was added and violently shaken. The tube was centrifuged at 12000 r/min at room temperature for 10 min; the supernatant taken was mixed with equal volume of chloroform, and then the tube was violently shaken. The tube was centrifuged at 12000 r/min at room temperature for min; the supernatant was mixed with 1/20-volume 3 mol/L NaCl and 2.5-time volume pre-cooled anhydrous ethanol; the mixture was blended well and should not be made upside down; it's kept on ice for 30 min. The tube was centrifuged at 12000 r/min at 4 C for 10 min, and the supernatant was abandoned swiftly. 1 mL 70% alcohol was added for rinsing. The tube was centrifuged at 12000 r/min at 4 C for 10 min. The supernatant was abandoned swiftly, and vacuum drying was performed. Finally, 30 pL of deionized water was added in the end to dissolve the DNA. The solution was kept at -20 C for future use.
After the 0.8%
agarose electrophoresis detection, the PCR test was performed with the corresponding primer, and the positive strip was subjected to sequencing verification.
Wherein, ghl-R:
tgctacaaataaagtgcactacaca and collala-F:gggtctggattggagtcaca were double treated between the amplified col lal a gene and ghl; ghl-R:tgctacaaataaagtgcactacaca and ddx5-F:acgcgttacgtacgtcagaa, as well as GH1-F:aaatgaccggaatcacaaca and ddx5-R:acgaccatccttaccctctg were inversely treated between the amplified ddx5 gene and ghl.
The experimental results were shown as follows:as shown in Figure 23, the characteristic fragments of chromosome duplication were detected in the zebrafish embryo samples of the RNP injection group; as shown in Figure 51, sequencing results showed that the expected duplication event occurred in the chromosome fragments between GH1 and COL1A1 A gene targets in zebrafish embryos; as shown in Figure 52, sequencing results showed that the coding area & promotor of ddx5 gene and the coding area & the promotor of ghl gene were exchanged due to the inversion of chromosome fragments; as shown in Figure 53, the growth of zebrafish with upregulated expression was obviously accelerated.
Example 10: Field herbicide resistance test on Ti generation of herbicide-resistant rice 1inesQY2234 Ti generation of inversion lines QY2234/818-5 and QY2234/818-42 PPO1 were subjected to field herbicide resistance test with the wild-type Jinjing 818 rice variety as an herbicide-susceptible control. They were planted in sync with the inversion line Ti generation seeds in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan Province;
the test was performed between November 30, 2020 and April 15, 2021. Seedlings were cultivated after 2 days of soaking rice seeds, and transplantation was performed after 3 weeks of seedling; 3 sets of replications were arranged; an herbicide called as compound A
was applied in 3 weeks after transplantation, and the concentration was set to 0.3, 0.6 and 0.9 ga.i./mu (1 mu = 1/15 ha); the status of rice seedlings was investigated 10 days post application (DPA).

The result of the field herbicide resistance test was shown in Figure 24. In 10 DPA at a dose of 0.3 ga.i./mu, all wild-type Jinjing 818 rice plants died; QY2234/818-5 and QY2234/818-42 were growing normally; at the dose of 0.6 ga.i./mu,QY2234/818-42 was growing normally, while most individual plants of QY2234/818-5 died, but there were resistant individual plants of QY2234/818-5; at the dose of 0.9 ga.i./mu, most individual plants of QY2234/818-42 and QY2234/818-5 died, but a few resistant plants were green and continued to grow. The test result indicated that the PPO1 gene inverted line exhibited herbicide resistance under field conditions under high light intensity in Hainan; stable resistant lines can be selected from the populations, whichprovides basic materials for herbicide-resistant rice breeding.
Example 11: Western Blot test on Ti-generation PPO1 protein expression level of the QY2234 line rice The Ti-generation seedling leaves of the four PPO1 inversion rice lines, i.e., QY2234/818-5, QY2234/818-42, QY2234/818-144 and QY2234/818-257, were selected to determine the PPO1 protein expression level. With the wild-type Jinjing 818 rice variety as a control, they were planted in the greenhouse in sync with the inversion line Ti generation seeds; when the seedlings grew to a height of 15 cm, leaf samples were taken with reference to Example 6 for molecular identification; the inversion-positive seedlings were selected for the Western Blot Test on protein expression.
A Western Blot test was performed as per the Molecular Cloning: A Laboratory Manual (Sambrook, J., Fritsch, E.F. and Maniatis, T, Molecular Cloning: A
Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989). The protein antibody was rice PPO1 polyclonal antibody prepared by Qingdao Jinmotang Biotechnology Co., Ltd. (Qingdao, China); a plant endogenous reference Actin protein antibody was purchased from Sangon Biotech (Shanghai, China) Co., Ltd. (Art.
No.
D195301); the secondary antibody was HRP-labeled goat anti-rabbit IgG (Sangon, Art. No.
D110058); the test was performed according to the operating instructions using the Western Blot Kit (Boster, Art. No. AR0040).
To be more specific, 2 g of single-plant rice sample was taken and ground with liquid nitrogen into powder; an appropriate amount of protein extraction buffer (material: Protein extraction buffer = 1:1.5); incubated on ice for 30 min; centrifuged at 4 C
with 27100 g for 15 min; the supernatant was mixed with 5Xloading buffer (delivered with the kits); the mixture was boiled for 15 min and subjected to electrophoresis at 110 V for 30 min.
The protein extraction buffer was formulated as follows:
component concentration Tris-HCI (PH8.0) 100mM
glycerin 10%
EDTA 1mM

AsA (ascorbic acid) 2mM
PVPP 0.5%
PVP-40 0.5%
DTT (Add at operation time) 20mM
PMSF (Add at operation time) 1mM
After the electrophoresis was finished, the gel was removed, and the gel block in an appropriate size was taken depending on the size of target protein, and then the filter paper and PVDF film of approximately the same volume was taken; the gel block was cleaned with clear water and then soaked with transfer solution; the filter paper and PVDF film were also soaked and wetted with the transfer solution; the wet filter paper, PVDF
film, SDS-PAGE gel block and filter paper were stacked from bottom to top to expel as many bubbles as possible; they could be flattened with a test tube, while the displacement between layers should be prevented during the flattening; the film was transferred under at 25 V and 1.3A for 10-30 min; after the transfer, the PVDF film was cleaned with PBST
buffer. Upon completion of the cleaning, they were transferred to the blocking buffer solution and blocked at room temperature for lh. After the confining, the PVDF film was cleaned with PBST buffer solution for 3 times to remove the blocking liquid, then the primary antibody was incubated at a dilution ratio of approx. 1:1000 - 1:3000; the incubation time of the primary antibody was 2h at room temperature, or 12h at 4 C. Upon completion of the primary antibody incubation, the PVDF film was cleaned with the PBST buffer solution for 3 times with each cycle lasting for 10 min. The secondary antibody was incubated at a dilution ratio of approx. 1:10000 - 1:20000 for lh at room temperature. Upon completion of the secondary antibody incubation, the PVDF film was cleaned with the PBST
buffer solution for 3 times with each cycle lasting for 10 min. ECL luminescence: ECL
solutions A
and B were mixed well in equal volume (prepared when needed), and the liquid mixture was dropped onto the PVDF film evenly; the film was placed in the fluorescence imager for imaging.
The Western Blot test result was shown in Figure 25. According to the result, the internal-control Actin protein expression levels of the PPO1 inversion-positive lines werethe same as the wild-type Jinjing 818, while the expression levels of PPO1 protein weresignificantly up-regulated. The 4 selected QY2234 lines had different genotypes at the inverted junction region between the CP12 promoter and the PPO1 protein coding region;
QY2234/818-5 was identical to the predicted post-inverted fusion fragment sequence;
compared with the predicted sequence, QY2234/818-42 lacks 16 bases in the CP12 promoter region; 1 base was inserted in the CP12 promoter region of QY2234/818-144 and QY2234/818-257. The test result showed that all the new genotypes could express PPO1 protein at high levels, and manifested that the method for creating new genes provided by the present invention could produce a variety of functional genotypes in the genome to enrich the gene pool.
Example 12: Field herbicide resistance test on Ti generation of HPPD-duplicated rice lines QY2091 Through germination test, the Ti-generation of HPPD-gene duplicated lines QY2091-12 and QY2091-21 without albino seedling separation were selected for the field herbicide resistance test with the wild-type Jinjing 818 rice variety as a control. They were planted in sync with the Ti generation seeds of QY2091 lines in a paddy field of Red Flag Team, Nanbin Farm, Sanya, Hainan Province; the test was performed between November 1, 2020 and April 10, 2021. Seedlings were cultivated after 2 days of soaking rice seeds, and QY2091 seeds were soaked with 1/30000 herbicide compound Bipyrazone aqueous solution;
albino seedlings were removed after emergence; transplantation was performed after 3 weeks of seedling, and 3 sets of repetitions were arranged; herbicide compound Bipyrazone was applied in 3 weeks after the transplantation at a concentration of 4, 8, 16, and 32 ga.i./mu; the seedling status was investigated 21 days after application.
The result of field herbicide resistance test was shown in Figure 26. In 21 days after application, all wild-type Jinjing 818 rice plants died of albinism at 4 ga.i./mu and 8 ga.i./mu ofherbicide compound Bipyrazone, while the QY2091-12 and QY2091-21 were normally growing; at 16 g a.i./mu, the QY2091-12 line was growing normally, while the QY2091-21 line began to exhibit resistance separation: Most individual plants showed resistance, and a few individual plants developed yellowing of new leaves; at 32 g a.i./mu, QY2091-12 and QY2091-21 began to exhibit resistance separation, and a few individual plants died of albinism, while significant yellowing of new leaves was observed in some individual plants; approx. 1/2 of the individual plants were growing normally and exhibit extremely high resistance. The recommended dosage for field application of herbicide compound Bipyrazone was 4 g a.i./mu. The test result indicated that the edited lines with highly expressive HPPD new genes created through chromosome segment duplication exhibited herbicide resistance under field conditions under high light intensity in Hainan, and could withstand an herbicide dose that was 8 times the recommended field dose. The screening of stable resistant lines will provide basic materials for herbicide-resistant rice breeding.
Example 13: New gene creation activity of NLS-free Cas9 and separately expressed crRNA and tracrRNA in rice protoplast Targets were chosen from upstream and downstream of the PPO 1 gene to test whether chromosome fragment duplication events could be produced; furthermore, tests were performed on whether the nuclear localization signal with Cas9 removed could produce duplication event, and on whether replacing sgRNA (single guide RNA) with separated expression of crRNA and tracrRNA could induce cell targeted site editing to produce chromosome fragment duplication events.
Dual-target editing vector pQY2648 was constructed by the method described in Example 1 for the selected target sequence design primers, i.e., OsPP01-esgRNA3:5' taggtctccaaacATG GCGTTTTCTGTCCGCGTgcttcttggtgccgcg3' and OsPP01-esgRNA2:5' TaggtctccggcgCAGTT
GGATTAGGGAATATGGTTTAAGAGCTATGCTGGAAACAGC3'. The NLS signal peptides at both ends of SpCas9 wereremoved on the basis of pQY2648 to construct the NLS-free rice PPO1 dual-target editing vector pQY2650; the sgRNA expression cassette was modified based on pQY2650 and pQY2648; the fused Scaffold sequence was removed, and the crRNA and tracrRNA sequences were separately expressed. To be more specific, the OsU3 promoter drove the expression of OsPP01-sgRNA2:5'CAGTTGGATTAGGGAATATGGTTTAAGGCTATGCT3' crRNA
sequence; the TaU3 promoter drove the expression of the OsPP01-sgRNA3:5' ACGCGGACAGAAAACGCCATGTTTAAGGCTATGC3' sequence; the OsU3 promoter drove the expression of the expression cassette of tracrRNA sequence 5'AGCATAGCAAGTTTAAATAAGGCTAGTC
CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT3'; the NLS-free crRNA
rice PPO1 dual-target editing vector pQY2651 and the crRNA rice PPO1 dual-target editing vector pQY2653 containing NLS were constructed; the primers used during the process were as follows:
2650E-BstBI: 5'gtacaaaaaagcaggcttcgaaATGgacaagaagtactcgatcggc3' 2650R-SacI: 5'tgaacgatcggggaaattcgagctcCTAgtcgcccccgagctgag3' OsU3-HindIII-For2651F: 5'GCAGGTCTCaagcttaaggaatctttaaacatacgaacag3' CrRNAl-B sal-RI:
5'GCAGGTCTCCAGGTAAAAAAAAAAAGCATAGCCTTAAACCATATT
CCCTAATCCAACTG3' TaU3-BsaI-F2: 5'GCAGGTCTCCACCcatgaatccaaaccacacggag3' CrRNA2-BsaI-R2:
5'GCAGGTCTCGCTAGAAAAAAAAAAGCATAGCCTTAAACATGGCGT
TTTCTGTCCGCGT3' TraCrRNA-OsU3-BsaIF3: 5'GCAGGTCTCGCTAGaaggaatctttaaacatacgaac3' TraCrRNA-KpnI-R3:
5'GgtaccAAAAAAAAAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGG
ACTAGCCTTATTTAAACTTGCTATGCTCGCCacggatcatctgcacaac3', For the above-mentioned 4 vectors, Example 1 was consulted to prepare the high-purity and high-concentration plasmids for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of edit duplication event; PCR
primersto amplifythe designed duplicated DNA at the junction regions weredesigned basedthe targeted cut sites on both sides, and then the PCR amplified fragments were sequenced;
the primer sequences wereas follows:
OsPPOlDup-testF1: CCACTGCTGCCACTTCCAC
OsPPOlDup-testF2: GGCGACTTAGCATAGCCAG
OsPPOlDup-testR1: GC TATTGC GGTGCGTATCC
OsPPOlDup-testR2: TCCAAGCTAGGGGTGAGAGA
The test result was shown in Figure 27; chromosome fragment duplication events were detected through the sequencing of PCR products using primers OsPPO1Dup-testF2 or OsPPO1Dup-testR2 and DNA extracted from pQY2648, pQY2650, pQY2651 and pQY2653 transformed rice protoplast samples; small fragments of DNA were missing between two DNA break sites at the expected fragment junction regions. The protoplast test result of pQY2650 demonstrated that the Cas9 without NLS could cut the target effectively to produce and detected the doubling event of chromosome fragments between targeted cuts when chromosomes were edited with the dual-target editing vector. The result of pQY2653 protoplast test demonstrates that the assembled gRNA could effectively guide the target editing in the event of separately expressed crRNA and tracrRNA to produce and detect doubling event of chromosome fragments between targeted cutting sites. The pQY2651 protoplast test result demonstrated that NLS-free Cas9 could work with separately expressed crRNA and tracrRNA and the spontaneously assembled gRNA to effectively guide target editing to produce and detect doubling event of chromosome fragments between cuts, which indicated that the creation of new genes through doubling/duplication, inversion, or translocation of chromosome fragments using the method of the present invention was independent of the nuclear localization signal of Cas9 protein or the fused single guide RNA
(sgRNA) system.
Example 14: Different chromosome fragment translocation and restructureto createa new HPPD gene in rice As mentioned in example 1 and example 4,rice HPPD gene is located on chromosome 2, CP12 gene is located on chromosome 1 but in opposite direction.ThroughCRISPR/Cas9-mediated chromosome cutting andnaturally occurred inversion of CP12 and PPO1 gene protein coding regions-containing fragmentand followed by the chromosomalfragments fusion, a new gene was generated in which CP12 promoter drives PPO1 expression, andas expected PPO1 expression was significantly enhanced,and conferred rice plant herbicide resistance. Taking advantage of thehigh expression characteristics of the CP12 promoter, a dual-target editing vector was designed and constructed, which cut thetwo regions upstream two start codons ATGs.After Agrobacterium-mediatedtransformation and followed by selection and plant-regeneration, a new HPPD gene in which CP12 promoter drives HPPD protein expression was identified through PCRand amplicon sequencing.
According to the analysis of rice gene expression profile data (http://rice.plantbiology.msu.edu/index.shtml) provided by the international rice genome sequencing project (International Rice Genome Sequencing Project),CP12 gene expression intensity isdozens to hundred times that of HPPD gene in rice leaf blade, CP12 gene promoter isstrong in leaf blades and seedlings.
With reference to example 1 and example 2, the related genomic DNA sequences of rice HPPD and CP12 genes were input into CRISPOR online tool (http://crispor.tefor.net/) to find and assess available edit targets. After online scoring, the following targets (5'-3') were selected between the promoters and protein coding regions of HPPD and CP12 genes for testing:
HPPD-guide RNA1 gtgctggttgccttggctgc HPPD-guide RNA2 cacaaattcaccagcagcca CP12-guide RNA1 gccatggctggctgttgatg CP12-guide RNA2 cggatttctgcgtgtgatgt HPPD-guide RNA1 and HPPD-guide RNA2 are located between HPPD gene promoter and protein coding region and close to HPPD protein start codon ATG, while CP12-guide RNA1 and CP12-guide RNA2 are located between CP12 gene promoter and protein coding region and close to CP12 protein start codon ATG.
For the above-mentioned targets the following primersweredesigned and synthezed, the double-target editors pQY2257, pQY2258, pQY2259, pQY2260 were constructed with expectation ofthe editing eventsin whichCP12 promoter driving HPPD protein coding region could be identifiedafter transformation and selection with hyg,as shown in Figure 28.
Primer ID DNAsequence(5 to 3')target sequences are underlined HPPD-sgRNAl-F
taggtctccggcmtgctggttgccttggctgottttagagctagaaatagcaagttaaaataaggc HPPD-sgRNA2-F
taggtctccggcgcacaaattcaccagcagccagttttagagctagaaatagcaagttaaaataaggc CP12-sgRNA1 -R taggtctccaaaccatcaacagccagccatggcgcttettggtgccgcg CP12-sgRNA2-R taggtctccaaacacatcacacgcagaaatccggcttcttggtgccgcg Wherein, guide RNA combinations in each editing vector:
pQY2257 contains the combination of HPPD-guide RNAland CP12-guide RNA1, pQY2258 contains the combination of HPPD-guide RNA1 and CP12-guide RNA2 combination, pQY2259 contains the combination of HPPD-guide RNA2 and CP12-guide RNA1 combination, pQY2260 contains the combination of HPPD-guide RNA2 and CP12-guide RNA2 combination.
With reference to the example 1 for rice protoplast transformation method,the above pQY2257-2260 vectors with high purity and concentration of the plasmid DNA
were prepared, and then the high-quality rice protoplast was prepared as well, PEG
mediated transformation of the rice protoplast was carried out, and finally thegenome editing and the designed new gene wasexpected to be detected where CP12 promoter drives HPPD
gene expression.
The following detecting primers, OsCP12pro-detection-F and OsHPPDutr-detection-R, were used to amplify the predicted fragment generated by the fusion of CP12 promoter and HPPD coding region, and the length of PCR amplicon was expected to be 305 bp.
Similarly, OsHPPDpro-detection-F and OsCP12cds-detection-R were used to detect the fragment produced by the fusion of HPPD promoter and CP12 coding region, and the length of PCR
products was expected to be 445bp.
Primer ID Sequence(5' to 3') OsCP12pro-detection-F ctgaggaggcgataagaaacga OsIAPPDutr-detection-R
gtgtgggggagtggatgac OsHPPDpro-detection-F caagagctttactccaagttacc OsCP12cds-detection-R
acccgccctcggagttgg The identification results showed that in pQY2257-transformed protoplastsamples were detected to have the CP12 promoter fused with the HPPD coding region, as shown in figure 29. Whilein the pQY2259-transformed protoplast samples were detected to have the HPPD
promoter fused with the CP12 coding region, as shown in figure 30.
The above results show that, using the method described in this invention, can generaterecombination between two chromosome fragments derived from two different chromosomes, whichis expected to create the new genes as designed.
In this particular example,HPPD gene expression increasesdrivenby the strong promoter of CP12 gene, meanwhileCP12 gene expression decreases driven by the weak promoter of HPPD gene.Therefore, the expressionlevel of the new genes generated through this invention can be regulated as needed by choice of a strong or weak promoter.
Example 15: Creation of a newhigh-expression HPPD gene caused by chromosome fragment duplication mediated by LbCpfl dual-target editing-rice protoplast test LbCpfl belongs to the Cas12a type of nucleases, recognizes a TTTV PAM site, and thus is suitable to edit a high AT-content DNA sequence; while Cas9 recognizes a NGGPAMsite and is suitable to edit a high GC-content DNA sequence. Therefore, the DNA
scope of their editing ability is complementary to each other. In the rice protoplast system, the ability of LbCpfl to cut and then induce the chromosome fragment to duplicate, i.e. to create a new HPPD gene was tested, as shown in the Figure 31.
With reference to Example 1, the pHUE411 vector (https://www.addgene.org/62203/) was used as the backbone, and the sgRNA expression cassette was removed by restriction enzyme digestion.The SV40 NLS-LbCpfl-nucleoplasmin NLS gene fragment synthesized in GenScript Biotechnology Company (Nanjing, China) replaced the Cas9 CDS of pHUE411.At 338kb downstream of HPPD gene is a high-expression Ubi2 gene with a same expression orientation. Thus, a duplication strategy was used to increase the expression of HPPD, which confers resistance to HPPD inhibitor herbicides. To this end, acrRNA was designed in the upstream of the start codon of rice HPPD gene:
5'accccccaccaccaactcctccc3', and thesecond crRNA was designed in the upstream of the start codon of rice UBI2 gene:
5'ctatctgtgtgaagattattgcc3'. A tandem crRNA sequence was synthesized with HH
ribozyme and HDV ribozyme recognition sites at both ends, as shown below:
S'AAATTACTGATGAGTCCGTGAGGACGAAACGAGTAAGCTCGTCTAATTTCTACT
AAGTGTAGATaccccccaccaccaactcctcccTAATTTCTACTAAGTGTAGATctatctgtgtgaagatt attgccTAATTTCTACTAAGTGTAGATGGCCGGCATGGTCCCAGCCTCCTCGCTGGCG
CCGGCTGGGCAACATGCTTCGGCATGGCGAATGGGAC3'.It was connected to the end of LbCpfl protein expression cassettein the vector according to the operating instructions of the Seamless Cloning Kit from HB-infusion Hanbio Biotechnology Co.Ltd.
(Shanghai, China). The maize UBIl promoter was used to drive both Lbcpfl protein and crRNA in the same expression cassette.This vector was named pQY2658.
With reference to Example 1, plasmidswithhigh-purityandhigh-concentrationwereprepared for PEG-mediated transformation of rice protoplasts.After 48-72 hr of transformation protoplast DNA was extractedfordetectingduplication-editing events. The primers fromboth sides of the targetswere designedto cover the duplicated area, and the target fragment was expected to be 494bp.The primer sequencesare:
Ubi2pro-Primer 5: gtagcttgtgcgtttcgatttg HPPDcds-Primer 10: tcgacgtggtggaacgcgag The PCR amplification of the DNA extracted from the pQY2658 transformed rice protoplasts forthe duplicated adapter fragments did produce bands with the expected size, and the sequencing result of the amplicon is consistent with the expected chromosome fragment duplicated adapter sequence. The sequencing result is shown in SEQ.No.27.
The test results onprotoplasttransformed with pQY2658 proved that LbCpfl nuclease can effectively cleave the target, generatethe detectableduplication of chromosome fragments between the targeted cut sites. It shows that the present invention can be used to create new genes through the duplication, inversion, or translocation of chromosome fragments, which can also be realized on the nuclease system of Cas12a.
Example 16: OsCATC gene connected to the chloroplast signal peptide domain through deletion of a chromosome segment Three genes of rice, namely glycolate oxidase OsGL03, oxalate oxidase 0s0X03 and catalase OsCATC, form a photorespiratory branch, which was referred to as GOC
branch.

The glycolic acid produced by photorespiration could be directly catalyzed into oxalic acid in chloroplast and finally completely decomposed into CO2 by introducing the GOC branch into rice by transgene and locating it in the chloroplast, thereby creating a photosynthetic CO2 concentration mechanism similar to C4 plants, which helped improve the photosynthetic efficiency and yield of rice (Shen et al. Engineering a New Chloroplastic Photorespiratory Bypass to Increase Photosynthetic Efficiency and Productivity in Rice.
Molecular Plant, 2019, 12(2): 199-214).
By using the method presented by the invention, the protein domains of different genes could be recombined by non-transgenic method to add chloroplast signal domains to genes that required chloroplast localization. Primer OsCATC-sgRNAl:
5'gtcctggaacaccgccgcgg3' was designed at the end of the chloroplast signal peptide domain of LOC4331514 gene of upstream 28Kb of OsCATC gene; OsCATC-sgRNA2:51atcagccatggatccctaca31 was designed in the first five amino acid coding regions of OsCATC gene. The chloroplast signal peptide domain of L0C4331514 gene was expected to fuse with the coding region of OsCATC gene to produce a new CATC gene located in chloroplast after the removal of inter-target fragment. Dual-target editing vector pQY2654 was constructed by the method stated in Example 1, and the primers used were OsCATC-sgRNAl-For2654F:taggtctccggcggtcctggaacaccgccgcggGTTTAAGAGCTATGC
TGGAAACAGC, and OsCATC-sgRNA2-For2654R:taggtctccaaactgtagggatccatggctgatgcttcttggtgccgcg.
High-purity and high-concentration plasmids were prepared for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of deletion edit event; detection primers were designed to extend the linker segment after the middle 28Kb chromosome segment deletion for the targets on both sides; sequencing was performed, and the primer sequences were shown below:
OsCATC-TestF: ccacaaaacgagtggctcag OsCATC-TestR: gtgagcgagttgttgttgttcc OsCATC-seqF: ctcttccctccactccactg The test result was shown in Figure 32. The extraction of DNA from pQY2654 transformed rice protoplast could detect chromosome fragment deletion event through PCR
amplification of the expected junction region after the targeted deletion, and then sequencing; the chloroplast signal peptide domain of L0C4331514 gene was fused with the coding region of OsCATC gene to create a new gene; the sequencing result was shown in SEQ ID No: 28. The protoplast test result of pQY2654 indicates that new genes combined from new protein domains could be created through the deletion of chromosome segments between different protein domains by using the method of the present invention.
Example 17: OsGLO3 gene connected to the chloroplast signal peptide domain through inversion of a chromosome segment As stated in Example 16, the OsG103 gene also needed to be heterotopically expressed in chloroplasts to improve the photosynthetic efficiency of rice. Hence, for the OsGLO3 gene, OsGL03-gRNA1:5'gtcctggaacaccgccgcgg3' was designed at the end of chloroplast signal peptide domain of the L0C4337056 gene of the upstream 69Kb, and OsGLO3-sgRNA2:5'tgatgacttgagcagagaaa3' was designed in the initiation codon region of the OsCATC gene; the chloroplast signal peptide domain of the L0C4337056 gene was expected to fuse with the coding region of OsGLO3 gene to produce the new GLO
gene located in chloroplast after the inversion of inter-target fragments. Dual-target editing vector pQY2655 was constructed as described in Example 1 using primers OsGL03-sgRNA1-For2655F:taggtctccggcgcgatgcttggtggcaagtgcGTTTAAGAGCTATGCT
GGAAACAGC and OsGL03-sgRNA2-For2655R:taggtctccaaactttctctgctcaagtcatcagcttcttggtgccgcg. High-purity and high-concentration plasmids were prepared for PEG-mediated transformation of rice protoplast; the protoplast DNA was extracted for detection of inversion edit event; detection primers were designed to extend the linker segment after the middle 69Kb chromosome segment inversion for the targets on both sides; sequencing was performed, and the primer sequenceswere shown below:
OsGL03-TestF1: cctccttgttcgtgttctccg OsGL03-TestF2: cggtcggttggttcatttcagg OsGL03-TestRl: catccagcagtgtgctaccag OsGL03-TestR2: cttgagaaggcctccctgttc The test result was shown in Figure 33. The extraction of DNA from pQY2655 transformed rice protoplast could detect chromosome fragment inversion event through PCR
amplification of the expected junction region after the targeted inversion, and then sequencing; the chloroplast signal peptide domain of L0C4337056 gene was fused with the coding region of OsCATC gene to create a new gene; the sequencing result was shown in SEQ ID NO: 29 The protoplast test result of pQY2655 indicated that new genes combined from new protein domains could be created through the inversion of chromosome segments between different protein domains by using the method of the present invention.
Example 18: Creation of Herbicide-resistant Rice through Knock-up of Endogenous PPO2 Gene Expression The rice PPO2 gene was located on rice chromosome 4; bioinformatics analysis indicated that the S-adenosylmethionine decarboxylase (hereinafter referred as "SAMDC") gene was approx. 436kb downstream the PPO2 gene; the PPO2 gene and SAMDC gene had the same transcription direction on the chromosome. According to the analysis performed with the rice gene expression profile data (http://rice.plantbiology.msu.edu/index.shtml) from the International Rice Genome Sequencing Project, the expression intensity of SAMDC gene in rice leaves was tens to hundreds of times that of PPO2 gene; the promoter of SAMDC gene was a strong and constitutive express promoter.
For the rice PPO2 gene, the genomic DNA sequence of rice PPO2 and SAMDC was entered into the CRISPOR online tool (http://crispor.tefor.net/) respectively, to seek available edit targets following the procedures stated in Examples 1 and 2.
Based on the online scoring, the following targets were selected for test between the promoter and CDS
region of PPO2 and SAMDC genes:
PPO2 -guide RNA1 gatttacttgttgtcttgtg PPO2 -guide RNA2 ttggggctcttggatagcta SAMDC-guide RNA1 ggttggtcagaacactgtgc SAMDC-guide RNA2 actgtgccggagatggagga PPO2-guide RNA1 and PPO2-guide RNA2 were close to the initiation codon ATG of PPO2 between the promoter and CDS region of PPO2 gene, (i.e. 5'UTR); SAMDC-guide RNA1 and SAMDC-guide RNA2 were also close to the SAMDC protein initiation codon between SAMDC gene promoter and CDS region (i.e. 5'UTR).
The following primers were designed for above-noted targets; dual-target edit vectors pQY1386 and pQY1387 were constructed, and the edit event of chromosome fragment duplication between two targeted cuts was expected to be achieved; the novel gene expressed by PPO2 CDS driven by SAMDC promoter was produced at the duplication fragment linker, as shown in Figure34.
Primer ID DNA sequence (5' to 3') taggtctccggeggatttacttgttgtettgtgGTTTAAGAGCTATGCT
PP02-esgRNA1-F
GGAAACAGC
taggtctccggcgttggggctcttggatagctaGTTTAAGAGCTATGC
PPO2-esgRNA2-F
TGGAAACAGC
SAMDC-esgRNAl-R taggtctccaaacgcacagtgttctgaccaaccgcttcttggtgccgcg SAMDC-esgRNA2-R taggtctccaaactcctccatctccggcacagtgcttcttggtgccgcg Wherein, pQY1386 contains the combination of PPO2-guide RNA1 and SAMDC-guide RNA1 pQY1387 contains the combination of PPO2-guide RNA2 and SAMDC-guide RNA2.
Vector plasmids were extracted, and agrobacterium strain EHA105 was electrotransformed. Agrobacterium tumefaciens-mediated transformation was performed with rice variety Jinjing 818 as the receptor by the method stated in Example 2. Several rounds of callus identification were conducted during the transformation and selection, and positive calli of duplication events were selected for differentiation.
The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC

promoter and PPO2 coding region; the length of PCR product was expected to be bp; the primer5-F+primer4-R combination was used to detect the fusion segment at the intermediate linker after chromosome fragment duplication; the predicted product length was 912 bp.
Primer ID Sequence (5' to 3') OsPPO2duplicated-primer1-F tctcggacaaacagtgcaccc OsPPO2duplicated-primer2-F caaattgtgggccgtatgcacg OsPPO2duplicated-primer3-R gcttcctcagcctgtacgcc OsPPO2duplicated-primer4-R acccgccctcggagttgg OsPPO2duplicated-primer5-F gtgcagtaagtggatgtactaatggagtc OsPPO2duplicated-primer6-F gccggaggcgtgaagaagttcca OsPPO2duplicated-primer7-R .. gacacaatggtgcaccgtgc OsPPO2duplicated-primer8-R ggactcagagaggacataggagtc According to the final identification result, duplication edit events were detected in QY1386/818-28# and QY1386/818-62# calli; the sequencing result at the duplication fragment linker was shown in SEQ ID NO: 30andSEQ ID NO: 31;The sequence alignment result was shown in Figure35; the result at #62 callus linker was exactly in line with expectations; seamless connection was observed, but duplication edit event was not detected in later differentiated seedlings.
Five duplication edit events were detected in the calli of QY1837; the sequencing results at the duplication fragment linker were shown inSEQ ID NO: 32, SEQ ID
NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, and SEQ ID NO: 36; some sequence alignment results were shown in Figure36.
Duplication events were detected in QY1837 differentiated seedlings; the results of the PCR amplified products and the sequencing at chromosome duplication linkers, targets and SAMDC targets of some TO seedlings were given below:
TO seedling No. Genotype at duplication point PPO2 target SAMDC target 1387/818-2 Heterozygosis: Seamless, -2bp +T, -11bp -6bp 1387/818-4/6/7 Heterozygosis: Seamless, -2bp +T, -11bp -2bp Heterozygosis, Heterozygosis, 1387/818-36 No duplication detected doublet doublet Heterozygosis, Heterozygosis, 1387/818-38 Heterozygosis: Seamless, -2bp doublet doublet The result of comparison of 1387/818-2 with the sequencing peak diagram was shown in Figure37; it was obvious that novel PPO2 gene expressed by PPO2 driven by SAMDC
promoter developed in the genome; small fragments were deleted on both sides of the target, but this did not affect the integrity of CDS region reading frame.
Quantitative PCR detection of the relative expression of PPO2 gene was performed for TO-generation differentiated seedlings 1387/818-2, 1387/818-4 and 1387/818-6;
the experiment operation was in line with Example 2; the quantitative PCR primer sequence was 5'-3 as follows:

RT-OsPP02-F GTATGGCTCTGTCATTGCTGGTG
RT-OsPP02-R GTTTATTCCTTCCTTTCCCTGGC
RT-OsSAMDC-F ACCTATGGTTACCCTTGAAATGTG
RT-OsSAMDC-R CTGGGATAATGTCAGAGATGCC
With UBQ5 as the internal control, the result was shown in Figure 35; compared with the wild-type rice Jinjing 818 control, the PP02 gene expression of double-edited seedlings increases significantly, while SAMDC expression decreases relatively.
The herbicide resistance of TO seedlings of 1387/818-2 and 1387/818-4 was preliminarily determined as stated in Example 6; wild-type Jinjing 818 seedlings with similar plant heights were taken as the control, and compound A was applied to them and TO
seedlings at the same time at a chemical concentration of 0.6 g a.i./mu; the culture temperature was kept at 28 C on a 16 (light) + 8 (dark) basis; pictures were taken to record the results 7 days after application, as shown in Figure 36. The TO seedlings of 1387/818-2 and 1387/818-4 were a little dried-up at the top, while a few drug spots appear on the leaf surface; the wild-type Jinjing 818 withered and died; the result indicated that the SAMDC
promoter-driven high expression of PPO2 protein enables rice to resist PPO
inhibitor herbicides.
Example 19: Creation of herbicide-resistant rice through knock-up expression of the endogenous OsPPO2 gene caused by CRISPR/Cas9targetedchromosome cutting and inversion afterAgrobacterium-mediated transformation With reference to Example 4 to operate0sPP02 gene, OsZFF (LOC OSO4G41560), a highly expressed gene at 170kb downstream from OsPPO2 in the opposite direction, was selected to design two sgRNAs targeting in the regions close to the protein start codons ATGs, and a dual-target editing vector pQY2611 was constructed. Similarly, to increase the inversion probability, the downstream 40kb from 0sPP02 and highly expressed gene OsNPP (LOC 0504G41340) in the opposite direction of 0sPP02 was also selected to design another two sgRNAs targeting in the regions close to the protein start codons ATGs, and another dual-target editing vector pQY2612 was constructed. The three selected targets were shown as the following table. It was expected that the editing could produce double-strand DNA cut and then the inversion of chromosome fragments between the targets to form a new gene with high expression of PP02, respectively, as shown in Figure 40:
0sPP02-guide RNA2 ttggggctcttggatagcta 560-guide RNA3 agttagtttagtcgtctcga 340-guide RNA4 tccggtggcgtctgtttggt The following primers were used to construct the vectors:
Primer ID Sequence (5' to 3') 0sPP02-sgRNA2-F taggtctccggcgttggggctcttggatagctaGTTTAAGAGCTATGCTGGAA

ACAGC
560-sgRNA3-R
taggtctccaaactcgagacgactaaactaactgcttcttggtgccgcg 340-sgRNA4-R taggtctccaaacaccaaacagacgcaagacaagcttcttggtgccgcg Wherein, pQY2611 contains the combination of OsPPO2-guide RNA2 and 560-guide RNA3 pQY2612 contains the combination of OsPPO2-guide RNA2 and 340-guide RNA4 pQY2611 contains the combination of OsP02-guide RNA2and560-guide RNA3 pQY2612 contains the combination of OsP02-guide RNA2and340-guide RNA4 The vector plasmid was extracted and transformed into Agrobacterium tumefacien strain EHA105.The rice variety Jinjing 818 was used as the receptor for Agrobacterium-mediated transformation, and the transformation method was referred to Example 2.Several rounds of callus identification were carried out during the transformation-postselection process, and the callus with positive inversion events was selected for differentiation.
The detecting primers in the table below were used to amplify the fragments containing both target sites and the fused fragment betweenthe predicted 560 promoter and the PPO2 coding region. The length of the PCR amplicon was expected 300-1000 bp.Primer2-F +
Primer12-R and Primer3-F + Primer10-R were used to detect fused fragments at the junction of OsZFF after chromosome fragmentation and then inversion, and the expected amplicon lengths were 512bp and 561bp, respectively. Similarly, Primer2-F + Primer6-R
and Primer3-F + Primer7-R were used to detect the fused fragments at the junction of OSNPP
after chromosome fragmentation and then inversion, and the expected amplicon lengths were 383bp and 666bp, respectively.
Primer ID Sequence (5' to 3') OsPPO2 inverted-primer2-F
caaattgtgggccgtatgcacg OsPPO2 inverted-primer12-R
cacgtctccactctcccagcc OsPPO2 inverted-primer3-F gcttcctcagcctgtacgcc OsPPO2 inverted-primer1O-R
Gcccgtgcagcctagccatc OsPPO2inverted-primer6-R ccacctccccggcggtactg OsPPO2inverted-primer7-R
gatatgccggaccggacatgt The pQY2611-transformed calli were identified through PCR and amplicon sequencing.
292 samples were identified, 19 of which were positivefor the inversion.The identified inversion event genotypes were shown as following table:
Junction sequence between Junction sequence between Positive callus ID inverted PPO2coding region inverted ZFFcoding region and ZFF promoter region and PPO2 promoter region 2611/818-3 -4bp, homozygous +T, homozygous 2611/818-10 seamless, homozygous no identification 2611/818-13 -2bp, homozygous -lbp, homozygous 2611/818-21 seamless, homozygous +T, homozygous 2611/818-24 seamless, homozygous not detect -26bp, 2611/818-53 not detect messychromatogrampeaks -30bp, 2611/818-54 not detect messychromatogrampeaks -26bp, 2611/818-55 not detect messychromatogrampeaks 2611/818-67 -30bp, homozygous not detect 2611/818-83 seamless, homozygous +T, messychromatogrampeaks 2611/818-85 seamless, homozygous not detect 2611/818-90 +418bp, homozygous not detect 2611/818-92 -2bp, homozygous +T, messychromatogrampeaks 2611/818-102 seamless, homozygous +T, messychromatogrampeaks 2611/818-106 seamless, homozygous +T, messychromatogrampeaks 2611/818-107 -2bp, homozygous +T, messychromatogrampeaks 2611/818-108 -2bp, heterozygous not detect 2611/818-109 heterozygous not detect 2611/818-121 -22bp, homozygous not detect The sequencing results of the OsZFF promoter fused with OsPPO2 CDS region were shown in Seq No.37, Seq No.38, Seq No.39, Seq No.40, Seq No.41, Seq No.42, Seq No.43.The alignment comparison results of 2611/818-10 and 2611/818-13 chromatogram peaks are shown in Figure 41.The events 2611/818-3, 2611/818-10, 2611/818-54 were differentiated further and obtained inversion positive TO plants.
Similarly, pQY2612-transformed calli were identified for inversion events. A
total of 577 callus samples were identified, and 45 callus samples were detected to be positive for the inversion.The genotypes of inversion events detected were shown as following table:
Positive genotype of inverted PPO2 genotype of inverted NFF
callusID
2612/818-5 seamless, homozygous -1 A, homozygous 2612/818-29 seamless, homozygous not detect 2612/818-34 -3bp, homozygous not detect 2612/818-62 seamless, homozygous not detect 2612/818-64 seamless, homozygous not detect 2612/818-66 +1 T, homozygous not detect 2612/818-129 seamless, homozygous Seamless, homozygous 2612/818-156 seamless, homozygous Seamless, homozygous 2612/818-157 seamless, homozygous Seamless, homozygous 2612/818-366 seamless, homozygous -5bp 2612/818-377 -3 lbp, the start codon is broken,homozygous not detect 2612/818-419 seamless, homozygous +lbp T
2612/818-444 Seamless, homozygous Seamless,homozygous 2612/818-457 Seamless, homozygous Seamless, homozygous 2612/818-497 +1 T, homozygous -3bp, homozygous The sequencing results of the OsNPP promoter fused OSPPO2 CDS region were shown in Seq No.44, Seq No.45, Seq No.46, and Seq No.47. The sequencing results of events 2612/818-5 and 2611/818-34 and the chromatogrampeaks are shown in Figure 42.Eventually only event 2612/818-29 was differentiated successfully and obtained a positive TO plant with desired inversion.
Example 20: Test on creation of novel PPO2 gene with maize protoplasts As shown in Example 7, the gene distribution on chromosomes was collinear among different plants; the method for successful creation of novel genes like EPSPS, PP01, PPO2 and HPPD in new mode of expression was versatile among other plant species.
According to Example 18, novel PPO2 gene was created through the PPO2 gene selection in maize and the duplication of chromosome fragments between maize SAMDC genes, and then dual-target edit vectors were constructed for maize protoplast test.
The following targets were selected for test between the promoter and CDS
region of PPO2 and SAMDC genes: ZmPP02-sgRNA1:5'ggatttgcttgttgtcgtgg3' was close to the initiation codon ATG of PPO2 protein between the promoter and CDS region of PPO2 gene (i.e. 5'UTR). ZmSAMDC-sgRNA2:5'gtcgattatcaggaagcagc3 and ZmSAMDC-sgRNA3:5'acaatgctggagatggaggg3' were close to the SAMDC protein initiation codon ATG between the promoter and CDS region of SAMDC gene(i.e. 5'UTR).
Dual-target edit vectors pQY1340 and pQY1341 were constructed using the following primers designed for above-noted targets.
Primer ID DNA sequence (5' to 3') TaggtctccggcgggatttgcttgttgtcgtggGTTTAAGAGCTATGCT
ZmPP 02-sgRNAl-F
GGAAACAGC
ZmSAMDC-sgRNA2-R Taggtctccaaacgtcgattatcaggaagcagctgcaccagccgggaatcgaac ZmSAMDC-sgRNA3-R Taggtctccaaacacaatgctggagatggagggtgcaccagccgggaategaac Wherein, pQY1340 contained ZmPP02-sgRNA1 and SAMDC-sgRNA2 targets combination, while pQY1341 contained ZmPP02-sgRNA1 and SAMDC-sgRNA3 targets combination.
High-concentration plasmids were prepared for above-noted vectors and used for the protoplast transformation in maize following the procedures stated in Example 1 for preparation and transformation of rice protoplasts; it was slightly different from rice in that a vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis so that the enzymatic hydrolysate contacts the cells more adequately; the maize variety used was B73.
The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC
promoter and PPO2 coding region; the length of PCR product was expected to be bp; the ZmSAMDC test-F1+ ZmPPO2 test-R2 combination was used to detect the fusion segment at intermediate linker after chromosome fragment duplication; the expected product length was approx. 597 bp; inner primer ZmSAMDC test-F2 was used for sequencing.
Primer ID DNA sequence (5' to 3') ZmSAMDC test-Fl gggtggcaaaaagtctagcag ZmSAMDC test-R1 ggtgagcaggagcttggtag ZmSAMDC test-F2 cggaggcgtgaagaagttccag ZmSAMDC test-R2 ccgtgcaagatccagaacagag ZmPPO2 test-Fl gccatcctgagacctgtagc ZmPPO2 test-R1 gcacaagggcataaagcaccac ZmPPO2 test-F2 gcagtccgaccatacccatacc ZmPPO2 test-R2 cctcgaaggcacaaacacgtac 1% agarose gel electrophoresis test was performed for the PCR reaction product, and the result indicated that the predicted positive band (approx. 597 bp) into which the ZmSAMDC promoter and ZmPPO2 coding region were fused was detected in all pQY1340 and pQY1341 transformed maize protoplast samples. Positive fragments were sequenced, and the PPO2 duplication event sequencing result of pQY1340 vector transformed protoplast test was shown in SEQ ID NO: 48; the PPO2 duplication event sequencing result of pQY1341 vector transformed protoplast test was shown in SEQ ID NO: 49. The result of comparison with the sequence at predicted chromosome segment duplication linker was shown in Figure43, indicating that the SAMDC gene promoter and the PPO2 gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression; thus, it's obvious that the method provided by the present invention for creating novel genes was also applicable to maize.
Example 21: Creation of novel PPO2 gene in wheat protoplast test According to Example 18, in wheat the chromosome fragment region between PPO2 gene and SAMDC gene was selected for dual-target editing to create the novel gene expressed by PPO2 coding region driven by the SAMDC promoter. Wheat was hexaploid, so there were 3 sets of PPO2 genes and SAMDC genes in genomes A, B, and D. The TaPP02-2A (TraesCS2A02G347900) gene was located at the wheat 2A chromosome, and the TaSAMDC-2A (TraesCS2A02G355400) gene was approx. 11.71Mb downstream; since the TaSAMDC-2A and TaPP02-2A gene transcriptions are in opposite directions on the same chromosome, it's necessary to choose inversion editing strategy, as shown in Figure44;
TaPP02-2B (TraesCS2B02G366300) was located at the wheat 2B chromosome, and TaSAMDC-2B (TraesCS2B02G372900) was 9.5 Mb downstream; since TaSAMDC-2B and TaPP02-2B gene expressions are in the same direction on the chromosome, the duplication editing strategy should be used, as shown in Figure45; TaPP02-2D
(TraesCS2D02G346200) was located at the wheat 2D chromosome, and TaSAMDC-2D (TraesCS2D02G352900) was 8.3 Mb downstream; since the TaSAMDC-2D and TaPP02-2D gene transcriptions are in the same direction on the chromosome, the duplication edit event should be selected, as shown in Figure46.

The DNA sequence of wheat ABD gene group PPO2 and SAMDC gene was entered into the CRISPOR online tool (http://crispor.tefor.net/) respectively, to seek available edit targets. Based on the online scoring, the following targets were selected for test between the promoter and CDS region of PPO2 and SAMDC genes:
Primer ID DNA sequence (5' to 3') 2A guide RNAI GCGGAGTACTAGTAGGTACG
2A guide RNA2 TGTGAATTTGTTTCCTGCAG
2A guide RNA3 ATGACGCAGAGCACTCGTCG
2A guide RNA4 CTTCTCGTAGTTTAGGATTT
2B guide RNAI CCCTCCTACCTACTACTCCG
2Bguide RNA2 TGTGACATTTTTTTCATCTT
2Bguide RNA3 CGAAGGCGACGACGGAGAGC
2Bguide RNA4 TCACTTCTGTTCAGACATTT
2Dguide RNAI CCGCGGAGTAGTAGGTAGCA
2Dguide RNA2 GCTTCACGATAATCGACCAG
2Dguide RNA3 CGATGACGCCGACGCAGAGC
2Dguide RNA4 CCAATCTCTCTGGCCTGCTT
2A guide RNAI and 2A guide RNA2 were close to the initiation codon of PPO2 protein between the promoter and CDS region of PPO2 gene (i.e.5'UTR); 2A guide RNA3 and 2A
guide RNA4 were close to the SAMDC protein initiation codon between SAMDC gene promoter and CDS region (i.e.5'UTR). 2B and 2D followed the same principle as above.
The following primers were designed for above-noted targets to construct the vector with pHUE411 vector (https://www.addgene.org/62203/) as the framework using the method presented in "Xing fit, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC
Plant Biol.
2014 Nov 29;14(1):327".
Primer ID DNA sequence (5' to 3') TaPPO2A-T2 for taggtctccggcgGCGGAGTACTAGTAGGTACG
2626/2627BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCA-for taggtctccaaacTGTGAATTTGTTTCCTGCAG
2627/2629BsaIR gcttcttggtgccgcg TaPPO2A-T2 for taggtctccggcgATGACGCAGAGCACTCGTCG
2628/2629BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCA-for taggtctccaaacCTTCTCGTAGTTTAGGATTT
2626/2628BsaIR gcttcttggtgccgcg TaPPO2B-T2 for taggtctccggcgCCCTCCTACCTACTACTCCG
2630/263 lBsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCB for taggtctccaaacTGTGACATTTTTTTCATCTT
2630/2632BsaIR gcttcttggtgccgcg TaPPO2B for taggtctccggcgCGAAGGCGACGACGGAGAGC
2632/2633Bsaff GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCB for taggtctccaaacTCACTTCTGTTCAGACATTT

263 1/263 3BsaIR gcttcttggtgccgcg TaPPO2D for taggtctccggcgCCGCGGAGTAGTAGGTAGCA
2635/2636BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCD for taggtctccaaacGCTTCACGATAATCGACCAG
2634/2636BsafR gcttcttggtgccgcg TaPPO2D for taggtctccggcgCGATGACGCCGACGCAGAGC
2636/2637BsaIF GTTTAAGAGCTATGCTGGAAACAGC
TaSAMDCD for taggtctccaaacCCAATCTCTCTGGCCTGCTT
2635/2637BsaIR gcttcttggtgccgcg The following dual-target combined gene edit vectors were constructed using the method described in the literature above. To be more specific, pCBC-MT1T2 plasmid (https://www.addgene.org/50593/) was used as template to amplify dual-target fragments sgRNA1+3, sgRNA1+4, sgRNA2+3 and sgRNA2+4 to construct the sgRNA expression cassettes. BsaI digests the pHUE411 vector framework, and the gel was recovered; the target fragment was used for ligation reaction directly after digestion. T4 DNA ligase was used to link up the vector framework and target fragment, and the ligation product was transformed to the Trans5a competent cell; different monoclonal sequences were selected;
after the sequences were confirmed by sequencing to be correct, the Sigitech small-amount high-purity plasmid extraction kit was used to extract plasmids and attain recombinant plasmids, which were respectively named as pQY2626, pQY2627, pQY2628, pQY2629, pQY2630, pQY2631, pQY2632, pQY2633, pQY2634, pQY2635, pQY2636, and pQY2637 as follows:
pQY2626 contains the combination of 2A-guide RNA1 and 2A-guide RNA3 pQY2627 contains the combination of 2A-guide RNA1 and 2A-guide RNA4 pQY2628 contains the combination of 2A-guide RNA2 and 2A-guide RNA3 pQY2629 contains the combination of 2A-guide RNA2 and 2A-guide RNA4 pQY2630 contains the combination of 2B-guide RNA1 and 2B-guide RNA3 pQY263 1 contains the combination of 2B-guide RNA1 and 2B-guide RNA4 pQY2632 contains the combination of 2B-guide RNA2 and 2B-guide RNA3 pQY2633 contains the combination of 2B-guide RNA2 and 2B-guide RNA4 pQY2634 contains the combination of 2D-guide RNA1 and 2D-guide RNA3 pQY2635 contains the combination of 2D-guide RNA1 and 2D-guide RNA4 pQY2636 contains the combination of 2D-guide RNA2 and 2D-guide RNA3 pQY2637 contains the combination of 2D-guide RNA2 and 2D-guide RNA4 High-concentration plasmids were prepared for above-noted vectors and used for the protoplast transformation in wheat following the procedures stated in Example 1 for preparation and transformation of rice protoplasts; it's slightly different from rice that a vacuum degree of 15 pa should be maintained for 30 minutes before enzymolysis so that the enzymatic hydrolysate contacts the cells more adequately. The variety of wheat used was KN199; the seeds were from the Teaching and Research Office on Weeds, School of Plant Protection, China Agricultural University, and were propagated at our lab; the wheat seeds were sown in small pots for dark culture at 26 C for approx. 10 d - 15 d;
stems and leaves of the etiolated seedlings were used to prepare protoplasts.
The detection primers in the table below were used to PCR amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted SAMDC promoter and PPO2 coding region; the length of PCR product was expected to be 300-1100 bp; the ZmSAMDC test-F1+ ZmPPO2 test-R2 combination was used to detect the fusion segment at intermediate linker after chromosome fragment duplication;
the PCR
product length was expected to be 300-1100 bp; primer pair combinations TaSAMDCA-g600F&TaPPO2A+g480R, TaSAMDCB-g610F &TaPPO2B+g470R, and TaSAMDCD-g510F &TaPPO2D+g49OR were respectively used to test the fusion segments at intermediate linker after the chromosome fragment duplication or inversion in the ABD
genome; the product length was expected to be approx. 1 kb.
Primer ID DNA sequence (5' to 3') TaPPO2A-g330F TCACCAAAAATGTGTGCGCTCGTG
TaPPO2A+g48OR ACACAGGTCGCACCATTCGCTCCAACAC
TaPPO2B-g360F CACATTCACCAAAAATGTGTGTGCTCGACTG
TaPPO2B+g47OR AGGTCGCACCATTCGCCACAATCC
TaPPO2D-g340F TGGGTCCGTTTTTTATTGGGCGCTCAAG
TaPPO2D+g49OR CTCAATTCGCTCCAGCATTCGCCG
TaSAMDCA+g67OR CAGACCTCCATCTCGGGAATGATGTCG
TaSAMDCA-g600F TCCGTATGGCGCTTGTTCGTTGTTCG
TaSAMDCB+g62OR AGCACAGGAGACATGGCCATCAGCAG
TaSAMDCB-g610F GAATTTGCCGTGGCTTATGGCATCATG
TaSAMDCD+g67OR CCTCCATCTCAGGGATAATGTCAGAGATT
TaSAMDCD-g510F TACAGCATTCCGTCCCTGCTGTGAC
1% agarose gel electrophoresis test was performed for the PCR reaction product, and the result indicated that the predicted SAMDC promoter and the positive strip/band of approx. 1 kb in the PPO2 coding region fusion segment can be detected in the pQY2626 and PQY2627 transformed samples of the 2A genome, the pQY2630 and pQY2631 transformed samples of 2B genome, and the QY2634, pQY2635 and pQY2636 transformed samples of 2B genome.
PCR amplified positive fragments were sequenced, and the PPO2 inversion event sequencing result of pQY2626 vector transformed protoplast test was shown in SEQ ID NO:
50; the PPO2 inversion event sequencing result of PQY2627 vector transformed protoplast test was shown in SEQ ID NO: 51. The result of sequence comparison at inversion linker of predicted chromosome segment indicated that the TaSAMDC-2A gene promoter and the TaPP02-2A gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression.
The PPO2 duplication event sequencing result of pQY2630 vector transformed protoplast test was shown in SEQ ID NO: 52; the PPO2 duplication event sequencing result of pQY2631 vector transformed protoplast test was shown in SEQ ID NO: 53. The result of sequence comparison at duplication linker of predicted chromosome segment indicated that the TaSAMDC-2B gene promoter and the TaPP02-2B gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression;
the result of pQY2631 sequencing peak diagram comparison was shown in Figure45.
The PPO2 duplication event sequencing result of pQY2634 vector transformed protoplast test was shown in SEQ ID NO: 54; the PPO2 duplication event sequencing result of pQY2635 vector transformed protoplast test was shown in SEQ ID NO: 55. The duplication event sequencing result of QY2636 vector transformed protoplast test was shown in SEQ ID NO: 56. The comparison with the predicted sequence at chromosome segment duplication linker indicated that TaSAMDC-2D gene promoter and TaPP02-gene expression region can be linked up directly to create novel PPO2 gene with strong promoter-driven expression; the result of pQY2635 sequencing peak diagram comparison was shown in Figure46.
According to the results of these protoplast tests, novel PPO2 genes expressed by TaPPO2 driven by TaSAMDC promoter can also be created through chromosome segment inversion or duplication in wheat; therefore, it's obvious that the method presented in the present invention for creating new genes was also applicable to wheat.
Example 22: Creation of herbicide-resistant rape with knock-up endogenous PP02 gene expression through agrobacterium tumefaciens-mediated transformation Brassica napus was tetraploid, where the chromosome set was AACC; the redundancy between the A and C genomes enables the creation of new genes with different combinations of gene elements through the deletion or rearrangement of chromosome segments. To create a rape germplasm resistant to PPO inhibitor herbicides, the up-regulation of endogenous PPO gene expression was a feasible technical route. The analysis of the genomic data of rape C9 chromosome shows that the 30S
ribosomal protein S13 gene (hereinafter referred as 30SR) was located at approx. 23 kb upstream the BnC9.PPO2; both were in the same direction for transcription on the same chromosome; the expression levels of rape 30SR and BnC9.PPO2 in various tissues in rapeseed were analyzed with BrassicaEDB database (https://brassica.biodb.org/); 30 SR and BnC9.PPO2 were principally expressed in leaves, and the expression level of 30SR was significantly higher than that of BnC9.PPO2; the PPO2 protein expression level was expected to rise when the novel gene expressed by BnC9.PPO2 CDS driven by 305R promoter was created by deleting the chromosome segment between 30SR promoter and BnC9.PPO2 CDS; in that way, rape gained herbicide tolerance.
Targets available were identified by finding the information on C9 chromosome of transformed receptor rape variety Westar at the rape database web site (http://cbi.hzau.edu.cn/bnapus/); a total of 6 targets were selected:
BnC9.PPO2-guide RNA1 TTCCTGTATCCTTCTTCAG
BnC9.PPO2 -guide RNA2 AAGATGAGAGCTACGGATA
BnC9.PPO2 -guide RNA3 AACCCAACAGAAACGCGTC
BnC9.PPO2 -guide RNA4 CGAAAGAGAAGTAGACCAG
BnC9.PPO2 -guide RNA5 CTCCTGAAACGACAACAAA
BnC9.PPO2 -guide RNA6 CTTAAGTTATGTTTCTAAC
Wherein, guide RNA1, guide RNA2 and guide RNA3 were close to the initiation codon ATG of 30SR protein between the promoter and CDS region of 30SR gene (i.e.5'UTR
region); guide RNA4, guide RNA5 and guide RNA6 were close to the BnC9.PPO2 protein initiation codon ATG between BnC9.PPO2 gene promoter and CDS region (i.e.5'UTR

region).
With reference to Example 1, the edit vectors of different target combinations, namely pQY2533, pQY2534, pQY2535 and pQY2536 were constructed with pHSE401 vector as the framework; where:
pQY2533 contains the combination of guide RNA1 and guide RNA4 pQY2534 contains the combination of guide RNA2 and guide RNA5 pQY2535 contains the combination of guide RNA3 and guide RNA6 pQY2536 contains the combination of guide RNA1 and guide RNA5 Vector plasmids were extracted, and agrobacterium strain GV3101 was electrotransformed. Agrobacterium tumefaciens-mediated transformation was performed with rape variety Westar as receptor using the method below:
Sowing: Seeds were soaked in 75% alcohol for 1 min, disinfected with 10%
sodium hypochlorite solution for 9 min, washed 5 times with sterile water, sown into MO medium, and cultured in darkness at 24 C for 5-6 days.
Preparation of agrobacterium: 3 mL of liquid LB medium was transferred into the sterile tube; the solution with agrobacterium was subjected to shake culture in a 200-rpm shaker at 28 C for 20-24h. The solution with bacteria was incubated for 6-7h in the LB
culture medium. The cultured bacteria solution was poured into a 50 mL sterile centrifuge tube; the tube was centrifuged for 5 min at 6000 rpm; the supernatant was discarded, and a moderate amount of DM suspension was added; the solution was shaken well and the 0D600 value of infecting bacteria solution was set to approx. 0.6-0.8.
Infection and co-cultivation of explants: The prepared infecting bacteria solution was activated on ice, while the hypocotyls of seedlings cultured in darkness were cut off vertically with sterile forceps and scalpel; the cut-off explant was infected for 12 minutes in a dish, which was shaken every 6 min during infection; the explants were transferred to sterile filter paper after infection, and the excess infection solution was sucked out; then, the explants were placed in M1 culture medium and co-cultured at 24 C for 48h.
i0 Callus induction: After the co-culture, the explants were transferred to M2 culture medium, where callus was induced for 18-20 days; the culture conditions: Light culture at 22-24 C; light for 16 hrs / dark for 8 hrs. The conditions for differentiation culture and rooting culture were the same as the present stage.
Induced germination: The callus was transferred to M3 culture medium for differentiation culture, and succession was performed every 14 days until germination.
Rooting culture and transplantation: After the buds were differentiated to see obvious growth points, the buds were carefully cut off from the callus with sterile forceps and scalpel; the excess callus was removed as much as possible, and then the buds were transferred to M4 medium for rootage. Rooted plants were transplanted into the culture soil;
Ti-generation seeds were achieved through bagged selfing of the TO-generation regenerated plants.

The formula of culture medium used during the process was as follows:
Sowing culture medium MO
Culture Chemical name Dosage Method of preparation medium MS 2.22g Dissolved in 1000 mL
MO Agar 8g of double distilled water; pH adjusted to 5.8-5.9; autoclaved DM transform buffer solution Culture Chemical name Dosage Method of preparation medium MS 4.43g _______________________ Dissolved in 1000 mL
Sucrose 30g of double distilled DM 2,4-D lmL water;
pH adjusted to Kinetin (KT) lmL 5.8-5.9;
AS added Acetosyringone (AS) lmL after autoclaving Co-culture medium M1 Culture Chemical name Dosage Method of preparation medium MS 4.43g Sucrose 30g Dissolved in 1000 mL
Manitol 18g of double distilled M1 2,4-D lmL water; pH
adjusted to Kinetin (KT) lmL 5.8-5.9;
AS added Phytagel 4-5g after autoclaving Acetosyringone (AS) lmL
Screening medium M2 Culture Chemical name Dosage Method of preparation medium MS 4.43g Sucrose 30g ___________________________________________________________________ Dissolved in 1000 mL
Manitol 18g 2 4-D lmL _______________________ of double distilled , ___________________________________________________________________ water; pH
adjusted to Kinetin (KT) lmL
M2 5.8-5.9; silver nitrate, Phytagel 4-5g timentin and AgNO3 (silver nitrate) 0.2mL
___________________________________________________________________ hygromycin added Timentin lmL
after autoclaving Hygromycin (Hyg) 0.2mL
Acetosyringone (AS) lmL
Differential medium M3 Culture Chemical name Dosage Method of preparation medium MS 4.43g Glucose lOg ___________________________________________________________________ Dissolved in 1000 mL of Xylose 0.25g ___________________________________________________________________ double distilled water; pH
MES 0.6g __________________________________________________________________ adjusted to 5.8-5.9; ZT, M3 Phytagel 4-5g IAA, timentin and Zeatin (ZT) lmL
___________________________________________________________________ hygromycin added after Indoleacetic acid (IAA) 0.2mL
autoclaving Timentin lmL
Hygromycin (Hyg) 0.2mL
Rooting medium M4 Culture Chemical name Dosage Method of preparation medium MS 2.2g Sucrose lOg Dissolved in 1000 mL of lmL ______________________ double distilled water; pH
M4 Indolebutyric acid (IBA) ________________________________ adjusted to 5.8-5.9; timentin Agar lOg added after autoclaving Timentin 0.5mL
After the emergence of seedlings, leaves were taken from TO seedlings for molecular identification. The detection primers in the table below were used to amplify the fragments containing target sites on both sides or the fragments produced from the fusion of predicted 30SR promoter and BnC9.PPO2 coding region; where klenow fragment was removed, the PCR product length should be approx. 700 bp.
Primer ID Sequence (5' to 3') 30SR PRO-F: TGACTTTGCATCTCGCCACT
PPO2 PRO-R3:
GCAGATGATGATGATGATAAGCTC
363 TO seedlings from the transformation of the four vectors were tested;
Klenow fragment deletion event was observed in 18 plants; the probability of Klenow fragment deletion varied depending on target combination; even the same target combination may bring about different probabilities of Klenow fragment deletion; pQY2534 vector offered the highest probability (10.96%), while pQY2535vector offered the lowest probability (2%);
the average probability was on the order of 5.56%.
Analysis of the sequencing result of 18 individual plants with positive knocked out: The sequencing results of 10 individual plants showed seamless Klenow fragment deletion between two targets; homozygous seamless knockout occurred in QY2533/w-7, and heterozygous knockout occurred in the other 9 plants; compared with the expected sequence after deletion, the insertion or deletion of small fragments of base was observed in 8 individual plants; up to 32 bases were deleted in the 30SR promoter region, and this was not expected to affect the promoter activity; homozygous knockout was observed in QY2533/w-36, QY2533/w-42, QY2535/w-32 and QY2536/w-124; the details of result were as follows:
Plant No. PCR test result Sequencing result analysis Deletion; seamless;
QY2533/w-7 With strip/band homozygous QY2533/w-36 With strip/band Deletion; -2bp; homozygous QY2533/w-39 With strip/band Deletion; -13bp; heterozygous With strip/band Deletion; +1bp; T;
QY2533/w-42 homozygous With strip/band Deletion; seamless;
QY2534/w-32 miscellaneous peaks With strip/band Deletion; seamless;
QY2534/w-36 miscellaneous peaks With strip/band Deletion; seamless;
QY2534/w-40 miscellaneous peaks With strip/band Deletion; -32bp; miscellaneous QY2534/w-44 peaks With strip/band Deletion; seamless;
QY2534/w-53 miscellaneous peaks With strip/band Deletion; seamless;
QY2534/w-55 miscellaneous peaks With strip/band Deletion; seamless;
QY2534/w-56 miscellaneous peaks With strip/band Deletion; seamless;
QY2534/w-59 miscellaneous peaks QY2535/w-32 With strip/band Deletion; +10bp; homozygous QY2535/w-46 With strip/band Deletion; -lbp; heterozygous With strip/band Deletion; seamless;
QY2536/w-73 miscellaneous peaks With strip/band Deletion; seamless;
QY2536/w-77 miscellaneous peaks QY2536/w-78 With strip/band Deletion; +lbp; heterozygous QY2536/w-124 With strip/band Deletion; +A; homozygous The sequencing result showed that the 30SR promoter can be directly connected with the BnC9.PPO2 CDS region to create novel PPO2 gene with strong promoter-driven expression after the deletion of inter-target sequence.The sequencing results of the 30SR
promoter fused BnC9.PPO2 CDS region were shown in Seq No.57, Seq No.58, Seq No.59, Seq No.60, and Seq No.61.
TO seedling test result indicated that the method presented in the present invention enabled the creation of novel genes expressed by the BnC9.PPO2 CDS region driven by the 30SR promoter; so, it's obvious that the way presented in the present invention to create new genes was also applicable to rape. The results of test on rice, corn, wheat, arabidopsis thaliana, and rape demonstrate that the method provided by the present invention was designed for purposeful precise creation of novel genes with combinations of different gene elements or different protein domains in both monocotyledons and dicotyledons.
Example 23: Creation of Rice Blast Resistance through knock-up Expression of an Endogenous Gene OsWAK1 OsWAK1 is a novel functional protein kinase. It was reported that overexpression of the OsWAK1 gene can confer resistance to rice blast(Li et al. A novel wall-associated receptor-like protein kinase gene, OsWAK1, plays important roles in rice blast disease resistance. Plant Mol Biol, 2009, 69: 337-346). The OsWAK1 gene locates on rice chromosome 1. Through bioinformatics analysis, it was found that LOC
OsOlg044350 (hereinafter referred to as 44350) gene, which is highlyexpressed in rice, locates about 26 kb upstream of OsWAK1 gene, and the 44350 gene and the OsWAK1 gene are in the opposite direction on the chromosome. The 44350 gene promoter can be used for inversion to increase the expression of OsWAK1 gene. Similarly, BBTI12 (MSU ID:
LOC OsOlg04050), which is highlyexpressed in rice, locates about 206 kb upstream of OsWAK1 gene, and the BBTI12 gene and the OsWAK1 gene are in the same direction on the chromosome. The BBTI12 gene promoter can be used for duplication to increase the expression of OsWAK1 gene.
Similarly, the dual-target combination 0sWAK1ts2:5'TTCAGCTAGCTGCTACACAA
3' and 44350ts2: 5' TAGAAGCTTTGATGCTTGGA 3', was used to construct the duplication editing vector pQY1085. The construction primers used were bsaI-OsWAK1 5'UTR ts2-F:
S'AATGGTCTCAggcATTCagctagctgctacacaaGTTTAAGAGCTATGCTGGAAACAG
CAT3' and bsaI-44350 5'UTR ts2-R:
S'AATGGTCTCAAAACTCCAAGCATCAAAGCTTCTAgcttcttggtgccgcgc 3'.
Similarly, the dual-target combination OsWAK1ts2: 5' TTCAGCTAGCTGCTACACAA 3' and BBTI12ts2: 5' CAAGTAGAGGAAATAGCTCA 3' was used to construct the duplication editing vector pQY1089. The construction primers used were bsaI-0sWAK1 5'UTR ts2-F:
5'AATGGTCTCAGGCATTCAGCTAGCTGCTACACAAGTTTAAGAGCTATGCTG
GAAACAGCAT3' and bsaI-BBTI12 5'UTR ts2-R:
5'AATGGTCTCAAAACTGAGCTATTTCCTCTACTTGGCTTCTTGGTGCCGCGC
3' .
The above two plasmids were extracted to transform Agrobacterium sp. EHA105., The recipient rice variety Jinjing 818 was transformed through Agrobacterium-mediated transformation and the transformation method was referenced to Example2.
During the transformation process, genotype identification at the junction regions was performed on the rice calli, and the inversion or duplication event-positive calli were selected to enter the differentiation stage for regeneration of seedlings.
For pQY1085 transformed rice calli, the primer44350tsdet-F+primer0sWAKltsdet-F

combination was used to detect the fusion fragment at the middle joint after the inversion of the chromosome fragment, and the PCR product length was expected to be 713 bp.
Primer ID Sequences(5' to 3') 44350tsdet-F CGATCGATTCATCGAGAGGGCT
44350tsdet-R ATCACCAGCACGTTCCCCTC
0 sWAK1 T SDET-F TTTTGTGTGCCGCGACGAATGAG
0 sWAK1T SDET-R
CATAACGCTGTCGACAATTGACCTG
For pQY1089 transformed rice calli, the primer0sWAKltsdet-F+
primerBBTI12tsdet-R combination was used to detect the fusion fragment at the middle joint after the duplication of the chromosome fragment, and the PCR product length was expected to be 837 bp.
Primer ID Sequences(5' to 3') BBTI12tsdet-F TTTTCTTTTGCAACAGCAGCAAAGATT
BBTI12tsdet-R AGGGTACATCCTAGACGAGTCCAAG
A
OsWAKltsdet-F TTTTGTGTGCCGCGACGAATGAG
OsWAKltsdet-R CATAACGCTGTCGACAATTGACCTG
The above two vectors were referred to in Example 2 for Agrobacterium-mediated transformation of rice callus. After the callus was identified, the inversion or duplication event-positive calli were differentiated, and eventually positive edited seedlings were obtained. The results of molecular identification are shown in the Figure47.
As shown, the pQY1085-transformed seedlings were detected to identifythe inversion editing events in which the 0s01g044350 promoter drives the OsWAK1 gene expression and thus a new OsWAK1 gene was formed. The representative sequences of the sequenced inversion events, QY1085/818-57, QY1085/818-107, QY1085/818-167, QY1085/818-23are shown in SEQ
ID
NO: 62, SEQ ID NO: 64, SEQ ID NO: 65andSEQ ID NO: 66.
As shown in the Figure 48, the pQY1089-transformed seedlings were detected to identify theduplication editing events in which the BBTI12 promoter drives the OsWAK1 gene expression and another new OsWAK1 gene was also formed. The representative sequences of the sequenced duplication events, QY1089/818-595, QY1089/818-321, QY1089/818-312 are shown in SEQ ID NO: 63, SEQ ID NO: 67and SEQ ID NO: 68.
Example 24: Creation of blast-resistant rice through knock-up expression of endogenous OsCNGC9 gene in rice The cyclic nucleotide-gated channels (CNGCs) gene family encodes a set of non-specific, Ca2+ permeable cation channels. It was reported that overexpression of the OsCNGC9 gene can confer resistance to rice blast(Wang et al. A cyclic nucleotide-gated channel mediates cytoplasmic calcium elevation and disease resistance in rice.Cell Research, 2019, epub). The OsCNGC9 gene locates on rice chromosome 9. Through bioinformatics analysis, it was found that LOC 0s09g39180 (hereinafter referred to as 39180) gene, which is highly expressed in rice, locates about 314 kb downstream of OsCNGC9 gene, and the 39180 gene and the OsCNGC9 gene were in the opposite direction on the same chromosome.
The 39180 gene promoter can be used for inversion to increase the expression of OsCNGC9 gene. In addition, LOC 0s09g39390 (hereinafter referred to as 39390), which is highly expressed in rice, locates about 456 kb downstream of OsCNGC9 gene, and the 39390 gene and the OsCNGC9 gene were in the same direction on the same chromosome. The gene promoter can be used for duplication to increase the expression of OsCNGC9 gene.
The dual-target combination OsCNGC9ts1: 5' ACAGCAAGATTTGGTCCGGG 3' and 39180ts1: 5' ATGGAATGGAAGAGAATCGA 3' was used to construct the inversion editing vector pQY1090. The construction primers used were bsaI-OsCNGC9 5'UTR
tsl-F:
5' AATGGTCTCAGGCAACAGCA
AGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3' and bsaI-39180 5'UTR tsl-R: 5' AATGGTCTCAAAACTCGATTCTCTTCCATTCCATGCTTCTTG
GTGCCGCGC 3'.
The dual-target combination OsCNGC9ts1: 5' ACAGCAAGATTTGGTCCGGG 3' and 39390ts1: 5' CTACTGGCCTCGATTCGTCG 3' was used to construct the duplication editing vector pQY1094. The construction primers used were bsaI-OsCNGC9 5'UTR
tsl-F:
5' AATGGTCTCAGGCAACAGCA
AGATTTGGTCCGGGGTTTAAGAGCTATGCTGGAAACAGCAT3' and bsaI-39390 5'UTR tsl-R: 5' AATGGTCTCAAAACCGACGAATCGAGGCCAGTAGGCTTCT
TGGTGCCGCGC 3'.
The above two plasmids were extracted to transform Agrobacterium sp. EHA105., The recipient rice variety Jinjing 818 was transformed through Agrobacterium-mediated transformation and the transformation method was referenced to Example2.
During the transformation process, molecular identification was performed on the rice calli, and the inversion or duplication event-positive calli were selected to enter the differentiation stage and regeneration of seedlings.
For pQY1090 transformed calli, the primer39180tsdet-R+ primerOsCNGC9tsdet-R
combination was used to detect the fusion fragment at the middle joint after the inversion of the chromosome fragment, and the PCR product length was expected to be 778 bp.
Primer ID Sequences(5' to 3') OsCNGC9tsdet-F
ACATCTCATGTGCAAGATCCTAGCA
¨
OsCNGC9tsdet-R
AAACTGGTCCTGTCTCTCATCAGGA
39180tsdet-F TGGCTCAGCGAAGTCGAGC
39180tsdet-R CATGGTTGAACTGTCATGCTAATCAGT

For pQY1094 transformed calli, the primer3390tsdet-F3+ primerOsCNGC9tsdet-R
combination was used to detect the fusion fragment at the middle joint after the duplication of the chromosome fragment, and the PCR product length was expected to be 895 bp.
Primer ID Sequences(5 to 3') OsCNGC9tsdet-F ACATCTCATGTGCAAGATCCTAGCA
OsCNGC9tsdet-R AAACTGGTCCTGTCTCTCATCAGGA
39390tsdet-F3 TACTACAGCCTTTGCCTTTCACGGTTC
39390tsdet-R GTCTGCCACATGCCGTTGAG
The above two vectors were referred to in Example 2 for Agrobacterium-mediated transformation of rice callus. After the callus was identified, the inversion or duplication event-positive calli were differentiated, and finally positive edited seedlings were obtained.
Sequencing results prove thatthe pQY1090 transformed seedlings were detected to identify the inversion edited events in which the LOC 0s09839180 promoter drives the OsCNGC9 gene expression and thus a new OsCNGC9 gene was formed. The representative sequences of the sequenced inversion events QY1090/818-192, QY1090/818-554 and QY1090/818-541, are shown in SEQ ID NO: 69, SEQ ID NO: 70 and SEQ ID NO: 71.
Sequencing results prove that the pQY1094 transformed seedlings were detected to identify duplication edited events in which the LOC 0s09g39390 promoter drives the OsCNGC9 gene expression and thus another new OsCNGC9 gene was also formed. The representative sequence of the sequenced duplicated event QY1094/818-202 are shown in SEQ ID NO: 72.
Example 25: Pig IGF2 gene expression knock-up IGF-2 (Insulin-like growth factor 2) is one of three protein hormones that have similar structure with insulin. IGF2 is secreted by the liver and circulates in the blood. It has the activity of promoting mitosis and regulating growth.
TNNI2 and TNNT3 encode muscle troponin I and troponin T, respectively, and they are the core components of muscle fibers. These two protein coding genes are constitutively and highly expressed in muscle tissue. Therefore, using the promoters of these two genes to drive the expression of IGF2 gene is expected to significantly increase its expression in muscle cells and promote growth. Since the directions of these two genes are opposite to IGF2 on the same chromosome, knock-up of IGF2 could be achieved by promoters exchange through chromosome segmentsinversion.
The experiment procedure was as follows:
1. CRISPR/Cas9 target site selection and vector construction:
Using the CRISPR target online design tool (http://crispr.mit.edu/), we selected 20 bp sgRNA oligonucleotide sequences in the 5'UTR regions of pig IGF2, TNNI2, and genes, respectively.The sgRNA oligos were synthesized by BGI, Qingdao.
IGF2-sgRNA: 5'ccgggtggaaccttcagcaa3' TNNI2-sgRNA: 5'agtgctgctgcccagacggg3' TNNT3-sgRNA: 5'acagtgggcacatccctgac3' Diluting the synthesized sgRNA oligo with deionized water to 100 limol/L in a reaction system (10 p.L): positive strand oligo lIAL, reverse strand oligo 1 p1, deionized water 8 1AL.The annealing program of thermal cycler was set as follows: incubate at 37 C for 30 min; incubate at 95 C for 5 min, and then gradually reduce the temperature to 25 C at a rate of 5 C/min.After annealing, the oligo was diluted by 250 volume using deionized water.pX459 plasmid was linearized with BbsIrestriction endonuclease, the annealed product was ligated, and transformed into competent DH5a, a single colony was picked into a shaker tube, incubated at 37 C for 12-16 h, 1 mL aliquot of bacterial solution was sent for sequencing. After sequencing verification, the bacterial solution was freezed and extracted for preparing the plasmid pX459-IGF2, pX459-TNNI2 and pX459- TNNT3. These plasmids were used for transfection in the following experiment.
2. Cell transfection:
Thawing and culturing the pig primary fibroblast cell, removal of the culture medium and added preheated PBS for washingbefore transfection, then removed PBS and added 2m1 of 37 C prewarmed trypsin solution.Digesting for 3 minutes in room temperature before terminating digestion. Suspending the cells in nucleofection solution, and diluting the volume to 106/100W, adding plasmid to 51Ag/100111 final concentration, performing electro-transformation with optimized program on the electroporator, adding 5001A1 of preheated culture medium, and culturing the cell in a concentration of 20% FBS
DMEM
medium, at 37 C, with 5% carbon dioxide, and saturated humidity.
3. cell screening and test:
When the cells reached 100% cell density, cells were lysed with NP40 buffer.
Genomic DNA was extracted, and the target regions were amplified by PCR.
The result is shown in Figure 49, using the primer pair (T2-F2:
tgggggaggccatttatatc/IGF2-R2:acagctcgccactcatcc), the fusion events of the promoter and the IGF2 gene was successfully detected.
As showed in the Figure 50, using the primer pair (TNNT3-R:CCCCAAGATGCTGTGCTTAG/IGF2-F:CTTGGGCACACAAAATAGCC), the fusion events of the IGF2 promoter and the TNNT3 gene were successfully detected. As affected by repeated sequences, efforts are still taken to detect the fusion events of the TNNT3 promoter and the IGF2 gene.
The invention fused the pig TNNI2 promoter with the IGF2protein coding region in vivo through the inversion editing events of the chromosome segment, which forms a new IGF2 gene with continuously high expression. These editing events created new fast-growing pig cell lines. This example shows that the method of the present invention can be used to create new genes in mammalianorganisms.
Examp1e26: Chicken IGF1 expression Knock-up IGF1 (insulin like growth factor 1) is closely related to the growth and development of chickens. MYBPC1 (myosin binding protein C) is a highly expressed gene downstream of IGF1. A new gene with the MYBPC1 promoter driving IGF1coding sequence was created through genome editing using a dual-target editing vector.
The experiment procedure was as follows:
1. CRISPR/Cas9 target site selection and targeted cutting vector construction:
Using the CRISPR target online design tool (http://crispr.mit.edu/), 20 bp sgRNA
oligonucleotide sequences were designed in the 5'UTR regions of chicken IGF1 gene and MYBPC1 gene respectively. sgRNA oligoes were synthesized by BGI. Diluting the synthesized sgRNA oligoes with deionized water to 100 pmol/L in a reaction system (10 [LL): positive strand oligo 1 vL, reverse strand oligo 1 iL, deionized water 8 A; the annealing program of thermal cycler was set as follows : incubate at 37 C for 30 min;
Incubate at 95 C for 5 min, and then gradually reduce the temperature to 25 C at a rate of 5 C/min; after annealing, the oligo was diluted by 250 volumes of deionized water. pX459 plasmid was linearized with BbsI restriction endonuclease, the annealed product was ligated, and transformed into competent DH5a, a single colony was picked into a shaker tube, incubated at 37 C for 12-16 h, aliquot 1 mL of bacterial solution was sent for sequencing .
After sequencing verification, the bacterial solution was freezed and extracted for preparing the plasmid pX459-IGF1 and pX459-MYBPC1, Those dual-target editing plasmids were used for transfection of chicken DF-1 cells.
2. Cell culture and Passage of DF-1 cells:
DF-1 (Douglas Foster-1) cell is chicken embryo fibroblast cell with vigorously proliferation ability, so DF-1 is the most popular cell line for in vitro study. DF-1 cells were thawed in a 37 C water bath, and then inoculated in a petri dish and placed in a 37 C, 5%
CO2 constant temperature incubator for cell culture. The culture medium is 90%

DMEM/F12+10% FBS. When the cell density reached more than 90%, passaging cell at a ratio of 1:2 or 1:3.
3. DF-1 cell transfection:
O Preparing two 1.5m1 EP tubes and marked them as A tube and B tube respectively.
O Placing 250 1 of Opti-MEM medium, 2.5ps plasmid and 5111 of P3000TM
reagent in tube A.
O Placing 250 1 of Opti-MEM medium and 3.750 of Lipofectaminee 3000 reagent in tube B.
O Transferring the liquid from tube A to tube B with a pipette, and quickly mixing the liquid of tube A and tube B and vortexing for 10 seconds.

OVortexing AB tube mixture (liposome-DNA complex) and incubating at room temperature for 15 minutes.
O Finally, slowly adding liposome-DNA complex to the DF-1 cell dish after the culture medium had been removed with pipette.
4. DF-1 cell screening and test:
CCulturing DF-1/PGCs cells, and the transfection efficiency is best when the confluence reaches 60-70%;
CD After 2 days of transfection, add 1ps/ml puromycin for screening;
CD After 4 days of transfection, replace with the fresh cell culture medium to remove tpuromycin, and continue to culture until the 7th day after transfection to increase the number of cells.
O Collecting the cells and extracting cell DNA with Tiangen's Genomic DNA
Kit according to the operating instructions.
O Designing primers to amplify new gene fragments that are expected to be doubled or inverted.
The invention fused the chicken MYBPC1 promoter with the IGF1CDS region in vivo through the double editing events of the chromosome segment, which forms a new gene with continuously high expression. These editing events created new fast-growing avian cell lines. This example shows that the method of the present invention can be used to create new genes in avian organisms.
Example 27: Induced gene expression through chromosomal segment inversion in yeast FPP is a key precursor of many compounds in yeast. However, it can be degraded by many metabolic pathways in yeast, which affects the final yield of exogenous products such as terpenoids. The synthesis of squalene using FPP as substrate, is the first step of the ergosterol metabolic pathway, which is catalyzed by the squalene synthase encoded by the ERG9 gene. However, direct knockout of ERG9 gene would lead to the inability of yeast cells to grow, so the expression level of squalene synthase could only be regulated specifically, so that it could accumulate intracellular FPP concentration as well asmaintaining its own growth. HXTpromoter is a weakly glucose-responsive promoter, whose expression strength decreases with the decrease of glucose concentration in the external environment, which is consistent with the sugar metabolism process in the fermentation process, so it is an ideal induciblepromoter.
As found in the saccharornyces cerevisiae genome database web site (https://www.yeastgenome.org/), both the HXT1 and ERG9 genes are located at the long arm end of chromosome VIII and are transcribed in the opposite direction, so the endogenous ERG9 gene promoter in yeast can be replaced by the HXT1 promoter, whose expression strength is responsive to glucose concentration, through the inversionediting events of the chromosome segmentit is expected that the specific induction of ERG9 gene expression will achieve the purpose of accumulation of FPP in yeast.
1. Vector design and construction Vector design includes Cas9 vector and gRNA vector, which are constructed into two different backbones. For the Cas9 vector, we used pUC19 backbone, driven by yeast TEF1 promoter, Cas9 sequence is yeast codon-optimized; gRNA vector used pUC57backbone, SNR52 promoter and SUP4 terminator. The sgRNA is designed using an online tool (http://crispor.tefor.net/) and selected the following targets between the promoter and coding regions of the HXT1 and ERG9 genes for testing: ERG9 sgRNA:
GAAAAGAGAGAGGAAG; HXT1 sgRNA: CCCATAATCAATTCCATCTG. Once vectors are completed, they will be mixed together for transformation.
2. Transformation of yeastby electroporation 1) Pickedup better-grown mono-clones from a fresh plate and inoculated it with 5 mL
YPD medium, grew with vigorously shaking 220rpm at 30 Cfor overnight. 2) Transferred to 50 mL YPD medium so that the initial OD660wouldbe about0.2, incubated with vigorously shaking 220rpm at 30 C to make OD660about 1.2. 3) After placing the yeast on ice for 30 min, centrifuged at 5000g for 5min at 4 C to collect the cells. 4) Discarded the supernatant, washedthe cells with pre-cooled sterile water twice, and then centrifuged. 5) Discarded the supernatant, washed the cells three times with pre-cooled 1 mol/L sorbitol solution.6) Centrifuged to collect the cells, washed the cells three times with pre-cooled 200 pH_ mol/L
sorbitol solution. 7) Added 20pL (about 5pg) plasmids or DNA fragments to the cell suspension, gently mixedand incubated at ice for 10 min. 8) Transferred the mix into a pre-cooled cup,shocked 5ms with 1500V. 9) Re-suspended the cells in the cup with 1 mL
YPD medium and incubated at 30 Cwithvortexfor 1-2 hours. 10) Washed the recoveredcells with sterile water, and finally re-suspended with lmL sterile water, took 100pLon the corresponding plate. 11) Incubated at 30 C thermostatic incubator for 3-5 days to select the transformers.
3. Extraction of yeast genome DNA
1) Took 5 ml overnight cultured medium, centrifuged to collect cells, after washedwith lmL PBS twice, centrifugedto collect cells at maximum speed for lmin; 2) Added 500pL
sorbitol buffer to re-suspend the cells and then added 50U Lyticase, incubated at 37 C for 4h; 3) Centrifuged at 12000rpm for lmin to collect cells; 4) Added 5004 yeast genomic DNA extraction buffer and re-suspended, added 50pL 10%SDS, and placed immediately at 65 C water bath for 30min; 5) Added 2004 5M KAc (pH8.9), and incubated at ice for lh; 6) Centrifuged at 12000rpm for 5minat 4 C, and transferred supernatant to a new EP tube; 7) Added isopropyl alcohol of equal volume, centrifuged at 12000rpm for 10s; 8) discarded the supernatant and added 500[LL 75% ethanol to wash DNA, centrifuged at 12000rpm for lmin;
9) After precipitation, added 501AL TE buffer to dissolve; 10) Took 31..LL DNA
for electrophoresis test, the remaining was reserved in -20 C refrigerator.
4. Detection of inverted events PCR detection of transformed yeast cells using the following primers: HXT1pro-detF:
TGCTGCGACATGATGATGGCTTT and ERG9cds-detR:TCGTGGAGAGTGACGACAAGT, respectively. The length of PCR
product was expected to be 616bp.
The invention replaces the yeast ERG9 gene promoter with the HXT1 promoter in vivo through the inversion editing event of the chromosome fragment between the target sites, which forms a new ERG9 gene regulated by glucose concentration. This example shows that the method of the present invention can be used to create new genes in fungal organisms.
Example 28: Knock-up expression of EPO gene in 293T cell line EPO (erythropoietin), is an important cytokine in human, PSMC2 (proteasome 26S

subunit ATPase 2) is a regulated subunit of 26S protease complex, ubiquitously expressed in cells. By designing a dual-target editing vector to identify and screen new EPO gene which would driven by PSMC2 promoter in 293T cell lines.
1. Target design and editing vector construction of CRISPR/Cas9 Using target design online tools of CRISPR (http://crispr.mit.edu/), sequence of 20 bp sgRNA oligos was designed in the 5'UTR region of the human EPO gene and PSMC2 gene, respectively. Oligos were synthesized by BGI Company(Qingdao, China. Diluted the synthetic sgRNA oligo to 100 [tmol/L with deionized water. Reaction system (10 !IL):
forword oligo 1[11, reverse oligo 1jtl, deionized water 8pL; annealing program used for PCR:
incubated 30 min at 37 C, incubated 5 min at 95 C, then gradually cool down to 25 C at 5 C/min;
diluted the oligo 250 times after annealing. The pX459 plasmid wasfirstly linearized with BbsI
restriction enzyme, and then the annealing product wasadded, ligated product was transformed into DH5a competent cells. Single clones wereselected into the centrifugal tube, incubated with shaking at 37 C 12 to 16 hours, and then dividedinto 1 mL for sequencing. After sequence confirmation, plasmidswere extracted. Preparation of the plasmid pX459-EPO and pX459-PSMC2 for transfection.
2. Resuscitation of 293T cell: removed the frozen tube from liquid nitrogen or refrigerator container, immersed directly into warm water bath at 37 C, and shook it at interval to melt it as soon as possible; removed the frozen tube from the water bath at 37 C, opened the lid in the ultra-clean table, and sucked out the cell suspension with the tips (3 ml of cell complete media has been pre-added in the centrifugal tube), flicked and mixed;
centrifugedat 1000 rpm for min; discarded the supernatant, re-suspendedcells gently, added10% FBS cell media, re-suspended cells gently, adjusted cell density, inoculated atpetri dishes, and incubated at 37 C.
Replaced the cell media once the next day.
3. Transferrd steps: removed cell petri dish (60mm) from the carbon dioxide incubator, sucked out the medium in the bottle at the ultra-clean workbench, added2m1 1 >< PBS solution, gently rotated the petri dish to clean the cells, discardedthe lx PBS
solution; added trypsin 0.5 ml and incubated for 3-5 minutes; during the incubation, observed the digested cells under an inverted microscope, and if the cells become round and no longer connected to each other, immediately added 2vo1ume complete medium (containing serum) in the ultra-clean workbench, added 1 mL of complete medium, blew and kept the cell suspended; the cell suspension was sucked out and placed in a 15 ml centrifugal tube, centrifuged at 1000 rpm for 5 min; discarded the digestive fluid and tapped the bottom of the centrifugal tube to make the cells re-suspended;
added 2.5 ml complete medium into two new 60mm petri dishes, the original digestive dish also added 2.5 ml of complete medium, and marked it; dropped the cell suspension in the centrifugal tube into three petri dishes at 0.5 ml/dish, blew cells with tips several times, and incubated in a carbon dioxide incubator.
4. Trypsin digested the cells and counted in a 100mm petri dish, making them 60%-70%
denser on the day of transfection. Added plasmid DNA with a maximum capacity of 24.01..ig into cell petri dish with a bottom area of 100 mm, diluted with 1.5 mL serum-free medium, mixed and incubated at 5 min at room temperature.
5. Cell transfection: (1) Diluted 80111 LIPOFECTAMINE 2000 reagent with a 1.5m1 serum-free medium, and mixed diluted DNA within 5 minutes. (2) Mixed diluted plasmid DNA
with diluted LIPOFECTAMINE 2000, incubatedat room temperature for 20 minutes.
(3) The above mixture was then added evenly to the cells. (4) Kept warm for 6 hours at 37 C, 5%
CO2,100% saturated humidity, and added 12 ml of fresh DMEM culture with 10%
FBS to each petri dish. After 24 hours, replaced the old medium with a fresh DMEM medium containing 10%
FBS and keep incubating.
6. After 48 hours of transfection, centrifuged to collect cells. DNA from 293T
cells was extracted using Tiangen's TIAN amp Genomic DNA Kit The primers were also designed for PCR amplification of the target region.
Example 29: Creation of new genes with different expression patterns by translocation of gene promoter or coding region fragment A dual-target combination was designed for cutting off the promoter region of 0sUbi2 gene at chromosome 2, wherein target 1 was just before the 0sUbi2 initiation codon and target 2 was at the upstream of the 0sUbi2 promoter. Third target (Target 3) was designed to cut between the promoter and the initiation codon of 0sPP02 gene at chromosome 4.The sgRNA sequences designed for the three targets were as following:
Target 1:0sUbi2pro-7NGGsgRNA: 5' gaaataatcaccaaacagat3 ' Target 2:0sUbi2pro-1960NGGsgRNA:5'atggatatggtactatacta3' Target 3:0sPP02cds-6NGGsgRNA:5'ttggggctcttggatagcta3', As shown in Figure 54, new gene cassette, which is 0sUbi2 promoter driving 0sPP02 gene, is created as a result of designed translocation.The translocation of 0sUbi2 promoter resulted in the combination of the OsUbi2 promoter and the OsPPO2 coding region, which is a new gene or new gene expression cassette, ie. OsUbi2 promoterdrives OsPPO2 expression. The calli or plantlets derived from the calli harboring such expected new gene may be obtained through PCR screening and genotyping.
The designed sgRNA sequences were ordered from GenScript Biotechnology Company (Nanjing, China). These sgRNAs were respectively assembled with SpCas9 forming RNP
complexes, and three RNP complexes were mixed together in equal ratio. The mixture was subjected to biolistic transformation of rice calli (see W02021088601A1 for specific experimental procedures).
The transformed calli were cultivated for 2 weeks and then sampled by using the following primer pair to test:
OsUBi2pro-1648F: 5'ggaatatgtttgctgtttgatccg3' OsPPO2-gDNA-236R: 5' cagaactgaacccacggagag3 ' PCR detection was preformed to detect whether new genes, which are OsUbi2 promoter driving OsPPO2, were generated. The translocation positive calli continued to be cultivated for 2 weeks, then followed by another round of PCR detection. After 3 rounds of detection, the positive calli were differentiated into seedlings, which were also sampled for PCR detection. The positive TO seedlings were sequenced to identify the specific genotypes.
A total of four different genotypes with OsUbi2 promoter driving OsPPO2 were obtained:
QY378-16: Ubi2pro+PP02-CDS
5'CCCCCCTTTGGAATATGTTTGCTGTTTGATCCGTTGTTGTGTCCTTAATCTTG
TGCTAGTTCTTACCCTATCTCCAAGAGCCCCAAATCAGATGCTCTCTCCTGCCACC
ACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTCGCGCTCC
CACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCCGCCCCGCGCGC
GCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGCCGTCGTCGGCG
CCGGCGTCAGT3' QY378-18:Ubi2pro+PP02-CDS
5'AATTGGAATATGTTTGCTGTTTGATCCGTTGTTGTGTCCTTAATCTTGTGTTG
TGTCCTTAATCCAAGAGCCCCAAATCAGATGCTCTCTCCTGCCACCACCTTCTCCT
CCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTCGCGCTCCCACCCGCTTC
GCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCCGCCCCGCGCGCGCCATGGCCG
CCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGCCGTCGTCGGCGCCGGCGTCAG
TGG3' QY378-41:Ubi2pro+PP02-CDS
5'ATCTGTGCTAGTTCTTaCCCTATCTCCAGAGCCCCAAATCAGATGCTCTCTCC
TGCCACCACCTTcTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCACGCTCG
CGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCCGCCCC

GCGCGCGCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGCCGTCG
TCGGCGCCGGCGTCAGGTGG3' QY378-374: Ubi2pro+PP02-CDS
5'GGTGGTCTATCTTGTGTTGTGTCCTTATCCAGAGCCCCAAATCAGATGCTCT
CTCCTGCCACCACCTTCTCCTCCTCCTCCTCCTCCTCGTCGCCGTCGCGCGCCCAC
GCTCGCGCTCCCACCCGCTTCGCGGTCGCAGCATCCGCGCGCGCCGCACGGTTCC
GCCCCGCGCGCGCCATGGCCGCCTCCGACGACCCCCGCGGCGGGAGGTCCGTCGC
CGTCGTCGGCGCCGGCGTCAGGTG3' The Ti generation seedlings were harvested from TO plants, then tested using PCR.
The results confirmed that the above genotypes could be inherited stably. The Ti generation of QY378-16 were selected and treated with compound A by foliar spray. As shown in Figure 55, it showed significantly improved resistance to PPO-inhibiting herbicide Compound A. The wild-type rice was killed at the rate of 2 g a.i./mu, while the Ti generation of QY378-16 bearing Ubi2pro+PP02-CDS genotype could survive a rate of 4 g a.i./mu, showing that the new PPO2 gene improved plant tolerance to Compound A.
By referring to this technical route, different target combinations were designed for OsUBi2, OsPPO2 and OsPPO1 using SpCas9 protein as the editing agent:
1. 0 sUbi2pro-196ONGGsgRNA: 5' atggatatggtactatacta3' 2. 0sUbi2pro-7NGGsgRNA:5'atattgtgaagacattgac3' 3. 0sPPO2cds-6NGGsgRNA:5'ttggggctcttggatagcta3' 4. 0sPP02cds-14NGGsgRNA:5'gcaggagagagcatctgatt3' 5. 0 sPP Olcds-4NGGsgRNA: 5' ccatgtccgtcgctgacgag3' The combination of sgRNA 1+2+3 and sgRNA 1+2+4 with Cas9 protein was subjected to RNP transformation, new heritable genes with Ubi2pro+PP02-CDS were identified after PCR screen selection. Similarly, the combination of sgRNA 1+2+5 with Cas9 protein was also subjected to RNP transformation, new heritable genes with Ubi2 promoter driving PP01-CDS were also obtained.
Using MAD7 protein as the editing agent:
1. 0 sUbi2pro-1896MAD7crRNA:5 ' gttggaggtcaaaataacagg3' 2. 0 sUbi2pro-14MAD7crRNA:5 ' tgaagacattgaccggcaaga3 ' 3. 0 sUbi2pro-17MAD7crRNA:5 ' gtgattatttcttgcagatgc3' 4. 0sPP02cds-9MAD7crRNA:5'gggctcttggatagctatgga3' 5. 0sPP01cds-125MAD7crRNA:5'ccattccggtgggccattccg3' The combination of crRNA 1+2+4 and crRNA 1+3+4 with MAD7 protein was subjected to RNP transformation, new heritable genes with Ubi2pro+PP02-CDS were identified after PCR screen selection. Similarly, the combination of crRNA 1+2+5 and crRNA
1+3+5 added with MAD7 protein was subjected to RNP transformation, new heritable genes with Ubi2 promoter driving PP01-CDS were also obtained.
In these examples, a new gene with different expression pattern was generated by inserting a translocated promoter upstream of the coding region of another gene. Likewisely, following the same technique idea, a new gene with different expression pattern could also be generated by inserting a translocated gene coding region into the downstream region of another promoter, which is covered by the technical solution scope of the present application.
All publications and patent applications mentioned in the description are incorporated herein by reference, as if each publication or patent application is individually and specifically incorporated herein by reference.
Although the foregoing invention has been described in more detail by way of examples and embodiments for clear understanding, it is obvious that certain changes and modifications can be implemented within the scope of the appended claims, such changes and modifications are all within the scope of the present invention.

Claims

What is claimed is:

1. A method for creating a new gene in an organism, characterized by comprising the following steps:
simultaneously generating DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are genomic sites capable of separating different genetic elements or different protein domains, and the DNA breaks are ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination of the different genetic elements or different protein domains different from the original genomic sequence, thereby creating the new gene; or a method for in vivo creation of new genes that can be stably inherited in an organism, characterized by comprising the following steps:
(1) simultaneously generating double-stranded DNA breaks at two or more different specific sites in the organism's genome, wherein the specific sites are capable of separating different gene elements or different protein domains, and the DNA breaks are then ligated to each other by a non-homologous end joining (NHEJ) or homologous repair, generating a new combination or assemble of the different gene elements or different protein domains derived from the original genomic sequence, thereby the new gene is generated;
preferably, it also includes (2) designing primer pairs that can specifically detect the above-mentioned new combination or assemble, then cells or tissues containing the new genes can be screened out by PCR test, and the characteristic sequences of new combinations of gene elements can be determined by sequencing; and (3) cultivating the above-screened cells or tissues to obtain TO generation organisms, and perform PCR tests and sequencing on the organisms for two consecutive generations including the TO generation and its bred T1 or at least three consecutive generations to select the organisms containing the above-mentioned characteristic sequence of new combination of gene elements, namely, a new gene that can be stably inherited has been created in the organism;
optionally, it also includes (4) testing the biological traits or phenotypes related to the function of the new gene, to determine the genotype that can bring beneficial traits to the organism, and to obtain a new functional gene that can be stably inherited.

2. The method according to claim 1, wherein in the step (1), DNA breaks are simultaneously generated at two different specific sites in the genome of the organism, wherein one site is the genomic locus between the promoter region and the coding region of a gene, meanwhile, the other site is between the promoter region and the coding region of another gene with different expression patterns, resulting in a new combination of the promoter of one gene and the coding region of the other gene that has a different expression pattern; preferably, a combination of the strong promoter and the gene of interest is eventually produced.

3. The method according to claim 1, wherein in the step (1), DNA breaks are simultaneously generated at three different specific sites in the genome of the organism, the three specific sites include two genomic sites whose combination capable of cutting off the promoter region of a highly expressed gene and the third genomic site between the coding region and the promoter region of the gene of interest that has a different expression pattern;
or a genomic site between the promoter region and the coding region of a highly expressed gene and another two genomic sites whose combination capable of cutting off the coding region fragment of the gene of interest that has a different expression pattern; then through gene editing at the above-mentioned sites, translocation editing events can be generated, in which the strong promoter fragment that is inserted upstream of the coding region of the gene of interest, or the coding region fragment of the gene of interest is inserted the downstream of the promoter of another highly expressed gene, finally, the combination of the promoter of one gene and the coding region of the other gene of interest with different expression patterns is generated.

4. The method according to any one of claims 1-3, characterized in that said two or more different specific sites locate on the same chromosome or on different chromosomes; preferably, said two or more different specific sites may be specific sites on at least two different genes, or may be at least two different specific sites on the same gene; and said at least two different genes may have the same or different transcription directions

5. The method according to any one of claims 1-4, characterized in that said gene elements are selected from the group consisting of a promoter, a 5' untranslated region, a coding region or non-coding RNA region, a 3' untranslated region, a terminator of the gene, or any combination thereof.

6. The method according to any one of claims 1-5, characterized in that the combination of different gene elements is a combination of the promoter of one of the two genes with different expression patterns and the coding region or the non-coding RNA region of the other gene, or the combination of different gene elements is a combination of the region from the promoter to 5'UTR of one of the two genes with different expression patterns and the CDS
or non-coding RNA region of the other gene, or the combination of different gene elements is a combination of adjacent gene elements of the same gene; preferably, the different expression patterns are different levels of gene expression, different tissue-specific of gene expression, or different developmental stage-specificities of gene expression.

7. The method according to any one of claims 1-4, characterized in that the protein domain is a DNA fragment corresponding to a specific functional domain of a protein, preferably including but not being limited to a nuclear localization signal, a chloroplast leading peptide, a mitochondrial leading peptide, a phosphorylation site, a methylation site, a transmembrane domain, a DNA binding domain, a transcription activation domain, a receptor activation domain, or an enzyme catalytic center.

8. The method according to any one of claims 1-4 and 7, characterized in that the combination of different protein domains is a combination of the localization signal region of one of two proteins with different subcellular localizations and the mature protein coding region of the other gene, or a combination of two protein domains with different biological functions, or a combination of adjacent protein domains of the same gene; preferably, the different subcellular locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, mitochondrial location, and endoplasmic reticulum membrane location; preferably, the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to a protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof

9. The method according to any one of claims 1-5 and 7, characterized in that the combination of gene elements and protein domains are a combination of protein domains and adjacent promoters, 5'UTR, 3'UTR or terminators of the same gene.

10. The method according to any one of claims 1-9, characterized in that the organism is a non-human animal, a plant or a fungus.

11. The method according to claim 1, characterized in that the combination of different gene elements is selected from any of the following:
(1) one element is a plant endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclase gene coding region of the same plant;
(2) one element is an endogenous strong promoter or the region from a strong promoter to 5'UTR of the organism, and the other is a gene coding region of any one of the P450 family in the same organism, (3) one element is a rice or maize endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is a gene coding region of OsCYP81A gene or ZmCYP81A9 gene in the same organism;
(4) one element is a maize endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the coding region of maize gene ZIVIM28(Zm00001d022088), ZmKNR6 or ZmBAM1d;
(5) one element is a rice endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the coding region of rice gene COLD1 or OsCPK24;
(6) one element is an endogenous strong promoter or the region from a strong promoter to 5'UTR of the organism, and the other is a gene coding region of any one of the ATP-binding cassette (ABC) transporter family in the same organism, (7) one element is a plant endogenous strong promoter or the region from a strong promoter to 5'UTR of the plant, and the other is a gene coding region of any one of the NAC transcription factor family (for example, OsNAC045, OsNAC67, ZmSNAC1, OsNAC006, OsNAC42, OsSNAC1 or Os SNAC2) in the same plant;
(8) one element is a plant endogenous strong promoter or the region from a strong promoter to 5'UTR, and the other is the gene coding region of any one of MYB, MADS, DREB and bZIP
transcription factor family in the same plant;
(9) one element is the promoter of any one of overexpression or tissue-specific expression rice genes listed in Table A, and the other is the protein coding region or the non-coding RNA
region of another gene that is different from the selected promoter corresponding to the rice gene;
(10) one element is a protein coding region or non-coding RNA region selected from any one of the biological functional genes listed in Table B to K, and the other is the promoter region of another gene that is different from the selected functional gene of the biological genome corresponding to the selected gene;
(11) one element is an endogenous strong promoter or the region from a strong promoter to 5'UTR of the organism, and the other is a gene coding region of any one of the GST
(glutathione-s-transferases) family in the same organism;
(12) one element is a wheat or maize endogenous strong promoter or the region from a strong promoter to 5'UTR of the organism, and the other is a gene coding region of wheat GST
C1a47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat GST28E45 (AY479764.1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene in the same organism;
(13) one element is an rice endogenous strong promoter or the region from a strong promoter to 5'UTR of the organism, and the other is the coding region of any one of gene protein in rice GIF1 (0s04g0413500), NOG1 (0s01g075220), LAIR (0s02g0154100), OSA1 (0s03g0689300), OsNRT1.1A (0s080155400), OsNRT2.3B (0s01g0704100), OsRacl (0 sO1g0229400), OsNRT2.1 (0s02g0112100), OsGIF 1 (0s03g0733600), OsNAC9 (0s03g0815100), CPB1/D11/GNS4 (0s04g0469800), miR1432 (0s04g0436100), OsNLP4 (0s09g0549450), RAG2 (0s07g0214300), LRK1 (0s02g0154200), OsNHX1 (0s07t0666900), GW6 (0s06g0623700), WG7 (0s07g0669800), D11/0sBZR1 (0s04g0469800, 0s07g0580500), OsAAP6 (0s07g0134000), OsLSK1 (0s01g0669100), IPA1 (0s08g0509600), SMG11 (0 sOlg0197100), CYP72A31 (0s01g0602200), SNAC1 (0s03g0815100), ZBED
(0s01g0547200), OsSta2 (0s02g0655200), OsASR5 (0s11g0167800), OsCPK4 (0s02g03410), OsDjA9 (0s06g0116800), EUI (0s05g0482400), JMJ705 (0s01g67970), WRKY45 (0 sO5t0322900), OsRSR1 (0s05g0121600), OsRLCK5 (0s01g0114100), APIP4 (0s01g0124200), OsPAL6 (0s04t0518400), OsPAL8 (0s11g0708900), TPS46 (0s08t0168000), OsERF3 (0s01g58420) and OsYSL15 (0s02g0650300);
(14) one element is a fish endogenous strong promoter, and the other is a gene coding region of GH1 (growth hormone 1) in the selected fish.

12. A new gene created by the method according to claim 11, characterized in that the new genes formed by any one of the combinations of the different gene elements (1)-(14) respectively have the following characters:
(1) the level of the new gene expression is up-regulated relative to the plant endogenous wild-type HPPD, EPSPS, PPO, ALS, ACCase, GS, PDS, DHPS, DXPS, HST, SPS, cellulose synthesis, VLCFAS, fatty acid thioesterase, serine threonine protein phosphatase or lycopene cyclasegenes gene;

(2) the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type P450 gene of the organism;
(3) the level of the new gene expression is up-regulated relative to the rice endogenous OsCYP81A6 gene or corn endogenous ZmCYP81A9 gene, respectively;
(4) the level of the new gene expression is up-regulated relative to the plant endogenous wild-type ZMM28 gene, ZmKNR6 gene or ZmBA1\41d gene, respectively;
(5) the level of the new gene expression is up-regulated relative to the rice endogenous wild-type COLD1 gene or OsCPK24, respectively;
(6) the level of the new gene expression is up-regulated relative to the corresponding endogenous wild-type ATP-binding cassette (ABC) transporter gene of the organism;
(7) the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type NAC transcription factor family gene;
(8) the level of the new gene expression is up-regulated relative to the corresponding plant endogenous wild-type MYB transcription factor gene, MADS transcription factor family gene, DREB transcription factor family gene coding region or bZIP transcription factor family gene, respectively;
(9) the expression pattern of the new gene is changed relative to the selected protein coding region or the non-coding RNA region of the rice endogenous gene;
(10) the expression pattern of the new gene is changed relative to the selected functional gene;
(11) the level of the new gene expression is up-regulated relative to the corresponding endogenous GST (glutathione-s-transferases) family gene of the organism;
(12) the level of the new gene expression is up-regulated relative to the endogenous wheat GST C1a47 (AY064480.1) gene, wheat GST 19E50 (AY064481.1), wheat G5T28E45 (AY479764 1), maize ZmGSTIV, maize ZmGST6, maize ZmGST31, maize GSTI, maize GSTIII, maize GSTIV, maize GST5 or maize GST7 gene, respectively;
(13) the level of the new gene expression is up-regulated relative to the corresponding endogenous gene;
(14) the new gene is a fish endogenous high expression GH1 gene.

13. Use of the new gene obtainable by the method according to any one of claims 1-11 in the field of animal and plant breeding.

14. Use of the new gene according to claim 12 in the following aspects, respectively:
(1) in the improvement of the resistance or tolerance to a corresponding inhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of DHPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicide in a plant cell, a plant tissue, a plant part or a plant;

(2) in enhancing biological detoxification capability, stress tolerance or secondary metabolic ability;
(3) in the improvement of the resistance or tolerance of rice or corn to a herbicide;
(4) in the improvement of maize yield;
(5) in the improvement of cold tolerance in rice;
(6) in enhancing biological detoxification capability or stress tolerance;
(7) in enhancing plant stress tolerance or plant yield;
(8) in enhancing plant stress tolerance or regulating plant growth and development;
(9) in regulating the growth and development of rice;
(10) in regulating the growth and development of organism;
(11) in enhancing biological detoxification capability or stress tolerance;
(12) in the improvement of the resistance or tolerance of wheat or maize to a herbicide;
(13) in rice breeding;
(14) in fish breeding.

15. The method according to claim 1, characterized in that the combination of different protein domains is selected from any of the following:
(a) one element is a wheat endogenous protein chloroplast localization signal domain, and the other is a wheat mature protein coding region of cytoplasmic localization phosphoglucose isomerase (PGIc);
(b) one element is a rice protein chloroplast localization signal domain (CTP), and the other is the mature protein coding region of OsGL03, 0s0X03 or OsCATC.

16. A new gene created by the method according to claim 15, characterized in that the new genes formed by any one of the combinations of the different protein domains (a)-(b) respectively have the following characters:
(a) the new gene locates the phosphoglucose isomerase gene relative to the coding cytoplasm and its mature protein is located in the chloroplast.
(b) the mature protein of the new gene is located in chloroplast different from OsGL03, 0s0X03 or OsCATC.

17. Use of the new gene according to claim 16 in the following aspects, respectively:
(a) in the improvement of wheat yield;
(b) in improving the photosynthetic efficiency of rice.

18. A chloroplast localized protein OsCACT, the nucleotide encoding the protein has a sequence selected from the group consisting of:
(1)the nucleic acid sequence as shown in SEQ ID NO: 28 or a portion thereof or a complementary sequence thereof;
(2)a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

19. A chloroplast localized protein OsGL03, the nucleotide encoding the protein has a sequence selected from the group consisting of:
(1)the nucleic acid sequence as shown in SEQ ID NO: 29 or a portion thereof or a complementary sequence thereof;
(2)a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

20. Use of the protein according to claim 18 or 19 inimproving the photosynthetic efficiency of rice.

21. An editing method for regulating the gene expression level of a target endogenous gene in an organism, which is independent of an exogenous DNA donor fragment, which comprises the following steps:
simultaneously generating DNA breaks separately at selected sites between the promoter and the coding region of each of the target endogenous gene and an optional endogenous inducible or tissue-specific expression gene with a desired expression pattern;
ligating the DNA breaks to each other by means of non-homologous end joining (NHEJ) or homologous repair, thereby generating an in vivo fusion of the coding region of the target endogenous gene and the optional inducible or tissue-specific expression promoter to form a new gene with expected expression patterns, the target endogenous gene and the optional endogenous inducible or tissue-specific expression gene with a desired expression pattern are located on the same chromosome or on different chromosomes; preferably, the target endogenous gene is yeast ERG9 gene, the endogenous inducible expression gene is HXT1 gene, and the inducible expression promoter is HXT1 in response to glucose concentration.

22. A yeast endogenous inducible ERG9 gene obtainable by the editing method according to claim 21.

23. Use of the yeast endogenous inducible ERG9 gene in synthetic biology according to claim 22.

24. A highly-expressing rice endogenous HPPD gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 27 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1); or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

25. A highly-expressing rice endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID

NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO:

37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 or SEQ ID NO: 47 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

26. A highly-expressing maize endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 48 or SEQ ID NO: 49 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

27. A highly-expressing wheat endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 50, SEQ ID NO: 5, SEQ ID
NO:
52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 or SEQ ID NO: 56 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

28. A highly-expressing oilseed rape endogenous PPO2 gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown in SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID

NO: 59, SEQ ID NO: 60 or SEQ ID NO: 61 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

29. Use of the gene according to any one of claims 24-28 in the improvement of the resistance or tolerance to a corresponding inhibitory herbicide in a plant cell, a plant tissue, a plant part or a plant.

30. A plant or a progeny derived therefrom regenerated from the plant cell which comprises the gene (1) (3) or (12) described in claim 12 or according to any one of claims 24-28.

31 A method for producing a plant with an increased resistance or tolerance to an herbicide, which comprises regenerating the plant cell which comprises the gene (1) (3) or (12) described in claim 12 or according to any one of claims 24-28 into a plant or a progeny derived therefrom;
preferably, the plant with an increased resistance or tolerance to an herbicide is a non-transgenic strain obtainable by crossing a plant regenerated from the plant host cell with a wild-type plant to remove the exogenous transgenic components through genetic segregation.

32. A rice resistant to a herbicide, which comprises one or a combination of two or more of the rice new gene (3) described in claim 12, the highly-expressing rice endogenous HPPD gene according to claim 24, and the highly-expressing rice PPO2 gene according to claim 25;
preferably the rice is non-transgenic.

33. A maize, wheat or oilseed rape resistant to a herbicide, which comprises one or a combination of two or more of the maize new gene (3) described in claim 12, the wheat or maize new gene (12) described in claim 12, the highly-expressing maize PPO2 gene according to claim 26, the highly-expressing wheat PPO2 gene according to claim 27, and the highly-expressing oilseed rape PPO2 gene according to claim 28; preferably the maize, wheat or oilseed rape is non-transgenic.

34. A method for controlling a weed in a cultivation site of a plant, wherein the plant is selected from the group consisting of a plant prepared by the method according to claim 31, wherein the method comprises applying to the cultivation site one or more corresponding inhibitory herbicides in an amount for effectively controlling the weed.

35. The use according to claim 14 or 29, the method according to claim 31 or 34, characterized in that the herbicide comprises one or a combination of two or more ofinhibition of HPPD, inhibition of EPSPS, inhibition of PPO, inhibition of ALS, inhibition of ACCase, inhibition of GS, inhibition of PDS, inhibition of MIPS, inhibition of DXPS, inhibition of HST, inhibition of SPS, inhibition of cellulose synthesis, inhibition of VLCFAS, inhibition of fatty acid thioesterase, inhibition of serine threonine protein phosphatase or inhibition of lycopene cyclase herbicides.

36. An editing method for knocking up the expression of an endogenous WAK gene or CNGC gene in a plant, characterized in that it comprises fusing the coding region of the WAK gene or CNGC gene with a strong endogenous promoter of a plant in vivo to form a new highly-expressing plant endogenous WAK gene or CNGC gene, respectively;
preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the WAK
gene or CNGC
gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the WAK gene or CNGC gene and the optional strong endogenous promoter to form a new highly-expressing WAK gene or CNGC gene.

37. A highly-expressing plant endogenous WAK gene or CNGC gene obtainable by the editing method according to claim 36.

38. A highly-expressing rice WAK gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown inSEQ ID NO: 62, SEQ ID NO: 63, SEQ ID
NO:
64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67 or SEQ ID NO: 68 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

39. A highly-expressing rice CNGC gene, which has a sequence selected from the group consisting of:
(1) the nucleic acid sequence as shown inSEQ ID NO: 69, SEQ ID NO: 70, SEQ ID
NO:
71 or SEQ ID NO: 72 or a portion thereof or a complementary sequence thereof;
(2) a sequence having an identity of at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% to any one of the sequences as defined in (1);
or (3) a nucleic acid sequence capable of hybridizing to the sequence as shown in (1) or (2) under a stringent condition.

40. Use of the gene according to claim 38 or 39 in conferring or improving a resistance to rice blast in a rice

41. A rice resistant to rice blast, which comprises one or a combination of two or more of the highly-expressing rice WAK gene according to claim 38, and the highly-expressing rice CNGC gene according to claim 39; preferably the rice is non-transgenic.

42. An editing method for knocking up the expression of an endogenous GH1 gene in a fish, characterized in that it comprises fusing the coding region of the GH1 gene with a strong endogenous promoter of a fish in vivo to form a new highly-expressing fish endogenous GH1 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the GH1 gene and an optional endogenous highly-expressing gene, ligating the DNA
breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the GHlgene and the optional strong endogenous promoter to form a new highly-expressing GH1 gene; the strong promoter is preferably the corresponding fish ColIAla ( Collagen type I alpha la) gene promoter, RP515A (ribosomal protein 515a) gene promoter, Actin promoter or DDX5 [DEAD (Asp-Glu-Ala-Asp) box helicase 5] gene promoter.

43. An editing method for knocking up the expression of an endogenous IGF2(Insu1in-like growth factor 2) gene in a pig, characterized in that it comprises fusing the coding region of the IGF2 gene with a strong endogenous promoter of a pig in vivo to form a new highly-expressing pig endogenous IGF2 gene; preferably, it comprises the following steps:
simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF2 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF2 gene and the optional strong endogenous promoter to form a new highly-expressing IGF2 gene; the strong promoter is preferably one of the pig TNNI2 and TNNT3 gene promoter.

44. An editing method for knocking up the expression of an endogenous IGF1 (Insulin-like growth factor 1) gene in a chicken embryo fibroblast, characterized in that it comprises fusing the coding region of the IGF1 gene with a strong endogenous promoter of a chicken in vivo to form a new highly-expressing chicken endogenous IGF1 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the IGF1 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the IGF1 gene and the optional strong endogenous promoter to form a new highly-expressing IGF1 gene; the strong promoter is preferably chicken MYBPC1 (myosin binding protein C) gene promoter.

45. A highly-expressing fish endogenous GH1 gene, a highly-expressing pig endogenous IGF2 gene or a highly-expressing chicken endogenous IGF1 gene obtainable by the editing method according to claim 42, 43 or 44.

46. Use of the highly-expressing fish endogenous GH1 gene, the highly-expressing pig endogenous IGF2 gene or the highly-expressing chicken endogenous IGF1 gene according to claim 45 in the corresponding biological breeding, respectively.

47. An editing method for knocking up the expression of an endogenous EPO
(Erythropoietin) or p53 gene in an animal cell, characterized in that it comprises fusing the coding region of the EPO or p53 gene with a strong endogenous promoter of an animal in vivo to form a new highly-expressingendogenous EPO or p53 gene; preferably, it comprises the following steps: simultaneously generating DNA breaks respectively in selected specific sites between the promoter and the coding region of each of the EPO or p53 gene and an optional endogenous highly-expressing gene, ligating the DNA breaks to each other through an intracellular repair pathway, generating in vivo a fusion of the coding region of the EPO or p53 gene and the optional strong endogenous promoter to form a new highly-expressing EPO or p53 gene.

48. A highly-expressing animal endogenous EPO or p53 gene obtainable by the editing method according to claim 47.

49. Use of the highly-expressing animal endogenous EPO gene according to claim 48 in animal breeding or the highly-expressing animal endogenous p53 gene according to claim 48 in animal breeding or cancer prevention.

50. The method according to any one of claims 1-11, 21, 36, 42-44 and 47, characterized in that said DNA breaks are achieved by delivering a nuclease with targeting property into a cell of the organism to contact with the specific sites of the genomic DNA;
preferably, said nuclease with targeting property is selected from the group consisting of Meganuclease, Zinc finger nuclease, TALEN, and CRISPR/Cas system (such as Cas9 nuclease system or Cas12 nuclease system); more preferably, the nuclease with targeting property exists in the form of DNA, or in the form of mRNA or protein, but not DNA.

51. The method according to claim 50, characterized in that the nucleases with targeting property are delivered into the cell by: 1) a PEG-mediated cell transfection method; 2) a liposome-mediated cell transfection method; 3) an electric shock transformation method; 4) a microinjection; 5) a gene gun bombardment; 6) an Agrobacterium-mediated transformation method; 7) viral vector-mediated transformation method; or 8) nanomagnetic bead mediated transformation method.

52. A DNA containing the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48.

53. A protein encoded by the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48, or a biologically active fragment thereof

54. A recombinant expression vector, which comprises the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48 and a promoter operably linked thereto.

55. An expression cassette comprising the gene according to any one of claims 12, 16, 22, 24-28, 37-39, 45 and 48.

56. A host cell, which comprises the expression cassette according to claim 55; which is preferably a plant cell, an animal cell or a fungal cell.

57. An organism regenerated from the host cell according to claim 56.

58. A composition, which comprises:
(a) a promoter of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;
(b) a promoter to a 5' untranslated region of one of two genes with different expression patterns and a coding region or non-coding RNA region of the other gene;
(c) a localization signal region of one of the two protein coding genes with different subcellular localizations and a mature protein coding region of the other gene;
(d) DNA regions coding two different functional domains that come from two different functional protein-coding genes; wherein, the combination of gene elements said is not naturally exist, but a joined chromosome segment as designed and stable inheritance;
preferably, which is fused in vivo; more preferably, the different expression patterns are different levels of gene expression, different tissue-specific of gene expression, or different developmental stage-specificities of gene expression; or the different subcellular locations are selected from the group consisting of nuclear location, cytoplasmic location, cell membrane location, chloroplast location, a mitochondrial location, an endoplasmic reticulum membrane location, and any combination thereof; or the different biological functions are selected from the group consisting of recognition of specific DNA or RNA conserved sequence, activation of gene expression, binding to protein ligand, binding to small molecular signal, binding to an ion, specific enzymatic reaction, and any combination thereof.