CN113322257B - Pseudo-ginseng inducible promoter PPO1 and application thereof - Google Patents

Abstract

The invention discloses a pseudo-ginseng inducible promoter PPO1 and application thereof, wherein the nucleotide sequence of the PPO1 is shown as SEQ ID NO:1, the invention confirms that the pseudo-ginseng promoter PPO1 responds to several plant hormones, biotic stress and abiotic stress through the related technical researches of molecular biology and genetic engineering. The expression frame constructed by the pseudo-ginseng inducible promoter PPO1 and the beta-glucosidase gene is transferred into tobacco for expression, the glucuronidase activity of the transgenic tobacco is quantitatively detected by fluorescence, and the result shows that the activity of the glucuronidase of the transgenic tobacco is obviously enhanced after gibberellin, indoleacetic acid, abscisic acid, injury, fusarium solani and alternaria are treated. Therefore, the pseudo-ginseng promoter PPO1 is induced by several hormones, biological and abiotic stress factors, and can be used for plant stress resistance genetic engineering.

Description

Pseudo-ginseng inducible promoter PPO1 and application thereof

Technical Field

The invention relates to the fields of molecular biology and related research of genetic engineering, in particular to a pseudo-ginseng inducible promoter PPO1 and application thereof.

Background

Plant promoters are DNA sequences which bind specifically to RNA polymerase and its transcription factors and determine the initiation of transcription of genes. Promoters are the center of regulation of gene transcription, which acts like a "switch," controlling the start time and extent of gene expression. The promoter composition not only comprises basic action elements such as CAAT-box, TATA-box and the like, but also comprises cis-action elements responding to stress, so that the transcription of genes under different conditions can be regulated and controlled by factors such as environment, exogenous treatment and the like. Plant promoters can be classified in their transcriptional fashion as: constitutive promoters (expression of a gene is not limited by space-time and under the control of exogenous factors), inducible promoters (expression of a gene is induced by exogenous physical and chemical factors, no inducer is present, gene expression levels are low or even absent), and tissue-specific promoters (expression of a gene is distributed in a certain tissue or organ of a plant).

Constitutive promoters, which can drive gene transcription continuously and efficiently at different types of cells and at different stages of cellular development, have relatively constant transcriptional activity, typically the cauliflower mosaic virus (cauliflower mosaic virus, caMV) 35S promoter, and are widely used in dicotyledonous plant transgenic engineering. However, if the target gene is expressed in high intensity in the whole life cycle of the plant, excessive accumulation of the gene product can cause unnecessary waste of resources, and meanwhile, accumulation of a large amount of heterologous proteins can break the original metabolic balance of the plant, prevent normal growth of the plant, and cause metabolic disorder and even death of the plant. To ameliorate this problem, the development and utilization of tissue-specific promoters and inducible promoters has become a hotspot in genetic engineering research.

The inducible promoter is formed in the plant adaptation environment and long-term evolution process, and can respond to special biological, physical and chemical signals so as to improve the transcription level of a specific gene to adapt to a type of promoter with environmental change within a certain range. In the absence of an inducer, it controls the expression of the coding gene either without or with a background. Once the inducer appears in the environment, the expression of the encoding gene increases rapidly, and the regulation of the gene is stopped after the inducer is removed. The inducible promoter is added on the vector to regulate the expression of the target gene in the presence of external stimulus, so that the problem of unlimited expression of the exogenous gene is well solved. The expression of the exogenous gene is controlled by specific physical or chemical signals, so that the expression of the exogenous gene can be controlled more finely (Yang Ruijuan, bai Jianrong, li Rui, chang Lifang. Research on inducible promoters in plant genetic engineering progresses. Shanxi agricultural science, 2018, 46 (02): 292-298).

The inducible promoter has been used in various plants, such as riceOryza sativa) In (a)OsAAA1The gene is a new gene with induction resistance, and can be used for treating rice blastMagnaporthe oryzae) And bacterial leaf blightXanthomonas oryzae pv. oryzae) All have very strong resistance. In order to research the functions and disease resistance mechanism, wang et al construct an inducible promoter vector PPR1b-ADH-OsAAA1, which can obviously reduce the adverse effect on plant agronomic traits caused by the expression of resistance genes, when the induction expression of rice blast bacteria is carried out on positive plants, and the detection is carried out by qPCROsAAA1The result of the change of the gene expression level shows that the inducible promoter fusion vector PPR1b-ADH-OsAAA1 is successfully induced by the Pyricularia oryzae,OsAAA1the expression level of (A) was significantly increased (Wang Z, chen J, wang C, liu X. Genetic transformation and induction expression of promoter structure of rice resistance gene OsAAA1. Mol)ecular Plant Breeding, 2018, 16 (21): 7021-7026). Rhizoma et radix Parthenocissi TricuspidataeErianthus arundinaceus) PR10 promoter obtained by cloning, and transferring into tobacco, rice and sugarcane after being connected with reporter gene GUSSaccharum officinarum). GUS enzyme activity measurement results show that wound stress, methyl jasmonate and abscisic acid treatment induce festuca arundinaceaPR10Expression of the promoter (Chakravarthi M, syamaladevi DP, harunitriya P, augustine SM, subramonian N.A.novel PR10 promoter from)Erianthus arundinaceus directs high constitutive transgene expression and is enhanced upon wounding in heterologous plant systems. Mol Biol Rep, 2016, 43(1): 17-30）。

Disclosure of Invention

The invention aims to provide an inducible promoter PPO1 which is derived from pseudo-ginseng and has a nucleotide sequence shown as SEQ ID NO. 1.

The invention also aims to apply the promoter in genetic engineering, namely, under the condition of biological stress, the promoter is used for inducing expression to regulate and control the specific high-efficiency expression of exogenous genes in transgenic receptor plants.

The invention relates to an inducible promoter fragment which is separated and the expression activity is identified, and the invention clones and obtains the inducible promoter from pseudo-ginseng, and the promoter is 965bp long. The isolated and cloned inducible promoter fragment of the invention is used for replacing the 35s promoter of CaMV on pBI121 vector, and the inducible promoter is used for driving the reporter geneGUSThrough the expression frame of agrobacterium tumefaciens @Agrobacterium tumefaciens) Mediating the transfer of the plant into model plant tobaccoNicotiana tabacum) The expression characteristics of the inducible promoter are revealed through further experiments, a foundation is laid for the later-period utilization of the promoter to regulate and control the efficient and specific expression of the exogenous gene in the transgenic plant, and the inventor names the promoter as PPO1.

The PPO1 promoter in the invention is drivenGUSThe expression cassette of (2) is transferred into tobacco, plant hormone, biotic stress and abiotic stress are adopted to treat transgenic tobacco plants, and fluorescent quantitative analysis of GUS activity is carried out, and the detection result shows that the PPO1 promoter responds to the treatment of several plant hormone, biotic stress and abiotic stressAbscisic acid, indoleacetic acid, gibberellin, injury stress and fusarium solaniFusarium solani) Alternaria alternata (L.) KuntzeAlternaria compacta) Can obviously induce the activity of the promoter PPO1.

The promoter PPO1 can be applied to the induction expression of exogenous genes in genetic engineering, and the specific operation is as follows:

(1) Extracting genome DNA from tender tissue of notoginseng, adopting specific primer for amplifying PPO1, amplifying PPO1 sequence by polymerase chain reaction (polymerase chain reaction, PCR), then connecting it to pGEM-T carrier, and obtaining clone with correct sequence by sequencing;

(2) Cutting pGEM-T-PPO1 vector by restriction enzyme, and recovering the promoter fragment; simultaneously adopting proper restriction enzyme to cut out constitutive expression promoters on plant expression vectors, and obtaining large vector fragments through glue recovery; the obtained PPO1 fragment was then reacted with pBI121-GUSThe vector segments are connected to construct a plant induction expression vector; transferring the constructed plant induction expression vector into a receptor plant through the mediation of agrobacterium tumefaciens; when a plant expressing the transgene is subjected to injury stress or infection of fusarium solani and alternaria pachyrhizi, a target gene driven by a promoter PPO1 can be induced and up-regulated in expression level, and in addition, abscisic acid, indoleacetic acid and gibberellin in vitro and in vivo can also induce high-level expression of the target gene.

In genetic engineering, a plant overexpression vector is commonly used as a 35S promoter from cauliflower mosaic virus, the promoter is a constitutive expression promoter, the expression of a target gene is generally constant at a certain level, and the expression levels of different tissues and parts are not obviously different, so that the expression of a foreign gene transferred into a plant is not controlled, and a large amount of protein is accumulated and energy is wasted. The inducible promoter can improve the expression quantity of the target gene when the plant is influenced by external stress or chemical factors, and can reduce the expression of the target gene after stress or chemical treatment is removed, so that the effects of protecting the plant and resisting external stimulus when the plant is stressed by adversity can be ensured, and otherwise, the energy of the plant is not wasted in a proper environment. In addition, in the application of genetic engineering, the inducible promoter can not only avoid the excessive consumption of plant energy caused by the continuous expression of a target gene, but also eliminate the damage of the accumulation of gene products to plants. Several hormones (abscisic acid, indoleacetic acid and gibberellin), abiotic stress (injury) and biotic stress (fusarium solani and alternaria tenuis) can obviously induce the expression activity of the PPO1 promoter in the invention, so the invention has wide application prospect in genetic engineering for resisting biotic stress.

Drawings

FIG. 1 shows the results of the detection of the gel recovery products of the promoters PPO1 (panel A) and pBI121 vector (panel B) of the present invention;

FIG. 2 shows pBI121-PPO1-GUSPositive cloning test result of transformed E.coli, wherein the positive control was obtained with plasmid pBI121-PPO1-GUSPCR reaction as template; the blank control is a PCR reaction using sterile water as a template;

FIG. 3 is a partial pBI121-PPO1-GUSPCR screening results of transgenic tobacco, wherein the positive control was obtained with plasmid pBI121-PPO1-GUSPCR reaction as template; WT: PCR performed by taking non-transgenic tobacco (wild type) total DNA as a template; the blank control is a PCR reaction using sterile water as a template;

FIG. 4 is a standard curve of GUS enzyme activity assay of the present invention;

FIG. 5 shows pBI121-PPO1-GUSGUS activity of transgenic tobacco treated with abscisic acid, indoleacetic acid and gibberellin respectively, wherein the control is pBI121-PPO1-GUSGUS activity of transgenic tobacco;

FIG. 6 shows pBI121-PPO1-GUThe S transgenic tobacco has GUS activity after being treated with Fusarium solani, alternaria alternata and injury respectively, wherein the control is pBI121-PPO1-GUSGUS activity in transgenic tobacco.

Detailed Description

The present invention will be further illustrated by the following figures and examples, but the scope of the invention is not limited to the description, and the methods in this example are all performed according to the conventional methods unless otherwise specified, and the reagents used are the conventional reagents or the reagents configured according to the conventional methods unless otherwise specified.

Example 1: cloning and sequence analysis of pseudo-ginseng inducible promoter PPO1

The extracted genomic DNA of notoginseng root is used as template, and the specific primer of amplified promoter PPO1 (upstream primer: 5' ACACACTCCTACCGTGGAAGA3″ and downstream primer: 5' GAGGAGTGAAAGGGCAT3 ') is used to clone the sequence of promoter PPO1 by PCR. The reaction system (20. Mu.L) was 0.5. Mu.g of Notoginseng radix genomic DNA, 2. Mu.L of 10 XAdvantage 2 PCR Buffer, 1.8. Mu.L of dNTP Mix (10 mM each), 0.2. Mu.L of upstream primer (10. Mu.M), 0.2. Mu.L of downstream primer (10. Mu.M), 0.2. Mu.L of Advantage 2 PCR Polymerase Mix, and 14.6. Mu.L of PCR-Grade water. PCR reaction conditions: 94 ℃ for 5min;94 ℃, 1min,56 ℃, 30s,72 ℃, 50s,32 cycles; after the PCR was completed at 72℃for 5min, 8. Mu.L was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The PCR product has only one DNA band, TA cloning is directly carried out on the PCR product, the used kit is pGEM-T vector system (Promega), and the reaction system and the operation process are as follows: 1.5. Mu.L of the PCR product was taken, 1. Mu.L of pGEM-T vector (50 ng/. Mu.L) and 2.5. Mu.L of 2X Ligation solution I were added in this order, and after mixing, the mixture was allowed to stand at 16℃overnight for reaction. The ligation product was transferred into E.coli DH 5. Alpha. Competence by heat shock transformation. Positive clones were screened with LB solid medium containing ampicillin (Amp). Several single colonies were selected, and after shaking, clones with multiple cloning sites inserted into PPO1 were detected with specific primers for amplifying PPO1. The obtained positive clone was sequenced, and finally the obtained promoter PPO1 was 965bp long.

Example 2: PPO1-GUSExpression vector construction

pBI121 having multiple cloning sitesScaI andXbai cleavage site, thus, specific primers for the amplified promoter are added separatelyScaI andXbarecognition sites for I. A SanPrep column type plasmid DNA small extraction kit (Shanghai) is adopted to extract the E.coli plasmid pGEM-T-PPO1 inserted with PPO1 and the plant expression vector pBI121 plasmid, and 1 mu L is taken for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. By limiting the innerCutting enzymeScaI andXbai, carrying out double digestion (50 mu L system) on plasmids pGEM-T-PPO1 and pBI121 respectively, wherein the reaction system and the operation process are as follows: mu.L of pGEM-T-PPO1 and pBI121 plasmids were taken separately, and 3. Mu.L of 10 XH buffer and 2. Mu.L of the plasmid were added in sequenceScaI、5μL ddH ₂ O, mixing, centrifuging for a short time, reacting at 37deg.C for 2 hr, and adding 2 μl Xba I、5μL 10×M buffer、13μL ddH ₂ O, after mixing evenly, centrifuging for a short time, and placing the mixture at 37 ℃ for reaction for 2 hours. All the digested products were subjected to agarose gel electrophoresis, then the promoter fragment and the large pBI121 vector fragment were separately subjected to gel recovery using a SanPrep column type DNA gel recovery kit (Shanghai Kogyo), and 1. Mu.L of the recovered product was taken and the size and concentration of the recovered fragment were detected by agarose gel electrophoresis, and the results are shown in FIG. 1.

The recovered promoter DNA fragment and pBI121 vector fragment were ligated together using T4 DNA Ligase (TaKaRa), and the reaction system (20. Mu.L) was operated as follows: mu.L of PPO1 DNA fragment was taken and 2. Mu.L of pBI121 vector DNA, 2. Mu.L of 10 XT 4 DNA Ligase Buffer, 1. Mu. L T4 DNA Ligase and 5. Mu.L of ddH were sequentially added ₂ O, after mixing evenly, centrifuging for a short time, and then carrying out a water bath at 16 ℃ for overnight reaction. The ligation product was then transferred into E.coli DH 5. Alpha. Using heat shock transformation and positive clones were selected using solid medium containing 50mg/L kanamycin. Single colony shaking bacteria are selected, bacterial liquid is used as a template, PCR is carried out by using a specific primer of an amplification promoter PPO1, clones successfully connected with the PPO1 and the pBI121 are selected, and for positive clones shown in figure 2, glycerol is added and the mixture is kept at the temperature of minus 80 ℃ for standby.

Extracting and purifying pBI121-PPO1 in the Escherichia coli DH5 alpha-GUSPlasmid, and then the plant expression vector pBI121 constructed in the above is frozen and thawed by liquid nitrogen-PPO1-GUSTransfer into competent cells of Agrobacterium tumefaciens LBA4404 prepared. The operation steps are as follows: 0.2 μg of pBI121-PPO1 was taken-GUSThe plasmid was added to a centrifuge tube containing 200. Mu.L of competent cells, gently mixed and ice-incubated for 5min, then transferred into liquid nitrogen and frozen for 1min, then rapidly placed in a 37℃water bath for 5min and ice-incubated for 2min, and then 500. Mu.L of LB liquid culture was added for shaking culture at 28℃for 4h. The activated Agrobacterium was spread on LB solid medium containing 50mg/L kanamycin,inverted culturing at 28deg.C. Selecting single colony and shaking bacteria, then carrying out PCR reaction by using specific primers for amplifying PPO1, and detecting pBI121-PPO1-GUSWhether or not to transfer into Agrobacterium. Adding glycerol into the obtained positive strain, and storing at-80deg.C.

Example 3: agrobacterium-mediated plant genetic transformation and transgenic plant selection

The transgenic acceptor in this experiment was tobacco, tobacco seeds were soaked in 75% alcohol for 30s, washed with sterile water and then with 0.1% HgCl ₂ Soaking for 8min, washing with sterile water for several times, seeding on 1/2 MS culture medium, dark culturing at 28deg.C for 5-8d, germinating, transferring to illumination incubator (25deg.C, 16h/d illumination), and subculturing with MS culture medium once per month.

Storing in-80deg.C refrigerator containing pBI121-PPO1-GUSThe bacterial liquid of the agrobacterium LBA4404 of the plasmid is taken out, 10 mu L of the bacterial liquid is inoculated into 1mL of LB liquid medium containing 20mg/L rifampicin and 50mg/L kanamycin, and the culture is carried out at 28 ℃ under shaking at 200rpm until the bacterial liquid is turbid. mu.L of the bacterial liquid is absorbed and evenly spread on LB solid medium containing 20mg/L rifampicin and 50mg/L kanamycin, and the bacterial liquid is inversely cultured at 28 ℃ until bacterial lawn grows. Scraping 3-5 loop thallus Porphyrae with inoculating loop, inoculating into 40mL MGL culture medium containing 25mg/mL acetosyringone, shake culturing at 28deg.C and 220rpm until OD ₆₀₀ About 0.6. Cutting the leaves of the aseptic tobacco tissue culture seedling into about 1cm ² Leaf discs with the size are soaked in MGL culture medium containing suspended agrobacterium tumefaciens, and shake culture is carried out at 25 ℃ for 15min. The bacterial liquid on the surface of the leaf disc is sucked by sterile filter paper and then transferred into a tobacco co-culture medium for dark culture at 22 ℃ for 2 days. The leaf discs after co-cultivation were transferred to tobacco screening medium and cultured in an illumination incubator (25 ℃,16h/d illumination). The differentiated tobacco seedlings were cut out and subcultured on rooting medium containing 50mg/L kanamycin and 300mg/L cephalosporin for about 3 weeks.

The genome DNA of the leaves of the transgenic tobacco plants is extracted by adopting a CTAB method, and 1 mu L of genome DNA is taken for agarose gel electrophoresis to detect the integrity and the concentration. PCR reaction is carried out by using genomic DNA of transgenic plants as templates and specific primers of an amplification promoter PPO1. After the PCR was completed, 8. Mu.L of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification result of partial transgenic tobacco plants is shown in figure 3, and 45 positive transgenic plants are screened from the pseudo-ginseng inducible promoter PPO1 transgenic tobacco.

Example 4: GUS (guide rail) fluorescence quantitative detection of transgenic tobacco

The method of fluorometric analysis of GUS activity in transgenic tobacco leaves is referred to by Jefferson et al (Jefferson R. Assaying chimeric genes in plants: the GUS gene fusion system Plant Mol Biol Rep. 1987,5 (4): 387-405) by the reaction mechanism: GUS can react with a substrate 4-MUG to catalyze and generate 4-MU, the 4-MU generates fluorescence under the conditions of 365-nm excitation wavelength and 455-nm emission wavelength, and the generated fluorescence value can be quantitatively measured by a fluorescence spectrophotometer.

The pretreated tobacco leaves were placed in a mortar containing liquid nitrogen and ground to a powder, 400. Mu.L of GUS extraction buffer was added, and the homogenate was transferred to a 1.5mL centrifuge tube and centrifuged at 12000 g for 10min at 4 ℃. After centrifugation, the supernatant was collected in a new centrifuge tube. 1mL of the 4-MUG solution (1 mmol/L) was pre-heated in a 2.0mL centrifuge tube at 37℃for 10min. 50. Mu.L of the supernatant was added to the preheated GUS reaction buffer, shaken rapidly and 200. Mu.L of the reaction mixture was immediately placed in 1.8mL of stop buffer (run time less than 30 s) as a 0 spot for the enzymatic reaction (blank control for the fluorometric assay), and the remaining liquid was allowed to continue at 37℃and the time was started. 200. Mu.L of the reaction mixture was taken at 15min, 30min and 45min, and added to 1.8mL of stop buffer for fluorescence measurement. The fluorescence value of each sample was measured using a fluorescence spectrophotometer at an excitation wavelength of 365nm and an emission wavelength of 455 nm. 4-MU standard curve was prepared: the 1mM 4-MU mother solution was diluted with reaction terminating solution into different gradient solutions of 5nM, 10nM, 20nM, 40nM, 60nM,80nM and 100nM, respectively, and the fluorescence value of each gradient solution was measured at an excitation wavelength of 365nM and an emission wavelength of 455nM, and a standard curve was drawn using the measured fluorescence value and the concentration of 4-MU as a blank control with the reaction terminating solution (as shown in FIG. 4). 10 μl of the supernatant was used to determine the protein content of the samples using the modified coomassie brilliant blue method. The amount of enzyme catalyzing 4-MUG to generate 1pmol 4-MU in one minute is taken as one activity unit, and the GUS enzyme activity is calculated according to the enzyme activity of total protein per MU g, namely, the enzyme activity is expressed as 4-MUpmol/min/MU g protein. GUS activity of transgenic tobacco was calculated by standard curve.

In order to detect the response of the pseudo-ginseng promoter PPO1 to plant hormones, biotic stress and abiotic stress, leaves of transgenic tobacco are respectively treated by a plurality of plant hormones, biotic stress and abiotic stress factors, GUS activity before and after treatment is measured by the method, and GUS activity of leaves of the transgenic tobacco which are not treated is normally grown is used as a control; as shown in FIG. 5, the GUS activity of transgenic tobacco leaves of the pseudo-ginseng promoter PPO1 was significantly up-regulated after treatment with abscisic acid, indoleacetic acid and gibberellin, respectively. Wherein the induction degree of the indoleacetic acid and gibberellin is obviously greater than that of the abscisic acid; leaves of transgenic tobacco inoculated with fusarium solani and alternaria alternata all significantly up-regulated the activity of promoter PPO1 (figure 6). The transgenic tobacco leaves are subjected to wound stress, and the expression level of GUS genes can be obviously induced. The experimental results show that the pseudo-ginseng promoter PPO1 responds to plant hormone, biological and abiotic stress, and obviously, the pseudo-ginseng promoter PPO1 is a plant hormone, biological stress and abiotic stress factor inducible promoter and can be applied to plant stress resistance genetic engineering.

Sequence listing

<110> university of Kunming engineering

<120> pseudo-ginseng inducible promoter PPO1 and application thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 965

<212> DNA

<213> pseudo-ginseng (Panax notoginseng)

<400> 1

acatcctacc gtgaagaaat atatttttct tttgaccgac tatggtgagg gatgaaaaag 60

caaattaaaa ctttaaaaaa taaaattaat agttgttttt tttttttggt aaaataaaag 120

atcgtcttaa ggcggaaggt gcattgttta ttgcttaatg gttcatattt gagattaaaa 180

tggtccataa cttttttgta ttcaatttgt gaccagcatt ttgtgatatg tggattcatt 240

ggacacatgg gaagctggga gttgagtcca aattgtttgg atatccataa cagaagaaaa 300

ccgacacagg caggctccct tatccatatt ggcgctacat ttgcacgata aaaaattaca 360

ttttgaataa agtaggagta ttatacaaat aattctaact ttttaatata tatatatata 420

tcatttcaat aaaattgttc gaatttgaca atgacacaag ggcccaagat aaaaacagaa 480

aacagctaaa agcaaactaa aggctacgtg aatttcgatc agattttaaa agaatgacat 540

gctttggata ttcggcttta tgcttttagg ttacattttt cctttgctag tagtagtatt 600

tatcttttac tttactttta acatatacta gtataatata gcttacaata acttataact 660

tggcatgcat taggttaggt tctagctggc tagaattcgg gtaagattaa cgatataaac 720

gtaaaaatat tattttcacg taatcctttt ttacataaag aaaattcaca ttctattaca 780

acaggctaat aaacaaaaga attatttttt gaaaaatatt ctattatatt ttttctgttt 840

ttacataata ccaaacttta aacaatctca aatgaacaaa atatttcctc aacaaataaa 900

aaaggacact aaatatcagt ttttcacaaa aaatagccta agatcaacat gccctttcac 960

tcctc 965

<210> 2

<211> 17

<212> DNA

<213> Artificial sequence (Artifical)

<400> 2

acatcctacc gtgaaga 17

<210> 3

<211> 17

<212> DNA

<213> Artificial sequence (Artifical)

<400> 3

gaggagtgaa agggcat 17

Claims (2)

1. An inducible promoter PPO1 is derived from Notoginseng radix, and has a nucleotide sequence shown in SEQ ID NO. 1.

2. The inducible promoter PPO1 of claim 1 in abscisic acid, indoleacetic acid, gibberellin, injury, fusarium solaniFusarium solani) Or compact Alternaria alternataAlternaria compacta) The application of regulating and controlling exogenous gene expression in transgenic acceptor plant.

Images