CN112608924B - Inducible promoter PCHI and application thereof - Google Patents

Abstract

The invention discloses an inducible promoter PCHI, which is derived from Lilium Minianum, the nucleotide sequence of which is shown as SEQ ID NO. 1, and the invention confirms that the Lilium Minianum promoter PCHI responds to methyl jasmonate and biotic stress through the research of related technologies of molecular biology and genetic engineering; the expression frame constructed by the PCHI and beta-glucosidase genes of the lily of the invention is transferred into tobacco for expression, the glucosidase activity of the transgenic tobacco is quantitatively detected by fluorescence, and the result shows that the glucosidase activity of the transgenic tobacco is obviously enhanced after the treatment of methyl jasmonate, fusarium oxysporum, fusarium solani and black spore mould; the lily regale promoter PCHI is induced by methyl jasmonate and biotic stress factors, and can be used in plant disease resistance gene engineering.

Description

Inducible promoter PCHI and application thereof

Technical Field

The invention relates to the fields of molecular biology and related research of genetic engineering, in particular to an inducible promoter PCHI and application thereof.

Background

A promoter is a DNA sequence located upstream of a gene that is specifically recognized by RNA polymerase. It acts like a "switch" to control the start time and extent of gene expression. The promoter composition includes a core promoter and an upstream promoter element. The core promoter consists of a transcription initiation site, a TATA box and a 5' utr sequence. Upstream promoter elements include CAAT boxes, GC boxes and some constitutive and specific elements that bind to the corresponding protein factors to increase transcription efficiency. Promoters can be classified functionally and functionally into constitutive promoters (expression of a gene is not limited by space-time restriction and controlled by exogenous factors), inducible promoters (expression of a gene is induced by exogenous physical and chemical factors, no inducer is present, and gene expression levels are low or even absent), and tissue-specific promoters (expression of a gene is distributed in a certain tissue or organ of a plant). However, under certain conditions, a promoter may be characteristic of both types of promoters, e.g., most fruit-specific promoters have ethylene response elements present at the same time and thus may also be considered ethylene inducible promoters.

Plant genetic engineering is a method of introducing exogenous genes into recipient cells, integrating them with recipient chromosomes, and altering the genetic characteristics of recipient plants. It not only can overcome the reproductive isolation between species, but also can greatly accelerate the plant breeding process. In genetic engineering, the expression of a foreign gene must be driven by a promoter. Most of the traditional genetic engineering uses constitutive promoters which are expressed with high intensity throughout the life cycle of the plant, resulting in excessive accumulation of gene products and consequent metabolic disorders and even death of the plant. The inducible promoter is formed in the plant adaptation environment and long-term evolution process, and can respond to special biological, physical and chemical signals so as to improve the transcription level of a specific gene to adapt to a type of promoter with environmental change within a certain range. In the absence of an inducer, it controls the expression of the coding gene either without or with a background. Once the inducer appears in the environment, the expression of the encoding gene increases rapidly, and the regulation of the gene is stopped after the inducer is removed. In genetic engineering, exogenous genes transferred into plants are expressed in large quantities in plants if not controlled, so that proteins accumulate in large quantities and energy is wasted. The inducible promoter is added on the vector to regulate the expression of the target gene in the presence of external stimulus, so that the problem of unlimited expression of the exogenous gene is well solved, and the expression of the exogenous gene driven by the inducible promoter is controlled by specific physical or chemical signals. Thus, research on inducible promoters has been one of the hot spots of plant molecular biology and genetic engineering research. (Yang Ruijuan, bai Jianrong, li Rui, chang Lifang. Research into inducible promoters in plant genetic engineering [ J ]. Shanxi agricultural science, 2018, 46 (02): 292-298).

Inducible promoters are generally designated by an induction signal, such as light-inducible promoters, heat-inducible promoters, wound-inducible promoters, hormone-inducible promoters, and fungal-inducible promoters. Utilizing chromosome walking technology to obtain lily flowerLilium regale) A kind of electronic devicePR10-5The end of the gene is amplified to 1489bp promoter, which is connected with GUS report gene to transfer tobaccoNicotiana tabacum) The result shows that the lilyPR10-5The promoter is a multiple stress inducible promoter. Gibberellin, abscisic acid and ethylene pairsPR10-5The promoters have positive regulation function, wherein gibberellin has the strongest induction effect on the promoters; after abiotic stress treatment such as salt stress and wound stress, GUS activity of transgenic tobacco is obviously enhanced, which indicates that the salt stress and wound stress are positively regulated and controlledPR10-5A promoter; fusarium oxysporumFusarium oxysporum) Sclerotinia sclerotiorum (L.) KuntzeSclerotinia sclerotiorum) Botrytis cinereaBotrytis cinerea) Treatment pairPR10-5The induction of GUS activity was also very pronounced (Chen R, he H, yang Y, et al Functional characterization of a pathogenesis-related protein family 10 gene, lrPR10-5, from Lilium regale Wilson. Australas Plant Path, 2017, 46 (3): 1-9). Rhizoma et radix Parthenocissi TricuspidataeErianthus arundinaceus) PR10 promoter obtained by cloning, and transferring into tobacco and rice after connecting with reporter gene GUSOryza sativa) And sugarcane doSaccharum officinarum). GUS enzyme activity measurement results show that wound stress, methyl jasmonate and abscisic acid treatment induce festuca arundinaceaPR10Expression of the promoter (Chakravarthi M, syamaladevi DP, harunitriya P, augustine SM, subramonian N.A.novel PR10 promoter from)Erianthus arundinaceus directs high constitutive transgene expression and is enhanced upon wounding in heterologous plant systems. Mol Biol Rep, 2016, 43(1):17-30）。

Disclosure of Invention

The invention aims to provide an inducible promoter PCHI from lily of Min river, the nucleotide sequence of which is shown as SEQ ID NO. 1.

The invention also aims to apply the promoter in genetic engineering, namely, under the action of biological stress or plant hormone, the promoter is induced to express to regulate the specific high-efficiency expression of exogenous genes in transgenic receptor plants.

The invention relates to the separation of inducible promoter fragments and the identification of the expression activity thereof, the invention clones and obtains an inducible promoter from lily of Minjiang, and the promoter is 491bp long; bioinformatics analysis shows that the inducible promoter comprises a series of different cis-acting elements, such as a light modulation element (SORLIP 1 AT), a gibberellin response element (GT 1 CONSENSUS), an abscisic acid response element (EBOxNNAPA), a high-salt and dark induction element (ABRELATERD 1), and the like. The WRKY transcription factor plays an important regulatory role in plant disease resistance defense reaction, and the inducible promoter sequence has 1 cis-acting element w-box (C/TTGACC/T) of WRKY.

The isolated and cloned inducible promoter fragment of the invention is used for replacing the 35s promoter of CaMV on pBI121 vector, and the inducible promoter is used for driving the reporter geneGUSThrough the expression frame of agrobacterium tumefaciens @Agrobacterium tumefaciens) Mediating the expression of the promoter in tobacco of mode plant, revealing the expression characteristic of the inducible promoter through further experiments, and utilizing the promoter to regulate and control exogenous genes in later periodLays a foundation for high-efficiency specific expression in transgenic plants. The inventors named this promoter PCHI.

The PCHI promoter drives the expression cassette of GUS to be transferred into tobacco, transgenic tobacco plants are treated by adopting plant hormone and biotic stress, and fluorescent quantitative analysis of GUS activity is carried out, and the detection result shows that the PCHI promoter responds to the treatment of plant hormone and biotic stress, and the methyl jasmonate and fusarium oxysporum are treatedFusarium oxysporum) Fusarium solani (Fusarium solani.)Fusarium solani) Black spore mould of riceNigrospora oryzae) Can obviously induce the activity of promoter PCHI.

The promoter PCHI can be applied to the induction expression of exogenous genes in genetic engineering, and the specific operation is as follows:

(1) Extracting genome DNA from tender tissue of lily of Min by using specific primer for amplifying PCHI, amplifying PCHI by polymerase chain reaction (polymerase chain reaction, PCR), connecting the PCHI to pGEM-T vector, and obtaining clone with correct sequence by sequencing;

(2) Cutting pGEM-T-PCHI vector by restriction enzyme, and recovering promoter fragment; simultaneously adopting proper restriction enzyme to cut out constitutive expression promoters on plant expression vectors, and obtaining large vector fragments through glue recovery; the obtained PCHI fragment was then reacted with pBI121-GUSThe vector segments are connected to construct a plant induction expression vector; and transferring the constructed plant induction expression vector into a receptor plant through the mediation of agrobacterium tumefaciens. When the transgenic plants are infected by fusarium oxysporum, fusarium solani and black spore mould, the target genes driven by the promoter PCHI can induce and up-regulate the expression level, and in addition, in-vivo and in-vitro methyl jasmonate can induce the high-level expression of the target genes.

The invention provides a novel promoter for inducing expression in plant genetic engineering application. In genetic engineering, a plant overexpression vector is commonly used as a 35S promoter from cauliflower mosaic virus, the promoter is a constitutive expression promoter, the expression of a target gene is generally constant at a certain level, and the expression levels of different tissues and parts are not obviously different, so that the expression of a foreign gene transferred into a plant is not controlled, and a large amount of protein is accumulated and energy is wasted. The inducible promoter can improve the expression quantity of the gene when the plant is influenced by external stress or chemical factors, and can reduce the expression of the target gene after stress or chemical treatment is removed, so that the inducible promoter can ensure the effects of protecting the plant and resisting external stimulus when the plant is stressed by adversity, and otherwise, the energy of the plant is not wasted in a proper environment. In addition, in the application of genetic engineering, the inducible promoter can not only avoid the excessive consumption of plant energy caused by the continuous expression of a target gene, but also eliminate the damage of the accumulation of gene products to plants. Methyl jasmonate and biotic stress (fusarium oxysporum, fusarium solani and black spore mould) obviously induce the expression activity of the PCHI promoter in the invention, so the invention has wide application prospect in the genetic engineering of resisting biotic stress.

Drawings

FIG. 1 shows the results of the detection of the gel recovery products of the promoters PCHI (Panel A) and pBI121 vector (Panel B) of the present invention;

FIG. 2 shows pBI121-PCHI-GUSThe positive cloning detection result of the transformed escherichia coli, wherein the positive control is a PCR reaction taking pGEM-T-PCHI plasmid as a template, and the blank control is a PCR reaction taking sterile water as a template;

FIG. 3 is a partial pBI121-PCHI-GUSPCR screening of transgenic tobacco, wherein the positive control was obtained with plasmid pBI121-PCHI-GUSPCR reaction as template; WT: PCR performed by taking non-transgenic tobacco (wild type) total DNA as a template; the blank control is a PCR reaction using sterile water as a template;

FIG. 4 is a standard curve of GUS enzyme activity assay of the present invention;

FIG. 5 shows pBI121-PCHI-GUSGUS activity of transgenic tobacco after methyl jasmonate treatment, wherein the control is pBI121-PCHI-GUSGUS activity of transgenic tobacco;

FIG. 6 shows pBI121-PCHI-GUSGUS activity of transgenic tobacco after inoculation of Fusarium oxysporum, fusarium solani and Nigromaculatum, wherein the control is normally grown pBI121-PCHI-GUSGUS activity in transgenic tobacco.

Detailed Description

The present invention will be further illustrated by the following figures and examples, but the scope of the invention is not limited to the description, and the methods in this example are all performed according to the conventional methods unless otherwise specified, and the reagents used are the conventional reagents or the reagents configured according to the conventional methods unless otherwise specified.

Example 1: cloning and sequence analysis of lily-of-Minjiang inducible promoter PCHI

Using the extracted genomic DNA of Lilium regale as a template, the sequence of the promoter PCHI was cloned by PCR using a specific primer (the upstream primer is 5' ATCATACGTGTGTCCCTATCTATGTG3 ' ', the downstream primer is 5' GGAATGAAGGGCGAGGGTGG3 ') for amplifying the promoter PCHI. The reaction system (20. Mu.L) was 0.5. Mu.g of genomic DNA of Lilium Minum, 2. Mu.L of 10 XAdvantage 2 PCR Buffer, 1.8. Mu.L of dNTP Mix (10 mM each), 0.2. Mu.L of upstream primer (10. Mu.M), 0.2. Mu.L of downstream primer (10. Mu.M), 0.2. Mu.L of Advantage 2 PCR Polymerase Mix, and 14.6. Mu.L of PCR-Grade water. PCR reaction conditions: 94 ℃ for 5min;94℃for 30s,63℃for 30s,72℃for 30s,32 cycles; and at 72℃for 5min. After the PCR was completed, 8. Mu.L of the sample was subjected to agarose gel electrophoresis to examine the specificity and size of the amplified product.

The PCR product has only one DNA band, so the PCR product is directly TA cloned, and the used kit is pGEM-T vector system (Promega), and the reaction system and the operation process are as follows: 1.5. Mu.L of the PCR product was taken, 1. Mu.L of pGEM-T vector (50 ng/. Mu.L) and 2.5. Mu.L of 2X Ligation solution I were added in this order, and the mixture was allowed to stand at 16℃overnight for reaction. The ligation product was transferred into E.coli DH 5. Alpha. Competence by heat shock transformation. Positive clones were screened with LB solid medium containing ampicillin. Several single colonies were picked, and after shaking, clones with multiple cloning sites inserted into the PCHI were detected using specific primers for amplifying the PCHI. The obtained positive clone was sequenced, and finally 491bp of promoter PCHI was obtained.

Example 2: PCHI-GUSExpression vector construction

pBI121 having multiple cloning sitesHindIIIBamHI cleavage sites, thus, are added to specific primers of the amplified promoterHindIIIBamRecognition sites for HI. The E.coli plasmid pGEM-T-PCHI inserted with PCHI and the plant expression vector pBI121 plasmid were extracted using SanPrep column plasmid DNA miniprep kit (Shanghai, ind.) and 1. Mu.L was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. By restriction enzymesBamhI andHindIII plasmids pGEM-T-PCHI and pBI121 were digested simultaneously (100. Mu.L system), and the reaction and procedures were: mu.L of pGEM-T-PCHI and pBI121 plasmids were taken separately, and 10. Mu.L of 10 XH buffer and 5. Mu.L of the plasmid were added in sequenceBamHⅠ、5μL HindⅢ、60μL ddH ₂ O, after mixing evenly, centrifuging for a short time, and standing at 37 ℃ overnight for reaction. All the digested products were subjected to agarose gel electrophoresis, then the promoter fragment and the large pBI121 vector fragment were separately subjected to gel recovery using a SanPrep column type DNA gel recovery kit (Shanghai Kogyo), and 1. Mu.L of the recovered product was taken and the size and concentration of the recovered fragment were detected by agarose gel electrophoresis, and the results are shown in FIG. 1.

The recovered promoter DNA fragment and pBI121 vector fragment were ligated together using T4 DNA Ligase (TaKaRa), and the reaction system (20. Mu.L) was operated as follows: mu.L of PCHI DNA fragment was taken and 2. Mu.L of pBI121 vector DNA, 2. Mu.L of 10 XT 4 DNA Ligase Buffer, 1. Mu. L T4 DNA Ligase, 5. Mu.L of ddH were added in this order ₂ O, after mixing evenly, centrifuging for a short time, and then carrying out a water bath at 16 ℃ for overnight reaction. The ligation product was then transferred into E.coli DH 5. Alpha. Using heat shock transformation and positive clones were selected using solid medium containing 50mg/L kanamycin. Selecting single colony shaking bacteria, using bacterial liquid as a template, carrying out PCR by using a specific primer of an amplification promoter PCHI, selecting clones successfully connected with the PCHI and the pBI121, adding glycerol into the obtained positive strain, and storing at the temperature of-80 ℃ for later use.

Extracting and purifying pBI121-PCHI in the escherichia coli DH5 alpha by using SanPrep column type plasmid extraction kit-GUSA plasmid. The plant expression vector pBI121 constructed above was then frozen and thawed with liquid nitrogen-PCHI-GUSTransfer into competent cells of Agrobacterium tumefaciens LBA4404 prepared. The operation steps are as follows: mu.g of pBI121-PCHI was taken-GUSThe plasmid was added to a centrifuge tube containing 200. Mu.L of competent cells, gently mixed and ice-incubated for 5min, then transferred into liquid nitrogen and frozen for 1 min, then rapidly placed in a 37℃water bath for 5min and ice-incubated for 2min, and then 500. Mu.L of LB liquid culture was added for shaking culture at 28℃for 4h. The activated Agrobacterium was spread on LB solid medium containing 50mg/L kanamycin, and cultured upside down at 28 ℃. Selecting single colony shaking bacteria, then carrying out PCR reaction by using specific primers for amplifying PCHI, and detecting pBI121-PCHI-GUSWhether or not to transfer into Agrobacterium. For the positive clones shown in FIG. 2, glycerol was added and stored at-80℃until needed.

Example 3: agrobacterium-mediated plant genetic transformation and transgenic plant selection

The transgenic acceptor in this experiment was tobacco, tobacco seeds were soaked in 75% alcohol for 30s, washed with sterile water and then with 0.1% HgCl ₂ Soaking for 8min, washing with sterile water for several times, seeding on 1/2 MS culture medium, dark culturing at 28deg.C for 5-8d, germinating, transferring to illumination incubator (25deg.C, 16h/d illumination), and subculturing with MS culture medium once per month.

Storing in-80 ℃ refrigerator containing pBI121-PCHI-GUSThe bacterial liquid of the agrobacterium LBA4404 of the plasmid is taken out, 10 mu L of the bacterial liquid is inoculated into 1mL of LB liquid medium containing 20mg/L rifampicin and 50mg/L kanamycin, and the bacterial liquid is cultured at 28 ℃ under shaking at 200rpm until the bacterial liquid is turbid. mu.L of the bacterial liquid is absorbed and evenly spread on LB solid medium containing 20mg/L rifampicin and 50mg/L kanamycin, and the bacterial liquid is inversely cultured at 28 ℃ until bacterial lawn grows. Scraping 3-5 loop thallus Porphyrae with inoculating loop, inoculating into 40mL MGL culture medium containing 25mg/mL acetosyringone, shake culturing at 28deg.C at 220rpm until OD ₆₀₀ About 0.6. Cutting the leaves of the aseptic tobacco tissue culture seedling into about 1cm ² Leaf discs with the size are soaked in MGL culture medium containing suspended agrobacterium tumefaciens, and shake culture is carried out at 25 ℃ for 15min. The bacterial liquid on the surface of the leaf disc is sucked by sterile filter paper and then transferred into a tobacco co-culture medium for dark culture at 22 ℃ for 2 days. The leaf discs after co-cultivation were transferred to tobacco screening medium and cultured in an illumination incubator (25 ℃,16h/d illumination). After about 3 weeks of culture, the differentiated tobacco seedlings were cut out and subcultured to rooting cultures containing 50mg/L kanamycin and 300mg/L cephalosporinRooting culture is carried out on the culture medium.

The genome DNA of the leaves of the transgenic tobacco plants is extracted by adopting a CTAB method, and 1 mu L of genome DNA is taken for agarose gel electrophoresis to detect the integrity and the concentration. PCR reaction is carried out by using genomic DNA of transgenic plants as templates and specific primers for amplifying the promoter PCHI. After the PCR was completed, 8. Mu.L of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of part of the transgenic tobacco plants are shown in figure 3, and 29 positive transgenic plants are obtained by co-screening the PCHI transgenic tobacco of the lily-of-Min inducible promoter.

Example 4: GUS (guide rail) fluorescence quantitative detection of transgenic tobacco

The method of fluorometric analysis of GUS activity in transgenic tobacco leaves is referred to by Jefferson et al (Jefferson R. Assaying chimeric genes in plants: the GUS gene fusion system Plant Mol Biol Rep. 1987,5 (4): 387-405) by the reaction mechanism: GUS can react with a substrate 4-MUG to catalyze and generate 4-MU, the 4-MU generates fluorescence under the conditions of 365-nm excitation wavelength and 455-nm emission wavelength, and the generated fluorescence value can be quantitatively measured by a fluorescence spectrophotometer.

The pretreated tobacco leaves were placed in a mortar containing liquid nitrogen and ground to a powder, 400. Mu.L of GUS extraction buffer was added, the homogenate was transferred to a 1.5mL centrifuge tube and centrifuged at 12000g for 10min at 4 ℃. After centrifugation, the supernatant was collected in a new centrifuge tube. 1mL of the 4-MUG solution (1 mmol/L) was pre-heated in a 2.0mL centrifuge tube at 37℃for 10min. 50. Mu.L of the supernatant was added to the preheated GUS reaction buffer, shaken rapidly and 200. Mu.L of the reaction mixture was immediately placed in 1.8mL of stop buffer (run time less than 30 s) as a 0 spot for the enzymatic reaction (blank control for the fluorometric assay), and the remaining liquid was allowed to continue at 37℃and the time was started. 200. Mu.L of the reaction mixture was taken at 15min, 30min and 45min, and added to 1.8mL of stop buffer for fluorescence measurement. The fluorescence value of each sample was measured using a fluorescence spectrophotometer at an excitation wavelength of 365nm and an emission wavelength of 455 nm. 4-MU standard curve was prepared: the 1mM 4-MU mother solution was diluted with reaction terminating solution to 5nM, 10nM, 20nM, 40nM, 60nM, 80nM and 100nM gradient solutions, respectively, and fluorescence values of the gradient solutions were measured at an excitation wavelength of 365nM and an emission wavelength of 455nM, and a standard curve was drawn using the measured fluorescence values and the concentration of 4-MU with the reaction terminating solution as a blank (see FIG. 4). 10 μl of the supernatant was used to determine the protein content of the samples using the modified coomassie brilliant blue method. The GUS activity of the transgenic tobacco was calculated by using the enzyme amount catalyzing 4-MUG to 1pmol 4-MU in one minute as one activity unit and the GUS enzyme activity calculated as enzyme activity per μg total protein, expressed as 4-MUpmol/min/μg (protein), by a standard curve.

In order to detect the response of the PCHI of the lily of the Min river promoter to plant hormone and biological stress, the leaf of the transgenic tobacco is treated by methyl jasmonate and biological stress factors respectively, GUS activity before and after treatment is measured by the method, and the GUS activity of the leaf of the untreated transgenic tobacco is used as a control. As shown in FIG. 5, GUS activity of PCHI transgenic tobacco leaves of the Lilium Minum promoter was significantly up-regulated after methyl jasmonate treatment. Leaves of transgenic tobacco inoculated with the three pathogenic fungi Fusarium oxysporum, fusarium solani and Nicotiana oryzae all significantly up-regulated the activity of the promoter PCHI. From the induction level, fusarium solani > fusarium oxysporum > nigella oryzae (fig. 6). The GUS activity after infection of fusarium solani is about 3 times that before infection, the GUS activity after infection of fusarium oxysporum is about 2.4 times that before infection, and the GUS activity after infection of black mould is about 2.4 times that before infection. The experimental results show that the PCHI of the Min lily promoter responds to treatment of plant hormone and biotic stress, and methyl jasmonate, fusarium oxysporum, fusarium solani and black spore mould can obviously up-regulate GUS activity driven by the PCHI. Obviously, the lily of the regale promoter PCHI is a plant hormone and biotic stress factor inducible promoter, and can be applied to plant stress resistance genetic engineering.

Sequence listing

<110> university of Kunming engineering

<120> an inducible promoter PCHI and use thereof

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 491

<212> DNA

<213> Lilium regale (Lilium regale)

<400> 1

atcatacgtg tgtcccctat catgtgtcgt tatcttcaac atccttcctc ctagtatata 60

tgcagaacat ccatacattt ttcattacaa ctgttcaaaa ttgttagtga gacactcatt 120

tttaaagaac tgtcttaaaa taccgtctca taaaaatttg ccacaataaa ttcacaaagg 180

tttgccaaat catacctatg tacaagctga gcaccagtgt acgtctggaa caggttgaat 240

atacgagggt ggtaccgagg ccacacacgg aggttggcac agaagattat ttctcctgtt 300

aatttatatt tctggcttat ctttaagcct gccgattcaa catttagggt agttcaatcg 360

ctgctcatta cgtacacagt tgtctcactg ctcgttacca cgttttacaa cacacggcaa 420

acttttaggc caagagattg actagaaccc tcacaatctc tatataagcc cccaccctcg 480

cccttcattc c 491

<210> 2

<211> 24

<212> DNA

<213> Artificial sequence (Artifical)

<400> 2

atcatacgtg tgtcccctat catg 24

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artifical)

<400> 3

ggaatgaagg gcgagggtgg 20

Claims (2)

1. An inducible promoter PCHI is derived from lily of Min, and the nucleotide sequence of the promoter is shown as SEQ ID NO. 1.

2. The inducible promoter PCHI of claim 1 in methyl jasmonateFusarium oxysporum (F.oxysporum)Fusarium oxysporum) Fusarium solani (Fusarium solani.)Fusarium solani) Or black spore mould of riceNigrospora oryzae) The application of exogenous gene in the expression of transgenic plant is induced under the action of the exogenous gene.

Images