CN107974454B - Rubber powdery mildew endogenous promoter WY193 and application thereof - Google Patents
Rubber powdery mildew endogenous promoter WY193 and application thereof Download PDFInfo
- Publication number
- CN107974454B CN107974454B CN201711429297.3A CN201711429297A CN107974454B CN 107974454 B CN107974454 B CN 107974454B CN 201711429297 A CN201711429297 A CN 201711429297A CN 107974454 B CN107974454 B CN 107974454B
- Authority
- CN
- China
- Prior art keywords
- promoter
- recombinant
- seq
- powdery mildew
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses an endogenous promoter WY193 of rubber tree powdery mildew and application thereof, wherein the promoter WY193 has the sequence shown in SEQ ID NO: 1, or a variant thereof having promoter function. The invention also relates to nucleic acid constructs, vectors, recombinant cells, transgenic plants, explants and callus containing the promoter. The promoter can be used for regulating and controlling the expression of exogenous target genes in dicotyledonous plants and monocotyledonous plants, and provides a brand-new tool and selection for the gene expression of transgenic plants.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to an endogenous promoter WY193 of rubber powdery mildew and application thereof.
Background
The promoter is a site recognized and bound by RNA polymerase, and is an important cis-element in gene expression regulation. The core promoter is the shortest contiguous DNA sequence capable of precisely directing transcription initiation through the rnase mechanism of action, including TATAbox, the initiator, downstream core promoter elements, TFIIB recognition elements, and ten motif elements.
The current classification of promoters is based mainly on controlling the level of transcription and on controlling both the mode of action and the function. Promoters can be classified into strong promoters and weak promoters according to the level of control transcription; promoters include constitutive promoters, tissue-specific promoters, and inducible promoters, depending on the transcription pattern. The tissue-specific promoter is a promoter which keeps continuous activity in most or all tissues, while the inducible promoter is a promoter regulated by external chemical or physical signals, and the inducing sources of the inducible promoter are mainly three major types, namely chemical factors, physical factors and artificially synthesized chemical inducers.
It is generally believed that constitutive promoters isolated from monocot plants exhibit higher transcriptional activity in monocot transgenic plants and that the inclusion of introns between the promoter and reporter gene increases transcription levels. At present, the developed genes suitable for the high-efficiency expression of monocotyledons include rice Actin I promoters, maize Ubiquitin promoters and the like. In addition, plum, the people and the like find that the expression of CAT gene started by the Ubiquitin promoter in corn is 10 times higher than the expression efficiency of the gene started by 35S, Lu and the like also separate a new rubi3 promoter from rice, which can enable the gene to be expressed in each tissue, and the starting activity is higher than that of the Ubi-1 promoter found in corn, so that the promoter is strong in efficiency and has a great application prospect.
The tissue type promoter existing in the monocotyledon at present has few types, is mainly Lem1 promoter separated from barley, and the promoter mainly promotes the expression of genes in the palea and palea of the barley; and Ca in rice2+The full length of the ATPase promoter has the specificity of vascular tissue expression, and the promoter can also respond to various stresses such as drought, high salt, pathogenic bacteria and the like.
Monocots have a large number of inducible promoters, of which rice contributes the vast majority of the work. At present, promoters cloned from rice comprise Rab16A salt-induced promoter, Os HsfB2cp, PM19p, Hsp90p heat-induced promoter, TdCor39 cold-induced promoter, Rab16B ABA-induced promoter, LHCPII and R4CL-1 light-induced promoter and Os EBP-89 pathogenic microorganism-induced promoter. The cloned promoters in wheat are mainly four types: mwcs120 and wcoll 5 cold inducible promoters, EmABA inducible promoters and Cab light inducible promoters. Barley also has inducible promoters that have been cloned, such as the cold inducible promoters of blt4.9 and blt101.1, the drought inducible promoter of Dhn4s, and the inducible promoter of PGIII pathogenic microorganisms. Individual inducible promoters also appear in maize and gastrodia elata. For example, the Os DREB1B promoter in rice can be induced by salt, ABA, PEG abiotic stress and other biotic stresses.
The Ca MV35S promoter has the characteristic of high-efficiency expression in dicotyledonous plants, can be transcribed in all cells and at any time, has great advantages for obtaining a large amount of exogenous proteins, and is widely applied to the promotion of the expression of exogenous genes.
Tissue-type promoters in many dicotyledonous plants, such as citrus phloem protein gene (Cs PP) promoter, arabidopsis phloem gene (At PP2) promoter, and arabidopsis sucrose transporter gene (At SUC2) promoter, have the ability to express phloem-specifically in plant vascular tissues because of the possession of plant hormone response elements, light response elements, biotic and abiotic stress response elements, and tissue-specific expression elements.
In the current research situation of inducible promoters, dicotyledons have more varieties than monocotyledons and have wider range of related plants. Wherein, the inducible promoter in arabidopsis occupies the half-wall Jiangshan: currently found are CBF2, cor15a, cor15b, ADH, LT178, At Rd29A 6 cold inducible promoters, Rd22, cor15, rab18, ABA5 and AtNCED3ABA inducible promoters, Rd29A and AtNCED3 drought inducible promoters and Psy light inducible promoters. The tobacco contains Nt HSP3A heat-induced promoter, Nt Cel7 auxin-induced promoter, PPP1, PPP2 and PPP3 pathogenic microorganism-induced promoter. In addition, more inducible promoters have been found in dicotyledonous plants such as soybean, cotton, pea, mung bean, etc.
Constitutive promoters have achieved great success in expressing foreign genes and are still widely used today. However, specific promoters are also increasingly important in the aspects of transgenic food, gene timing and positioning expression and the like.
Filamentous fungi are important products in industry, such as various types of antibiotics, and are also important raw materials for many enzyme preparations. The mass production of these industrial products illustrates on the one hand the importance of filamentous fungi for human life and industry and on the other hand the very large expression level of filamentous fungi when expressing their endogenous genes, which are very powerful and abundant in promoter resources. If the promoter can be used for expressing the exogenous gene, the method provides more abundant resources for transgenic engineering. Molecular research of filamentous fungi is generally lagged, and genetic transformation systems of many filamentous fungi, especially obligate parasitic fungi which cannot be cultured in vitro, are not established or perfected. The discovery and the utilization of the fungal endogenous promoter are also very beneficial to the construction of the genetic transformation system of the fungus.
Aiming at the defects of the prior art, the invention provides an endogenous promoter WY193 of the rubber tree powdery mildew through the deep research on the genome of the rubber tree powdery mildew.
The technical scheme adopted by the invention is as follows:
an endogenous promoter WY193 of Erysiphe hevea, wherein the promoter comprises a nucleotide sequence selected from any one of the following groups and has promoter function:
a. SEQ ID NO: 1;
b. and SEQ ID NO: 1 complementary nucleotide sequence;
c. a nucleotide sequence capable of hybridizing with the nucleotide sequence of a or b;
d. a nucleotide sequence modified by substitution, deletion and addition of one or more bases on the nucleotide sequence shown in the a or the b;
e. a nucleotide sequence having at least 90% homology with the nucleotide sequence shown in a or b.
Preferably, the preparation method of the promoter comprises the following steps: performing amplification by using a pair of amplification primers by using the genomic DNA of the rubber tree powdery mildew as a template, wherein the amplification primers are represented by SEQ ID NO: 1 the sequences in the genomic DNA of Blastomyces hevea are designed for the beginning and the end respectively.
Further, the present invention also relates to a nucleic acid construct comprising the promoter of the present invention, and a gene sequence operably linked to the promoter.
Furthermore, the invention also relates to a recombinant vector, wherein the vector is obtained by recombining the promoter and pGEM-Teasy or PBI121 plasmid.
Further, the present invention relates to a recombinant cell comprising the promoter of claim 1 or the nucleic acid construct of claim 3 or the recombinant vector of claim 4.
Preferably, the recombinant cell is a recombinant escherichia coli cell or a recombinant agrobacterium tumefaciens cell.
Furthermore, the invention also relates to a group of primer pairs, wherein two primers of the primer pairs respectively contain the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3; and the two primers of the primer pair are also respectively connected with restriction enzyme cutting sites and/or protective bases at the 5' ends.
Further, the present invention also relates to a transgenic plant transformed with the promoter or nucleic acid construct or recombinant vector of the present invention or infected with the recombinant cell of the present invention.
Further, the present invention also relates to a plant callus or explant transformed with a promoter or nucleic acid construct or recombinant vector of the present invention or infected with a recombinant cell of the present invention.
Further, the invention also relates to the application of the promoter WY193 or the nucleic acid construct or the recombinant vector or the recombinant cell in regulating and controlling the expression of a target gene in a plant or plant breeding.
Compared with the prior art, the invention has the beneficial effects that:
the new promoter WY193 derived from the rubber tree powdery mildew is provided, and the promoter can be used for regulating and controlling the expression of exogenous target genes in dicotyledonous plants and monocotyledonous plants, provides a brand-new tool and selection for the gene expression of transgenic plants, and also provides a beneficial idea for the construction of a rubber tree powdery mildew genetic transformation system.
Drawings
FIG. 1 is a plasmid map of the recombinant vector PBI121-WY 193.
FIG. 2 shows the GUS staining result of the three-generation tobacco leaf discs which are transformed by the recombinant Agrobacterium tumefaciens mediated transformation of the promoter WY193 recombinant vector PBI121-WY 193.
In the figure, WY193 is the GUS staining result of PBI121-WY193 transformed three-generation tobacco leaf discs; CK (CK)+(CaMV 35S): GUS staining results of transformation of three-generation tobacco leaf discs by PBI121 empty vector with GUS gene transcription regulated by CaMV 35S; CK (CK)-(sterile seedling) is the GUS staining result of leaf disc of untransformed sterile seedling of Sansheng tobacco.
FIG. 3 is a graph of WY193 transgenic triple-grown tobacco at each growth stage;
in the figure, the co-culture period, the callus period, the lateral bud period, the rooting period and the adult plant period are sequentially arranged from left to right.
FIG. 4 shows the PCR amplification detection result of GUS gene transgenic third generation tobacco regulated by WY 193;
in the figure, M: marker 2000; WY 193: WY193 regulates and controls GUS gene transgenic third generation tobacco leaf DNA; CK (CK)+: transgenic third-generation tobacco transformed with PBI121 empty vector; CK (CK)-: wild type three-generation tobacco.
FIG. 5 shows the GUS staining result of the callus of rice (Nipponbare) transformed by recombinant Agrobacterium tumefaciens mediated transformation of promoter WY193 recombinant vector PBI121-WY 193;
in the figure, WY 193: GUS staining results of the PBI121-WY193 transformed rice callus discs; CK (CK)+(CaMV 35S): the GUS staining result of rice callus transformed by PBI121 empty vector with GUS gene transcription regulated by CaMV 35S; CK (CK)-: GUS staining results of non-transformed Nipponbare rice calli.
Detailed Description
The present invention will be described in further detail with reference to the following detailed description and accompanying drawings.
EXAMPLE I PCR amplification of the WY193 promoter fragment
A fungus genome DNA extraction kit (OMEGA, D3390-01) is used for extracting genome DNA of Erysiphe koenigii (provided by key laboratories for sustainable utilization of tropical biological resources in Hainan province), and a pair of specific amplification primers (an upstream primer WY193F, a restriction enzyme cutting site Hind III and a protective base, a downstream primer WY193R, a restriction enzyme cutting site BamH I and a protective base) are designed according to the sequence of a WY193 promoter. PCR amplification was performed using high fidelity Ex Taq polymerase (TRANSGEN, AP122) using the extracted genomic DNA of Blumeria necator as a template. As shown in table 1.
TABLE 1 PCR System for Gene promoter amplification
The PCR amplification procedure was: pre-denaturation at 94 ℃ for 5min, followed by denaturation at 94 ℃ for 60s, annealing at 55 ℃ for 50s, and extension at 72 ℃ for 60s, for 35 reaction cycles, and finally extension at 72 ℃ for 5 min.
Wherein, the upstream primer WY 193F: CCCAAGCTTGTGATTATGGGTTCAATCTCT, wherein the HindIII cleavage site is underlined. Downstream primer WY 193R: CGGGATCCTTTCGCGCTAAATTACCAA, wherein the underlined indicates the BamHI cleavage site.
The PCR amplification product was separated by 1.0% agarose gel electrophoresis to obtain a band of about 260bp in size, which was purified and recovered using an OMEGA agarose gel DNA recovery kit (catalog No. D2500-01).
EXAMPLE two construction of pGEM-T easy-WY193 recombinant vector
The PCR amplification product obtained above was subjected to T/A cloning (pGEM-T easy plasmid, PROMEGA, A1360) to transform Escherichia coli (TRANSGEN, CD201), and positive clones were selected for sequencing, which proved accurate.
Wherein, the connection conditions of the T/A clone are as follows:
T/A connection system: 10ul of
pGEM-T Easy Vector(PROMEGA，A137A):1ul
2×Rapid ligation Buffer:5ul
PCR amplification product (recovery insert): 2ul
T4DNA ligase:1ul
ddH2O:1ul
The recombinant vector pGEM-T easy-WY193 was obtained by incubating at room temperature for 1 hour and then ligating at 4 ℃ overnight. The product after the connection is transformed into escherichia coli according to the following method:
the competent cells (100. mu.l DH5 α (CD 201) prepared by the calcium chloride method as shown in molecular cloning guidelines (third edition, science publishers) were removed from the refrigerator, and after thawing on ice, 10. mu.l of the ligation product obtained as above, i.e., pGEM-T easy-WY193 recombinant vector, was added, gently stirred, ice-cooled for 30min, 42 ℃ heat shock for 60s, ice-cooled for 3min, 600. mu.l LB medium pre-cooled at 4 ℃ (detailed in molecular cloning guidelines, third edition, science publishers), 37 ℃ recovery at 220rpm for 60min, 8000rpm centrifugation for 30s, supernatant was removed, 200. mu.l was retained, the mixture was resuspended in 200. mu.l supernatant, and then gently blown, a glass rod was coated with LB (ampicillin, X-gal) plate (detailed in scientific formulation: molecular cloning guidelines, third edition, publishers, publications), 37 ℃ culture for 12 h-16 h, 193 h, and the recombinant vector containing pGEM-T easy-193 was obtained, and the PCR product was analyzed by WY-WY 193 PCR products as shown in Wyy-Wyy vector (Wyy) for Wyy-193).
Sequencing results show that the WY193 promoter sequence in the obtained pGEM-T easy-WY193 cloning vector is correct.
EXAMPLE III construction of the PBI121-WY193 recombinant vector
A single colony of the DH5 α -WY193 strain obtained by the construction is picked up and shaken at 37 ℃ and 220rpm overnight, the plasmid is extracted by an OMEGA plasmid miniprep kit (D6943-01), then double digestion is carried out by HindIII (NEB, R0104S) and BamHI (NEB, R0136V) restriction enzymes, and the fragment of the WY193 promoter is recovered by an OMEGA recovery kit (D2500-01).
The recovered product obtained above is connected with PBI121 plasmid (TIANNZ, 60908-750y), then transformed into Escherichia coli, and positive clone is selected for sequencing, which proves accuracy.
Wherein, the connection conditions of the T/A clone are as follows:
T/A connection system: 10ul of
PBI121Vector:1ul
10×T4DNA Ligase Buffer:1ul
Recovery of product (WY193 promoter fragment): 6ul
T4DNA Ligase(Ta Ka Ra，D2011A)：0.5ul
ddH2O:1.5ul
The ligation was carried out overnight at 16 ℃ to obtain a PBI121-WY193 recombinant vector. The product after the connection is transformed into escherichia coli according to the following method:
the competent cells (100. mu.l DH5 α (Transgen, CD 201)) prepared by the calcium chloride method as shown in molecular cloning Experimental guideline (third edition, science publishers) were removed from the refrigerator, and after thawing on ice, 10. mu.l of the ligation product obtained above, i.e., the PBI121-WY193 recombinant vector, gently stirred, ice-cooled for 30min, 42 ℃ heat shock for 60s, ice-cooled for 3min, 600. mu.l of LB medium pre-cooled at 4 ℃ (detailed in molecular cloning Experimental guideline, third edition, science publishers), 37 ℃ recovered at 200rpm for 60min, centrifuged at 8000rpm for 30s, supernatant was removed, 200. mu.l was retained, the mixture precipitated by resuspension of the remaining 200. mu.l of supernatant was blown uniformly, a glass rod was coated with LB (kanamycin) plate (detailed in molecular cloning Experimental guideline, third edition, science publishers), inverted culture at 37 ℃ for 16h to 24h to obtain recombinant E.coli containing the PBI121-WY193 sequencing vector, and the result of the PCR gene clone Escherichia coli was shown in WID NO. WK.W 1, WK. 1.
Sequencing results show that the WY193 promoter sequence in the obtained PBI121-WY193 cloning vector is correct.
EXAMPLE four preparation of recombinant Agrobacterium tumefaciens LBA4404-WY193 cells
Selecting single colony of recombinant Escherichia coli DH5 α -PWY193, shaking in liquid LB culture medium containing 50ug/ml kanamycin, growing at 37 deg.C 200rpm to OD600About 0.5, mixed with competent cells of E.coli HB101 containing helper plasmid pRK2013 and recipient Agrobacterium LBA4404 in equal volume, spread on LB medium plates without any antibiotic solid with a smear stick, and cultured overnight at 28 ℃. The grown colonies were transferred to solid LB medium plates containing 50ug/ml kanamycin and 100ug/ml rifampicin using an inoculating needle and cultured at 28 ℃ for 3 to 4 days. The single colonies that grew out were again transferred to a solid containing 50ug/ml kanamycin and 100ug/ml rifampicinOn the LB medium plate, single colonies were picked and checked by colony PCR using LB liquid medium containing 50ug/ml kanamycin and 100ug/ml rifampicin at 37 ℃ and 200rpm with primers WY193F and WY193R, while plasmids were extracted and verified by double restriction with HindIII and BamHI restriction enzymes. The band of about 260bp is the recombinant Agrobacterium tumefaciens LBA4404-WY193 cell.
Example five recombinant Agrobacterium tumefaciens mediated transformation of Sansheng tobacco
1) Obtaining of tobacco aseptic seedlings
Loading the Sansheng tobacco seeds into a 1.5ml centrifuge tube (< 50 particles/tube), adding 1ml ddH2And O, putting the mixture into a refrigerator with the temperature of 4 ℃, and soaking for 2-3 days for vernalization. The vernalized three-raw tobacco seeds are sucked out of ddH by a liquid transfer gun2O, adding 1ml of 75% absolute ethyl alcohol, soaking for 2min, sucking out absolute ethyl alcohol by using a liquid transfer gun, repeatedly washing for 3-5 times by using ddH2O, and washing seeds by using ddH each time2O1 ml. Then adding 3% sodium hypochlorite solution into a liquid transfer gun to soak the seeds for 3min, and then adding ddH2Washing with O for 3-5 times, and sucking out ddH with pipette2And O. The water on the surface of the seeds is sucked by sterile filter paper, the Sansheng tobacco seeds are inoculated on an MS solid culture medium plate by a suction head for germination, 10-20 seeds are placed in each dish and are cultured in an illumination incubator (16h light and 8h dark) at 26 ℃ for one week, and the illumination intensity is 2000lx (all illumination culture of the invention is carried out under the illumination intensity). After the seedlings of the three-generation tobacco grow out, the three-generation tobacco is transferred to a tissue culture bottle filled with a fresh MS solid culture medium, 1 tobacco seedling in each bottle (phi 6cm, H11 cm, 50ml culture medium/bottle) is cultured for 3-5 weeks in an illumination incubator (16H light and 8H dark) at 26 ℃, and the three-generation tobacco aseptic seedlings are obtained.
Cutting off leaves and roots of the Sansheng tobacco aseptic seedlings, cutting stems into small sections with axillary buds, wherein each section is about 2-3cm in length, and clamping by using a gun forceps to vertically insert the morphological lower ends of the small sections into a tissue culture bottle containing a fresh MS solid culture medium. One stem segment with axillary bud is inoculated in each bottle, and the bottle is cultured for 3-5 weeks at 26 ℃ by illumination, and the material to be transformed is obtained.
2) Preparation of infection bacterial liquid
Single colony of recombinant Agrobacterium tumefaciens LBA4404-WY193 was transferred to a strain containing 50ug/ml kanamycin and 100ug/ml rifampicinThe LB liquid medium was shaken overnight at 28 ℃ and 200 rpm. A small amount of the suspension was transferred to 30-fold volume of LB liquid medium containing 50ug/ml kanamycin and 100ug/ml rifampicin, and the mixture was shaken under the same conditions. Cultured to OD600About 0.6-0.8, namely the infecting bacterium liquid.
3) Infection by infection
Cutting larger leaf from 3-5 weeks of aseptic seedling of Sansheng tobacco, and placing in container with little ddH2O in sterile petri dishes.
Beating tobacco leaf into leaf disc with a puncher with diameter of about 1cm, or cutting tobacco leaf into approximately square leaf disc with side length of about 1cm with a sterile scalpel, and placing another leaf disc containing a little ddH2O in sterile petri dishes.
The tobacco leaf discs were clamped out with a gun forceps and placed into a sterile 50ml centrifuge tube containing an appropriate amount of infecting bacteria solution. Gently shaking the centrifuge tube to ensure that the Agrobacterium is sufficiently contacted with the wound at the edge of the leaf disc, soaking for 10-25min, and shaking for several times. The tobacco leaf disk is fished out, transferred to dry sterile filter paper, and the bacterial solution is sucked dry. Transferring to MS solid culture medium plate without any antibiotic and containing 1.0 mg/L6-BA and 0.1mg/L NAA, with the leaf surface facing upwards, inoculating 4-10 leaf discs in each dish, and culturing in dark at 26 ℃ for 2 days.
4) Screening
The tobacco leaf discs after the dark culture are transferred to MS solid culture medium plates containing 5-10ug/ml kanamycin, 1.0 mg/L6-BA, 0.1mg/LNAA and 100ug/ml timentin, and are cultured by illumination at 26 ℃.
After 2-4 days of culture, the leaf discs without whitening were stained with GUS. After dyeing overnight at 37 ℃, decolorization is carried out three times by using 75% ethanol solution, chlorophyll is removed, and pictures are taken. As shown in FIG. 4, the triphytic tobacco leaf discs transformed by the recombinant Agrobacterium tumefaciens mediated transformation of the recombinant vector PBI121-WY193 containing the promoter WY193 became blue after GUS staining. The result shows that the WY193 promoter has a regulating effect on GUS genes in dicotyledonous model plant Sansheng tobacco.
GUS staining solution formula:
0.25mM K3Fe(CN)6,0.25mM K4Fe(CN)6,64mM Na2HPO4·12H2O,36mM KH2PO4，10mMNa2EDTA,0.1％Trition X-100,10％CH3OH,2.5mg/ml X-Gluc。
EXAMPLE sixthly, expression of GUS Gene in transgenic tobacco
And (3) continuously carrying out illumination culture on part of the transformed three-generation tobacco leaf discs, and carrying out subculture after about two weeks, wherein cluster buds appear after about four weeks.
When the cluster buds grow to 1-2cm, they are excised with a sterilized scalpel and inoculated into 1/2MS medium containing 5-10ug/ml kanamycin and 100ug/ml timentin, 1-4 strains per flask. Incubated at 26 ℃ for about 2 weeks with light. Taking tobacco plantlets with good rooting conditions, opening the cover of the tissue culture bottle in an incubator, and hardening seedlings for 2-3 days.
Most leaves of the transgenic tobacco plantlets are cut off, most culture mediums at roots are carefully washed off, and the plantlets are transplanted into sterilized soil for potting. Growing for 2-3 weeks, taking out new grown leaves, extracting DNA, and performing PCR amplification verification. The amplification primers are WY193F and WY 193R. The amplified product was subjected to 1% agarose electrophoresis, and the result is shown in FIG. 5, which yielded a band of about 250bp, which was identical to the size of WY193, and no band was observed in the PBI121 empty vector-transferred positive control and the wild type sterile seedling of Sansheng tobacco.
EXAMPLE seventhly, Induction and transformation of Rice callus
Rice callus is induced and transformed with recombinant Agrobacterium tumefaciens LBA4404-WY 193.
1) Rice seed sterilization
Mature japanese fine rice seeds were manually dehulled. Adding 70% ethanol, treating for 1-2min, removing ethanol, and washing with sterile water for three times. 0.1% HgCl was added2Soaking for 15min, and washing with sterile water for three times. And (5) drying for later use.
2) Induction and subculture of rice callus
Inoculating the sterilized embryo-containing rice grains to N6D culture medium, culturing in biochemical incubator at 29 deg.C for about 2 weeks, and inducing callus.
The grown rice callus is peeled off from the seeds, transferred to a new N6D culture medium, and subcultured. Subcultured approximately every two weeks.
3) Activation of agrobacterium LBA4404-WY193 and preparation of transformed bacterial liquid
The yellow-white, dry, active callus was selected and inoculated onto fresh N6D medium for three days.
Single colonies of recombinant Agrobacterium tumefaciens LBA44O4-WY193 were picked and shake cultured at 28 ℃ and 250rpm on liquid YM/YEP/LB medium containing 50ug/ml kanamycin and 100ug/ml rifampicin to OD600＝0.8-1.0。
Sucking 1ml of cultured bacterial liquid, adding into 50ml of YM/YEP/LB liquid culture medium containing 50ug/ml kanamycin, and continuously culturing to OD6000.8-1.0. Centrifuging at 4 deg.C and 4000rpm, precipitating thallus, and then re-suspending the bacterial liquid to OD with appropriate amount of MS600About 0.5 for standby.
4) Transformation of
Placing the subcultured rice callus into a sterilized culture dish, pouring the LBA4404-WY193 heavy suspension into the culture dish, and soaking the rice callus for 15-30 min. The rice calli were removed and placed on sterile filter paper and excess fluid was filtered off. A piece of sterilized filter paper was placed on the N6 co-culture medium. Putting the rice callus on filter paper, sealing and culturing, and dark culturing at 28 ℃ for 48-60 hours.
5) Screening
The infected rice calli were washed 3-4 times with 1% mannitol solution and then 3-4 times with sterile water shaking until the supernatant became clear. Finally, washing with 300mg/L of cefuroxime or 500mg/L of carbenicillin in sterile water for 3-4 times. The callus was placed on sterile filter paper and excess water was removed. Finally, the callus was inoculated on N6 medium containing 5-10ug/ml kanamycin and 300mg/L cefalotin or 500mg/L carbenicillin, sealed, cultured in the dark at 29 ℃ and subcultured once for about two weeks.
Example eight: expression of GUS Gene in callus of Nipponbare Rice
Rice calli transformed with LBA4404-WY193 were stained with GUS.
Prescription of GUS staining solution (1 ml):
0.25mM K3Fe(CN)6,0.25mM K4Fe(CN)6,64mM Na2HPO4·12H2O,36mM KH2PO4，10mMNa2EDTA,0.1％Trition X-100,10％CH3OH,2.5mg/ml X-Gluc。
rice calli transformed with LBA4404-WY193 were soaked in GUS staining solution at 37 ℃ overnight.
Photographing results are shown in FIG. 5, and the callus of the Agrobacterium tumefaciens-mediated transformation of the japonica clear rice containing the recombinant vector PBI121-WY193 turns blue after GUS staining. The color of the callus GUS of the japonica rice which is transferred by the agrobacterium tumefaciens mediated transformation and does not contain the recombinant vector PBI121-WY193 is not changed after the GUS is dyed. The result shows that the WY193 promoter has a regulating effect on the expression of GUS genes.
TABLE 2MS culture Medium formulation
Adjusting pH to 5.8, and sterilizing at 121 deg.C for 20 min.
TABLE 3N 6 culture Medium formulation
Adjusting pH to 5.2, and sterilizing at 121 deg.C for 20 min.
The foregoing is a more detailed description of the present invention that is presented in conjunction with specific embodiments, and the practice of the invention is not to be considered limited to those descriptions. It will be apparent to those skilled in the art that a number of simple derivations or substitutions can be made without departing from the inventive concept.
Sequence listing
<110> university of Hainan
<120> Erysiphe hevea endogenous promoter WY193 and use thereof
<141>2017-12-25
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>251
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gtgattatgg gttcaatctc tgcagctaat gacttttgtg ccgtgacaag cgcgctagag 60
ggtacaagtt caaagtgcta tttttctcgg agtggatgta ccaggttttt aagagataaa 120
aatttcttgc gtcaaaataa cgtgttggac ttgttgatcc tctcgacaat ctgtcaggca 180
agactttcgg atgcgaaaag aagaaagttg ttaaaataat cgtgcatcgg aattggtaat 240
ttagcgcgaa a 251
<210>2
<211>21
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gtgattatgg gttcaatctc t 21
<210>3
<211>19
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
tttcgcgcta aattaccaa 19
Claims (7)
1. The rubber powdery mildew endogenous promoter WY193 is characterized in that the nucleotide sequence of the promoter is shown as SEQ ID NO: 1 is shown.
2. The promoter according to claim 1, wherein the promoter is prepared by a method comprising: performing amplification by using a pair of amplification primers by using the genomic DNA of the rubber tree powdery mildew as a template, wherein the amplification primers are represented by SEQ ID NO: 1 the sequences in the genomic DNA of Blastomyces hevea are designed for the beginning and the end respectively.
3. A nucleic acid construct comprising the promoter of claim 1 operably linked to a gene sequence.
4. A recombinant vector, wherein the vector is obtained by recombining the promoter of claim 1 with pGEM-T easy or PBI121 plasmid.
5. A recombinant cell comprising the promoter of claim 1 or the nucleic acid construct of claim 3 or the recombinant vector of claim 4, wherein the recombinant cell is a recombinant E.coli cell or a recombinant A.tumefaciens cell.
6. A group of primer pairs is characterized in that the sequences of two primers of the primer pairs are respectively shown as SEQ ID NO: 2 and SEQ ID NO: 3 is shown in the specification; and the two primers of the primer pair are also respectively connected with restriction enzyme cutting sites and/or protective bases at the 5' ends.
7. Use of the promoter of claim 1 or the nucleic acid construct of claim 3 or the recombinant vector of claim 4 or the recombinant cell of claim 5 for regulating expression of a gene of interest in a plant or plant breeding, wherein the plant is Nicotiana trisica or Oryza sativa.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429297.3A CN107974454B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY193 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429297.3A CN107974454B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY193 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107974454A CN107974454A (en) | 2018-05-01 |
| CN107974454B true CN107974454B (en) | 2020-03-06 |
Family
ID=62007513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711429297.3A Expired - Fee Related CN107974454B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY193 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107974454B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943660A (en) * | 2018-10-17 | 2019-06-28 | 中国热带农业科学院环境与植物保护研究所 | For detecting primer pair, kit and the method for rubber tree powdery mildew bacterium |
| CN110144353B (en) * | 2019-05-31 | 2020-08-04 | 中国热带农业科学院橡胶研究所 | Rubber tree U6 gene promoter proHbU6.6 and cloning and application thereof |
| CN113999859A (en) * | 2021-10-29 | 2022-02-01 | 海南大学 | Screening method of rubber tree powdery mildew avirulence gene, effector protein and application |
| CN114317586A (en) * | 2021-12-31 | 2022-04-12 | 海南大学 | Fluorescent vector for marking rubber tree powdery mildew and expression method and application thereof |
| CN114540401A (en) * | 2022-01-06 | 2022-05-27 | 海南大学 | Carbendazim resistance screening vector for genetic transformation of rubber tree powdery mildew |
| CN114540402A (en) * | 2022-01-11 | 2022-05-27 | 海南大学 | Method for evaluating transformation efficiency of rubber tree powdery mildew genetic transformation system |
| CN116254267B (en) * | 2023-02-24 | 2024-04-05 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121004A (en) * | 2010-12-03 | 2011-07-13 | 西北农林科技大学 | Grape pathogen inducible promoter separating method and application in breeding for disease resistance |
-
2017
- 2017-12-26 CN CN201711429297.3A patent/CN107974454B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121004A (en) * | 2010-12-03 | 2011-07-13 | 西北农林科技大学 | Grape pathogen inducible promoter separating method and application in breeding for disease resistance |
Non-Patent Citations (2)
| Title |
|---|
| PePPER ：a webserver for prediction of prokaryote promoter elements and regulons;Anne de Jong 等;《BMC Genom》;20121231;第13卷(第299期);1-10 * |
| 橡胶树白粉菌真核表达启动子的预测、克隆及功能鉴定;王义 等;《中国植物病理学会2016年学术年会论文集》;20160805;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107974454A (en) | 2018-05-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107974454B (en) | Rubber powdery mildew endogenous promoter WY193 and application thereof | |
| CN108374012B (en) | Rubber powdery mildew endogenous promoter WY51 and application thereof | |
| CN107974455B (en) | Rubber powdery mildew endogenous promoter WY7 and application thereof | |
| Sharma et al. | A simple and efficient Agrobacterium-mediated procedure for transformation of tomato | |
| JP4739634B2 (en) | Kestrum Yellow Leaf Curling Virus Promoter | |
| CN109369790B (en) | Rice bacterial blight resistance-related protein OsBBR1, and coding gene and application thereof | |
| CN107760681B (en) | Promoter WY195 and uses thereof | |
| CN113174389A (en) | Lilium regale inducible promoter PR4 and application thereof | |
| WO2000056895A1 (en) | COTTON LEAF CURL VIRUS (CLCuV) PROMOTER AND ITS USE | |
| CN106011141B (en) | Ming River lily inducible promoter and its application | |
| CN112708625A (en) | Lilium regale inducible promoter PG1 and application thereof | |
| CN111424037B (en) | Cymbidium CgWRKY70 gene and application thereof | |
| CN110684089B (en) | Application of plant stress tolerance related protein GmMYB118 in regulation and control of plant stress tolerance | |
| KR101557043B1 (en) | Constitutive expression promoter from chrysanthemum | |
| Sugiharto et al. | A Comparison Study for Agrobacterium-mediated transformation Method in Sugarcane (Saccharum spp L.) | |
| Hasan et al. | Transformation of tomato (Lycopersicon esculentum Mill.) with Arabidopsis early flowering gene APETALAI (API) through Agrobacterium infiltration of ripened fruits | |
| CN111304222B (en) | Cymbidium CgWRKY11 gene and application thereof | |
| CN111269915B (en) | Bacterial blight resistance related gene Xa39(t), related biological material thereof and method for cultivating bacterial blight resistant rice | |
| JP2004528854A (en) | New constitutive plant promoter | |
| CN117721111B (en) | Mangrove plant avicennia marina endogenous promoter AMGT P5 and application thereof | |
| CN106146636B (en) | Callus initiation development related protein GaLBD-2 and related biological material and application thereof | |
| Rafique et al. | Comparison of transgenic plant production for bacterial blight resistance in Pakistani local rice (Oryza sativa L.) cultivars | |
| CN112760322B (en) | Rice constitutive strong promoter and application thereof | |
| CN111875684B (en) | Disease-resistant heat-resistant related protein TaRHP1, related biological material thereof and method for cultivating disease-resistant heat-resistant plants | |
| CN114540354B (en) | Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200306 Termination date: 20211226 |