CN107974454A - Rubber tree powdery mildew endogenesis promoter WY193 and application thereof - Google Patents
Rubber tree powdery mildew endogenesis promoter WY193 and application thereof Download PDFInfo
- Publication number
- CN107974454A CN107974454A CN201711429297.3A CN201711429297A CN107974454A CN 107974454 A CN107974454 A CN 107974454A CN 201711429297 A CN201711429297 A CN 201711429297A CN 107974454 A CN107974454 A CN 107974454A
- Authority
- CN
- China
- Prior art keywords
- promoter
- nucleotide sequence
- seq
- powdery mildew
- recombinant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of rubber tree powdery mildew endogenesis promoter WY193 and application thereof, the promoter WY193 to have SEQ ID NO：Nucleotide sequence shown in 1, or its variation with promoter function.The invention further relates to the nucleic acid construct containing the promoter, carrier, recombinant cell, genetically modified plants, explant and callus.The promoter can be used in regulating and controlling the expression of dicotyledon and the external source target gene in monocotyledon, and a kind of brand-new instrument and selection are provided for the gene expression of genetically modified plants.
Description
Technical field
The invention belongs to gene engineering technology field, and in particular to rubber tree powdery mildew endogenesis promoter WY193 and its use
On the way.
Background technology
Promoter is RNA polymerase identification and the site combined, is cis element important in gene expression regulation.And core
Heart promoter is then that the most short continuous DNA sequence of transcription initiation can be accurately instructed by RNase mechanism of action, including
TATAbox, starting, downstream core promoter element, TFIIB recognition components and motif ten element.
Currently active sub classification foundation mainly controls transcriptional level and two kinds of the mode of action and function.Turned according to control
Horizontal height is recorded, promoter can be divided into strong promoter and weak promoter；According to transcriptional profile, promoter is opened including composing type
Mover, tissue-specific promoter and inducible promoter.Tissue-specific promoter is to be kept in most or whole tissues
The promoter of continuous activity, and inducible promoter is then the promoter by extraneous chemically or physically signals-modulating, it induces source
Mainly chemokines, physical agent, artificial synthesized chemical inducer three major types.
It has been generally acknowledged that separated constitutive promoter shows higher in unifacial leaf genetically modified plants from monocotyledon
Transcriptional activity, and can improve transcriptional level containing introne between promoter and reporter gene.At present, people have developed
It is adapted to the gene of monocotyledon high efficient expression to have rice Actin I promoters and corn Ubiquitin promoters etc..In addition,
Lee has found to start the expression of CAT genes than using the gene table that 35S starts using Ubiquitin promoters in corn for people et al.
10 times are higher by up to efficiency, and Lu etc. is also separated to new rubi3 promoters from rice, it can make gene table in each tissue
Reach, and start activity and be higher than the Ubi-1 promoters found in corn, potent and great application prospect.
The startup of tectotype present in monocotyledon subcategory is less at present, the Lem1 being mainly separated to from barley
Promoter, the main promotor gene of the promoter are expressed in the lemma and glumelle of barley；Ca also in rice2+- ATPase is opened
Mover total length has vascular tissue expression specificity, which can also ring the various abiotic stress such as arid, high salt, pathogen
Should.
There are a large amount of inducible promoters, wherein rice contribute to most contributions in monocotyledon.At present, from water
The promoter being cloned into rice has Rab16A Salt treatments promoter, Os HsfB2cp, PM19p, Hsp90p heat shock promoter, Td
Cor39 cold induced promoters, Rab16B ABA evoked promoters, LHCPII and R4CL-1 photoinduction promoters, Os EBP-89 diseases
Pathogenic microorganism evoked promoter.And the promoter being cloned into wheat is mainly following four：Mwcs120 and Wcorl5 are cold-induced
Promoter, EmABA evoked promoters and Cab photoinduction promoters.Equally also there is the inducible promoter cloned in barley,
Such as the drought-induced promoter of blt4.9 and blt101.1 cold induced promoters, Dhn4s and the induction of PGIII pathogenic microorganisms start
Son.Also indivedual inducible promoters are occurred in corn, rhizoma Gastrodiae.And also there are the feelings being induced by a wide variety of factors in individual promoter
Os DREB1B promoters in condition, such as rice can then be induced by salt, ABA, PEG abiotic stress and other biological stress
Deng.
Ca MV35S promoters have the characteristics that the high efficient expression in dicotyledon, and can all cells and it is any when
Time is transcribed, and is had very big advantage for obtaining a large amount of foreign proteins, has been widely used in starting the table of foreign gene
Reach.
Tectotype promoter such as citrus bast protein gene (Cs PP) promoter, plan in many dicotyledons
Southern mustard bast gene (At PP2) promoter and arabidopsis sucrose transporter gene (At SUC2) promoter, because having plant
Thing hormone response element, photoreactive element, biology and abiotic stress response element and tissue specific expression element, thus
Ability with the phloem specific expressing in plant vasular tissue.The cowpea storage protein gene 8SG α of discovered in recent years
GUS Enzyme activities under promoter driving are 2-4 times of CaMV35s promoter activities, and the promoter has seed expression spy
The opposite sex.
In current inducible promoter present Research, dicotyledon has more species compared with monocotyledon, relates to
And plant scope is also wider.Wherein, the inducible promoter in arabidopsis occupies half of the country：It is presently found have CBF2,
6 kinds of cor15a, cor15b, ADH, LT178, At rd29A cold induced promoters, rd22, cor15, rab18, ABA5 and
AtNCED3ABA evoked promoters, Rd29A and the drought-induced promoters of AtNCED3 and Psy photoinduction promoters.And have in tobacco
Nt HSP3A heat shock promoters, Nt Cel7 growth hormone inductions promoters and the induction of PPP1, PPP2, PPP3 pathogenic microorganism are opened
Mover.In addition, in the dicotyledons such as soybean, cotton, pea, mung bean, also it is found that more induction types open successively
Mover.
Constitutive promoter achieves huge success in terms of expression alien gene, is currently still widely used.It is but special
Specific Promoters are also more and more important in GM food and gene timing localization and expression etc..
Filamentous fungi is for example all kinds of antibiotic of industrial many staple products, also has the important source material of many enzyme preparations.
On the one hand a large amount of productions of these industrial products illustrate importance of the filamentous fungi for human lives and industry, on the other hand
The filamentous fungi expression quantity very huge when expressing its endogenous gene is further illustrated, its endogenesis promoter is very powerful, starts
Child resource is very abundant.If its promoter expression alien gene can be utilized, this will provide what is more enriched for transgenic engineering
Resource.Hysteresis is generally compared in the molecular studies of filamentous fungi, and many filamentous fungis, especially there is no the obligate of method cultured in vitro to post
Raw fungi, genetic conversion system all not yet foundation or perfect.It was found that and utilize fungi endogenesis promoter, to structure fungi itself
Genetic conversion system is also very useful.
For in place of above the deficiencies in the prior art, the present invention by the further investigation to rubber tree powdery mildew genome,
Provide a kind of rubber tree powdery mildew endogenesis promoter WY193.
The technical solution that the present invention takes is as follows：
A kind of rubber tree powdery mildew endogenesis promoter WY193, the promoter contain selected from following any one group and have
The nucleotide sequence of promoter function：
a、SEQ ID NO：Nucleotide sequence shown in 1；
B, with SEQ ID NO：1 complementary nucleotide sequence；
C, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b；
D, the core that substitution, missing, the addition of one or more bases are modified is carried out to nucleotide sequence shown in above-mentioned a or b
Nucleotide sequence；
E, there is the nucleotide sequence of at least 90% homology with nucleotide sequence shown in above-mentioned a or b.
Preferably, the preparation method of the promoter includes：Using rubber tree powdery mildew genomic DNA as template, one is used
Amplimer is expanded, the amplimer is according to SEQ ID NO：1 sequence in rubber tree powdery mildew genomic DNA
It is designed respectively for head and the tail.
Further, the invention further relates to a kind of nucleic acid construct, it includes the promoter of the present invention, can be grasped with promoter
Make the gene order connected.
Further, the invention further relates to a kind of recombinant vector, the carrier is promoter and pGEM-T of the invention
Easy or 121 plasmids of PBI are through restructuring gained.
Further, the invention further relates to a kind of recombinant cell, the cell contains the promoter or right of claim 1
It is required that 3 nucleic acid construct or the recombinant vector of claim 4.
Preferably, the recombinant cell is recombinant Bacillus coli cells or restructuring Agrobacterium tumefaciens cell.
Further, the invention further relates to one group of primer pair, two primers of the primer pair to contain SEQ ID respectively
NO：2 and SEQ ID NO：Sequence shown in 3；Restricted digestion is also respectively connected at 5 ' ends in two primers of the primer pair
Site and/or protection base.
Further, the invention further relates to a kind of genetically modified plants, the genetically modified plants conversion the startup of the present invention
The recombinant cell of son or nucleic acid construct or recombinant vector or the infection present invention.
Further, the invention further relates to a kind of plant callus or explant, the callus or explant to turn
Change the promoter for having the present invention or nucleic acid construct or recombinant vector or the recombinant cell infected with the present invention.
Further, the invention further relates to the promoter WY193 or described nucleic acid constructs or the recombinant vector or
The recombinant cell is in destination gene expression in regulating and controlling plant or the purposes in plant breeding.
Compared with prior art, the beneficial effects of the invention are as follows：
A kind of new promoter WY193 from rubber tree powdery mildew is provided, the promoter can be used in regulating and controlling
The expression of external source target gene in dicotyledon and monocotyledon, one kind is provided for the gene expression of genetically modified plants
Brand-new instrument and selection, also provide a beneficial thinking for the structure of rubber tree powdery mildew genetic conversion system.
Brief description of the drawings
Fig. 1 is the plasmid map of recombinant vector PBI121-WY193.
The three lives cigarette for the restructuring Agrobacterium-Mediated Transformation that Fig. 2 is promoter WY193 recombinant vectors PBI121-WY193
The GUS coloration results of leaf dish.
In figure, WY193 is the GUS coloration results that PBI121-WY193 converts three lives tobacco leaf disk；CK+(CaMV35S)：By
The GUS coloration results of the PBI121 empty carriers conversion three lives tobacco leaf disk of CaMV35S regulation and control gus gene transcriptions；CK-(aseptic seedling) is
The GUS coloration results of unconverted three lives cigarette aseptic seedling leaf dish.
Fig. 3 is each growth period figure of WY193 transgenosis three lives cigarettes；
In figure, co-cultivation phase, callus phase, lateral bud phase, the phase of taking root, Adult plant are followed successively by from left to right.
Fig. 4 is the PCR amplification testing result that WY193 regulates and controls gus gene transgenosis three lives cigarette；
In figure, M：Marker2000；WY193：WY193 regulates and controls gus gene transgenosis three lives Tobacco Leaves DNA；CK+：Turn
The transgenosis three lives cigarette of PBI121 empty carriers；CK-：Wild type three lives cigarette.
Rice (the day for the restructuring Agrobacterium-Mediated Transformation that Fig. 5 is promoter WY193 recombinant vectors PBI121-WY193
This is fine) the GUS coloration results of callus；
In figure, WY193：The GUS coloration results of PBI121-WY193 rice transformation callus leaf dishes；CK+(CaMV35S)：By
The GUS coloration results of the PBI121 empty carrier rice transformation callus of CaMV35S regulation and control gus gene transcriptions；CK-：Unconverted day
The GUS coloration results of this fine rice callus.
Embodiment
The present invention is described in further detail below by embodiment combination attached drawing.
The PCR amplification of embodiment one, WY193 promoter fragments
Use fungal genomic DNA extracts kit (OMEGA, D3390-01) extraction rubber tree powdery mildew (Hainan Province's heat
There is provided with living resources sustainable use key lab) genomic DNA, according to the sequence of WY193 promoters, design is a pair of
(sense primer WY193F, adds restriction enzyme site Hind III and protection base, anti-sense primer to specificity amplification primer
WY193R, adds restriction enzyme site BamH I and protection base).Using the genomic DNA of the rubber tree powdery mildew of said extracted as
Template, PCR amplification is carried out using high-fidelity Ex Taq polymerases (TRANSGEN, AP122).As shown in table 1.
The PCR system of 1 gene promoter of table amplification
PCR amplification program is：94 DEG C of pre-degeneration 5min, then with 94 DEG C of denaturation 60s, 55 DEG C of annealing 50s, 72 DEG C extend
60s, carries out 35 reaction cycles, last 72 DEG C of extensions 5min.
Wherein, sense primer WY193F：CCCAAGCTTGTGATTATGGGTTCAATCTCT, wherein underscore represent Hind
III restriction enzyme site.Anti-sense primer WY193R：CGGGATCCTTTCGCGCTAAATTACCAA, wherein underscore represent I digestions of BamH
Site.
Pcr amplification product is separated through 1.0% agarose gel electrophoresis, obtains band of the size for 260bp or so, is used
OMEGA Ago-Gel DNA QIAquick Gel Extraction Kit (catalog number (Cat.No.)s：D2500-01 purifying recycling) is carried out.
The structure of embodiment two, pGEM-T easy-WY193 recombinant vectors
Pcr amplification product obtained above is subjected to T/A clones (pGEM-T easy plasmids, PROMEGA, A1360) conversion
Escherichia coli (TRANSGEN, CD201), picking positive colony sequencing, it was demonstrated that accurate.
Wherein, the condition of contact of T/A clones is as follows：
T/A linked systems：10ul
PGEM-T Easy Vector (PROMEGA, A137A):1ul
2×Rapid ligation Buffer:5ul
Pcr amplification product (recycling Insert Fragment)：2ul
T4DNA ligase:1ul
ddH2O:1ul
First be placed in room temperature 1 it is small when, then in 4 DEG C connection overnight, obtain pGEM-T easy-WY193 recombinant vectors.Will be through
The product crossed after above-mentioned connection converts Escherichia coli as follows：
In refrigerator take out according to《Molecular Cloning:A Laboratory guide》Prepared by Calcium Chloride Method shown in (third edition, Science Press)
100 μ l DH5 α (Transgene, CD201) of competent cell, after melting on ice, add 10 μ l connection products as obtained above,
That is pGEM-T easy-WY193 recombinant vectors, gently stir evenly, ice bath 30min, 42 DEG C of heat shock 60s, ice bath 3min, add 600 μ l
(specific formula refers to the LB culture mediums of 4 DEG C of precoolings《Molecular Cloning:A Laboratory guide》, the third edition, Science Press), 37 DEG C
220rpm recoveries 60min, 8000rpm centrifugation 30s, removes supernatant, leaves and takes 200 μ l, after precipitation is resuspended with remaining 200 μ l supernatants
Mixture, gently blows even, and (specific formula refers to tablet glass rod coating LB (ampicillin, IPTG, X-gal)《Molecular cloning
Experiment guide》, the third edition, Science Press), 37 DEG C are inverted culture 12h~16h.Acquisition contains pGEM-T easy-WY193 gram
The recombination bacillus coli of grand carrier, is named as DH5 α-WY193.Shenzhen Huada Genetic Technology Co., Ltd is to pGEM-T easy-
WY193 in WY193 cloning vectors is sequenced, sequencing result such as SEQ ID NO：Shown in 1.
Sequencing result shows that WY193 promoter sequences are correct in the pGEM-T easy-WY193 cloning vectors of acquisition.
The structure of embodiment three, PBI121-WY193 recombinant vectors
DH5 α-WY193 bacterial strain picking the single bacterium colonies that above-mentioned structure obtains are carried out shaking bacterium, 37 DEG C of 220rpm shake bacterium and stay overnight,
Extract plasmid with the small extraction reagent kit of OMEGA plasmids (D6943-01), then with Hind III (NEB, R0104S) and BamH I (NEB,
R0136V) restriction enzyme carries out double digestion, and digestion products are recycled with OMEGA QIAquick Gel Extraction Kits (D2500-01)
WY193 promoter fragments.
Recovery product obtained above and PBI121 plasmids (TIANNZ, 60908-750y) are attached, then converted
Escherichia coli, picking positive colony sequencing, it was demonstrated that accurate.
Wherein, the condition of contact of T/A clones is as follows：
T/A linked systems：10ul
PBI121Vector:1ul
10×T4DNA Ligase Buffer:1ul
Recovery product (WY193 promoter fragments)：6ul
T4DNA Ligase (Ta Ka Ra, D2011A)：0.5ul
ddH2O:1.5ul
16 DEG C of connections overnight, obtain PBI121-WY193 recombinant vectors.By the product after above-mentioned connection according to as follows
Method converts Escherichia coli：
In refrigerator take out according to《Molecular Cloning:A Laboratory guide》Prepared by Calcium Chloride Method shown in (third edition, Science Press)
100 μ l DH5 α (Transgen, CD201) of competent cell, after melting on ice, add 10 μ l connection products as obtained above, i.e.,
PBI121-WY193 recombinant vectors, gently stir evenly, ice bath 30min, 42 DEG C of heat shock 60s, ice bath 3min, and it is pre- to add 4 DEG C of 600 μ l
(specific formula refers to cold LB culture mediums《Molecular Cloning:A Laboratory guide》, the third edition, Science Press), 37 DEG C of 200rpm recoveries
60min, 8000rpm centrifuge 30s, remove supernatant, leave and take 200 μ l, the mixture after precipitation are resuspended with remaining 200 μ l supernatants, gently
Featheriness is even, and (specific formula refers to glass rod coating LB (kanamycins) tablet《Molecular Cloning:A Laboratory guide》, the third edition, science
Publishing house), 37 DEG C are inverted culture 16h~24h.Obtain the recombination bacillus coli containing PBI121-WY193 cloning vectors, name
For DH5 α-PWY193.Shenzhen Huada Genetic Technology Co., Ltd surveys the WY193 in PBI121-WY193 cloning vectors
Sequence, sequencing result such as SEQ ID NO：Shown in 1.
Sequencing result shows that WY193 promoter sequences are correct in the PBI121-WY193 cloning vectors of acquisition.
Example IV, the preparation for recombinating agrobacterium tumefaciens lba4404-WY193 cells
Recombination bacillus coli DH5 α-PWY193 pickings single bacterium colonies are cultivated in the liquid LB containing 50ug/ml kanamycins
Bacterium is shaken in base, 37 DEG C of 200rpm, grow into OD600For 0.5 or so, the Escherichia coli HB101 of plasmid pRK2013 is assisted with containing
Mixed in equal volume with the competent cell of acceptor Agrobacterium LBA4404, be coated on paint daubs and do not contain any antibiotic solid
LB culture medium flat plates on, 28 DEG C of overnight incubations.The bacterium colony grown is transferred to the kanamycins containing 50ug/ml with transfer needle
On the solid LB media tablet of 100ug/ml rifampins, 28 DEG C are cultivated 3 to 4 days.The single bacterium colony grown is transferred to again
On the solid LB media tablet of kanamycins containing 50ug/ml and 100ug/ml rifampins, picking single bacterium colony is with containing
The kanamycins of 50ug/ml and the LB fluid nutrient mediums of 100ug/ml rifampins shake bacterium, 37 DEG C of 200rpm, with primer pair
WY193F, WY193R carry out bacterium colony PCR verifications, while extract plasmid and carry out double enzymes with Hind III and I restriction enzymes of BamH
Cut verification.Band is restructuring agrobacterium tumefaciens lba4404-WY193 cells for 260bp's or so.
Embodiment five, restructuring Agrobacterium-Mediated Transformation three lives cigarette
1) acquisition of tobacco aseptic seedling
Three lives cigarette seed is loaded into 1.5ml centrifuge tubes (＜ 50/pipe), adds 1ml ddH2O, is put into 4 DEG C of refrigerators, immersion
Carry out vernalization within 2-3 days.The good three lives cigarette seed of vernalization suctions out ddH with liquid-transfering gun2O, adds the soaked in absolute ethyl alcohol of 1ml75%
2min, suctions out absolute ethyl alcohol with liquid-transfering gun, is washed repeatedly 3 to 5 times with ddH2O, clean seed, use ddH every time2O 1ml.Then again
The liquor natrii hypochloritis that 3% is added with liquid-transfering gun soaks seed 3min, then uses ddH2O is washed 3 to 5 times, is finally suctioned out with liquid-transfering gun
ddH2O.The moisture of the surface of the seed is blotted with aseptic filter paper, then three lives cigarette seed is inoculated in MS solid medium tablets with suction nozzle
On sprouted, per 10-20, ware, be placed in 26 DEG C of illumination boxs (16h light 8h is dark) and cultivate one week, intensity of illumination is
2000lx (all illumination cultivations of the invention carry out under this intensity of illumination).After three lives cigarette grows seedling, it is transferred to and is equipped with
The tissue culture bottle of fresh MS solid mediums, every bottle (Φ 6cm, H 11cm, 50ml culture medium/bottle) 1 plant of tobacco seedling, 26 DEG C of illumination
Incubator (16h light 8h is dark) is cultivated 3-5 weeks, obtains three lives cigarette aseptic seedling.
The blade and root of three lives cigarette aseptic seedling are wiped out, cane is cut to the segment with axillary bud, per segment length about 2-3cm, is used
Rifle tweezer lives its morphology lower end is inserted perpendicularly into the tissue culture bottle containing fresh MS solid mediums.Every bottle of inoculation one carries
The stem section of axillary bud, 26 DEG C of illumination cultivations 3-5 weeks, this material i.e. to be transformed.
2) preparation of bacterium solution is infected
Will restructuring agrobacterium tumefaciens lba4404-WY193 picking single bacterium colonies be transferred to the kanamycins containing 50ug/ml and
The LB fluid nutrient mediums of 100ug/ml rifampins shake bacterium, and 28 DEG C of 200rpm shake bacterium and stay overnight.Draw a small amount of bacterium solution and be transferred to 30 times of volumes
The kanamycins containing 50ug/ml and 100ug/ml rifampins LB fluid nutrient mediums, the same terms carry out rereeling.Culture is extremely
OD600For 0.6-0.8 or so, bacterium solution is as infected.
3) infect
The blade larger from clip in the sterile three lives tobacco seedlings of culture 3-5 weeks, is contained into equipped with a little ddH2The sterile culture of O
In ware.
Tobacco leaf is broken into leaf disc with the card punch of diameter about 1cm, or is cut tobacco leaf with aseptic operation knife
For the leaf dish of the approximating square of the length of side about 1cm, it is put into another and a little ddH is housed2In the sterile petri dish of O.
Tobacco Leaf disk folder is gone out with rifle tweezer, is put into equipped with the sterile 50ml centrifuge tubes for infecting bacterium solution in right amount.Gently shake
Centrifuge tube, it is ensured that Agrobacterium is adequately exposed to the wound at leaf dish edge, soaks 10-25min, during which constantly rocks several times.Pull out
Tobacco leaf disc, is transferred on dry aseptic filter paper, blots bacterium solution.It is transferred to and is free of any antibiotic, contains 1.0mg/L 6-
In the MS solid medium tablets of BA and 0.1mg/L NAA, blade face upward, 4-10 block leaf dishes, 26 DEG C of light cultures 2 is inoculated with per ware
My god.
4) screen
The tobacco leaf disc that light culture terminates is transferred to containing 5-10ug/ml kanamycins and 1.0mg/L 6-BA, 0.1mg/L
In the MS solid medium tablets of NAA and 100ug/ml Ticarcillin/Clavulanate Acids, 26 DEG C of illumination cultivations.
After culture 2-4 days, the leaf dish not bleached is taken to carry out GUS dyeing.With 75% ethanol solution after 37 DEG C of stained over night
Decolourized three times, to eliminate chlorophyll, taken pictures.The results are shown in Figure 4, through the recombinant vector PBI121- containing promoter WY193
The three lives tobacco leaf disk of the restructuring Agrobacterium-Mediated Transformation of WY193 becomes blue after GUS is dyed.The results show present invention's
WY193 promoters have regulating and controlling effect in dicotyledonous model plant three lives cigarette to gus gene.
GUS prescription of its dyeing liquor：
0.25mM K3Fe(CN)6,0.25mM K4Fe(CN)6,64mM Na2HPO4·12H2O,36mM KH2PO4, 10mM
Na2EDTA, 0.1%Trition X-100,10%CH3OH,2.5mg/ml X-Gluc。
The expression of gus gene in embodiment six, transgene tobacco
Take the above-mentioned transformed three lives tobacco leaf disk in part to continue illumination cultivation, about subculture after two weeks, about clump occur after four weeks
Sprout.
When Multiple Buds grow into 1-2cm, cut with the scalpel to sterilize, be inoculated into that is mould containing 5-10ug/ml cards
In the 1/2MS culture mediums of element and 100ug/ml Ticarcillin/Clavulanate Acids, every bottle 1-4 plants.26 DEG C of illumination cultivations about 2 weeks.Take condition of rooting good
Tobacco seedling, in incubator open tissue culture bottle lid, hardening 2-3 days.
Most of blade of transgene tobacco seedling is wiped out, root major part culture medium is carefully washed off, is transplanted to sterilized
Soil in, carry out it is potted plant.Growth about 2-3 weeks, takes the young leaves grown to extract DNA and carries out PCR amplification verification.Amplimer is
WY193F、WY193R.Amplified production as a result as Fig. 5 is shown, has obtained the band of a treaty 250bp through 1% agarose electrophoresis,
It is in the same size with WY193, turn PBI121 empty carriers positive control and three lives cigarette wild type aseptic seedling then without band.
The induction and conversion of embodiment seven, Rice Callus
Inducing paddy rice callus, the callus is converted with restructuring agrobacterium tumefaciens lba4404-WY193.
1) rice paddy seed sterilizes
Ripe Nipponbare rice paddy seed is shelled by hand.Add 70% Ethanol Treatment 1-2min, evacuation ethanol, uses sterile water
Flush three times.Add 0.1%HgCl215min is soaked, with aseptic water washing three times.Dry, it is spare.
2) induction of Rice Callus and subculture
The grain of rice containing embryo after disinfection is inoculated on N6D culture mediums, 29 DEG C of biochemical cultivation case cultures 2 weeks or so, induction is cured
Injured tissue produces.
The Rice Callus grown is peeled off from seed, is transferred on new N6D culture mediums, squamous subculture.About
Subculture is once every two weeks.
3) prepared by the activation of Agrobacterium LBA4404-WY193 and transformed bacteria solution
Yellow-white is selected, dry enlivens callus, is inoculated on new N6D culture mediums and cultivates three days.
The single bacterium colony of picking restructuring Agrobacterium tumefaciems LBA44O4-WY193, in kanamycins and 100ug/ containing 50ug/ml
In on the liquid YM/YEP/LB culture mediums of ml rifampins, 28 DEG C, 250rpm shake cultures to OD600=0.8-1.0.
Draw the YM/YEP/LB fluid nutrient mediums that the cultured bacterium solutions of 1ml add kanamycins of the 50ml containing 50ug/ml
In, continue culture to OD600=0.8-1.0.4 DEG C, 4000rpm centrifugations precipitate thalline, then use containing appropriate MS resuspended bacterium solutions extremely
OD600=0.5 or so, it is spare.
4) convert
The Rice Callus of squamous subculture is put into sterilizing culture dish, LBA4404-WY193 re-suspension liquids are poured into training
Support ware, immersion Rice Callus 15-30min.Rice Callus is removed and is placed in sterilizing filter paper, filters surplus liquid.
N6 is co-cultured and is put a sterilizing filter paper on base.Rice Callus is put on filter paper, sealing culture, 28 DEG C of light culture 48-60
Hour.
5) screen
Infected Rice Callus is cleaned 3-4 times with 1% mannitol solution, then with sterile water oscillation cleaning
3-4 times, clarified until supernatant becomes.Most Hou is with the cephalosporin of 300mg/L or the sterile water of the carbenicillin of 500mg/L
Solution cleans 3-4 times.Callus is placed on aseptic filter paper, removes excessive moisture.Most Hou by callus be inoculated into containing
It is close on the N6 culture mediums of the kanamycins of 5-10ug/ml and the carbenicillin of the cephalosporin of 300mg/L or 500mg/L
Envelope, 29 DEG C of light cultures, about two weeks subcultures are once.
Embodiment eight：The expression of gus gene in Nipponbare Rice Callus
The Rice Callus converted with LBA4404-WY193 is subjected to GUS dyeing.
The formula (1ml) of GUS dyeing liquors：
0.25mM K3Fe(CN)6,0.25mM K4Fe(CN)6,64mM Na2HPO4·12H2O,36mM KH2PO4, 10mM
Na2EDTA, 0.1%Trition X-100,10%CH3OH,2.5mg/ml X-Gluc。
It is immersed in the LBA4404-WY193 Rice Callus converted in 37 DEG C in GUS dyeing liquors, overnight.
Take pictures, the results are shown in Figure 5, the Japan of the Agrobacterium-Mediated Transformation containing recombinant vector PBI121-WY193
Become blueness after fine Rice Callus GUS dyeing.Agrobacterium-Mediated Transformation without recombinant vector PBI121-WY193
Color is constant after Nipponbare Rice Callus GUS dyeing.The result shows that the table of WY193 promoters of the invention to gus gene
Up to regulating and controlling effect.
2 MS culture medium prescriptions of table
PH is adjusted to 5.8,121 DEG C of sterilizing 20min.
3 N6 culture medium prescriptions of table
PH is adjusted to 5.2,121 DEG C of sterilizing 20min.
Above content is to combine specific embodiment further description made for the present invention, it is impossible to assert this hair
Bright specific implementation is confined to these explanations.For general technical staff of the technical field of the invention, do not taking off
On the premise of from present inventive concept, some simple deduction or replace can also be made.
Sequence table
<110>University Of Hainan
<120>Rubber tree powdery mildew endogenesis promoter WY193 and application thereof
<141> 2017-12-25
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 251
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
gtgattatgg gttcaatctc tgcagctaat gacttttgtg ccgtgacaag cgcgctagag 60
ggtacaagtt caaagtgcta tttttctcgg agtggatgta ccaggttttt aagagataaa 120
aatttcttgc gtcaaaataa cgtgttggac ttgttgatcc tctcgacaat ctgtcaggca 180
agactttcgg atgcgaaaag aagaaagttg ttaaaataat cgtgcatcgg aattggtaat 240
ttagcgcgaa a 251
<210> 2
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
gtgattatgg gttcaatctc t 21
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
tttcgcgcta aattaccaa 19
Claims (10)
1. rubber tree powdery mildew endogenesis promoter WY193, it is characterised in that the promoter contains selected from following any one group simultaneously
Nucleotide sequence with promoter function：
a、SEQ ID NO：Nucleotide sequence shown in 1；
B, with SEQ ID NO：1 complementary nucleotide sequence；
C, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b；
D, the nucleotide that substitution, missing, the addition of one or more bases are modified is carried out to nucleotide sequence shown in above-mentioned a or b
Sequence；
E, there is the nucleotide sequence of at least 90% homology with nucleotide sequence shown in above-mentioned a or b.
2. promoter according to claim 1, it is characterised in that the preparation method of the promoter includes：With rubber tree
Powdery mildew genomic DNA is template, is expanded using pair for amplification primer, and the amplimer is according to SEQ ID NO：1
Sequence in rubber tree powdery mildew genomic DNA is designed for head and the tail respectively.
3. a kind of nucleic acid construct, it is characterised in that it includes the promoter described in claim 1, with the operable company of promoter
The gene order connect.
A kind of 4. recombinant vector, it is characterised in that the carrier for the promoter described in claim 1 and pGEM-T easy or
PBI121 plasmids are through restructuring gained.
5. a kind of recombinant cell, it is characterised in that the cell contains the promoter of claim 1 or the nucleic acid of claim 3
The recombinant vector of construct or claim 4.
6. a kind of recombinant cell according to claim 5, it is characterised in that the recombinant cell is thin for recombination bacillus coli
Born of the same parents or restructuring Agrobacterium tumefaciens cell.
7. one group of primer pair, it is characterised in that two primers of the primer pair contain SEQ ID NO respectively：2 and SEQ ID
NO：Sequence shown in 3；Restriction enzyme site and/or protection is also respectively connected at 5 ' ends in two primers of the primer pair
Base.
8. a kind of genetically modified plants, it is characterised in that the promoter or core that the genetically modified plants conversion is had the right described in requirement 1
The recombinant cell of acid con-struct or recombinant vector or the infection present invention.
9. a kind of plant callus or explant, it is characterised in that callus or the explant conversion has the present invention's
Promoter or nucleic acid construct or recombinant vector or the recombinant cell infected with the present invention.
10. promoter WY193 according to claim 1, it is characterised in that promoter target gene in plant is regulated and controled
Purposes in expression or plant breeding；Nucleic acid construct containing the promoter, the recombinant vector obtained using the promoter or
Recombinant cell is in destination gene expression in regulating and controlling plant or the purposes in plant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429297.3A CN107974454B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY193 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429297.3A CN107974454B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY193 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107974454A true CN107974454A (en) | 2018-05-01 |
| CN107974454B CN107974454B (en) | 2020-03-06 |
Family
ID=62007513
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711429297.3A Expired - Fee Related CN107974454B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY193 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107974454B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943660A (en) * | 2018-10-17 | 2019-06-28 | 中国热带农业科学院环境与植物保护研究所 | For detecting primer pair, kit and the method for rubber tree powdery mildew bacterium |
| CN110144353A (en) * | 2019-05-31 | 2019-08-20 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.6 and its clone and application |
| CN113999859A (en) * | 2021-10-29 | 2022-02-01 | 海南大学 | Screening method of rubber tree powdery mildew avirulence gene, effector protein and application |
| CN114317586A (en) * | 2021-12-31 | 2022-04-12 | 海南大学 | Fluorescent vector for marking rubber tree powdery mildew and expression method and application thereof |
| CN114540401A (en) * | 2022-01-06 | 2022-05-27 | 海南大学 | Carbendazim resistance screening vector for genetic transformation of rubber tree powdery mildew |
| CN114540402A (en) * | 2022-01-11 | 2022-05-27 | 海南大学 | Method for evaluating transformation efficiency of rubber tree powdery mildew genetic transformation system |
| CN116254267A (en) * | 2023-02-24 | 2023-06-13 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121004A (en) * | 2010-12-03 | 2011-07-13 | 西北农林科技大学 | Grape pathogen inducible promoter separating method and application in breeding for disease resistance |
-
2017
- 2017-12-26 CN CN201711429297.3A patent/CN107974454B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102121004A (en) * | 2010-12-03 | 2011-07-13 | 西北农林科技大学 | Grape pathogen inducible promoter separating method and application in breeding for disease resistance |
Non-Patent Citations (2)
| Title |
|---|
| ANNE DE JONG 等: "PePPER ：a webserver for prediction of prokaryote promoter elements and regulons", 《BMC GENOM》 * |
| 王义 等: "橡胶树白粉菌真核表达启动子的预测、克隆及功能鉴定", 《中国植物病理学会2016年学术年会论文集》 * |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109943660A (en) * | 2018-10-17 | 2019-06-28 | 中国热带农业科学院环境与植物保护研究所 | For detecting primer pair, kit and the method for rubber tree powdery mildew bacterium |
| CN110144353A (en) * | 2019-05-31 | 2019-08-20 | 中国热带农业科学院橡胶研究所 | A kind of rubber tree U6 gene promoter proHbU6.6 and its clone and application |
| CN110144353B (en) * | 2019-05-31 | 2020-08-04 | 中国热带农业科学院橡胶研究所 | Rubber tree U6 gene promoter proHbU6.6 and cloning and application thereof |
| CN113999859A (en) * | 2021-10-29 | 2022-02-01 | 海南大学 | Screening method of rubber tree powdery mildew avirulence gene, effector protein and application |
| CN114317586A (en) * | 2021-12-31 | 2022-04-12 | 海南大学 | Fluorescent vector for marking rubber tree powdery mildew and expression method and application thereof |
| CN114540401A (en) * | 2022-01-06 | 2022-05-27 | 海南大学 | Carbendazim resistance screening vector for genetic transformation of rubber tree powdery mildew |
| CN114540402A (en) * | 2022-01-11 | 2022-05-27 | 海南大学 | Method for evaluating transformation efficiency of rubber tree powdery mildew genetic transformation system |
| CN116254267A (en) * | 2023-02-24 | 2023-06-13 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
| CN116254267B (en) * | 2023-02-24 | 2024-04-05 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107974454B (en) | 2020-03-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107974454A (en) | Rubber tree powdery mildew endogenesis promoter WY193 and application thereof | |
| CN108374012A (en) | Rubber tree powdery mildew endogenesis promoter WY51 and application thereof | |
| CN107974455A (en) | Rubber tree powdery mildew endogenesis promoter WY7 and application thereof | |
| CN107760681A (en) | Promoter WY195 and application thereof | |
| CN106868023B (en) | Cucumber CsERF004 gene and coding protein and application thereof | |
| CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
| CN105218650B (en) | A kind of and plant adversity resistance related protein Prp1 and its encoding gene and application | |
| CN113774067A (en) | Cymbidium kanran gene expression vector for promoting seed germination, construction method and application | |
| CN105400814B (en) | A method of cultivating insect-resistant transgenic corn | |
| CN106636099A (en) | Citrus fruit specificity promoter and application | |
| CN102399795A (en) | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene | |
| CN116083445A (en) | CrBZR1 gene and application thereof | |
| CN102807990B (en) | Application of trkA genes in deinococcus radiodurans R1 to culture of drought-resistant plant | |
| CN102533809B (en) | Jujube glutathione peroxidase gene | |
| CN102174517B (en) | Shepherd's-purse cold-acclimation COR15a gene promoter and application thereof in improving cold resistance of plants | |
| CN112225790B (en) | Rice salt stress resistance related gene ONAC103, and coding protein and application thereof | |
| CN111304222B (en) | Cymbidium CgWRKY11 gene and application thereof | |
| CN111304220B (en) | Cymbidium CgWRKY3 gene and application thereof | |
| CN114480447A (en) | Application of kenaf thioredoxin analog protein gene HcTrx and recombinant vector thereof in VIGS silencing system | |
| CN105018493B (en) | The promoter of the rice Os AHL1 genes and recombinant vector comprising it, transformant and its application | |
| CN117721111B (en) | Mangrove plant avicennia marina endogenous promoter AMGT P5 and application thereof | |
| CN116004646B (en) | Tobacco NtSWEET gene and application thereof | |
| CN116004647B (en) | Tobacco NtSWEET gene and application thereof | |
| CN111424039B (en) | Cymbidium CgWRKY65 gene and application thereof | |
| CN115806999B (en) | Tobacco NtEIJ gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200306 Termination date: 20211226 |