CN102399795A - Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene - Google Patents
Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene Download PDFInfo
- Publication number
- CN102399795A CN102399795A CN2010102777223A CN201010277722A CN102399795A CN 102399795 A CN102399795 A CN 102399795A CN 2010102777223 A CN2010102777223 A CN 2010102777223A CN 201010277722 A CN201010277722 A CN 201010277722A CN 102399795 A CN102399795 A CN 102399795A
- Authority
- CN
- China
- Prior art keywords
- belladonna
- gene
- atropa belladonna
- transgenic
- coding region
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention provides a method for improving tropane alkaloid (TA) content in atropa belladonna by using atropa belladonna tropinone reductase I (TR-I) gene. The method comprises: clone of the target gene TR-I gene; construction of an efficient plant expression vector carrying the TR-I gene; genetic transformation of the atropa belladonna by the plant expression vector carrying the TR-I gene; obtaining and detection of transgenic atropa belladonna. The process of the method comprises that: high-fidelity RT-PCR is adopted to separate the target gene; the efficient plant expression vector carrying the target gene is constructed; the transgenic technology is adopted to introduce the target gene into the atropa belladonna to efficiently express, such that the rate-limiting reaction in the TA biosynthesis pathway in the atropa belladonna is broken, the metabolic flow is promoted to flow towards the target product direction, and the TA yield in the atropa belladonna is improved; the transgenic atropa belladonna is obtained under specific screening and induction conditions; the molecular detection and the chemical detection are performed for the transgenic atropa belladonna; finally the transgenic atropa belladonna is obtained, wherein the TA content in the atropa belladonna is substantially improved. With the present invention, the TA content in the atropa belladonna can be increased.
Description
Technical field
The invention belongs to fields such as molecular biology, thremmatology and genetically engineered, for a kind of utilize genetic engineering technique cultivate tropane alkaloids (Tropane alkaloids, TAs) belladonna of high yield (
Atropa belladonnaL .) method, be specifically related to clone, the expression vector of goal gene structure, obtain the detailed process of the transgenic belladonna of TAs high yield.The present invention also provides the transgenic belladonna of the TAs high yield that utilizes the genetically engineered acquisition and filial generation, regeneration plant, plant tissue or the seed of cultivation thereof.
Background technology
(Tropane alkaloids TAs) is widely used tropane alkaloids clinically.Initial stage is used for preanesthetic medication, antimotion sickness drug, treatment parkinsonism and microcirculation improvement etc., and the market requirement is huge.Along with deep to the TAs Pharmacological action study, TAs is widely used in detoxification and addiction-removing, treatment pesticide intoxication etc. gradually.On original great market basis, along with continually developing of the new function of TAs, its demand is also constantly increasing rapidly.
At present TAs extracts from natural phant, plants of Solanaceae such as belladonna, henbane, thorn apple for example, and wherein belladonna is the topmost commercial cultivated drug of TAs source.Vegeto-alkali all is rich at each position of belladonna, is mainly tropine (hyoscyamine, C
17H
23O
3N) and Scopolamine, but the amount of TAs is very low in the natural belladonna, and the content of Scopolamine is more much lower than the content of tropine.
The analytic metabolism approach of TAs after deliberation comparatively clear.Its biosynthetic upper reaches precursor is the polyamines metabolite.Wherein, Acutangula tropinone reductase (tropinone reductase; TR) be the reductase enzyme that stereospecificity relies on NADPH, comprise two kinds of TR-I, TR-II, formed the biosynthetic tapping point of TAs; The biosynthetic intermediate product tropinone of TR-I catalysis TA is reduced into tropine, and TR-II catalysis tropinone is reduced into
Ψ-tropine (pseudotropine alkali), tropine and the tropic acid reaction that comes from phenylalanine(Phe), synthetic tropine.
The present invention adopts gene engineering method at belladonna overexpression TR-I gene, breaks the rate-limiting reaction on the TAs biological approach in the belladonna thereby reach, and finally cultivates the belladonna of TAs high yield.
Summary of the invention
First purpose of the present invention provides a kind of method of utilizing genetic engineering technique genetic improvement belladonna, and this method efficiently expresses the TR-I gene nucleotide coding region that transfer derives from belladonna in belladonna, thereby improves the synthesis capability of TAs in the belladonna.
In another aspect of this invention, a kind of plant expression vector is provided also, it comprises the coding region of the TR-I gene nucleotide of above-mentioned belladonna.
In another aspect of this invention, also provide a kind of usefulness above-mentioned plant expression vector transformed host cells.This host cell is a belladonna in instance.
Technical scheme of the present invention is following:
The isolated dna molecular of the present invention:, use primer f-TR-I:5 '-GAAGATCTATGGAAGAATCAAAAGATAACA-3 ' and r-TR-I:5 '-GGGTGACCTAAAA TCCACCATTAGCAGTG-3 ' from belladonna, to increase for the coding region of the TR-I gene of belladonna.
A kind of method of utilizing genetic engineering technique to improve TA content in the belladonna; Be characterised in that the plant expression vector that utilizes the TR-I gene coding region that carries belladonna; Adopt any transgenic method overexpression TR-I in belladonna cell, tissue, organ, plant, thereby improve TAs biosynthesis ability in the belladonna.Its step is following:
(1) method of employing gene clone obtains the TR-I gene coding region of belladonna, the i.e. coding region of TR-I gene nucleotide: the primer of clone's belladonna TR-I gene coding region is: f-TR-I:5 '-GA
AGATCTATGGAAGAATCAAAAGATAA CA-3 ' as upstream primer, carries
BglThe II restriction enzyme site; R f-TR-I:5 '-G
GGTGACCTAAAATCCACCATTAGCAGT G-3 ' as downstream primer, carries
BstEThe II restriction enzyme site;
(2) be connected in expression regulation sequence to the TR-I gene coding region of belladonna, form plant expression vector;
(3) aseptic explant of acquisition belladonna;
(4) the TR-I gene coding region that adopts any transgenic method transfer belladonna is in belladonna cell, tissue, organ, plant;
(5) screen and identify the belladonna transformant under given conditions;
(6) the genetically modified belladonna of under the condition that is fit to, cultivating obtains transgenic progeny.
The plant expression vector that the present invention relates to comprises the DNA of the TR-I gene coding region of belladonna.
Life entity with the aforesaid method acquisition; It is cell, tissue, organ, the plant of genetically modified belladonna; Imported the belladonna TR-I gene coding region under the CaMV 35S promoter drives; Its TR-I expression level is greatly enhanced, and the TAs synthesis capability is greatly enhanced, and TAs content also is greatly enhanced.
In the present invention, can select various carrier known in the art for use, the carrier as commercially available comprises plasmid etc.In the present invention, term " life entity " refers to cell, tissue, organ, the plant of belladonna.
In the present invention, term " tropane alkaloids ", " TAs " comprise tropine and Scopolamine.
In the present invention, term " any transgenic method " comprise the conversion of agrobacterium tumefaciens Ti-plasmids mediated gene, the plasmid-mediated gene transformation of Agrobacterium rhizogenes Ri, plant viral vector mediated gene transform, like the conversion of PEG mediated gene, liposome-mediated gene transformation, the conversion of electric shocking method mediated gene, ultrasonic-mediated gene transformation, the conversion of microinjection mediated gene, the conversion of laser microbeam mediated gene, the conversion of particle bombardment mediated gene, the conversion of pollen tube channel mediated gene, the conversion of sexual cell infusion method mediated gene etc.
In the present invention, term " screen under given conditions and identify belladonna transformant " is meant under the condition of isolated culture the transformant of selecting the belladonna of antibiotics resistance with microbiotic (kantlex, Totomycin, G418 etc.); Can use methods such as PCR, Southern hybridization, Northern hybridization and Western trace to identify the transformant of belladonna.
In the present invention; Term " the genetically modified belladonna of under the condition that is fit to, cultivating obtains transgenic progeny " is meant the transformant isolated culture through identifying, and detects TR-I expression of gene level; The good transformant of screening TAs high yield is cultivated, and obtains transgenic progeny.
In the present invention; We clone the coding region of TR-I gene from belladonna, and have made up high efficiency plant expression vector, and genetic transformation belladonna; To break the rate-limiting reaction step in the TAs biosynthetic pathway in the belladonna; Thereby improve the generative capacity of TAs, the transgenic belladonna of screening acquisition TAs high yield is cultivated then, and obtains transgenic progeny.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in the restriction scope of the present invention.The experimental technique of unreceipted actual conditions in the following example; Usually according to normal condition; Condition described in for example " molecular cloning " (New York:Cold Spring Harbor Laboratory Press, 1989), or the condition of advising according to production firm.
Embodiment 1
The clone of belladonna TR-I gene coding region
From the belladonna blade, carry total RNA (RNA of Shanghai China Shun biotechnology ltd extracts test kit); Reverse transcription becomes cDNA (TaKaRa RNA PCR Kit); Carry out pcr amplification then, amplimer is: f-TR-I:5 '-GAAGATCTATGGAAGAATCAAAAGATAACA-3 ' and r-TR-I:5 '-GGGTGACCTAAAAT CCACCATTAGCAGTG-3 '; Pcr amplification reaction is following: reverse transcription product 1 μ L, 10 * PCR reaction buffer, 5 μ L, the MgCl of 25 mmol/L
23 μ L, 200 μ mol/L dNTPs, 2.5 U Taq archaeal dna polymerases, 10 mmol * 10
-6Each 1 μ L of the primer of/L, using the total system of sterilization distilled water polishing at last is 50 μ L.The PCR reaction conditions is following: 94 ℃ of preparatory sex change 5 min, begin to comprise 94 ℃ of sex change 45 sec, 56 ℃ of annealing 45 sec, 72 ℃ of 28 amplification cycles of extending 1 min then, and last 72 ℃ are extended 8min.The PCR product detects in 1% agarose gel electrophoresis; Reclaim title product (V-gene purification kit); Be connected with pMD 19-T carrier behind the purifying; Transform DH5 α competent cell, select positive white colony mono-clonal order-checking and in LB+ penbritin (Ampicillin, Amp) enlarged culturing of vibrating in the 100mg/L liquid nutrient medium.Utilize plasmid extraction kit (sky, Beijing root) to extract the recombinant plasmid warp
BglII,
BstESequence is confirmed in II double digestion, PCR detection validation and order-checking, with the recombinant plasmid called after T-easy+ that obtains
TR-I
Embodiment 2
Structure carries the plant expression vector of belladonna TR-I gene coding region
Selecting pBI121 and pCAMBIA1304 for use is primary element, makes up double base trivalent plant expression vector pCAMBIA1304
+(p1304
+).The structure flow process is following: 1)
HindIII with
EcoRI double digestion pBI121 and pCAMBIA1304; 2) reclaim the pBI121 expression cassette, reclaim the big fragment of pCAMBIA1304; 3) connect these two and reclaim product, transform DH5 α, screening obtains mono-clonal on kantlex LB flat board, shakes the bacterium enlarged culturing, the extracting plasmid,
HindIII with
EcoRThe checking of I double digestion; Promptly build p1304
+
Use
BglII with
BstEII double digestion recombinant plasmid T-easy+
TR-IWith expression vector p1304
+, reclaim T-easy+
TR-ISmall segment and p1304
+Big fragment, will reclaim product with DNA Ligation Kit (Takara, Japan) 16 ° of C connections are spent the night; Transform DH5 α, screening positive clone on the LB+Kan 50mg/L solid plate, enlarged culturing in LB+Kan 50mg/L liquid nutrient medium; The extracting plasmid, PCR detects, and uses respectively
BglII with
BstEThe checking of II double digestion can obtain recombinant plasmid p1304
++
TR-IThis plasmid can import Agrobacterium LBA4404, obtains engineering bacteria, called after LBA4404-P1304
+ -TR-I, can be used for conversion to belladonna.
Embodiment 3
The acquisition of belladonna aseptic explant
Method one: utilize explant to set up the belladonna aseptic explant
Take belladonna young shoot and young stem, flowing water flushing 1 hour; Use 2% (M/V) NaClO solution soaking 10 minutes then, with aseptic water washing 3 times; Use 0.1% (M/V) mercuric chloride (HgCl again
2) solution soaking 15 minutes, with aseptic water washing 6 times; Be seeded in then and add that (substratum is contained in the triangular flask of 150ml, in 121 in the aseptic inducing clumping bud substratum
0C sterilization 20 minutes); This culture medium prescription is: the MS minimum medium; Add plant growth regulating thing 1.25 mg/L BA (benzyladenine), it is 5.8 that 30g/L sucrose and 0.6 g/L PVP (Vinylpyrrolidone polymer) regulate the medium pH value, adds 5% agar powder again.In illumination box, cultivate the young shoot of belladonna, culture condition is: 25
0C, illumination in 12 hours, intensity of illumination is 55 μ mol. m
-2.s
-1After 40 days, can obtain aseptic belladonna aseptic explant, by the time the long genetic transformation that can be used for when big or small to 3cm * 3cm of blade.
Method two: utilize the belladonna seed under aseptic condition, to sprout and obtain aseptic explant
Take the sophisticated seed of belladonna, with 2% (M/V) NaClO solution soaking 20 minutes, with aseptic water washing 3 times; Use 0.1% (M/V) mercuric chloride (HgCl again
2) solution soaking 30 minutes, with aseptic water washing 6 times; Under aseptic condition, remove its kind skin; The belladonna embryo is seeded in (substratum is contained in the triangular flask of 150ml, in 121 on the seed germination substratum
0C sterilization 20 minutes), this culture medium prescription is: the MS minimum medium, add 30g/L sucrose, and regulating the medium pH value is 5.8, adds 5% agar powder again.In illumination box, cultivate the young shoot of belladonna, culture condition is: 25
0C, dark condition is cultivated down.After treating that seed is sprouted, the change culture condition is: 25
0C, illumination in 12 hours, intensity of illumination is 25 μ mol. m
-2.s
-1By the time the long genetic transformation that can be used for when big or small to 3cm * 3cm of blade.
Embodiment 4
Agrobacterium tumefaciens genetic transformation belladonna obtains transgenic belladonna
1, agrobacterium tumefaciens lba4404-P1304
+ -TR-I(obtain according to the method for implementing example 2, preserve in the applicant laboratory, life science institute of Southwestern University).Take out from refrigerator before using, be inoculated in 50ml YEP liquid culture (adding kantlex 100mg/L, Rifampin 40mg/L, Streptomycin sulphate 25 mg/L), 28
0C, twice of 200rpm shaking culture;
2, the OD of activation for the second time
600Reach at 0.3 o'clock, add 100 μ mol/mL Syringylethanones, continue 28
0C, 200rpm shaking culture, OD
600Reach at 0.6 o'clock, 4000rpm is centrifugal 10 minutes under the room temperature;
3, abandon supernatant, thalline suspends with MS liquid nutrient medium (100 μ mol/mL Syringylethanone), is diluted to 5 times of original volume, 28
0C, 200rpm shaking culture, the OD that bacterial concentration is reached
600About=0.3-0.5; Claim conversion fluid; The genetic transformation that can be used for belladonna; 1,2,3 steps are called the activation agrobacterium tumefaciens;
4, get plant different sites such as aseptic belladonna terminal bud, lateral bud, stem, stem is cut into 1 cm segment, or blade is cut into 2cm
2About, draw with "+" font wound with aseptic scalper, put into above-mentioned conversion fluid, infect after 10 minutes and take out, blot with aseptic toilet paper, insert in the MS solid medium that adds 100 μ mol/mL Syringylethanones and cultivated altogether 2 days, culture condition is: 25
0C, dark condition is cultivated down.
5, be transferred to the MS solid medium that adds 1.25 mg/L BA after cultivation finishes altogether and (add 200 mg/L cynnematins to reach the purpose of degerming; Add 10 mg/L Totomycin and press to obtain the transgenic belladonna bud of growing thickly as screening) in cultivate, culture condition is: 25
0C, illumination in 12 hours, intensity of illumination is 55 μ mol. m
-2.s
-1After 40 days, obtain the newborn belladonna bud of growing thickly.
6, treat that transforming the bud length of growing thickly that explant induces from belladonna is to about 1cm, downcut the one bud of growing thickly respectively, be seeded on the MS solid medium of no plant growth regulating thing and (add 200 mg/L cynnematins to reach the purpose of degerming; Add 10 mg/L Totomycin and press to obtain the transgenic belladonna bud of growing thickly as screening) succeeding transfer culture; The normal belladonna of the growth bud of growing thickly is transgenic belladonna on this substratum.Later on per 25 days succeeding transfer culture once, behind the subculture 5 times, Agrobacterium can be removed totally.Only on the MS solid medium that adds 0.25 mg/L NAA, take root then and get final product.Transgenic belladonna refining seedling can be transplanted after 1 week.
Embodiment 5
The Molecular Detection of transgenic belladonna
1, the extraction of belladonna genomic dna, method is following:
1) belladonna that takes a morsel is put into the Eppendorf pipe of 1.5ml, adds 500 microlitre extracting buffer;
2) be put in 60 ℃ of water-bath 50min after fully grinding with little glass rod, often put upside down mixing therebetween;
3) 12000rpm, centrifugal 10 minutes of room temperature;
4) get supernatant, add the saturated phenol of 500ul [Tris-HCl (pH8.0) is saturated, draw lower floor], mixing gently, 4 ℃ leave standstill 5 minutes to layering;
5) 12000rpm, the centrifugal 10min of room temperature;
6) suct clearly (about 250 microlitres), add the absolute ethyl alcohol (20 ℃ of storages) of 2 times of volumes, abundant mixing, room temperature leaves standstill to DNA to be separated out;
7) 8000rpm, 4 ℃ are centrifugal 5 minutes;
8) wash 2 times with 75% ethanol, centrifugal slightly, the exhaustion residual ethanol, room temperature is placed, and makes the ethanol volatilization fully;
9) add 50ul TE (10mM EDTA, pH 8.0 for 100ug/ml RNaseA, 50mM Tris.Cl), dissolving DNA.37 ℃ of water-baths 1 hour;
10) add 40ul chloroform/primary isoamyl alcohol (24:1), mixing leaves standstill 5 minutes to layering gently;
11) 12000rpm, centrifugal 10 minutes of room temperature;
12) draw supernatant (about 35ul) in new Eppendorf pipe ,-20 ℃ of preservations are used for PCR and detect.
The extraction buffer prescription is following:
100mM Tris-HCl(pH8.0)
2.5% (v/v) mercaptoethanol
500mM NaCl
20mM EDTA
1.5%(w/v) SDS
2, the PCR of transgenic belladonna detects, and method is following:
Because used goal gene belladonna TR-I gene comes from belladonna self, can not directly detect with PCR.Because these two genes are at p1304
+On be with hygromycin gene in same border, thereby can be in transgenic belladonna detect hygromycin gene among the DNA to confirm transformant.The detection use primer fhygr of hygromycin gene (812bp) (5 '-cgatttgtgtacgcccgacagtc-3 ') and rhygr (5 '-CGATGTAGGAGGGCGTGGATATG '-3).The PCR program is: 94 ℃ of sex change 5min → 30 circulation (94 ℃ of 50sec → 58 ℃ 50sec → 72 ℃ of 1min) → 72 ℃ of 6min.
Positive control is p1304
+-TR-I is as template amplification, and negative control is that the natural blades DNA of belladonna is as template amplification.The PCR product is through agarose gel electrophoresis and ultraviolet detection.
Embodiment 6:
The acquisition of Scopolamine high-yield transgenic belladonna
With the positive transgenic belladonna of Molecular Detection is material, adopts Northern hybridization testing goal gene, i.e. the expression level of TR-I filters out the transgenic line of high expression level, and Northern hybridization testing goal gene expression dose method is following:
1. the preparation of probe and mark: as template, adopt that identical primer carries out the pcr amplification probe when cloning with goal gene with the goal gene of sequence verification.Use the Amersham Pharmacia Gene Images of company
TMContents CDP-StarTM labelling module RPN3540), operates according to the appended specification sheets of test kit.Dilute template (DNA or RNA) concentration to 2-25ng/ul with DD water or TE; Template is generally from the PCR product, or enzyme cuts product, reclaims product and gets 5ul and go up an appearance electrophoresis, if high-visible, label probe should have no problem.The denatured DNA template is 10 minutes in boiling water bath, and volume is wanted 20ul at least, immediately ice bath (putting into ice chest).In centrifuge tube, add following reagent: 10ul Nucleotide mix; 5ul Primer; 50ng denatured DNA template; 1ul Klenow enzyme (5U/ul); Supply water to 50ul; Gentle mixing, centrifugal slightly, 37 spend night; In the solution of 2 * SSC, have the nylon membrane 15 minutes of probe afterwards in 65 ℃ of flushings with 2 μ l EDTA (0.5M pH=8.0), whether purple lamp descends the observation probe on the mark outward;-20 ℃ of probes that keep in Dark Place are subsequent use;
2. prepare agarose denaturing formaldehyde gel: in the triangular flask of one 180 ℃ dried roasting 2 h, add: 37.5 mL DEPC treated waters; 7.5 mL 10 * MOPS; 0.55 the low melting-point agarose of g RNase-free; TV 45 mL; In microwave oven, change glue, add 10 mL formaldehyde when being chilled to 60 ℃, wait to be chilled to about 45 ℃ glue behind the mixing, plug 3 mm combs, the cold back of gel is subsequent use;
3. the preparation of RNA sex change sample and electrophoresis: extract the total RNA of transgenic belladonna leaf; Adopt ethanol precipitation with more than RNA sample concentration to the 3 g/ L in advance, and calculate the L number of the required RNA of each sample, prepare the 500 L Eppendorf pipe of the RNase-free of respective numbers, add respectively after the numbering: the total RNA of 30 g; 7 L formaldehyde; 20 L deionized formamides; 2 L, 10 * MOPS; The DEPC treated water complements to 40 L; Behind the mixing in 65 ℃ of sex change 10 min, chilling on ice, what add micro-ethidium bromide and 6 L RNase-free goes up an appearance buffer, goes up appearance immediately, in 1 * MOPS damping fluid in 1 v.cm-1 electrophoresis, commentaries on classics film when treating that bromjophenol blue migrates to a half-distance of gel;
4. the Northern gel changes film, fixing and hybridization detection: take out gel after 1) electrophoresis finishes, cut unnecessary colloid, downcut the upper left corner and serve as a mark; 2) gel is paused to clean with the DEPC treated water; 3) the same with Southern hybridization, the 20 * SSC that adopts DEPC to handle changes film; 4) the same with Southern hybridization, prehybridization, hybridization (hybridize with Southern, only hybridization temperature becomes 65 ℃) and develop a film under the environment of RNase-free;
5. distinguish the power of genetic expression at last according to the power of hybridization signal, the strain system that selects high expression level does further to analyze.
Embodiment 7
The content of tropine and Scopolamine relatively in wild-type belladonna and the transgenic belladonna
The method (1993) that tropine and Scopolamine assay are set up with reference to people such as Hashimoto.The result is: the content of tropine in wild-type belladonna main root, leaf and stem is respectively: 10.0 mg/g (dry weight), 3.0 mg/g (dry weight), 0.6 mg/g (dry weight); The content of tropine in transgenic belladonna main root, leaf and stem is respectively: 14.2 mg/g (dry weight), 3.8 mg/g (dry weight), 1.6mg/g (dry weight); The content of Scopolamine in wild-type belladonna main root, leaf and stem is respectively: 0.6 mg/g (dry weight), 0.4 mg/g (dry weight), 0.05 mg/g (dry weight); The content of Scopolamine in transgenic belladonna main root, leaf and stem is respectively: 1.3 mg/g (dry weight), 0.8 mg/g (dry weight), 0.1 mg/g (dry weight).
Claims (4)
1. isolated dna molecular; It is characterized in that; It comprises: have coding belladonna acutangula tropinone reductase (tropinone reductase; TR) coding region of I type (TR-I) gene nucleotide series adopts primer f-TR-I:5 '-GAAGATCTATGGAAGAATCAAAAGATAACA-3 ' and r-TR-I:5 '-GGGTGACCTAAAA TCCACCATTAGCAGTG-3 ' from belladonna, to increase.
2. plant expression vector, it comprises the coding region of the TR-I gene nucleotide of above-mentioned belladonna.
3. method of utilizing genetic engineering technique to improve tropane alkaloids content in the belladonna; Be characterised in that and make up the high efficiency plant expression vector that carries the dna molecular in the claim 1; Adopt transgenic method dna molecular in the overexpression right 1 in belladonna cell, tissue, organ, plant, its step is following:
(1) adopt gene clone method obtain to derive from belladonna the coding region of TR-I gene, i.e. the coding region of TR-I gene nucleotide: the primer of clone's belladonna TR-I gene coding region is: f-TR-I:5 '-GA
AGATCTATGGAAGAATCAAAAGATTA CA-3 ' as upstream primer, carries
BglThe II restriction enzyme site; R f-TR-I:5 '-G
GGTGACCTAAAATCCACCATTAGCAGT G-3 ' as downstream primer, carries
BstEThe II restriction enzyme site;
(2) be connected in expression regulation sequence to the coding region of the TR-I gene nucleotide that derives from belladonna, form the high-efficiency plant expression vector;
(3) obtain the belladonna aseptic explant;
(4) adopt coding region that transgenic method shifts the TR-I gene that derives from belladonna in belladonna cell, tissue, organ, plant;
(5) screening and identify transformant: the transformant of under the condition of isolated culture, selecting the belladonna of microbiotic and glufosinates, glyphosate resistance with microbiotic kantlex, Totomycin or G418; Use PCR, Southern hybridization, Northern hybridization or Western trace method to identify the transformant of belladonna;
(6) culture transformation obtains transgenic progeny: to the transformant isolated culture through identifying, and detect TR-I expression of gene level, the good transformant of screening TAs high yield is cultivated, and obtains transgenic progeny.
4. one kind with the described plant expression vector transformed host cells of claim 2, and this host cell is a belladonna.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102777223A CN102399795A (en) | 2010-09-09 | 2010-09-09 | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2010102777223A CN102399795A (en) | 2010-09-09 | 2010-09-09 | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN102399795A true CN102399795A (en) | 2012-04-04 |
Family
ID=45882444
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2010102777223A Pending CN102399795A (en) | 2010-09-09 | 2010-09-09 | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102399795A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937414A (en) * | 2017-12-11 | 2018-04-20 | 西南大学 | Belladonna WRKY classes transcription factor gene and its recombinant plant expression vector and application |
| CN109837287A (en) * | 2017-12-11 | 2019-06-04 | 西南大学 | Belladonna calmodulin AbCaM1 gene and its recombinant plant expression vector and application |
| WO2021043189A1 (en) * | 2019-09-03 | 2021-03-11 | 西南大学 | Hyoscyamine aldehyde reductase |
| CN113307884A (en) * | 2021-05-25 | 2021-08-27 | 西南大学 | Tropinone biosynthesis fusion protein and application and method thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101168739A (en) * | 2007-10-12 | 2008-04-30 | 上海师范大学 | Scopoloa acutangula tropinone reductase II gene and its coding protein and application |
| CN101168740A (en) * | 2007-10-12 | 2008-04-30 | 上海师范大学 | Scopoloa acutangula tropinone reductase I gene and its coding protein and application |
-
2010
- 2010-09-09 CN CN2010102777223A patent/CN102399795A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101168739A (en) * | 2007-10-12 | 2008-04-30 | 上海师范大学 | Scopoloa acutangula tropinone reductase II gene and its coding protein and application |
| CN101168740A (en) * | 2007-10-12 | 2008-04-30 | 上海师范大学 | Scopoloa acutangula tropinone reductase I gene and its coding protein and application |
Non-Patent Citations (2)
| Title |
|---|
| GUOYIN KAI等: "Molecular cloning and characterization of two tropinone reductases in Anisodus acutangulus and enhancement of tropane alkaloid production in AaTRI-transformed hairy roots", 《BIOTECHNOL.APPL.BIOCHEM.》, vol. 54, 31 December 2009 (2009-12-31), pages 177 - 186 * |
| 成瑜 等: "颠茄PMT、TR-I和H6H基因植物高效表达载体的构建", 《安徽农业科学》, vol. 38, no. 14, 10 May 2010 (2010-05-10) * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107937414A (en) * | 2017-12-11 | 2018-04-20 | 西南大学 | Belladonna WRKY classes transcription factor gene and its recombinant plant expression vector and application |
| CN107937414B (en) * | 2017-12-11 | 2019-03-29 | 西南大学 | Belladonna WRKY class transcription factor gene and its recombinant plant expression vector and application |
| CN109837287A (en) * | 2017-12-11 | 2019-06-04 | 西南大学 | Belladonna calmodulin AbCaM1 gene and its recombinant plant expression vector and application |
| WO2021043189A1 (en) * | 2019-09-03 | 2021-03-11 | 西南大学 | Hyoscyamine aldehyde reductase |
| CN113307884A (en) * | 2021-05-25 | 2021-08-27 | 西南大学 | Tropinone biosynthesis fusion protein and application and method thereof |
| CN113307884B (en) * | 2021-05-25 | 2022-04-29 | 西南大学 | Tropinone biosynthesis fusion protein and application and method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108070594B (en) | Tobacco glandular hairTTR1Promoter, expression vector and application thereof | |
| CN107974454A (en) | Rubber tree powdery mildew endogenesis promoter WY193 and application thereof | |
| CN107974455A (en) | Rubber tree powdery mildew endogenesis promoter WY7 and application thereof | |
| CN108374012A (en) | Rubber tree powdery mildew endogenesis promoter WY51 and application thereof | |
| CN107760681A (en) | Promoter WY195 and application thereof | |
| CN106995817B (en) | Construction of high concentration CO resistance by using gene of coding chloroplast carbonic anhydrase2Application of industrial engineering microalgae capable of rapidly growing | |
| CN103387954A (en) | Culture medium and kit for preparing embryonic callus of cotton and applications of culture medium and kit | |
| CN102690841B (en) | Genetic transformation method for acquiring Taxus chinensis transgenic callus | |
| CN102399795A (en) | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene | |
| CN110358776A (en) | A kind of Rhizoctonia solani Kuhn pathogenic related gene and its application | |
| CN104593411B (en) | Application of the barley Hvsusiba2 genes in reduction rice terrace methane release | |
| CN106755071A (en) | Method and its application of transgenic peanuts are quickly obtained using peanut cotylcdon | |
| CN106636099B (en) | A kind of citrusfruit specificity promoter and application | |
| CN103525828A (en) | Tomato S1EBI gene as well as RNAi (ribonucleic acid interference) expression vector and applications thereof | |
| CN103805576B (en) | Tobacco squalene epoxidase protein, tobacco squalene epoxidase gene and applications of tobacco squalene epoxidase gene | |
| CN102586250A (en) | Promoter of terpene floral scent gene Hctps1 in hedychium gardneranum and application of promoter | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN102399813A (en) | Application of jasmonic acid carboxyl methyltranferase gene in cultivation of atropa belladonna with high yield of tropane alkaloids | |
| CN103981187B (en) | The deletion mutant of corn phosphatidylinositols synthase gene promoter P-ZmPIS and application thereof | |
| CN1884545B (en) | Method for cultivating Atropa belladonna L of high tropane analog alkaloid yield using gene engineering technology and Atropa belladonna L | |
| CN110106171A (en) | Long-chain non-coding RNA and its application in regulation plant frigostabile | |
| CN1995359A (en) | Agrobacterium mediated large size tomato transformation method | |
| KR101317891B1 (en) | High-efficiency and rapid method for producing transgenic rice plant using germinating rice seeds and the plant thereof | |
| CN105018493B (en) | The promoter of the rice Os AHL1 genes and recombinant vector comprising it, transformant and its application | |
| CN103773799B (en) | A kind of method that Agrobacterium is infected in Chinese yew callus conversion process |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20120404 |