CN106636099B

CN106636099B - A kind of citrusfruit specificity promoter and application

Info

Publication number: CN106636099B
Application number: CN201710068189.1A
Authority: CN
Inventors: 徐强; 曾亮; 邓秀新
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2017-02-08
Filing date: 2017-02-08
Publication date: 2019-07-19
Anticipated expiration: 2037-02-08
Also published as: CN106636099A

Abstract

The application obtains a kind of citrusfruit specificity promoter, is suitable for merging with any target gene, and being formed by recombinant vector and being transferred in plant expresses that target gene in plant cell, has the function of that starting foreign gene is specific expressed in citrusfruit.The present invention also provides above-mentioned citrusfruit specificity promoters, the application of recombinant vector or recombinant microorganism in Plant Transformation；Wherein, the application in Plant Transformation can also be to utilize in citrusfruit genetic improvement.

Description

A kind of citrusfruit specificity promoter and application

Technical field

The invention belongs to field of biotechnology, and in particular to a kind of citrusfruit specific expressing promoter and application.

Background technique

China's citrus fruit yield reaches more than 3,300 ten thousand tons, becomes the first in the world Orange Producing big country.Orange yield is basic The equilibrium of supply and demand, market propose requirements at the higher level to fruit quality.Consumption requires to develop to " color, smell, taste, shape " from " good-looking, nice " Have both, the citrus new varieties for cultivating and improveing fine quality are the new needs of current Aspects In The Development of Citrus Industry.

In gene function and genetic improvement research, in order to express that foreign gene efficiently and stably in receptor biological, Target gene overexpression is driven to become one of common strategy of researcher using composing type strong promoter (such as 35S).But group Constitutive promoter drives foreign gene in the equal high efficient expression of plant complete stool, causes the endotrophic a large amount of consumption of plant, often shadow The growth and development for having rung plant, it is unfavorable for parsing gene function or genetic improvement.

Summary of the invention

In view of this, the first object of the present invention is that a kind of citrusfruit specificity promoter, the citrusfruit are special Specific Promoters have sequence shown in SEQ ID NO.1, that is, have following sequence:

5'-TGTATTGAGAGCAGTTGGGGTTTTATTTGATGCGTCTTTAATCACATTAAAAACCTTTTGTTTGA CGCGTCTGTGCTTATTTTGAACAGCAAAAAGGTTAAAAGATTTCATGTATAAAGCGCTTCTACTCTTGATTTTGTC AAATTTTGAGTTCAATTGGTTCTGGAGAAGGTTCAGATCTTTAGGTTGCTAAAATGTAATTGGAGGTTTGTACCTT TATCCTACTTTTGCCTTAAATAACAAGAGTGGATTTCACTCAATTTTTTGTTGCAGATAAAGGCCGGAAAGGACCC AGACATCTATAGATGCATTTATAATAGAAATAATACGGATGAGGCCCTGAGACACATCTAACTTAATTTTAATAAT ATGGTGAAGTTTGTGAAACTCAACTTTGTAGCAAGTCTTCATATTTAGTGTGTGTGTTTATTATGCATTTGCAGTT TGGTCTAATTTTAATTGAACCTTCTTAACTGTATTGCATATACTCAGTTGGTGATTGCACGAGGAAATTTGCAGTA GAAATCATGACTCATGGGTTGGGAAGTTTAGGGATGAATGTGCGCAACTTTAAACATGAAATGAAAAACCTTTTTT TCTTTTTCTTTTTCTTTTTCACACGCAATTTTCCAAATGCCGACATTTCTCCATGTTTCGGACCGCAGGCAAACTT TTACAATTTGACGGACTCAAGGACCAGAGAGCCCAGAATTTACCGGGCCTTTACCTCGTATTTGGTTATTGGGCTT TTTTCTGCAGAATTGGACCGAGAAATTGGGCCAGCTCAAGAAACTGTTGGCACTGCAAGGCAACTAGTCACTGGGT AGTGACTCATTCTGGTTCCAGAAATCGAACAGTGCGTGCTCCGTTGTCAGATGTAAAGATTGACAAAGTGTGTGTG GCCGGGACAATAAAGAAAAAGGCCGAAGAACCCAAATGGATCAGATTCTAACGCGGACTAGTACGAAGAAGATCGA AACAATGCTGTGCTTGTGTTGAGTCTCATAATTGGAAAGGCAAAAACAGTCCATCCAAATGATAACAATGATTTTG AAGAGGCCTTGAAAGAATTTTGTTGACTTGGCGGCGCGTTATTAAGAAATTTTCAGGCAAAGGCTATTTTCTATCT AATTTTAGTGATGTCTATCAGATTATAATAAGCAGGGCGGCTGCCTATTTTCTATTCTAATTTTACAAAATTTTGC TCCCAAAACCCAAGCCATTTTTAAGCTCACCTGATTATATCCTCTTGGCAAATTGTTCCACTACACAATTTTTGAA GGAGGCGTTTGGTTAGTTATCGATCAGAAGGTATGTACATTTAAGTGATTATCAGGAATTGCGGCAGTTTAATCTA CCGGGCTAAACACATATATTTTTGAGAATTATATTACAATTTACTGATATTTTCAGGAAGCCTAAACCCATGTAAC TAAAGCACAGTCGGAGCCCTAATGAGCATTGCAAAAATATTAATTGTGTCAAATAGAAATGAGATCTACCCTCACT TAATCACAATTTTTTTTAAAAAAAGTAATAGGAAGTTCGATCTAATGCATTTTTGGAAGCCGGTTAATGAAGTTTG AATTTACTCAATGTGCTTGTAATAGAAATTGGATATGTCCCAATTACTGTTATTTCTCTTGGTATTTATTTTTATT CTTAGATAATCAAAAATATAAAATTTAGGCTTTTATTATGTTATATAATTATGTAACAATCGTGGAATGAAATCCA ACGATTATAAAAATATAAGATAAAAAATTATATTATTTTTACAATCGTTAAATTTTTAATTTAACGATTGTATAAT TATATATGTTACATCGTTATATAACATAATAATCATCATAAATTTAATATTTTTTGTGCTTTTAAAAAGTTAACAG GAAGAAGATTGCAGGGAATTGCATTGTCGGGAAAATCATTGATGCCTTTGAAGACATATACGGTGGATAGAAGAGA GAGATGGTAAAAGCATTAAGCTAATTAAATATTACCGATAAAGAAGACACGTGGCAACAAGAGATGGCCCGCGAAG GCACCAGAGATTTCGTCTAATAGAAAGCATCCAGAATCCTCTACATAAATCATATTAGTCCTATATATAGGCCTCT CTTGTCTCATCCTTCTCCATCTTCAAATTGATTGATCAAAGCATTTCCGAAGTTGTTGAGCATTTAATTAGCGTCC CAGTTTGCCATA-3'。

Preferably, citrusfruit specificity promoter of the present invention has sequence at least 90% shown in SEQ ID NO.1 The above homology, and have the function of that starting foreign gene is specific expressed in citrusfruit.

Preferably, citrusfruit specificity promoter of the present invention is the sequence after sequence modification shown in SEQ ID NO.1 Column, and have the function of that starting foreign gene is specific expressed in citrusfruit.

Another object of the present invention is to provide a kind of recombinant expression carrier, the recombinant expression carrier includes having SEQ The citrusfruit specificity promoter of sequence shown in ID NO.1.

Preferably, recombinant expression carrier of the present invention includes that sequence at least 90% or more shown in SEQ ID NO.1 is homologous Property promoter or SEQ ID NO.1 shown in promoter after sequence modification, and have starting foreign gene in citrusfruit spy The function of opposite sex expression.

Another object of the present invention is to provide a kind of recombinant microorganism, and above-mentioned recombinant microorganism is by above-mentioned recombinant expression carrier Microbial is obtained respectively.

Preferably, microorganism of the present invention is soil Agrobacterium (Agrobacterium tumefaciens).

It is highly preferred that soil Agrobacterium of the present invention includes having sequence at least 90% or more shown in SEQ ID NO.1 homologous Property or SEQ ID NO.1 shown in sequence after sequence modification promoter, and have starting foreign gene special in citrusfruit Property expression function.

The present invention also provides above-mentioned citrusfruit specificity promoter, recombinant expression carrier or recombinant microorganisms in plant Application in conversion；Wherein, the application in Plant Transformation can also be the application in citrusfruit improvement.

Present inventor is using sweet orange Cs8g18360 gene start codon 5' upstream 2.2Kb or so sequence as the base The promoter is named as CFP1 by the promoter sequence of cause.It is verified through inventive embodiments, which is fruit specific starting Son.This promoter sequence yet there are no any report or elaboration, and promoter region of the invention or its variant are suitable for and any purpose Gene Fusion, being formed by construction and being transferred in plant expresses that target gene in plant cell.

Citrusfruit specificity promoter area illustrated by the present invention can be used as a promoter sequence and be inserted in recombination base The conversion of plant is used for due in construction.In this gene expression in plants construction, promoter region has institute of the present invention The sequence shown or any associated variant for having promoter activity.What it was connected is in addition to this to be naturally occurring Any objective gene sequence other than citrusfruit specificity promoter；The DNA sequence dna of target gene can come from homologous plant, External source plant, fungi, algae, bacterium, virus or animal gene；It is also possible to the DNA sequence dna of engineer, synthesis.Purpose base Because can be single gene or a series of gene.Target gene is suitable for being transcribed into functional RNA in plant cell； It can also be mRNA, then protein translated by ribosomes；Or the rna form of associated mRNA translation can be inhibited.Two Person can cause the variation of cellular biochemical ingredient and correlated process.Therefore, it is functional to can be one section of coding for this target gene Protein or part thereof of Sense sequences or one section of antisense sequences.Can use a variety of conversion means will be involved in the present invention Constructs for expression of plants be transferred in plant, it is any to be suitable for plant or the method for transformation of plant cell and use；Such as It is infected with the Agrobacterium containing recombination Ti-plasmids, electric shocking method, cell and protoplast microinjection, Gene Knock-out Mice and flower Tube cell introductory technique etc..Then the cell being converted can regenerate complete plant under suitable conditions, described above embedding Gene constructs are closed to be stably integrated among its genome；It is also possible to plant tissue or plant containing this transformed cells Strain, and the plant derived by it or the seed obtained.

The method that the present invention still further provides a control gene expression in plants.In gene expression in plants construction Citrusfruit specificity promoter is connected with target gene, this promoter can be activated and drive the expression of target gene. In order to study the functional character of this promoter sequence, this citrusfruit specificity promoter segment and reporter gene can be connected It connects.Common reporter gene has CAT gene, gus gene, luciferase (luciferase, LUC) gene and green fluorescent protein (GFP) gene etc..GFP fluorescence reaction does not need additional substrate and confactor, and ultraviolet light or blue light is only needed to excite, i.e., capable of emitting Green fluorescence can be observed with fluorescence microscope even naked eyes.And the expression of individual cell level also can recognize.

The promoter sequence is passed through gateway by promoter sequence shown in clone SEQ ID NO.1 by the present embodiment Clone technology homologous recombination is to pKGWFS7 expression vector, carrier structure such as Fig. 1, expression vector establishment schematic diagram such as Fig. 2, with band The pKGWFS7 recombinant plasmid for having 35S promoter is positive control, and agrobacterium-mediated transformation converts mountain gold mandarin orange respectively, glimmering using body formula The expression of light microscope detection GFP gene.

Detailed description of the invention

Fig. 1 is pKGWFS7 carrier structure figure；

Fig. 2 is that promoter expression vector constructs schematic diagram；

Fig. 3 is the amplification of purpose promoter sequence, and A is amplification of the CFSP1-F/CFSP1-R in red summer orange genomic DNA As a result, B is amplification of the 35S-F/35S-R in pBI121 Plasmid DNA, M represents 1Kb DNA ladder in figure；

Fig. 4 be carried out using attB1/attB2 PCR positive verification as a result, A is the PCR verification result of CFP1 promoter, B is the PCR verification result of 35S promoter.M represents 1Kb DNA ladder in figure；

Fig. 5 is one wheel PCR amplification result of gateway clone.M represents 1Kb DNA ladder in figure；

Fig. 6 is two wheel PCR amplification result of gateway clone.M represents 1Kb DNA ladder in figure；

Fig. 7 is that LR reacts PCR positive verification result.M represents 1Kb DNA ladder in figure；

Fig. 8 is Agrobacterium bacterium solution PCR positive verification as a result, A is that pKGWFS7-5'/P1-3' is recombinantly expressed comprising CFP1 Amplification in the Agrobacterium bacterium solution of carrier, B are pKGWFS7-5'/35S-3' in the agriculture bar comprising 35S recombinant expression carrier Amplification in bacterium bacterium solution.M represents 1Kb DNA ladder in figure；

Fig. 9 is transgenosis mountain gold mandarin orange PCR positive identification as a result, A is amplification knot of the attB1/attB2 in 35S::GFP Fruit, B are amplification of the pKGWFS7-5'/P1-3' in CFP1::GFP.It is each to represent 1Kb DNA ladder, 1-15 by M in figure Number represents examined separate transgenic system, and P represents plasmid positive control, and W represents the negative control of non-transgenosis；

Figure 10 is that different mountain gold mandarin oranges organize GFP expression.S represents stem in figure, and L represents leaf, and O represents ovary and holder, OS is ovary sectional drawing.Scale is 2mm in figure.

Specific embodiment

Further technical solution of the present invention is illustrated below by way of specific embodiment, it should be understood that be below only this hair Bright exemplary illustration, is not intended to restrict the invention scope of protection of the claims.

Embodiment 1

1. promoter sequence cloning and expression vector construction

(1) with Cs8g18360 base in sweet orange genome database (http://citrus.hzau.edu.cn/orange/) Cause and 5' upstream sequence are as reference sequences, design, synthetic primer.With red summer orange [Citrus sinensis (L.) Osbeck] Genomic DNA is template, DNA piece of the primer pair CFSP1-F/CFSP1-R amplification comprising promoter sequence shown in SEQ ID NO.1 Section；Using pBI121 Plasmid DNA as template, primer pair 35S-F/35S-R expands 35S promoter sequence.PCR reaction system is as follows: 25 μ l 2X Phanta Max Buffer, 1 μ l dNTP Mix (10mM each), 1 μ l Phanta Max Super- Fidelity DNA Polymerase (1U/ μ l) (is purchased from the promise in Nanjing and only praises biology), and 200ng template DNA is forward and reverse to draw Each 20 μM of object, ddH₂O is supplemented to 50 μ l of final volume.Thermal circulation parameters are as follows: 95 DEG C of (initial denaturation) 3min, 1 circulation；95 DEG C (become Property) 30sec, 57 DEG C of (annealing, amplification 35S promoter sequence use 55 DEG C) 30sec, (amplification 35S is opened 72 DEG C of (extension) 80sec Promoter sequences use 30sec), 32 circulations；72 DEG C of (extending eventually) 5min, 1 circulation；12 DEG C of preservations.

(2) 1.5% agarose gel electrophoresis detect PCR product, cut the purpose of 2.3Kb, 0.85Kb or so size respectively Band usesGel Extraction Kit (Omega, USA) recycles purpose band DNA.Fig. 3 is promoter sequence Column amplification.

(3) it usesCloning Kit (purchased from the full formula in Beijing gold biology) by recovery product withCloning Vector is attached, heat-shock transformed to Escherichia coli Trans5 α.

(4) picking monoclonal cell expands numerous, and PCR verifying is positive, as a result as shown in Figure 4.Positive colony bacterium solution send Wuhan to hold up The sequencing of Kechuang neoformation Science and Technology Ltd., sequencing sequence are compared with sweet orange genome reference sequences, and the correct bacterium solution of sequence mentions Plasmid is taken, -20 DEG C of preservations are placed in.

(5) primer pair attB1+P1-F/attB2+P1-R, attB1+35S-F/attB2+35S-R are utilized, with above-mentioned sequencing Correct plasmid is that template carries out one wheel PCR amplification of gateway clone, and amplification is as shown in Figure 5.

(6) primer pair attB1/attB2 is utilized, carries out two wheel of gateway clone respectively using above-mentioned PCR product as template PCR amplification, amplification are as shown in Figure 6.1.5% agarose gel electrophoresis detects PCR product, cuts 0.9Kb, 2.3Kb respectively The purpose band of left and right size usesGel Extraction Kit (Omega, USA) recycles purpose band DNA。

(7) above-mentioned recovery product reacts with intermediate vector pDONR207 progress BP and converts Escherichia coli Trans5 α.BP is anti- Invitrogen company should be usedBPII enzyme is catalyzed, and reaction system is as follows: V (recycling Product)=16.5/ plasmid concentration of plasmid size * (ng/ μ l), V (pDONR207)=5.5*16.5/ plasmid concentration (ng/ μ l), V (ddH₂O)=2- (X+Y), V (BP Clonase)=0.5 μ l, 25 DEG C of water-bath 12-16h.

(8) picking monoclonal cell expands numerous, and PCR verifying is positive, and positive colony bacterium solution send Wuhan to hold up Kechuang neoformation science and technology Co., Ltd's sequencing, sequencing sequence are compared with sweet orange genome reference sequences, and the correct bacterium solution of sequence extracts plasmid.Sequencing is correct Plasmid and end carrier pKGWFS7 carry out LR and react and convert Escherichia coli Trans5 α.LR reaction uses Invitrogen company 'sLRII enzyme is catalyzed, and reaction system is as follows: V (plasmid)=16.5/ plasmid of plasmid size * Concentration (ng/ μ l), V (pKGWFS7)=16.5/ plasmid concentration of plasmid size * (ng/ μ l), V (ddH₂O)=2- (X+Y), V (LR Clonase)=0.5 μ l, 25 DEG C of water-bath 12-16h.

(9) picking monoclonal cell expands numerous, using primer pair pKGWFS7-5'/35S-3', pKGWFS7-5'/P1-3', divides Not carry out PCR positive verification, as a result as shown in Figure 7.Positive colony bacterium solution send Wuhan to hold up the survey of Kechuang neoformation Science and Technology Ltd. Sequence, sequencing sequence are compared with sweet orange genome reference sequences, and the correct bacterium solution of sequence extracts plasmid, are placed in -20 DEG C of preservations.

Wherein, primer pair (being followed successively by SEQ ID NO.2~NO.14) is as follows in the present embodiment:

[1] primer pair

2. Agrobacterium-mediated transformation mountain gold mandarin orange (Fortunella hindsii Swingle):

(1) citrus explant prepares.

Mountain gold mandarin orange seed is cleaned up with tap water, 10min is impregnated in 1M NaOH and removes pectin, then flowing water rushes Wash clean；Seed is placed in the liquor natrii hypochloritis that effective chlorine density is 3% on the super-clean bench and impregnates 15min (period shake 2-3 times), the surface of the seed sterilizing is carried out, sterile distilled water washs 3-5 times.On the super-clean bench, it will be planted with aseptic operation knife and tweezers Sub- exocuticle strips, and is inoculated in MT sowing culture medium.Dark culture is gone to optical culture 2 months or so after 1 week.Cut 0.8- The epicotyl of 1.5cm long is used for genetic transformation, takes the mode of beveling, and the notch of epicotyl physiologically lower end is made to be in same Face.

(2) preparation of soil Agrobacterium.

It is extracted in step 2 and correctly whole vector plasmid is sequenced and be added in 200ul Agrobacterium EHA105 competence, ice bath 30min, liquid nitrogen flash freezer 5min, then 37 DEG C of water-bath 5min, ice bath 2min, addition 800ulLB fluid nutrient medium, 28 DEG C, 200rpm, Cultivate 4-5h.2000-3000rpm be centrifuged bacterium solution 2min, abandon supernatant, take lower layer's 200ul bacterium solution apply spectinomycin containing 50mg/L with The LB plate of 25mg/L rifampin.28 DEG C of culture 48h, choose monoclonal cell expand it is numerous, utilize primer pair pKGWFS7-5'/35S- 3', pKGWFS7-5'/P1-3' carry out PCR amplification detection respectively.Fig. 8 is PCR positive verification result.

(3) preparation of Agrobacterium infected liquid.It is (grand containing 50mg/L in solid LB media to be verified as positive Agrobacterium Mycin and 25mg/L rifampin) on apply plate, 28 DEG C of culture 2d.With aseptic operation knife scraping thallus in suspension medium, 180rpm, 28 DEG C, shaken cultivation 1.5-2h is spare, with UV spectrophotometer measuring bacterial concentration, adjusts OD₆₀₀In 0.8- 1.2。

(4) it infects and co-cultures.The explant cut is immersed in the Agrobacterium bacterium solution prepared, standing infects Bacterium solution is abandoned after 20min, blots explant surface bacterium solution with sterile blotting paper, and notch is placed in upward on total training culture medium, and 21 DEG C dark Cultivate 3d.

(5) the mountain gold mandarin orange epicotyl after co-culturing, which is placed in the sterile distilled water of the cephalosporin containing 400mg/L, cleans 5min, Sterile distilled water cleans 3-5 times later, and sterile blotting paper blots explant surface moisture, is placed in illumination on culture medium of sprouting and trains It supports, 26 ± 2 DEG C of cultivation temperature, intensity of illumination 1500-2000Lx, daily illumination 16h.Every month, subculture was primary.

(6) when mountain gold mandarin orange epicotyl incision regeneration resistant buds grow three to four leaves, it is seeded to culture of rootage Base root induction.When root long reaches 2-3CM, regeneration resistance seedling is taken out from culture medium, cleans remaining culture medium, is transplanted It is cultivated 1 week into the apertured plastic cup for filling sterilizing humus matrix, pays attention to heat and moisture preserving.It is transplanted later into small basin, depending on it Growing state is transplanted to be cultivated into big basin.

[2] culture medium prescription:

[3] minimal medium: MT (Murashige and Tucker, 1969)

[4] culture medium: MT+ sucrose 25g/L+ agar 8g/L is sowed

[5] suspension medium: MT+ malt extract 0.5g/L+L- glutamine 1.5g/L

[6] culture medium is trained altogether: MT+AS 20mg/L

[7] sprout culture medium: that is mould for MT+BA 0.5mg/L+KT 0.5mg/L+NAA 0.1mg/L+ agar 8.0g/L+ card Plain 50mg/L+ cephalosporin 400mg/L

[8] root media: 1/2MT+NAA 0.5mg/L+IBA 0.1mg/L+ active carbon 0.5g/L+ sucrose 25g/L+ fine jade Rouge 8.0g/L+ kanamycins 25mg/L+ cephalosporin 400mg/L

Above-mentioned medium pH is adjusted to 5.8-6.0.

3. transgenosis mountain gold mandarin orange positive detection:

(1) the resistant plant genomic DNA of transplanting to big basin is extracted using the CTAB method of improvement.

(2) the resistant plant base obtained using primer pair attB1/attB2, pKGWFS7-5'/P1-3' difference Amplification Analysis Because of a group DNA.PCR reaction system is as follows: 5 μ l TaqMix, forward and reverse each 0.2 μ l of primer (10 μM), 1 μ l (50-150ng/ μ of DNA L), ddH₂O is supplemented to 10 μ l of final volume.Thermal circulation parameters are as follows: 95 DEG C of (initial denaturation) 5min, 1 circulation；95 DEG C (denaturation) 30sec, 55 DEG C of (annealing) 30sec, 72 DEG C of (extension) 1min, 32 circulations；72 DEG C, 8min, 1 circulations；12 DEG C of preservations.

(3) 1.0% agarose gel electrophoresis detect PCR product, and positive identification result is as shown in figure 9,35S has 10 positives Transgenosis system, CFP1 have 2 positive transgenic systems.

Wherein, primer pair is as follows:

[9] primer pair (NO.10~14 SEQ ID)

4. mountain gold mandarin orange different tissues GFP expression conditions detect: it is accredited as positive transgenosis mountain gold mandarin orange, acquisition leaf, Stem and ovary detect GFP expression conditions.Instrument is body formula fluorescence microscope (Leica MZFLIII), and optical filter is GFP.Identified, as shown in Figure 10, the failed negative control of transgenosis (CK) respectively organizes equal redgreen fluorescence, and 35S::GFP is each Tissue has green fluorescence, and in CFP1::GFP, the equal redgreen fluorescence of stem, leaf, but there is green fluorescence in ovary.It is known that Ovary development illustrates that the promoter has fruit specific at fruit.

The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.

SEQUENCE LISTING

<110>Hua Zhong Agriculture University

<120>a kind of citrusfruit specificity promoter and application

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 2205

<212> DNA

<213>Citrus sinensis(L.) Osbeck

<400> 1

tgtattgaga gcagttgggg ttttatttga tgcgtcttta atcacattaa aaaccttttg 60

tttgacgcgt ctgtgcttat tttgaacagc aaaaaggtta aaagatttca tgtataaagc 120

gcttctactc ttgattttgt caaattttga gttcaattgg ttctggagaa ggttcagatc 180

tttaggttgc taaaatgtaa ttggaggttt gtacctttat cctacttttg ccttaaataa 240

caagagtgga tttcactcaa ttttttgttg cagataaagg ccggaaagga cccagacatc 300

tatagatgca tttataatag aaataatacg gatgaggccc tgagacacat ctaacttaat 360

tttaataata tggtgaagtt tgtgaaactc aactttgtag caagtcttca tatttagtgt 420

gtgtgtttat tatgcatttg cagtttggtc taattttaat tgaaccttct taactgtatt 480

gcatatactc agttggtgat tgcacgagga aatttgcagt agaaatcatg actcatgggt 540

tgggaagttt agggatgaat gtgcgcaact ttaaacatga aatgaaaaac ctttttttct 600

ttttcttttt ctttttcaca cgcaattttc caaatgccga catttctcca tgtttcggac 660

cgcaggcaaa cttttacaat ttgacggact caaggaccag agagcccaga atttaccggg 720

cctttacctc gtatttggtt attgggcttt tttctgcaga attggaccga gaaattgggc 780

cagctcaaga aactgttggc actgcaaggc aactagtcac tgggtagtga ctcattctgg 840

ttccagaaat cgaacagtgc gtgctccgtt gtcagatgta aagattgaca aagtgtgtgt 900

ggccgggaca ataaagaaaa aggccgaaga acccaaatgg atcagattct aacgcggact 960

agtacgaaga agatcgaaac aatgctgtgc ttgtgttgag tctcataatt ggaaaggcaa 1020

aaacagtcca tccaaatgat aacaatgatt ttgaagaggc cttgaaagaa ttttgttgac 1080

ttggcggcgc gttattaaga aattttcagg caaaggctat tttctatcta attttagtga 1140

tgtctatcag attataataa gcagggcggc tgcctatttt ctattctaat tttacaaaat 1200

tttgctccca aaacccaagc catttttaag ctcacctgat tatatcctct tggcaaattg 1260

ttccactaca caatttttga aggaggcgtt tggttagtta tcgatcagaa ggtatgtaca 1320

tttaagtgat tatcaggaat tgcggcagtt taatctaccg ggctaaacac atatattttt 1380

gagaattata ttacaattta ctgatatttt caggaagcct aaacccatgt aactaaagca 1440

cagtcggagc cctaatgagc attgcaaaaa tattaattgt gtcaaataga aatgagatct 1500

accctcactt aatcacaatt ttttttaaaa aaagtaatag gaagttcgat ctaatgcatt 1560

tttggaagcc ggttaatgaa gtttgaattt actcaatgtg cttgtaatag aaattggata 1620

tgtcccaatt actgttattt ctcttggtat ttatttttat tcttagataa tcaaaaatat 1680

aaaatttagg cttttattat gttatataat tatgtaacaa tcgtggaatg aaatccaacg 1740

attataaaaa tataagataa aaaattatat tatttttaca atcgttaaat ttttaattta 1800

acgattgtat aattatatat gttacatcgt tatataacat aataatcatc ataaatttaa 1860

tattttttgt gcttttaaaa agttaacagg aagaagattg cagggaattg cattgtcggg 1920

aaaatcattg atgcctttga agacatatac ggtggataga agagagagat ggtaaaagca 1980

ttaagctaat taaatattac cgataaagaa gacacgtggc aacaagagat ggcccgcgaa 2040

ggcaccagag atttcgtcta atagaaagca tccagaatcc tctacataaa tcatattagt 2100

cctatatata ggcctctctt gtctcatcct tctccatctt caaattgatt gatcaaagca 2160

tttccgaagt tgttgagcat ttaattagcg tcccagtttg ccata 2205

<210> 2

<211> 22

<212> DNA

<213>artificial sequence

<400> 2

tgtattgaga gcagttgggg tt 22

<210> 3

<211> 20

<212> DNA

<213>artificial sequence

<400> 3

cgttggtaag ggcagaggac 20

<210> 4

<211> 18

<212> DNA

<213>artificial sequence

<400> 4

caggtcccca gattagcc 18

<210> 5

<211> 18

<212> DNA

<213>artificial sequence

<400> 5

agagtccccc gtgttctc 18

<210> 6

<211> 36

<212> DNA

<213>artificial sequence

<400> 6

aaaaagcagg cttctgtatt gagagcagtt ggggtt 36

<210> 7

<211> 35

<212> DNA

<213>artificial sequence

<400> 7

agaaagctgg gtgtatggca aactgggacg ctaat 35

<210> 8

<211> 32

<212> DNA

<213>artificial sequence

<400> 8

aaaaagcagg cttccaggtc cccagattag cc 32

<210> 9

<211> 31

<212> DNA

<213>artificial sequence

<400> 9

agaaagctgg gtgagagtcc cccgtgttct c 31

<210> 10

<211> 29

<212> DNA

<213>artificial sequence

<400> 10

ggggacaagt ttgtacaaaa aagcaggct 29

<210> 11

<211> 29

<212> DNA

<213>artificial sequence

<400> 11

ggggaccact ttgtacaaga aagctgggt 29

<210> 12

<211> 20

<212> DNA

<213>artificial sequence

<400> 12

ggttctgtca gttccaaacg 20

<210> 13

<211> 18

<212> DNA

<213>artificial sequence

<400> 13

gttcgccagt ctttacgg 18

<210> 14

<211> 18

<212> DNA

<213>artificial sequence

<400> 14

ccctaaactt cccaaccc 18

Claims

1. a kind of citrusfruit specificity promoter, which is characterized in that the citrusfruit specificity promoter is SEQ ID Sequence shown in NO.1.

2. a kind of recombinant expression carrier, which is characterized in that the recombinant expression carrier contains the mandarin orange of sequence shown in SEQ ID NO.1 Tangerine fruit-specific promoter.

3. a kind of recombinant microorganism is that the difference microbial of the recombinant expression carrier as described in claim 2 is obtained.

4. recombinant microorganism according to claim 3, which is characterized in that the microorganism is soil Agrobacterium.

5. citrusfruit specificity promoter, recombinant expression carrier or recombination described in a kind of any one according to claim 1~4 Application of the microorganism in Plant Transformation.

6. application according to claim 5, which is characterized in that the application in Plant Transformation is to change in citrusfruit Application in good.