CN106834303B - Cloning and application of cabbage type rape flowering phase genes BnFLC.A2 and Bnflc.a2 - Google Patents

Abstract

The invention discloses cloning and application of cabbage type rape flowering phase genes BnFLC.A2 and Bnflc.a2, and provides separation cloning, functional verification and application of two DNA fragments of a rape early flowering gene Bnflc.a2 and a rape late flowering allele BnFLC.a2. The early-flowering recessive gene Bnflc.a2 is a loss-of-function mutant of the BnfLC.a2 gene. The invention develops a function marker of early flowering gene, and discovers that the influence of Bnflc.a2 gene on flowering phase in natural population shows obvious level under seven environments through genotype and flowering phase phenotype analysis of 495 natural population of cabbage type rape, which shows that the loss of copy function caused by insertion of long fragment in Bnflc.a2 is an important factor influencing natural variation of flowering time of cabbage type rape. The functional marker is designed by utilizing the sequence of the gene per se to carry out molecular marker-assisted selection and breeding of early flowering materials so as to cultivate early flowering and early maturing rape, and the method has the characteristics of accuracy, high efficiency and economy.

Description

Cloning and application of cabbage type rape flowering phase genes BnFLC.A2 and Bnflc.a2

Technical Field

The invention belongs to the technical field of rape molecular breeding, and particularly relates to separation cloning, functional verification and application of two DNA fragments containing a cabbage type rape early flowering gene Bnflc.a2 and a cabbage type rape late flowering allele Bnflc.a2.

Background

Brassica napus (Brassica napus L.) is an allotetraploid crop, formed approximately 7500 years ago by natural crossing and natural doubling of the diploid crops Brassica campestris (b.rapa) and Brassica oleracea (b.oleracea) (chalhouub et al 2014). Brassica napus (b.napus) is an important oil crop and is widely cultivated in China. Timely flowering not only affects the yield and quality of the brassica napus, but also determines the adaptability of the brassica napus to ecological regions, so that the flowering period is one of important target traits for breeding the brassica napus. According to the vernalization demand of the cabbage type rape, the rape is divided into winter rape, semi-winter rape and spring rape, wherein the semi-winter rape is mainly distributed in Yangtze river basin of China, and the spring rape is mainly distributed in Gansu province, Qinghai province, inner Mongolia province and the like. At present, in actual production, crop stubble crops such as cabbage type rape, rice, cotton and the like are in conflict with one another, so that the planting area of the cabbage type rape is greatly reduced, and the self-sufficient rate of the rapeseed oil is seriously insufficient. The key point for solving the problem is to shorten the growth period of the cabbage type rape and develop the precocious breeding of the cabbage type rape. Previous studies have shown that cabbage type rape premature flowering and precocious maturity present a significant positive correlation, and that precocious rape can be bred through selection of materials for the premature flowering (Campbell and Kondra 1978; Gaoyongan 1979; Liu Neili 1985; Amiri-Oghan et al 2009). Therefore, the timely flowering of the cabbage type rape is regulated, the important significance is brought to the yield and the quality of the cabbage type rape, and the current situation that the cabbage type rape fights the land with rice and cotton can be avoided.

At present, the research of the flowering phase of the cabbage type rape still focuses on the positioning work of the QTL in the flowering phase, and reports of successfully cloning genes of the flowering phase of the cabbage type rape by a map-based cloning technology are few. Ferreira et al (1995) have long constructed DH populations using winter rape Major and spring rape Stellar, and mapped flowering QTL under vernalization conditions and without vernalization. They co-detected 3 QTL sites, of which the QTL site located on LG9(N2 linkage group) was significantly associated with the flowering phase of the population under all three conditions of no vernalization, vernalization for 4 weeks, and vernalization for 8 weeks; wherein the locus accounts for 28% of phenotypic variation under the condition of 8 weeks of vernalization treatment. Butruille et al (1999) constructed IBLs populations using german winter rape cultivar Ceres and australian spring rape cultivar Marno and canadian spring rape cultivar wistar that detected multiple loci significantly associated with flowering phase, where a QTL locus on the N2 linkage group could account for 22.6% of the phenotypic variation, in the same region as the flowering QTL locus on LG9 detected by Ferreira et al; in addition, they detected a major flowering site located on the N12 linkage group, which could account for 26% of phenotypic variation. Raman et al (2016) discovered that 69 sites of SNPs were significantly associated with the flowering phenotype and were reproducibly detected by gathering 182 Brassica napus varieties, recording the flowering phenotype in three different settings (field, greenhouse, and manually controlled) and performing correlation analysis.

Disclosure of Invention

The inventor successfully clones the flowering gene BnFLC.A2 of the brassica napus for the first time through a map-based cloning technology, and proves that the BnFLC.A2 is a flowering gene of the brassica napus through comparative sequencing, genetic complementation experiments and expression experiments.

Furthermore, the inventors found for the first time a Bnflc.a2 gene containing an insertion of a long fragment of about 2.8kb in Brassica napus by parental comparative sequencing. Sequence analysis and expression analysis of Bnflc.a2 gene prove that the gene is a loss-of-function mutation. The loss of function of the gene leads to early flowering time. Natural population analysis shows that the copy function loss caused by the insertion of the long fragment in Bnflc.a2 is an important factor influencing the natural variation of flowering time of the brassica napus, and the gene has important application value.

Therefore, the invention aims to separate and clone the early flowering gene Bnflc.a2 and the late flowering allele Bnflc.a2 from the brassica napus, and perform functional verification and application on the two genes.

In order to achieve the purpose of the invention, the inventor finally separates a brassica napus late-flowering gene BnFLC.A2 from brassica napus through a great deal of experimental research and diligent effort, and the nucleotide sequence of the brassica napus late-flowering gene is shown as SEQ ID NO.1 in a sequence table.

The present inventors can screen the gene or homologous gene of the present invention from a genomic or cDNA library using the cloned polynucleotide sequence as a probe according to conventional techniques in the art. Similarly, the gene of the invention or any segment of the nucleotide sequence of interest or a nucleotide sequence homologous thereto can be amplified from the genome and cNDA using PCR techniques. Therefore, the nucleotide sequence which is hybridized with the nucleotide sequence shown in SEQ ID NO.1 in the sequence table under strict conditions and encodes the protein with the same function also belongs to the brassica napus late flower gene sequence.

Furthermore, conservative variants obtained by conservative mutation of any one of the nucleotide sequences through nucleotide addition, deletion, substitution and modification also belong to the brassica napus late-flowering gene sequence.

In addition, the invention also provides a protein for expressing the brassica napus late-flowering gene BnFLC.A2, and the amino acid sequence of the protein is coded by any one of the nucleotide sequences. Further preferably, the amino acid sequence of the protein for expressing the brassica napus late flowering gene BnFLC.A2 is shown as SEQ ID NO.2 in the sequence table.

Furthermore, the invention also provides a cabbage type rape early flowering allele Bnflc.a2, the nucleotide sequence of which is selected from any one of the following:

(1) a nucleotide sequence shown as SEQ ID NO.3 in the sequence table;

(2) conservative variant obtained by conservative mutation of nucleotide addition, deletion, substitution and modification of the nucleotide sequence defined in (1).

Finally, the invention also provides application of the brassica napus late flowering gene BnFLC.A2 in rape growth period improvement. And the application of the cabbage type rape early flowering allele Bnflc.a2 in the early flowering and early maturing improvement of rape.

Compared with the prior art, the invention provides a cabbage type rape late-flowering gene BnFLC.A2 and a cabbage type rape early-flowering gene BnflC.a2 for the first time, wherein the early-flowering recessive gene BnflC.a2 is a function-loss mutant of the BnFLC.A2 gene. The invention develops a function marker of early flowering gene, and discovers that the influence of Bnflc.a2 gene on flowering phase in natural population shows obvious level under seven environments through genotype and flowering phase phenotype analysis of 495 natural population of cabbage type rape, which shows that the loss of copy function caused by insertion of long fragment in Bnflc.a2 is an important factor influencing natural variation of flowering time of cabbage type rape. The functional marker is designed by utilizing the sequence of the gene per se to carry out molecular marker-assisted selection and breeding of early flowering materials so as to cultivate early flowering and early maturing rape, and the method has the characteristics of accuracy, high efficiency and economy.

Drawings

FIG. 1: the invention relates to a technical flow chart for identifying, separating, cloning and verifying cabbage type rape early flowering gene Bnflc.a2 and late flowering allele Bnflc.a2.

FIG. 2: phenotype representation of parental flowering phase under the effect of BnFLC.A2 gene. FIG. 2A is a table type chart of L06, F1 and L04 taken on the 99 th day after sowing; FIG. 2B is a table type chart of L06, F1 and L04 photographed on the 136 th day after sowing; scale, 10 cm.

FIG. 3: NIL-F2 population flowering phenotype profile. FIG. 3A is a NIL-F2 phenotype profile at flowering time in winter rape environment; FIG. 3B is a NIL-F2 phenotype profile at anthesis in spring rape environment.

FIG. 4: the specific marker STA2-18 identifies Chinese cabbage, parents and NIL-F2 small population. The detection samples comprise 22 parts of Chinese cabbage, 11 parts of cabbage, L06, L04, NIL-F2(15-43) and the other two parts of cabbage type rape R15 and R11 in sequence. Wherein the florescence phenotype data for the small population of NIL-F2 is below the target band, -indicating data loss; m represents DL2000 marker.

FIG. 5: covering the physical map of the cabbage type rape flowering phase gene BnFLC.A2 segment. The numbers below the molecular markers in the figure indicate the number of individuals with recombinant crossovers between the bnflc.a2 gene site and the molecular markers detected in the population of the near isogenic lines.

FIG. 6: and (5) performing parental comparison sequencing on the target gene BnFLC.A 2. FIGS. 6A and 6B show the schematic position of primer combinations STA2-6L/STA2-6R, STA2-55L/STA2-1R, STA2-1L/STA2-42R, STA2-8L/STA2-8R and the amplification profiles of the four primer combinations in parents L04 and L06 and two other materials R15 and R11, respectively; the four pairs of primers are used for designing a target candidate gene BnFLC.A2 and an upstream and downstream interval thereof into four sections for amplification according to a reference genome sequence of the Brassica napus Darmor-bzh; FIGS. 6C and 6D show the schematic position of primer combinations STA2-13L/STA2-17R and STA2-17L/STA2-13R and the amplification patterns of the two primer combinations in parents L04 and L06 and two other materials R15 and R11, respectively; FIG. 6C blue arrows indicate target bands and red arrows indicate bands containing long fragment insertions; FIGS. 6E and 6F show schematic position diagrams of primer combinations STA2-55L/STA2-46R, STA2-54L/STA2-54R STA2-45L/STA2-1R, STA2-1L/STA2-42R, and amplification diagrams of the primer combinations in parents L04 and L06, respectively; the four pairs of primers are designed into four segments for amplification according to the sequence of the Bnflc.a2 gene measured in L06. M1 represents DL2000marker, M2 represents 1Kb DNA ladder marker.

FIG. 7: functional vector map used for the transgene pFGC5941 backbone.

FIG. 8: t1 generation strain and parent florescence phenotype diagram and florescence data statistical chart. FIG. 8A shows the parental L06, L04 and transgenic T1 generation positive and negative individual phenotypes; FIG. 8B shows the T1 positive and negative single flowering date data phenotypes for the parents L06, L04, and the 4 single copy lines BnA2-2, BnA2-10, BnA2-14, and BnA 2-37. Negative and positive individuals in the single copy line T1 generation, respectively. Flowering date is expressed as mean ± sem. Denotes P < 0.0001. Scale, 10 cm.

FIG. 9: schematic structure of candidate gene promoter analysis vector.

FIG. 10: and (4) carrying out GUS staining on flower buds of genetically transformed plants of the T2 generation of Arabidopsis thaliana. Fig. 10A to 10D are wild type controls, fig. 10E to 10H are results of GUS staining for each part of the bnflc.a2 gene promoter transformed seedling, and fig. 10I to 10L are results of GUS staining for each part of the bnflc.a2 gene promoter transformed seedling.

FIG. 11: expression pictures of BnFLC.A2 gene and Bnflc.a2 gene in winter rape environment, and the used materials are L04 and L06. FIG. 11A shows RT-PCR (32 cycles) detection of the expression of the different time periods BnFLC.A2 genes in L04 and L06; fig. 11B, 11C and 11D show the expression of bnflc.a2, BnFT and BnSOC1 at different times in qRT-PCR analysis L04 and L06, respectively. Samples 1-8 represent samples taken at 34d, 76d, 83d, 105d, 124d, 132d, 150d and 174d, respectively, after sowing. The expression of the BnACTN 7 gene served as a control. There were three biological replicates (mean ± Standard Error (SEM)) per sample point.

FIG. 12: functional markers of the Bnflc.a2 gene analyze flowering phase variation in natural populations. A2 genotypes were grouped, and flowering phase differences reached significant levels under seven circumstances. A 2-indicates that the material being tested does not contain the bnflc.a2 gene, and a2+ indicates that the material being tested contains the bnflc.a2 gene. Flowering days are expressed as mean ± standard error (s.e.m.) at flowering time.

Detailed Description

The present invention is further defined by the following specific examples, and describes the method of the present invention for isolating and cloning the DNA fragment containing the complete coding segment of the bnflc.a2 gene and bnflc.a2 gene based on the above-mentioned preliminary work and verifying the two genes (the technical route is shown in fig. 1). The present invention may be embodied in many different forms without departing from the spirit or essential characteristics thereof, and it should be understood that various changes in form and details can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims. Unless otherwise indicated, the experimental procedures described below are conventional and well-known in the art, and the reagent formulations or materials used are commercially available.

Example 1: constructing a near isogenic line of BnFLC.A2 gene and primarily positioning the gene

1. Experimental Material

The materials used in the experiment are cabbage type rape advanced generation near-isogenic line materials: late flower material L04 and early flower material L06 (fig. 2). Material sources are as follows: two cabbage type rape homozygous materials HZ396E and Y106 are used as original parents for hybridization, and HZ396E is used as a recurrent parent for continuous backcrossing for five generations and then selfing is carried out to obtain a high-generation segregating population, flowering period segregation is found, and a early-flowering homozygous material is selected from the high-generation segregating population and is named as L06 and a late-flowering homozygous material and is named as L04. The flowering phase of the NILs material is stable through years of field observation under the environment of winter rape, wherein the early-flowering material L06 blooms about 93 days after being sown, and the late-flowering parent L04 blooms about 135 days after being sown, and the difference of the flowering phase of the two materials reaches 42 days. The NIL-F2 segregating population was constructed by crossing and selfing L04 and L06 as parents for the localization of the flowering gene.

Florescence phenotype study of NIL-F2 segregating populations

Through NIL-F under the environment of winter rape in 2014 and spring rape in 2015₂Statistical findings of the flowering phenotype profile of the population were made: in the winter rape environment in 2014, the NIL-F2 population florescence separation shows that the late flower and early flower separation accords with the separation ratio of 3:1 (chi-shaped separation by chi-square detection)²When the plant is 3.20 and P is 0.064 (fig. 3A), under the environment of 2015 spring rape, the separation of the florescence of the NIL-F2 population shows that the separation of late flowers and early flowers meets the separation ratio (chi) of 3:1 through chi-square detection²1.16, P0.24) (fig. 3B). Each NIL-F₂The phenotype of the population at the flowering phase conforms to the Mendelian genetic law controlled by a pair of major genes, and the phenotype of the population at the flowering phase is controlled by a single gene, so that the site can be finely positioned by constructing a large population, and candidate genes can be further determined.

3. Preliminary positioning late flower gene BnFLC.A2

To determine the position of this flowering QTL, a total of 400 pairs of the common primers from this laboratory were selectedSSR primers which are uniformly distributed on 19 linkage groups of the brassica napus. First, we screened polymorphic primers by parents, and then used a NIL-F₂Populations were isolated to verify whether these primers were linked to the flowering phenotype. Through this strategy we found that four pairs of primers SRA2-6, SSA2-2, SSA2-6, SRA2-31 and the NIL-F₂The florescence phenotypes of the segregating populations are linked, the florescence differences all reach a very significant level (table 1), and the sequences of the four pairs of primers are shown in table 2. For the NIL-F₂The colony is separated, and the construction of a local genetic linkage map is carried out by using Mapmaker 3.0. Meanwhile, QTL scanning is carried out by utilizing QTL 1.1 software in combination with group phenotype. The results show that the flowering QTL locus is located between SSA2-2 and SSA2-6, the locus explains 96.4% of phenotypic variation, the additive effect is 18.96 days, the LOD value is 58.1, and the flowering trait in the population is controlled by only one pair of genes.

TABLE 1 NIL-F₂Segregating population validation linkage markers

The mean flowering time in the table indicates F₂Average of the flowering time of all individuals in the population that have the same marker genotype as L06, and average of the flowering time of all individuals that have the same marker genotype as L04. Flowering time is expressed as mean ± standard error of flowering time.

TABLE 2 linkage marker primer sequences

The sequence alignment of the four pairs of markers shows that the flowering gene is more likely to be located on the A2 chromosome (Table 3, Table 4), and in addition, a SCAR marker STA2-18 (FIG. 4) capable of specifically distinguishing A2/C2 is simultaneously developed, so that the target gene is further verified to be located on the A2 chromosome, and the site is named as qFT-A2 in the research. We used the sequences of the markers SRA2-6 and SRA2-31, which are furthest on both sides, to define qFT-A2 within the physical interval corresponding to about 1Mb of the chromosome of cabbage A2.

TABLE 3 alignment of the sequence of the primers for linkage markers with the genomes of cabbage and cabbage

The position in the table indicates the position where the left primer sequences are aligned-indicating that the primers are not aligned to the genome.

TABLE 4 alignment of the sequence of the primers for the linkage markers with the genome of Brassica napus

Positions in the table indicate positions where the left and right primer sequences were aligned, indicating that the primers were not aligned to the genome.

Example 2: fine positioning late flower gene BnFLC.A2

1. Development of molecular markers

According to the initial positioning result, 119 pairs of SSR markers are developed for the interval between the markers SRA2-6 and SRA2-31 which are furthest at two sides, the Chinese cabbage genome A2 chromosome sequence is taken as a reference sequence, and the total physical interval of about 1Mb is used. Polymorphic markers are screened by parents L06 and L04, and then the polymorphic markers can be used for large-population genotype analysis, and 28 pairs of SSR markers with polymorphism are screened together by marker screening. And selecting 10 pairs of SSR markers which are uniformly distributed in a target interval and have better banding patterns from the 28 pairs of SSR markers for subsequent population analysis and identification of genotype of the crossover individual plants. The sequence information of these markers is shown in Table 5.

TABLE 5 Fine positioning marker sequences

Fine localization and candidate Gene prediction for BnFLC.A2

To further narrow the target interval, 2014In the early 10 months, we planted 2065 NIL-F strain in the environment of winter rape of Wuhan₂Large population for further fine localization of qFTA2-1 site. As with the previous thought, we first analyzed the marker genotypes of this population using the two-sided markers SRA2-6 and SRA2-31, to identify 66 potential crossover individuals together; wherein 14 strains were present on the SRA2-6 side and 52 strains were present on the SRA2-31 side (FIG. 5A); then, other marks in the interval are directly used for detecting the 66 crossover individuals, and the 66 crossover individuals are only 14 crossover types through analysis (FIG. 5B); finally, 2 crossover individuals were found on the side of the marker SRA2-77, and 1 crossover individual was found on the side of the marker SRA 2-114; whereas markers SRA2-80, SRA2-81, STA2-18, SSA2-6 and SRA2-86 were co-isolated with the target gene (FIGS. 5A and 5B). In 5 months in 2015, selfing progenies of 1 plant selected from 14 exchange types in total from the 66 exchange single plants are sent to Gansu for planting, the flowering-stage phenotype is recorded for progeny verification of the exchange single plants, and other exchange single plants are planted in Wuhan in 10 months in 2015 and the segregation condition is recorded. Finally, the qFT-A2 locus was defined between the markers SRA2-77 and SRA2-114 by progeny validation of the crossover individuals (FIG. 5B), and sequence alignment analysis showed that this interval was referenced to the physical interval of about 86kb of the Brassica napus genome A2 chromosome, which contains 23 candidate genes (FIG. 5C). In order to further narrow the range of candidate genes, all the homologous genes of Chinese cabbage and Arabidopsis thaliana corresponding to the 23 candidate genes are labeled and subjected to functional annotation, and only one candidate gene BnaA02G00370D gene in the interval is analyzed and found to be the homologous gene of the flowering gene AT5G10140(FLC) in Arabidopsis thaliana (FIG. 5C). The FLC gene is a key gene for regulating flowering in the vernalization pathway of Arabidopsis thaliana, so that a target candidate gene is preliminarily determined to be the FLC gene in the vernalization pathway of Arabidopsis thaliana, and is named as BnFLC.A2 in the research.

Example 3: comparative sequencing to determine natural variation between BnFLC.A2 alleles

To further confirm the candidate genes, we designed specific primers based on the candidate gene BnaA02g00370D and the reference sequences upstream and downstream thereof of the target interval of Brassica napus A2 chromosome, and amplified the coding region of the target candidate gene BnFLC.A2 and the upstream promoter region and the downstream interval thereof, respectively. We analyzed the parents L04 and L06 using these primers, in which the marker STA2-6L/STA2-6R amplified the last exon of the gene upstream of the initiation codon of the BnFLC. A2 gene up to the last one, with a theoretical size of about 2.3 kb; STA2-8L/STA2-8R amplified is BnFLC. A2 gene stop codon downstream to the first exon of the next gene, theoretical size about 2.4kb (FIG. 6A); we designed two pairs of primer amplifications for the BnFLC. A2 coding region, STA2-55L/STA2-1R (theoretical size about 1.6kb), STA2-1L/STA2-42R (theoretical size about 1.9kb) (FIG. 6A). We used pairs of primers to amplify parent L04 and L06 to find that: compared with the late-flowering parent L04, the early-flowering parent L06 has no amplification product in the former half of the BnFLC.A2 coding region STA2-55L/STA2-1R (FIG. 6B), which shows that the early-flowering parent L06 has a mutation in the former half of the BnFLC.A2 coding region sequence, so that no amplification product exists. While the other three primer combinations can amplify target bands in parents, all amplified fragments of parents L04 and L06 are subjected to TA clone sequencing. For L04, four sequences were spliced to obtain a sequence of a copy of bnflc.a2 in this material. Aiming at the early-flowering parent L06, in order to find a mutation, a strategy is changed, the coding region of a target gene BnFLC.A2 and an interval of about 8kb in upstream and downstream are divided into two long fragments, primers STA2-13L/STA2-17R and STA2-17L/STA2-13R are respectively designed, and theoretical amplification product sizes are 3.8kb and 4.2kb respectively (FIG. 6C). The amplification result shows that a fragment with the length of about 6.6kb is amplified by the primer combination STA2-13L/STA2-17R in the early-flowering parent L06; in contrast, the amplification product of the primer combination STA2-13L/STA2-17R in L04 amplified a weaker fragment of about 6.6kb in addition to the target 3.8kb band (FIG. 6D). Theoretically, the primer combination STA2-13L/STA2-17R amplified a fragment with a size of only 3.8kb, while a fragment with a size of 6.6kb was amplified in L06, thus indicating that the sequence has a large variation. L04 also contained a 6.6kb band of similar size to L06, which was very weak and the concentration of recovered product was too low to allow for clonal sequencing. On the other hand, for the amplified product of 6.6kb in size in L06, we ligated the fragment to the vector PFGC5941 by homologous recombination one-step cloning, followed by cloning transformation, and selected two clones, positive clone L06-13L/17R-01 and L06-13L/17R-03, for sequencing. An additional fragment (4.2kb) of STA2-17L/STA2-13R clone in L06 was transformed and sequenced in the same manner. Finally, the two sequences are spliced to obtain the coding region of the target candidate gene in L06 and the sequences upstream and downstream thereof, and the allele type in L06 is marked as Bnflc.a2 (FIG. 6E). After assembling of Bnflc.a2 in L06 and sequences upstream and downstream thereof is completed, with the complete copy sequence as a reference, primers STA2-55L/STA2-46R (1.577kb), STA2-54L/STA2-54R (1.762kb), STA2-45L/STA2-1R (1.264kb) are designed on the basis of the complete copy sequence, and a primer combination STA2-1L/STA2-42R (1.954kb) before combination is formed by STA2-45L/STA2-1R (1.264kb) so that the copy is divided into four segments to be amplified in L04 and L06 respectively (FIG. 6F), then the amplified segments are recovered and subjected to TA clone sequencing, and the obtained sequences are spliced respectively to find that the sequence of the Bnflc.a2 copy obtained in L04 is completely consistent with the sequence of the Bnflc.a2 copy in L06. The sequence information of the primers used for comparative sequencing is shown in Table 6.

TABLE 6 comparative sequencing primer sequences

Example 4: transgenic complementation experiment of BnFLC.A2 gene

1. Construction of transgenic vectors

According to the prediction of the previous candidate gene and the result of the sequencing by the parental comparison, the genomic DNA of late floral material L04 is used as a template, primers STA2-13L/STA2-13R (the sequences of the primers are shown in Table 6) are used for amplifying the full-length 7.645-kb (including upstream 2.195kb, coding sequence 3.259kb and downstream 2.191kb) sequence of the BnFLC.A2 gene, and high fidelity enzyme Phanta is selected^TMSuper-Fidelity DNA Polymerase (Novovovowed, Nanjing) was amplified. And then ligated to the expression vector PFGC5941 (FIG. 7). The PCR amplification system (total volume 20. mu.l) was as follows:

template DNA: 2 μ l

5×SF Buffer：4μl

dNTP：0.4μl

Left primer: 0.8. mu.l

Right primer: 0.8. mu.l

DNA Polymerase：0.4μl

ddH₂O：11.6μl

The PCR reaction conditions were as follows: at 95 ℃ for 2 min; 95 deg.C, 10sec, 60 deg.C, 10sec, 72 deg.C, 4min, 35 cycles; 72 ℃ for 10 min; 20 ℃ for 5 min. The amplified product was detected by 1% agarose gel electrophoresis, and the target fragment was subjected to gel digging, after which DNA was recovered using the agarose gel recovery kit from Promega (http:// cn. Promega. com /). Meanwhile, plasmid DNA of the vector PFGC5941 is extracted, and the fast restriction enzymes EcoRI and SmaI are directly used for double digestion by Fermentas (Thermo Scientific, http:// www.thermoscientificbio.com), wherein the double digestion system is as follows:

template DNA: 5 μ l

EcoRI：0.5μl

SmaI：0.5μl

FD Green Buffer：1.5μl

The enzyme digestion reaction is carried out in a thermostat at 37 ℃ for 2 h. After the plasmid of the vector PFGC5941 is cut, the cut plasmid is detected and recovered by agarose gel electrophoresis, and the plasmid DNA is recovered by an agarose gel recovery kit of Promega (http:// cn. Promega. com /). The target fragment and linearized PFGC5941 plasmid were then cloned using the Novozam recombinant cloning kit (Clonexpress)^TMII) the sequence was ligated into the PFGC5941 vector by means of homologous recombination and transferred into competent cells of E.coli-sensitive Top10 for sequencing by heat shock transformation. And (3) selecting a monoclonal amplification culture strain with completely correct sequencing, preserving the strain, extracting a Plasmid by using a Plasmid extraction Kit (Plasmid mini Kit, OMEGA), and carrying out EcoRI and SmaI double enzyme digestion detection. The successfully constructed vector is transferred into agrobacterium-competent cells GV3101 by an electric shock transformation method and coated on LB plates containing three antibiotics (rifampicin, gentamicin and kanamycin). Selecting a single clone growing on a plate, carrying out amplification culture, extracting plasmids, carrying out EcoRI and SmaI double enzyme digestion detection, finally selecting 6 positive clones for activation, and storing at-70 ℃ for later use, wherein vectors constructed by BnFLC.A2 genes amplified from L04 are named as PFGC5941-L04-BnFLC.A2 respectively。

A2 transgenic process of BnFLC

1) Preparation of sterile receiver Material

Selecting full and clean rape seeds, soaking the rape seeds in 75% ethanol for 1min, sterilizing the rape seeds in 0.1% mercuric chloride for 10-15 min, washing the rape seeds with sterile water for 4-5 times, sucking excess water with sterile filter paper, inoculating the rape seeds on a germination culture medium, and placing the rape seeds in a paper box at 25-28 ℃ for dark culture for one week.

Seed germination culture medium

2) Pretreatment of receptor material

Taking cotyledons or hypocotyls of the aseptic seedlings of 4-6 days as transformation receptors. Cutting out the complete cotyledon (with 1-2 mm cotyledon petiole) or hypocotyl (5-10 mm) by using a scalpel, and placing the cut-out explant on a pre-culture medium NMS1 for pre-culture for 3d to perform inoculation and dip-dyeing.

Pre-culture medium: NMS1

3) Culture of Donor Strain

a. Preparing a solid culture medium and a liquid culture medium: the preparation of a conventional LB medium (Luria-Bertani) is given here.

LB liquid medium: 10g of tryptone (bacto-tryptone), 5g of yeast extract (bacto-yeastextract) and 10g of NaCl are weighed, dissolved in 800ml of deionized water, the pH value is adjusted to 7.0 by using 1mol/L of NaOH, and the deionized water is added until the total volume is 1L. Sterilizing with high pressure steam for 20 min.

LB solid medium: 12g of bacterial culture agar powder (bacto-agar) is added into each liter of LB liquid culture medium, after high-pressure steam sterilization, when the solution is cooled to about 60 ℃, Kan (to make the final concentration 50mg/L), Gen (gentamicin sulfate, the final concentration 50mg/L) and Rfi (rifampicin, the final concentration 50mg/L) are added and evenly mixed in a rotating way (to avoid generating air bubbles), the culture medium is poured out of a flask into a culture dish, and the culture dish with the diameter of 90mm needs about 20ml of culture medium. After complete solidification, the plate should be inverted and stored at 4 ℃ until use. The stored plate should be taken out 1-2 h before use.

b. Culturing single colony agrobacterium: taking out the strain tube stored at-70 ℃ for a long time, placing the strain tube on ice, scraping the surface of the frozen culture by using an inoculating needle under the aseptic condition, and quickly marking the agrobacterium attached to the inoculating needle on the surface of an LB agar plate containing 50mg/L Kan +50mg/L Gen +50mg/L Rfi. The strain tube is preserved at-70 deg.C. And carrying out dark culture on the inoculated agar plate at 28 ℃ for 36-48 h.

c. And (3) agrobacterium amplification liquid culture: picking well-grown single colonies from agar plates by using sterilized toothpicks, inoculating the single colonies into a liquid LB culture medium (added with 50mg/L Kan +50mg/L Gen +50mg/L Rfi), carrying out shaking culture (200r/min) at 28 ℃ overnight (16-18 h), and culturing the agrobacterium to a logarithmic growth phase, OD₆₀₀The value reaches about 0.4.

d. Centrifuging the bacterial solution in 2ml centrifuge tube at 6000r/min, collecting thallus after 5min, washing with MS liquid culture medium for 2 times, re-suspending thallus with MS liquid culture medium (adding 100 μmol/L AS, pH 5.4), and adjusting OD₆₀₀And (5) slightly shaking and culturing for 2-3 h for later use when the temperature is about 0.4 ℃.

4) Dip dyeing

And (3) pouring the cultured agrobacterium tumefaciens liquid into a sterile culture dish on a clean bench (the cultured agrobacterium tumefaciens liquid can be diluted by different times according to the sensitivity of materials to the bacterial liquid). Taking out the pre-cultured explant, putting the explant into a bacterial liquid, soaking for 30min (different material treatment time is different), and sucking the bacterial liquid on the surface of the explant by using sterile filter paper.

5) Co-culture of explants with Agrobacterium

The impregnated explants were inoculated into a layer of sterile filter paper spread on co-culture medium (i.e. NMS1 medium with filter paper cover) and cultured in the dark for 2 days in a light culture chamber.

6) Bacteria-removing screening culture medium

And taking out the explants subjected to co-culture, drying the explants by using sterile filter paper or drying redundant water on an ultra-clean workbench, and flatly placing hypocotyls on a bacteria-removing screening culture medium NMS3 for bacteria-removing culture for 7-10 days.

Selecting a culture medium: NMS3

Sterilizing, cooling to 50 deg.C, adding

Carb 1ml

PPT 50μl

7) Callus induction culture medium

Explants after one week on NMS3 (slightly enlarged on both ends, possibly with green callus) were transferred to induced callus medium NMS4, which was subcultured between 2 weeks.

Induction callus culture medium: NMS4

Sterilizing, cooling to 50 deg.C, adding

Carb 1ml

PPT 50μl

AgNO₃100μl

8) Culture medium for inducing germination

Explants with green callus appearing on both ends of NMS4 were transferred to germination-inducing medium NMS5(MS +3mg/L BAP +2mg/L Zeatin +30g/L Cross +5.5g/L Phytal-glue +500mg/L Carb +10mg/LPPT) until shoots appeared. The process takes the longest time, and is carried out for 2-3 times in an intermediate subculture.

Culture medium for induction of shoots: NMS5

Sterilizing, cooling to 50 deg.C, adding

Carb 1ml

PPT 50μl

9) Bud extension medium

Bud tissue differentiated from the callus on the NMS5 culture medium is cut off from the bonding part of the bud tissue and the callus by a knife and placed on NMS6 culture medium until the bud grows to 1-2 cm.

Shoot extension medium: NMS6

Sterilizing, cooling to 50 deg.C, adding

Carb 1ml

PPT 50μl

10) Rooting culture medium

The extended shoot tissue is transferred to rooting medium until rooted.

Rooting culture medium

Sterilizing, cooling to 50 deg.C, adding

Carb 500μl

After genetic transformation, PFGC5941-L04-BnFLC.A2 vector obtains 66 independently transformed T strains₀The number of the generation transformation seedlings is BnA2-1-BnA 2-66; detecting to obtain T₀48 generation positive individuals, only 11T are finally obtained₀The seeds harvested from the generation positive lines can be used for T₁Performing generation analysis; we analyzed T of these 11 positive lines₁Only 4 single-copy positive lines, BnA2-2, BnA2-10, BnA2-14 and BnA2-37, were found in the generations, and transgene T was found in these four lines₁The flowering phase of the generation-positive individual plant is obviously later than that of the transgenic T₁Generation negative lines, flowering late 23 to 30 days (fig. 8); and T thereof₁The generation cosegregation assay found a significant correlation between flowering phase and relative expression at the 0.001 level (r ═ 0.793) (table 7); the results finally confirmed that the BnFLC. A2 gene was the target gene of qFT-A2.

Table 7 bnflc. a2 transgenic T₁Surrogate co-separation detection

Example 5: analysis of promoter of BnFLC.A2 Gene

Earlier comparative sequencing revealed that the promoter regions of BnFLC.A2 and Bnflc.a2 only had 3 single-base changes at a position 1.8kb upstream of the initiation codon, and we speculated that the changes had no effect on the function of the promoter. To verify this hypothesis, and to explore the expression pattern of the target gene, we ligated the promoter sequences of bnflc.a2 and bnflc.a2 to the expression vector PMDC162 (fig. 9) by enzymatic ligation, and constructed P separately_BnFLC.A2GUS and P_Bnflc.a2The GUS promoter is connected with a GUS vector. Transferring the target vector into an arabidopsis Col-0 ecotype plant by an agrobacterium-mediated inflorescence infection method, screening the seeds by using a screening culture medium containing hygromycin resistance after the seeds are harvested, transferring the survived seedlings into soil for planting, sampling and detecting. For P_BnFLC.A2The GUS vector is co-screened to obtain 11 positive seedlings, and P_Bnflc.a2GUS is screened to obtain 16 positive seedlings. We selected T2 generations of two vector-positive transformed shoots and sampled at each growth stage for GUS staining analysis. GUS staining results show that promoters of BnFLLC.A2 and Bnflc.a2 have functions and have similar functions. Through promoter GUS expression analysis experiments, the promoter of the Bnflc.a2 copy is proved to be normally functional, and the expression of the Bnflc.a2 is not detected in the early flowering parent L06 (FIG. 10), which indicates that the function of the Bnflc.a2 is not lost due to the variation of a promoter interval, and the analysis result of comparison sequencing further indicates that the transcription of the Bnflc.a2 is possibly disturbed after the insertion of a long fragment, so that the expression of the copy is not detected.

Example 6: a2 Gene and expression analysis of allele thereof

In 10 months 2014 we sown parents L06 and L04 in the environment of north huohanshan winter rape, we started sampling on day 34 after sowing and then continued sampling at intervals until the late-flowering parent L04 florescence is over. The process spans the entire winter from late autumn to spring, and samples were taken 8 times in total, 34 days, 76 days, 83 days, 105 days, 124 days, 132 days, 150 days, and 174 days after sowing. After all samples were taken, RNA was extracted and expression analysis was performed. We carried out expression analysis experiments on samples of winter rape at different periods of time. As shown in FIG. 11A, the results of RT-PCR showed that the expression of the target gene was not detected in any of L06 as compared with L04; and the expression level of BnFLC.A2 in L04 shows a gradually decreasing trend. In order to more accurately reflect the expression trend of BnFLC.A2 in the parents, the expression condition of BnFLC.A2 in samples at different stages is analyzed by using fluorescent quantitative PCR (qRT-PCR). As shown in fig. 11B, the expression of bnflc.a2 could be detected only in late-flowering parent L04. At day 34 after sowing, there is no continuous low temperature at this stage during the end of autumn, so bnflc.a2 shows a high expression level, the air temperature gradually decreases with the arrival of winter, the expression level of bnflc.a2 shows a tendency to gradually decrease, and after the end of winter, the air temperature rises, however bnflc.a2 remains at a very low level. Meanwhile, we analyzed the expression of the florigen gene BnFT, as shown in fig. 11C, at day 34 after sowing, both L06 and L04 were at very low levels, and with the growth of the plant, the BnFT gene could reach a very high level quickly in the early-flowering parent L06 due to no inhibition of the bnfl. a2 gene; whereas in the late-flowering parent L04, the BnFT gene was previously at a very low level due to the inhibition of the bnflc.a2 gene, and did not start to gradually increase expression until day 105. In comparison, the late-flowering parent L04 showed opposite expression trends for bnflc.a2 and BnFT, similar to the findings in arabidopsis thaliana. Next, we analyzed the expression of the BnSOC1 gene in parents, as shown in fig. 11D, also because there is no inhibition of the bnflc.a2 gene in the early-flowering parent L06, the BnSOC1 gene can quickly reach a very high level; and the BnSOC1 gene shows a gradually rising trend due to the inhibition of the bnflc.a2 gene in the late-flowering parent L04. This process is similar to the expression pattern of the BnFT gene in the parents. In conclusion, BnFLC.A2 can still achieve the effect of inhibiting flowering by inhibiting the expression of BnFT and BnSOC1 in the brassica napus, and the mechanism for regulating flowering has certain conservation in the brassica napus.

Expression experiment primer sequences:

qBnFLC.A2-L 5’GCGATAACCTGGTCAAGATCC 3’

qBnFLC.A2-R 5’CTCCAGCTGAACGAGGGAG 3’

qBnFT-L 5’TAACAGAGATCCTCTTGTGGTAGG 3’

qBnFT-R 5’CCACCAATCTCAACTCTTGGC 3’

qBnSOC1-L 5’AGAGAATGCAACAAGCAGACAAG 3’

qBn SOC1-R 5’TGATCAGAGAAACTTCAGCATCAC 3’

BnACTIN7-L 5’GGAAGCTCCTGGAATCCATGAGA 3’

BnACTIN7-R 5’TCTTTGCTCATACGGTCAGCAATTCC 3’

example 7: analysis of the influence of Bnflc.a2 Gene on flowering phase in Natural population

To examine the distribution of the Bnflc.a2 gene in natural populations and the impact on flowering time, we analyzed a natural population containing 495 different varieties of Brassica napus and inbred line material from the group of Xu et al (2016) used for the correlation analysis of Brassica napus flowering time. Specific primers STA2-55L/STA2-46R are designed for the gene to detect the distribution condition of the Bnflc.a2 gene in a natural population, the detection result of 495 materials is counted, 59 materials contain the Bnflc.a2 gene, and single-marker analysis is carried out by combining with a flowering phase phenotype to find that 7 environmental flowering phase differences reach a significant level under 8 environments (figure 12). From the experimental results, the Bnflc.a2 gene is distributed less in the natural population and occupies only about 12 percent of the natural population; association analysis of the bnflc.a2 gene with flowering phase showed that: the effect of the Bnflc.a2 gene on flowering phase in a natural population shows a remarkable level under seven environments, and the fact that the loss of the copy function caused by the insertion of a long fragment in the Bnflc.a2 gene is probably an important factor of natural variation influencing the flowering time of the brassica napus is shown.

Specific primer sequences are as follows:

STA2-55L 5’GCTTCTCGGAGACAGAAGCC 3’

STA2-46R 5’TCAGAGTGGAAGACAAATGATGC 3’。

SEQUENCE LISTING

<110> Wuhan Union agriculture and ethnic science and technology, Limited liability company; university of agriculture in china

<120> cloning and application of cabbage type rape flowering phase genes BnFLLC A2 and Bnflc a2

<160>3

<170>PatentIn version 3.5

<210>1

<211>5624

<212>DNA

<213> Brassica napus (Brassica napus)

<400>1

gaggaggaag agctcatcgt gcttaatgtc ttcatcgaag caaaccaaga attgaaaact 60

attttagcat aaagtaacga atgatgatta gaataacaca gtatttaatg ctacaggtgg 120

tatgagtaat gaactagatg ttgctgtttt tattatcggg aatatatttc cccactttat 180

catttctatt ctattttatc ttctcgcgtt ctaaagttga atgttctgta accattaaaa 240

actaataaaa ttttaacaat ttaaaaagga taattgacat atccagaaat atggaaagcg 300

ggtgagatga ttggataaaa accatgccgt acattcaccc atcgattcgt ataagtacgt 360

ttcgcattaa gtttataata ataaatatag tattttctct gccacataat ttagcatata 420

gggttaatac atttcccttc tctccacaaa cgtttagttt atcgtatagg aaaattgcat 480

catctttaac tttgtagctc tttgttgggg atttttggta tacgaccttt gtgtaagttg 540

tttcttgggt ttgtattggc tcagttgcag ttttcacctg tttttggtat taatatattt 600

ttcaagttga caaaaaaaaa aaaacttttc atcctacatt atatagacga ttataatggg 660

attgcgcaaa attctaaaca aaaattaaat actaactttt gtatactatt ttctaaaaca 720

tctaaaaaat acattagtga gaacaatgtc tattaagtaa caatgtcaat taaacaacga 780

attcaacata ttaagaatat aaatttatca aaaaaaagtg ggccaaaatc tccaaatttc 840

atccttgtat aaataaagag agattttttt ctggacaaag tataaataaa gagatatttt 900

gcctaaaata gaggataaaa attatttagg caacatgttt tgaacaacca cagtgaaaca 960

aacaaaaata cattcgtcta ggcaacgagg catgtcatct aagcacatgg gctattttct 1020

aggcgcgcat cacctctcat gtaggcatcg cctactatct agttataact aatactacaa 1080

tctttttatg tttttcttcc tacttcagac ctcacatgaa agtttgcctt aaatccatca 1140

tcaaattgta cgtgccaaat tcagattaaa caattagagt ggcatatcaa acatctaaat 1200

acactagccg tccacgctaa atattctctt tggcagaaaa ataacaatca ttgttagtgg 1260

ttattcagat tggactcaga tcgaattcag acgaaatgag taatagtagt atttatatat 1320

caaactgtcc aatagatatt taagaatttt ggtttatgtt tattttttaa tcctaacaat 1380

tggtctgact tgtaggaagt aaaatattga atatgcaaga aacgaagaga aacaaaaatg 1440

tgggttaaat aaaaactctc atgtataaga agtaagataa actaaaattt ataagatcta 1500

aagagaaaaa ttaacgcctt atagacaaaa aaaaaccagt aaattttgtg ctaaataagc 1560

aaattgaaag gtttgtaggt tggctttagg tcaagttata ttattagaca cgtacgttag 1620

gtcaagttgt ctatattagt caggagtttc agtttggtca gcagattgga aaataaataa 1680

ccagatttta taacgaagtt tatgtatatt tgtcgtttaa gttataagta tagtgtaatg 1740

tgtgtaaaaa gtttgtttta agtagtatag tgtattctat tctttttggc aacagttctg 1800

cattagttaa gatataattt tccatagtat ttgagatcta accatgtaat ataacttgaa 1860

atttgaaaac ttgataaatt attcgataaa agataataaa ggcaagaggc aagagccaac 1920

gagggaactc gtcatgcggt acacgtggct gtcttgtccc tgaaccacat tggttctttc 1980

tacgaatttt tattttcatc tctctcgttt accctaataa aaagtggccc gagggagaaa 2040

aaggagagac acaaaaagaa agaaataaaa gcaaaaaaga aagaaaataa aagcaaaaat 2100

aagaaagaac aaaaaacgct cagtatctcc ggcgagagtt gaaaccgaac ctcaggatca 2160

aattagggca caaaggcttc tcggagacag aagccatggg aagaaagaaa ctagagatca 2220

agcgaattga gaacaaaagt agccgacaag tcaccttctc caaacgacgc aatggtctca 2280

tcgagaaagc tcgtcagctt tcagttctct gcgatgcatc cgtcgctctt ctcgttgtct 2340

cagcctccgg caagctttac aacttctccg ccggcgataa gtatgacttc tcctcttctg 2400

ggtcttcctt tatttgccct tttcgcttcc gttcctcttc tctttactat ttataggaaa 2460

ataaaataaa gtacaaataa aataaaataa aaaattaaaa gacactttga ttttccggca 2520

gatctcatgt ggatttctcg gttttgtgtt tgttattgtt tcttctatga acatgagaga 2580

tacatgaggt aaccagattt gagaaagaac aatgtcctga tgagctaaag cttcttactt 2640

tgttcatttc tctctctcaa tctttttctg catggatttt tttttttttt gtaaaaaaga 2700

ttgcatgtta ttcaaggtct tttgataagc tgtgatgcat acttgatgtt gtgtagtgaa 2760

gtttcaatac atctttgatt gtttaattgg atttaggact cctaattaag tatctgaaga 2820

gttccttatc agaatgagta ttagtggttt tctttttaga gtaattttgg tcgatggatc 2880

tcttgatttg taatgcaatg cacttcgggg agatctataa aaaatgtggg attaatgctt 2940

aataatagat taagagtttt aattcgaatg tatgccacat tttgcagcaa atgtgaactc3000

cgtagaactc cttaagtatc tgaagagttc attataagaa taaataatga ttaatgtttc 3060

tatttttaga gtaattcaag tcaatgaatc tcttggagtt cgatgcaatg cacttcgggg 3120

agatctataa aattgatgta ggattaatgc agaataatag atcaagagtt ttaatatgaa 3180

tgcatatatg ccacattgtg cagccattaa cttaaaaaga taattgtaga tcttcaaaaa 3240

aaaattacct ctttgccatg gatttattgc ttgaagatta tccaaattat aaggctacta 3300

gttggttctt agtatccaca tatatgtgta aagtaatttt gaaatttggt agatttaaga 3360

aaactcagcc tcacaattag tacttaacca cacatatgct acactactta tgttctccgc 3420

gatcgccatt acaatggtgt tgaacaagga ttagctagtt gttttgatct taacttattt 3480

tgttttgtct cctcttcagc ctggtcaaga tccttgatcg atatggaaaa caacatgctg 3540

atgatcttaa agctctggta atacaaattt tttgaattag tcctgatgca gttttaagag 3600

taattagtgc ctagagggct ccatacatac tggtcaaagc caacacatgt ttaggacttc 3660

aaaactgtgg agatctagat tagagttatt gcattattga tccactcatg agccattagt 3720

tcgtcaaaag atcctatgtg aggctgtgga tccgcatgca ttcccagttt ctcaaatccc 3780

ttgttttaat tgcctattct atcccttctc cgtggacagg atcttcagtc aaaagctccg 3840

aagtatggtt cacaccatga gctactagag cttgtcgaaa ggttagtatt gtctaagact 3900

tttttttgct ctcctccttt gatgacaaag gaattagtgt ttcttggcaa actattaata 3960

tttgcagtaa gcttgtggaa tcaaattctg atgtaagcgt cgactccctc gttcagctgg 4020

aggaccacct tgagactgcc ctctccgtaa ctagagctag gaaggtacgt tcactacaaa 4080

atctcttttt ttttcttact ttcagagcgc ttatatttaa tccgttgcag acagaactaa 4140

tgttgaagct tgttgatagc ctcaaagaaa aggttagata tcttatttta tagcacttaa 4200

ttagatatct taccttgtgt cgagagcctc aaaacttttg cgtattgtat tagtttccct 4260

aagtgtgctt tatgagctgg caaatctaca ttaaacttct tcacagttca tgtagtcttt 4320

ttggggatga tgcaaatgat ttgggttcta gaatctgaaa ttaggtttag aaacttggta 4380

agtgataatc atgttgacct ttaaaacagg agaaattgct gaaagaagag aaccagggtt 4440

tggctagcca ggtaacaaag ctacattctt catatatgca aaagctaaca agcactttta 4500

cacatactct tatacttgca gatataacat gtacaataga tattatactt aaggtattat 4560

agaaaagaat atgtcgagat tagggcattt tggtttatct taattttgat gagagtatta 4620

ctgtatgaaa accaaaaatg attggtctgg atttggttgg ggaaaatttt ggtttggttc 4680

taatttggat tattataaat tagtaaaaca gttaaaaccc taacgctaaa agtaaaacct 4740

aaactctgtc ataaacctta atacttcaac aaaagtctta aaccctaatt cctaaaagta 4800

gtatagttct ttgaagttag aggatgcagc atttccttaa acttaagggt tctgagtttt 4860

actgattata tatccaaatc gaatgaagcc tggatctgga agaaaaaacc gaagtttgtg 4920

tacattttta tattcacgac tacctaaaca attcttaacc aaaagaagaa gaaaaactaa 4980

ataatctcat atgtcatttg ggtaaagtca aaataatttc ttttcaggtt gttggacatc 5040

attctgtttt ggtaatttgg ttagagattt atgaaactga atgattgttt actgttacgg 5100

tttaggttgg gatccgattg gttagtttca agtagtctta gtttttcagt tttacttgtt 5160

caggttaatc aggaaaaagt agatatatat acatgatttg agattcgtta taagcttgat 5220

gaaagaccct aaaagctcga caaattatga aaaccagatt gctatatatt tttgatggtt 5280

ggtgggaaaa gaattttctt tgtgttaatt aatgactata aatggttttg acctaaaact 5340

atattacaga tggagaagaa taatcttgcg ggagccgaag ctgataaaat ggagatgtca 5400

cctggacaaa tctctgacat caatcgtccg gtaactctcc gactgcttta ttagccacct 5460

taagtccaaa acttgtgact aaaaacaaaa ataagttatc gaactattcc cctataaggg 5520

tgaacgttgt atatcttcat tctctctggc tgagagaccc cgtgtgtaaa actacggtta 5580

gatttaagta aaaatatata tttaagacat actaattatg gatc 5624

<210>2

<211>196

<212>PRT

<213> Brassica napus (Brassica napus)

<400>2

Met Gly Arg Lys Lys Leu Glu Ile Lys Arg Ile Glu Asn Lys Ser Ser

1 5 10 15

Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu Ile Glu Lys Ala

20 25 30

Arg Gln Leu Ser Val Leu Cys Asp Ala Ser Val Ala Leu Leu Val Val

35 40 45

Ser Ala Ser Gly Lys Leu Tyr Asn Phe Ser Ala Gly Asp Asn Leu Val

50 55 60

Lys Ile Leu Asp Arg Tyr Gly Lys Gln His Ala Asp Asp Leu Lys Ala

65 70 75 80

Leu Asp Leu Gln Ser Lys Ala Pro Lys Tyr Gly Ser His His Glu Leu

85 90 95

Leu Glu Leu Val Glu Ser Lys Leu Val Glu Ser Asn Ser Asp Val Ser

100 105 110

Val Asp Ser Leu Val Gln Leu Glu Asp His Leu Glu Thr Ala Leu Ser

115 120 125

Val Thr Arg Ala Arg Lys Thr Glu Leu Met Leu Lys Leu Val Asp Ser

130 135 140

Leu Lys Glu Lys Glu Lys Leu Leu Lys Glu Glu Asn Gln Gly Leu Ala

145 150 155 160

Ser Gln Met Glu Lys Asn Asn Leu Ala Gly Ala Glu Ala Asp Lys Met

165 170 175

Glu Met Ser Pro Gly Gln Ile Ser Asp Ile Asn Arg Pro Val Thr Leu

180 185 190

Arg Leu Leu Tyr

195

<210>3

<211>8452

<212>DNA

<213> Brassica napus (Brassica napus)

<400>3

gaggaggaag agctcatcgt gcttaatgtc atcatcgaag caaaccaaga attgaaaaat 60

attttagcat aaagtaacga atgatgatta gaataacaca gtatttaatg ctacaggtgg 120

tatgagtaat gaactagatg ttgctgtttt tattatcggg aatatatttc cccactttat 180

catttctatt ctattttatc ttctcgcgtt ctaaagttga atgttctgta accattaaaa 240

actaaaattt ttttaacaat ttaaaaagga taattgacat atccagaaat atggaaagcg 300

ggtgagatga ttggataaaa accatgccgt acattcaccc atcgattcgt ataagtacgt 360

ttcgcattaa gtttataata ataaatatag tattttctct gccacataat ttagcatata 420

gggttaatac atttcccttc tctccacaaa cgtttagttt atcgtatagg aaaattgcat 480

catctttaac tttgtagctc tttgttgggg atttttggta tacgaccttt gtgtaagttg 540

tttcttgggt ttgtattggc tcagttgcag ttttcacctg tttttggtat taatatattt 600

ttcaagttga caaaaaaaaa aaaaaacttt tcatcctaca ttatatagac gattataatg 660

ggattgcgca aaattctaaa caaaaattaa atactaactt ttgtatacta ttttctaaaa 720

catctaaaaa atacattagt gagaacaatg tctattaagt aacaatgtca attaaacaac 780

gaattcaaca tattaagaat agaaatttat caaaaaaaag tgggccaaaa tctccaaatt 840

tcatccttgt ataaataaag agagattttt ttctggacaa agtataaata aagagatatt 900

ttgcctaaaa tagaggataa aaattattta ggcaacatgt tttgaacaac cacagtgaaa 960

caaacaaaaa tacattcgtc taggcaacga ggcatgtcat ctaagcacat gggctatttt 1020

ctaggcgcgc atcacctctc atgtaggcat cgcctactat ctagttataa ctaatactac 1080

aatcttttta tgtttttctt cctacttcag acctcacatg aaagtttgcc ttaaatccat 1140

catcaaattg tacgtgccaa attcagatta aacaattaga gtggcatatc aaacatctaa 1200

atacactagc cgtccacgct aaatattctc tttggcagaa aaataacaat cattgttagt 1260

ggttattcag attggactca gatcgaattc agacgaaatg agtaatagta gtatttatat 1320

atcaaactgt ccaatagata tttaagaatt ttggtttatg tttatttttt aatcctaaca 1380

attggtctga cttgtaggaa gtaaaatatt gaatatgcaa gaaacgaaga gaaacaaaaa 1440

tgtgggttaa ataaaaactc tcatgtataa gaagtaagat aaactaaaat ttataagatc 1500

taaagagaaa aattaacgcc ttatagacaa aaaaaaacca gtaaattttg tgctaaataa 1560

gcaaattgaa aggtttgtag gttggcttta ggtcaagtta tattattaga cacgtacgtt 1620

aggtcaagtt gtctatatta gtcaggagtt tcagtttggt cagcagattg gaaaataaat 1680

aaccagattt tataacgaag tttatgtata tttgtcgttt aagttataag tatagtgtaa 1740

tgtgtgtaaa aagtttgttt taagtagtat agtgtattct attctttttg gcaacagttc 1800

tgcattagtt aagatataat tttccatagt atttgagatc taaccatgta atataacttg 1860

aaatttgaaa acttgataaa ttattcgata aaagataata aaggcaagag gcaagagcca 1920

acgagggaac tcgtcatgcg gtacacgtgg ctgtcttgtc cctgaaccac attggttctt 1980

tctacgaatt tttattttca tctctctcgt ttaccctaat aaaaagtggc ccgagggaga 2040

aaaaggagag acacaaaaag aaagaaataa aagcaaaaaa gaaagaaaat aaaagcaaaa 2100

ataagaaaga acaaaaaacg ctcagtatct ccggcgagag ttgaaaccga acctcaggat 2160

caaattaggg cacaaaggct tctcggagac agaagccatg ggaagaaaga aactagagat 2220

caagcgaatt gagaacaaaa gtagccgaca agtcaccttc tccaaacgac gcaatggtct 2280

catcgagaaa gctcgtcagc tttcagttct ctgcgatgca tccgtcgctc ttctcgttgt 2340

ctcagcctcc ggcaagcttt acaacttctc cgccggcgat aagtatgact tctcctcttc 2400

tgggtcttcc tttatttgcc cttttcgctt ccgttcctct tctctttact atttatagga 2460

aaataaaata aagtacaaat aaaataaaat aaaacaatta aaagacactt tgattttccg 2520

gcagatctca tgtgcatttc tcggttttgt gtttgttatt gtttcttcta tgaacatgag 2580

agatacatga ggtaaccaga tttgaagaag aacaatgtcc tgatgagcta aagcttctta 2640

ctttgttcat ttctctctct ctcaaccttt ttctgcatgg atttttttta tctgtaaaaa 2700

aaattgcatg ttattcaagg tcttttgata agctgtgatg catacttgat gttgttttgt 2760

gaagtttcaa tacatctttg attgtttaat tggatttagg actcctaatt aagtatctga 2820

agagttcctt atcagaatga gtattagtgg ttttcttttt agagtaattt tggtcgatgg 2880

atctcttgat ttgtaatgca atgcacttcg gggagatcta taaaaaatgt gggattaatg 2940

cttaataata gattaagagt tttaattcga atgtatgcca cattttgcag caaatgtgaa 3000

ctccgtagaa ctccttaagt atctgaagag ttccttataa gaataaataa tgattaatgt 3120

ttctattttt agagtaattc aagtcaatga atctcttgga gttcgatgca atgcacttcg 3180

gggagatcta taaaattgat gtaggattga tgcagaataa tagatcaaga gttttaatat 3240

gaatgcatat atgccacatt gtgcagccat ctatatatat aaagtattgt ttgcctctct 3300

cctgtgcttc cacgtcacta attcatctct tcctagcctg ccacgtgtcc acttgaccaa 3360

aacgtacggt ttcctcattt aattgttaag ggcttcgcta ttgttttgtg ttatgttcat 3420

gggctggccc atgacacttg catcttcttc tcagtctgaa atttagggtt caccagcttt 3480

aggaatcttc cattctgtat gttaacaatt gcagttctga gattttcgta tacattttgt 3540

caataatctc aaagtccatt tatgttctga tcgttttgtc ttacctccga accgttacaa 3600

gttgcagaga ttggcataat taacacaaac ttaactcttc ctcgccacta ggaccacgat 3660

caagaattca atgaatctta ttcagtttcc agtctgtgat tctctcctat aaaaaggtaa 3720

ttattcatcc cttgaacatc atcttttcat ctcctattat cgagagattt cttatttttt 3780

ctataatggc tgcatcattt gtcttccact ctgatttgaa agcaaatgtt gttcttccac 3840

ggctgttatg tttatcaaac tctagatttt gtttgtcttt ttgtttttct ctttcctctc 3900

cataagattt gttgataaac actatggatt gcttatgctt ttgtcttata tactcttggc 3960

tcaatacaaa ccagatggag gtggaagatc ttagctgcca ctggaaaaaa gctatggcaa 4020

agattatttt tcaggagatg gagttgagat gaggatgaga gttcaggctg cgctgaaact 4080

ggaaaaagct attcccttta gtcacgagat ggaaatcatt caactcaagt tgcatgatca 4140

agctagatac gacatattgt tacagtcaca cggcagatta ttaaatatcc tgtcaaggga 4200

acttttgatc ctttagttgt tgggtaacta aagtttccat ctttatcttc tcaatacatg 4260

attttaattg cctataaggt gtttgagtta ttgtctgctt ttctcatgtc tcaatcaaat 4320

agttgtttct ctggttttgt tgtcttctgc tcagtttggt gttcgtattt taaacagatc 4380

atactacacg aaattgcggc tgtgatctcc cccaagagcc ttttacgtac agattgacac 4440

atgaggtgat gttttgtggg ttagttgtgc tttttgcaat ggctgccctc aaaccagtaa 4500

actcctcaag taaattctct gatttgagtt aatgtgattc actgtgatgt tttgtgattt 4560

tcatgtcttt tttattttaa aatcctctga tttgagatta atctgttgct atgacttact 4620

ctgatccagg gagctcagta acaacgacac caatctcatg ttctgaccaa agatgcagct 4680

ggggtgttca gtcctctaat tcaggctgtt ctactcagaa caacatttgc gcttacacgt 4740

ttcggtatgg ggatggaagt tgcacctcag ggttcttcgt ctctgatgtc ttacagttcg 4800

tttgagtact atgactcttg gccagacatg ttgtctcatt ttttatttag tgctctgctt 4860

ttcagtgttt tcttcttgca tcgcttgaac agtgatgagc ccaaggccga tgtcaccttt 4920

tagaataaca tgtaagaccc atgaatacac tagaattgat taaaaaaatt taatgcatgg 4980

agatagttca ttttaccttg atcgagtgtt gagagagtgc ttgcagtttt ggcactgaag 5040

cctcaagatg atcttcttcg tggtctaagc atgttcaacg gataacacaa atacacatca 5100

cccttaaaac aaattatgac ataaaaaaca tagagcaaaa taatcccaaa tttaaaaaca 5160

ctaataaaat tttcatatga ttttaatctg aaaggatcaa atacagaatc ataaaaacaa 5220

ctcagtccct aaaactacaa gataaatggc tcactatatt gattaagaat atctaaaaat 5260

tgctcaagat ttaactaact ggtttaattc aaacacacaa aacacacttt gtaaaaaaga 5280

agtgtctatt gtacctttga tgacacccaa aaacaacaat ccactgagat gaagaatgga 5340

tattaaaaat atcaaacaaa agaaagacca aaggagacgc catgaaaatg ttaaaatttg 5400

cagttaaaaa ttaattatct tagtatcagt tttagtacca attatttttaatccaaaggg 5460

attctttgat gtttttattt acagaaatta cataatatat ctagcaataa tgacaataag 5520

taattgtagt gtaactaatt tgtttttcca aaatcattta attaaagaaa gttaatctta 5580

taattaatta tacatcatgg aacataaaca aatgtcaatc catttctaag tattttttca 5640

aataagtacc acatcaaaat tcttttaaac attaagtaaa tagtaaaatt atatagggta 5700

gtattatgtg tttttccaat aactatttta gtttgattat gtatatctga ttgaaatatt 5760

attcattttg tttaacaatt attcttttgt cattttgtag tgatctataa caaaaaaata 5820

aatgatacgt attttataaa aagcagaaga caaatcatct atcacataat ttacttaact 5880

gcattgattt tggggttcaa ttttctgaaa ttcagtataa agcgatttca tagaaataat 5940

gccctataca aaatatataa ttgaatttta gaaattattt taaaaaatca tgtcaattac 6000

ttagcgaatc cactcgccgc gcgaagcgcg gcccggccct agttaactta aaagataatt 6060

gtagatcttc aaaaaaaatt acctctttgc catggattta ttgcttgaag attatccaaa 6120

ttataaggct actaattagt atccatatat atgtgtaaag taattttgaa atttggtaga 6180

tttaagaaaa ttcagcctca caattagtac ttaaccacac atatgctaca ctacttatgt 6240

tctccgcgat tgccattaca atggtgttga acaaggatta gctagttgtt ttgatcttaa 6300

cttattttgt tttgtctcct cttcagcctg gtcaagatcc ttgatcgata tggaaaacaa 6360

catgctgatg atcttaaagc tctggtaata caattttttt gaattagtcc tgatgcagtt 6420

ttaagagtaa ttagtgccta gagggctcca tacattctgg tcaaagccaa cacatgttta 6480

ggacttcaaa actgtggaga tctagattag agtcattgca ttattgatgc acccatgagc 6540

cattagttcg tcaaaagatc ctatgtgagg ctgtggatcc acatgcattc ccagtttctt 6600

aaatcccttg ttttaattgc ctattctatc ccttctccgt ggacaggatc ttcagtcaaa 6660

agctccgaag tatggttcac accatgagct actagagctt gtcgaaaggt tagtattgtc 6720

taagactgtt tttgctctcc tcctttgatg acaaaggaat tagtgtttct tgtcaaacta 6780

ttaatatatg cagtaagctt gtggaatcaa attctgatgt aagcgtcgac tccctcgttc 6840

agctggagga ccaccttgag actgccctct ccgtaactag agctaggaag gtacgttcac 6900

tacaaaatct cttttttttt ttcttacttt cagagcgctt atatttaatt cgttgcagac 6960

agaactaatg ttgaagcttg ttgatagcct caaagaaaag gttagatatc ttatcttata 7020

gcacttaatt agatatccta ccttgtgtcg agagcctcaa tacttttgtg tattgtatta 7080

gtttccctaa gtgtgcttta tgagctccca agtctacatt aaacttcttc acagttcatg 7140

tagtcttttt ggtgatgatg caaatgattt gggttctaga atctgaaatt aggtttagaa 7200

acttggtaag tgataatcat gttgaccttt aaaacaggag aaattgctga aagaagagaa 7260

ccagggtttg gctagccagg taacaaagct acattcttca tatatgcaaa agctaacaag 7320

cacttttaca catactctta tacttgcaga tataacatat acagtagata ttatacttta 7380

ggtattatag aaaagaatat gtcgagatta aggcattttg gtttacctta attttgatga 7440

gagtattact gtatgaaaac caaaatttga ttggtctgga tttggttggg gaaaattttg 7500

gtttggttct aatttggatt attataaatt attaaaacag tttaaaccct aacgctaaaa 7560

gtaaacccta aactctgtca taaaccttaa tacttcaaca aaagtcttaa accctaattc 7620

ctaaaagtat tatagttctt tgaagttaga ggatgcagca tttctttata cttgggggtt 7680

ctgagtttaa ctgattatat atccaaatcg aatgaagcct ggatctggaa gaaaaaaccg 7740

aagtttgtgt acatttttat attcacgact acctaaacaa ttcttaacca aaagaagaag 7800

aaaaactaaa taatctcata tgtcatttgg gtaaagtcaa aataatttat tttcaggttg 7860

ttggacatca ttctgttttg gtaatttggt tagagattta tgaaactgaa tgattgttta 7920

ctgttacggt ttaggttggg atccgattgg ttaggttcaa gtagtcttag tttttcagtt 7980

ttacttgttc aggttaatca ggaaaaagta gatatatata catgatttga gattcgttat 8040

aagcttgatg aaagacccta aaagctcgac aaattatgaa aaccagattg ctatatattt 8100

ttgatggttg gtaggaaaag aattttcttt gtgttaatta atgactataa atggttttga 8160

cctaaactat attacagatg gagaagaata atcttgcggg agccgaagct gataaaatgg 8220

agatgtcacc tggacaaatc tctgacatca atcgtccggt aactctccca ctgctttatt 8280

agccacctta agtccaaaac ttgtgactaa aaacaaaaat aaattaccga actattcccc 8340

tataagggtg aacgttgtat atcttcattc tctctggctg agagaccccg tgtgtaaaac 8400

tacggttaga tttaagtaaa aatatatatt taagacatac taattatgga tc 8452

Claims (3)

1. A cabbage type rape early flowering allele Bnflc.a2 has a nucleotide sequence shown as SEQ ID No.3 in a sequence table.

2. The use of the brassica napus early flowering allele bnflc.a2 as claimed in claim 1 for early flowering, early maturing improvement in brassica napus.

3. Use of the brassica napus early flowering allele b nflc.a2 according to claim 1 in the early molecular breeding of brassica napus.

Images