CN115058432B

CN115058432B - Tobacco NtWRKY51 gene and application thereof in regulation and control of bacterial wilt resistance of tobacco

Info

Publication number: CN115058432B
Application number: CN202110251034.8A
Authority: CN
Inventors: 李晓旭; 王东; 蒲文宣; 刘万峰; 高军平; 张新要; 周文辉; 黄平俊; 何鑫玺
Original assignee: China Tobacco Hunan Industrial Co Ltd
Current assignee: China Tobacco Hunan Industrial Co Ltd
Priority date: 2021-03-08
Filing date: 2021-03-08
Publication date: 2024-01-19
Anticipated expiration: 2041-03-08
Also published as: CN115058432A

Abstract

The invention discloses a tobacco NtWRKY51 gene and application thereof in regulating and controlling bacterial wilt resistance of tobacco. The tobacco NtWRKY51 gene is inoculated with bacterial wilt pathogen bacterial wilt bacteria to induce expression, and participates in stress response of the tobacco wilt. After artificial inoculation of bacterial wilt, tobacco plants overexpressed by the NtWRKY51 gene show stronger resistance to bacterial wilt than K326. The tobacco NtWRKY51 gene plays an important role in the resistance regulation process of tobacco bacterial wilt, and can be applied to gene function research and genetic engineering breeding for improving the resistance of tobacco bacterial wilt.

Description

Tobacco NtWRKY51 gene and application thereof in regulation and control of bacterial wilt resistance of tobacco

Technical Field

The invention belongs to the technical field of tobacco genetic engineering, and particularly relates to a tobacco NtWRKY51 gene related to plant bacterial wilt resistance and application thereof in regulation and control of the tobacco bacterial wilt resistance.

Background

Bacterial wilt of tobacco is a bacterial soil-borne disease caused by ralstonia solanacearum (Ralstonia solanancearum), and occurs in the seedling stage and the field stage of tobacco, so that the growth and development of tobacco are seriously affected, and serious economic loss is caused to tobacco production. The prevention and treatment of tobacco bacterial wilt include chemical, agricultural and biological prevention and treatment methods, and the problems can not be effectively solved by the methods at present. In crops such as tobacco, excavation and utilization of a bacterial wilt resistance gene are fundamental approaches for controlling bacterial wilt. The related genes of bacterial wilt resistance are separated from tobacco by utilizing related genetic engineering technology and are applied to bacterial wilt resistance tobacco molecular breeding, so that the method has important practical significance for guaranteeing the quality and yield of tobacco.

The WRKY transcription factor family is a family of plant-specific transcription factors whose family members have 1 or 2 highly conserved WRKY domains (WRKYGQKs) at the N-terminus, the nomenclature of which also derives from this domain. The invention discovers a WRKY transcription factor related to tobacco bacterial wilt resistance, namely a tobacco NtWRKY51 gene, and provides a new way for tobacco bacterial wilt resistance.

Disclosure of Invention

The primary aim of the invention is to provide a tobacco NtWRKY51 gene related to tobacco bacterial wilt resistance, and a recombinant over-expression vector constructed by the tobacco NtWRKY51 gene related to tobacco bacterial wilt resistance is utilized to transform tobacco, so that the expression level of the NtWRKY51 gene is improved, and the resistance of the tobacco to bacterial wilt can be further enhanced, thereby providing a breeding intermediate material for improving the tobacco bacterial wilt resistance and tobacco bacterial wilt resistance breeding.

The tobacco NtWRKY51 gene has a gene CDS sequence shown in SEQ ID NO. 1.

Further, the gene sequence also comprises a gene sequence with a similarity of not less than 95% and a similar function; such similar functions include expression of proteins resistant to bacterial wilt.

Further, the specific object for resisting bacterial wilt is tobacco.

The second purpose of the invention is to provide an NtWRKY51 protein, and the protein sequence is shown as SEQ ID NO. 2.

Further, the protein sequence also comprises a protein sequence with a similarity of not less than 95% and a similar function; similar functions include resistance to bacterial wilt.

Further, the specific object for resisting bacterial wilt is tobacco.

The third object of the invention is to provide the application of the tobacco NtWRKY51 gene in improving bacterial wilt resistance.

Further, the tobacco additive is used for improving the bacterial wilt resistance of tobacco.

Further, tobacco transformed plants with improved resistance to tobacco bacterial wilt are obtained by over-expressing the tobacco NtWRKY51 gene.

Further, the vector overexpressing the tobacco NtWRKY51 gene is pCHF3.

The recombinant overexpression vector pCHF3 is a binary agrobacterium vector. When constructing the recombinant expression vector, the nucleotide sequence of the CDS gene NtWRKY51 is inserted into the cauliflower mosaic virus (CAMV) 35S promoter.

The transformed tobacco is prepared by infecting tobacco callus by using agrobacterium containing a recombinant overexpression vector, and integrating a cauliflower mosaic virus 35S promoter and a tobacco NtWRKY51 gene into a tobacco genome by using an agrobacterium-mediated transformation method. In tobacco, bacterial wilt resistance of tobacco is improved by over-expression of the NtWRKY51 gene.

The invention completes cloning, expression and functional analysis of the NtWRKY51 gene in tobacco for the first time, and analysis results show that the gene is related to bacterial wilt resistance response of the tobacco. In addition, the over-expression of the NtWRKY51 gene in the tobacco can obviously improve the bacterial wilt resistance of the tobacco, thereby providing materials for improving the bacterial wilt resistance of the tobacco and breeding the bacterial wilt resistance of the tobacco.

Drawings

FIG. 1 shows an electrophoresis chart of PCR amplification products of tobacco NtWRKY51 gene clone;

m in FIG. 1 is a 2000bp DNA maker;1 is the result of amplification of the NtWRKY51 gene; 2 is a negative control.

FIG. 2 analysis of the expression pattern of the NtWRKY51 gene after tobacco inoculation with bacterial wilt;

mock in fig. 2 represents a control;

FIG. 3 analysis of the expression level of NtWRKY51 in tobacco plants over-expressed with the tobacco NtWRKY51 gene;

FIG. 4 evaluation of bacterial wilt resistance of tobacco NtWRKY51 gene over-expressed tobacco plants and K326 control;

FIG. 5 tobacco root bacterial wilt pathogen propagation status of tobacco plants over-expressed with the tobacco NtWRKY51 gene and K326 control.

Detailed Description

The present application is further illustrated below in conjunction with examples, without limiting the invention; before describing the specific embodiments, the following will briefly describe the basic conditions of some biological materials, experimental reagents, experimental instruments, etc. involved in the following embodiments.

Biological material:

tobacco material, cultivar K326 of tobacco (Nicotiana tabacum) was stored in the laboratory. The vector plasmid pCHF3 used for the overexpression of the tobacco gene was stored in the laboratory and referenced by the vector construction method (https:// www.mdpi.com/2073-4409/8/1/50).

Experimental reagent:

the reagents and kits used in the development process of the experiment are as follows: restriction enzymes were purchased from NEB (beijing) limited; the RNA extraction TRIzol kit was purchased from kang century biotechnology limited; high-fidelity DNA amplification enzyme, reverse transcription kit and fluorescent quantitative kit are purchased from Nanjinouzan biotechnology Co., ltd; DNA gel recovery kit MiniBEST Agarose Gel DNA Extraction Kit, plasmid DNA miniprep kit MiniBEST Plasmid purification Kit were purchased from Invitrogen corporation; antibiotics such as kanamycin and rifampicin were purchased from Shanghai Biotechnology Inc.

Example 1

This example is briefly described below mainly in terms of the process of obtaining the NtWRKY51 gene.

1. Total RNA extraction

RNA is extracted by adopting a TRIzol reagent extraction method of century company, and the method comprises the following specific steps: under normal growth conditions, quickly grinding the grown tobacco K326 material in liquid nitrogen into powder, adding 1ml TRIzon Reagent (cWbiotech) into 30-50mg tissue, and mixing; after 5min at room temperature, 200. Mu.l of chloroform was added and the mixture was vigorously shaken for 15 seconds and allowed to stand at room temperature for 2min. Centrifuge at 12,000rpm for 10 minutes at 4℃and carefully remove the upper aqueous phase, transfer to another centrifuge tube and add an equal volume of 70% ethanol. The whole mixture was transferred to an adsorption column, centrifuged at 12,000rpm for 20 seconds, the waste liquid in the collection tube was discarded, 700. Mu.l Buffer RW1 was added, and centrifuged at 12,000rpm for 20 seconds, and the waste liquid in the collection tube was discarded. Mu.l Buffer RW2 was added and centrifuged at 12,000rpm for 20 seconds to pour out the waste liquid in the collection tube. Air-separating for 2min, pouring out the waste liquid in the collecting tube, standing at room temperature for 5min, adding 30 μl of water, standing at room temperature for 1min, centrifuging at 12,000rpm for 1min, collecting RNA solution, and preserving RNA at-70deg.C to prevent degradation. The RNA extracted was treated with DNase (Fermentas).

2. Reverse transcription reaction

The reverse transcription step adopts an R323 kit of Norwegian company, and comprises the following specific steps: taking 1 mu g K326 total RNA for reverse transcription, adding 4 XgDNA wind Mix 4 mu l, adding deionized water to make up to 16 mu l; after 2min incubation at 42℃4. Mu.l of 5X HiScript III qRT SuperMix were added, the final volume of the reaction was 20. Mu.l; the reaction was terminated by heating at 37℃for 15min and 85℃for 5 s. The obtained cDNA was stored at-20 ℃.

3. Identification and cloning of the NtWRKY51 Gene

By analyzing transcriptome data before and after bacterial wilt inoculation of tobacco, a tobacco gene NtWRKY51 with significantly up-regulated expression level after bacterial wilt inoculation is found. Tobacco genome database in solanaceae genome website of tobacco NtWRKY51 gene

(ftp:// ftp. Software. Net/genome/nicotiana_tabacum/edwards_et al_2017) accession No. Nitab4.5_0006656g0060.1, the gene was annotated to encode a WRKY transcription factor, the specific function was unknown.

PCR amplification refers to the In-fisuon method of Clontech company, a pair of primers are artificially synthesized, 20bp carrier sequences are respectively added at the 5 'end and the 3' end of the primers, and the carrier sequence is F5'-AGAACACGGGGGACGAGCTC-3' and is shown as SEQ ID NO. 3; r is 5'-GATCCCCGGGTACCGAGCTC-3' and is shown as SEQ ID NO. 4.

The upstream primer and the downstream primer are as follows:

NtWRKY51-F:5 '-ATGGATTGTGCTTTCAATTGGG', as shown in SEQ ID NO.5,

NtWRKY51-R:5 '-TCATGAGAAAAATCTGGGGTTA' as shown in SEQ ID NO. 6;

PCR amplification was performed using the whole tobacco seedling cDNA of K326 variety as a template, and NtWRKY51-F and NtWRKY51-R as primers, using high fidelity 2X Phanta Max Master Mix (Dye Plus) (Vazyme); the 50 μl reaction system was designed as follows:

the reaction procedure is 95 ℃ for 3min of pre-denaturation; 95 ℃ for 15s;56 ℃ for 15s;72 ℃ for 1min;35 cycles, and finally extending at 72 ℃ for 5min; after completion of the reaction, the PCR results were detected by electrophoresis (FIG. 1). After electrophoresis, the target gene fragment was recovered by gel cutting under ultraviolet irradiation and gel recovery kit (TAKARA). Sequencing the recovered amplified product to obtain NtWRKY51 gene, wherein the NtWRKY51 gene comprises 996bp base, and the base sequence of the NtWRKY51 gene is shown as SEQ ID NO. 1.

Example 2

Analysis of expression pattern of NtWRKY51 Gene after bacterial wilt of tobacco seed

Bacterial wilt disease is carried out on tobacco cultivar K326 plants. Root injury treatment is carried out before bacterial wilt pathogen inoculation. The root injury treatment is specifically implemented by transplanting tobacco seedlings which are cultivated indoors to a three-leaf-one-heart size into a seedling pot with a caliber of 9cm, and then inoculating bacterial wilt when the tobacco seedlings are cultivated to four-leaf-one-heart sizes. Before the preparation and the bacterial wilt are used for treating tobacco plants, root injury pretreatment is carried out, namely, one third of the tobacco roots are cut off by sharp scissors and then transplanted into a flowerpot again. The bacterial wilt specific inoculation method and process are that the preserved bacterial wilt strain CQPS-1 is taken out from a refrigerator with ultralow temperature of minus 80 ℃, NB culture medium is prepared, bacterial wilt is inoculated on an ultra-clean workbench, and the bacterial wilt is cultured at 28 ℃/220rpm overnight. And (3) inoculating 10mL of bacterial suspension with the concentration of about 108cfu/mL at the periphery of the root of each tobacco seedling by adopting a root irrigation inoculation method. And (3) regulating the environment temperature to 30 ℃ and regulating the environment humidity to 80% for culture. Subsequently, a disease investigation was performed and the propagation of ralstonia solanacearum in tobacco roots was examined after 0, 2, 4, 6 days, respectively. The method of example 1 was used to extract RNA from roots of diseased tobacco and to extract RNA from roots of non-diseased tobacco at the same time as the control. The extracted RNA was reverse transcribed to obtain cDNA, and real-time quantitative PCR detection was performed using specific primers for NtWRKY51 using the cDNA as a template (reverse transcription procedure was the same as in example 1), and the primer sequences were as follows:

the real-time quantitative primer F TGAAAATCTGATGATAGGTGGCGG is shown as SEQ ID NO.7,

the real-time quantitative primer R AACTTGTTGAGGAAGTGTTGGCTG is shown as SEQ ID NO.8

The results showed that the expression of the NtWRKY51 gene was significantly up-regulated 6 days after bacterial wilt inoculation (fig. 2), approximately 43.1-fold of the control.

Example 3

Using the NtWRKY51 gene obtained in example 1, the inventors further constructed an overexpression vector pCHF3-NtWRKY51 for transformation, and the related procedures are briefly described below.

First, the NtWRKY51 gene obtained In example 1 was ligated with the pCHF3 plasmid digested with SacI, and 10. Mu.L of a reaction system was established as required by the kit by referring to the In-fusion seamless ligation protocol of Clontech: 5x in-fusion 2 μl; 4. Mu.l of pCHF3 (SacI cleavage); 4. Mu.L of NtWRKY51 gene amplification product; at 50℃for 15min, put on ice for the next transformation. The connection product is transformed into escherichia coli competent cells by adopting a heat shock method, and the specific process is as follows: adding 2 μl of the ligation product into competent cells under aseptic conditions, gently mixing, and ice-bathing for 30min; heat shock at 42 ℃ for 90s, rapidly transferring the centrifuge tube into an ice bath, and placing for 2-3min; 800 μl of LB culture medium without antibiotics is added, and the shaking table is gently shaken for about 1h at 37 ℃; 200 μl of the culture broth was applied to LB solid medium containing 100 μg/ml spectinomycin, and cultured upside down at 37℃for 12-16h.

White bacterial plaques grow in the culture medium, the white bacterial plaques are inoculated into LB liquid culture medium containing 100 mug/ml spectinomycin for 12-16 hours of shaking culture, and PCR verification is carried out by using self primers and carrier primers, wherein the sequences of the primers are as follows:

self primer: TGAAAATCTGATGATAGGTG, as shown in SEQ ID NO. 9;

vector primer: GTGTGTGCGCAATGAAACTG, as shown in SEQ ID NO. 10;

the positive clones with correct results were further sequenced by company to ensure that the recombinant plasmid was constructed correctly.

Example 4

The pCHF3-NtWRKY51 vector prepared in example 3 was transformed into Agrobacterium GV3101 (purchased from Beijing full-scale gold biotechnology Co., ltd.) by a heat shock method, and single colonies were selected for PCR verification to confirm successful transformation of the expression vector pCHF3-NtWRKY51 into Agrobacterium.

Transforming tobacco plants:

the transgenic tobacco plants are obtained by adopting an agrobacterium-mediated leaf disc transformation method, and the specific steps are as follows:

1. culturing aseptic seedlings: taking a proper amount of K326 seeds, sterilizing the surfaces of the seeds with 75% alcohol for 30 seconds, cleaning the seeds with sterile water for 3 times, soaking the seeds with 15% hydrogen peroxide for 8 minutes, cleaning the seeds with sterile water for 3 times, and soaking the seeds in the sterile water for 24 hours. The sterilized seeds are sown on an MS culture dish, after 3 leaves grow out, seedlings are transferred into a tissue culture bottle containing MS for culture, and the seedlings are cultured for about 45 days in a climatic chamber, and the strong leaves are selected for agrobacterium infection.

2. Infection with agrobacterium: taking out correctly-identified and stored agrobacterium liquid, sucking 500uL of the correctly-identified and stored agrobacterium liquid into 50mL of YEP liquid culture medium with corresponding resistance after complete melting, and culturing at 28 ℃/220rpm until OD ₆₀₀ 0.6. 50mL of the bacterial liquid was centrifuged at 4000rpm for 10 minutes, and the supernatant was removed. The cells were collected and resuspended to OD ₆₀₀ AS was then added at a final concentration of 20mg/L for infestation at 0.6. Cutting off the edge of the leaf of aseptic seedling, cutting the leaf into 1cm along the main vein ² Is placed into an agrobacterium infection solution for 5 minutes.

3. Co-culture and subculture: fishing out the infected leaves, sucking the agrobacterium with filter paper, spreading the leaves on a co-culture medium downwards, and placing the leaves in a climatic chamber for dark culture for 3 days. S1, subculture: leaf surfaces of leaves which are co-cultured for 3 days are upwards transferred into an S1 differentiation culture medium, and the leaves are transferred to illumination for continuous culture in a dark culture room for about 1 week until cluster buds of about 0.5cm grow on the edge of the leaves. S2, subculture: transferring the clump buds growing on the S1 to an S2 differentiation medium, removing leaf parts without clump buds, and culturing for 2 weeks by illumination until clump buds grow into seedlings. S3, subculturing: the plantlets on S2 were transferred to S3 differentiation medium and light cultured for 2 weeks. Rooting culture: removing the swelling part and yellowing leaves at the bottom of the young seedling, transferring the young seedling into a tissue culture bottle containing a rooting culture medium, and culturing for 2 weeks under illumination.

4. Obtaining transgenic tobacco: when the seedlings grow about 8 roots with the length of about 3cm, the cover of the culture flask is opened to exercise the seedlings. After 3 days, the seedlings are transferred into a flowerpot filled with sterile soil, covered with a plastic film and kept warm. And removing the preservative film after one week to enable the preservative film to grow rapidly under natural conditions.

5. Positive identification of transgenic tobacco: the obtained total RNA of transgenic tobacco was extracted and subjected to reverse transcription to obtain cDNA according to the method of example 1. Real-time quantitative PCR detection was performed using specific primers for the NtWRKY51 gene of example 2. The results showed that the expression level of the NtWRKY51 gene in both OE6 and OE9 transgenic tobacco was significantly increased compared to the control (control refers to a plant not transformed with Agrobacterium) by 36.3-fold and 41.0-fold, respectively, of the control (FIG. 3).

Identification of bacterial wilt resistance

The positive plants OE6 and OE9 of the above-mentioned pCHF3-NtWRKY 51-transformed tobacco are transferred to a greenhouse for culture, selfed and transgenic seeds are collected. Meanwhile, tobacco K326 transformed with pCHF3 empty vector is used as a control for subsequent identification of bacterial wilt resistance.

When the plants grow to 45 days, bacterial wilt inoculation and investigation methods described in the example 2 are adopted to treat tobacco plants over-expressed by the NtWRKY51 gene and tobacco control plants transformed with the pCHF3 empty vector respectively, and the disease condition of the plants is observed after 6 days. As shown in FIG. 4, tobacco plants over-expressed with the NtWRKY51 gene had significant resistance to bacterial wilt compared to the control. Meanwhile, from the propagation condition of the bacterial wilt in the tobacco root, the propagation rate of the bacterial wilt in the root of the tobacco plant with the overexpression of the NtWRKY51 gene is obviously slower than that of the control (figure 5). Taken together, it is shown that overexpression of the NtWRKY51 gene in tobacco has a remarkable enhancement effect on tobacco bacterial wilt resistance.

Sequence listing

<110> Nannong Smoke industry Limited liability company in lake

<120> tobacco NtWRKY51 gene and application thereof in regulation and control of tobacco bacterial wilt resistance

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 996

<212> DNA

<213> tobacco (Nicotiana tabacum)

<400> 1

atggattgtg ctttcaattg ggaatacaat acacttatca atgagctaac tcaaggtatt 60

gaacacacaa agcaacttag agcttacttg aggtcaatgc cttcaatttc tgaaaatcaa 120

gaattgcttc tgcagaagat actttcttct tatgagcaat ctctgttaat tctcaaatgc 180

agtggatcgg ccgttcaatc tccacagcct ctgccacaaa catgtggcgc gatcgaatct 240

tcggtttcag ttgatggaag tcctaggagt gatgacaaga aaaggatcag cgccgagact 300

ggatttgaag gtcctactga tgatggatat agctggagaa agtatggtca gaaagacatt 360

cttggtgcta aatatcctag atgcacatat cgtcacatgc aaaactgttg gacgacaaaa 420

caagtgcaaa ggtcagatga tgatcctact gtatttgaga tcacatacaa aggctctcat 480

acttgtcacc aagctactaa ttctgcacta caaccgaaat caccagaaaa tcaagaattc 540

aagaaacaag ccaactatca aacagggcaa tattcaaatg aagtactcat gaacttgaga 600

gcaaacctga gagtcgatac taatgatttg gacaagactg agacaacagc agcatgttct 660

ttctcctttc ctccaacgtt ctctagtttg acagatgaaa atcaacattt ccagatttcc 720

catgttgatg aaaatctgat gataggtggc ggctattcac cgtcttttgt ctctcctaca 780

acccctgaat caaactactt ctcaatctca agcagctgtc agatgaatgg ttttggaatg 840

gttcataacg tgcaccgttc agaatcagac ctcactgata tattctcagc caacacttcc 900

tcaacaagtt ctccaattgt gggcagcgag ttttcactag accattttga gctagatcca 960

aattttccat tcgataaccc cagatttttc tcatga 996

<210> 2

<211> 331

<212> PRT

<213> tobacco (Nicotiana tabacum)

<400> 2

Met Asp Cys Ala Phe Asn Trp Glu Tyr Asn Thr Leu Ile Asn Glu Leu

1 5 10 15

Thr Gln Gly Ile Glu His Thr Lys Gln Leu Arg Ala Tyr Leu Arg Ser

20 25 30

Met Pro Ser Ile Ser Glu Asn Gln Glu Leu Leu Leu Gln Lys Ile Leu

35 40 45

Ser Ser Tyr Glu Gln Ser Leu Leu Ile Leu Lys Cys Ser Gly Ser Ala

50 55 60

Val Gln Ser Pro Gln Pro Leu Pro Gln Thr Cys Gly Ala Ile Glu Ser

65 70 75 80

Ser Val Ser Val Asp Gly Ser Pro Arg Ser Asp Asp Lys Lys Arg Ile

85 90 95

Ser Ala Glu Thr Gly Phe Glu Gly Pro Thr Asp Asp Gly Tyr Ser Trp

100 105 110

Arg Lys Tyr Gly Gln Lys Asp Ile Leu Gly Ala Lys Tyr Pro Arg Cys

115 120 125

Thr Tyr Arg His Met Gln Asn Cys Trp Thr Thr Lys Gln Val Gln Arg

130 135 140

Ser Asp Asp Asp Pro Thr Val Phe Glu Ile Thr Tyr Lys Gly Ser His

145 150 155 160

Thr Cys His Gln Ala Thr Asn Ser Ala Leu Gln Pro Lys Ser Pro Glu

165 170 175

Asn Gln Glu Phe Lys Lys Gln Ala Asn Tyr Gln Thr Gly Gln Tyr Ser

180 185 190

Asn Glu Val Leu Met Asn Leu Arg Ala Asn Leu Arg Val Asp Thr Asn

195 200 205

Asp Leu Asp Lys Thr Glu Thr Thr Ala Ala Cys Ser Phe Ser Phe Pro

210 215 220

Pro Thr Phe Ser Ser Leu Thr Asp Glu Asn Gln His Phe Gln Ile Ser

225 230 235 240

His Val Asp Glu Asn Leu Met Ile Gly Gly Gly Tyr Ser Pro Ser Phe

245 250 255

Val Ser Pro Thr Thr Pro Glu Ser Asn Tyr Phe Ser Ile Ser Ser Ser

260 265 270

Cys Gln Met Asn Gly Phe Gly Met Val His Asn Val His Arg Ser Glu

275 280 285

Ser Asp Leu Thr Asp Ile Phe Ser Ala Asn Thr Ser Ser Thr Ser Ser

290 295 300

Pro Ile Val Gly Ser Glu Phe Ser Leu Asp His Phe Glu Leu Asp Pro

305 310 315 320

Asn Phe Pro Phe Asp Asn Pro Arg Phe Phe Ser

325 330

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

agaacacggg ggacgagctc 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gatccccggg taccgagctc 20

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atggattgtg ctttcaattg gg 22

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tcatgagaaa aatctggggt ta 22

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tgaaaatctg atgataggtg gcgg 24

<210> 8

<211> 24

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aacttgttga ggaagtgttg gctg 24

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tgaaaatctg atgataggtg 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

gtgtgtgcgc aatgaaactg 20

Claims

1. The application of the tobacco NtWRKY51 gene in improving the bacterial wilt resistance of tobacco is provided, the CDS sequence of the gene is shown as SEQ ID NO.1, and the tobacco transformed plant with the improved bacterial wilt resistance of tobacco is obtained by over-expressing the tobacco NtWRKY51 gene.

2. The use according to claim 1, wherein the vector overexpressing the tobacco NtWRKY51 gene is pCHF3.