CN116004647B

CN116004647B - Tobacco NtSWEET gene and application thereof

Info

Publication number: CN116004647B
Application number: CN202111230544.3A
Authority: CN
Inventors: 李晓旭; 蒲文宣; 王东; 刘万峰; 黄平俊; 高军平; 何鑫玺; 周文辉
Original assignee: China Tobacco Hunan Industrial Co Ltd
Current assignee: China Tobacco Hunan Industrial Co Ltd
Priority date: 2021-10-22
Filing date: 2021-10-22
Publication date: 2024-05-17
Anticipated expiration: 2041-10-22
Also published as: CN116004647A

Abstract

The invention discloses a tobacco NtSWEET gene and application thereof. The tobacco NtSWEET gene is inoculated by bacterial wilt pathogen bacterial wilt-type bacteria to induce expression, and participates in the stress response of tobacco wilt. After artificial inoculation of bacterial wilt, ntSWEET gene over-expressed tobacco plants showed stronger bacterial wilt resistance compared to K326. The tobacco NtSWEET gene plays an important role in the regulation and control process of the bacterial wilt resistance of tobacco, and can be applied to the gene function research and genetic engineering breeding of the improvement of the bacterial wilt resistance of tobacco.

Description

Tobacco NtSWEET gene and application thereof

Technical Field

The invention belongs to the technical field of tobacco genetic engineering, and particularly relates to a tobacco NtSWEET gene related to plant bacterial wilt resistance and application thereof in regulating and controlling the tobacco bacterial wilt resistance.

Background

Bacterial wilt of tobacco is a bacterial soil-borne disease caused by ralstonia solanacearum (Ralstonia solanancearum), and occurs in the seedling stage and the field stage of tobacco, so that the growth and development of tobacco are seriously affected, and serious economic loss is caused to tobacco production. The prevention and treatment of tobacco bacterial wilt include chemical, agricultural and biological prevention and treatment methods, and the problems can not be effectively solved by the methods at present. In crops such as tobacco, excavation and utilization of a bacterial wilt resistance gene are fundamental approaches for controlling bacterial wilt. The related genes of bacterial wilt resistance are separated from tobacco by utilizing related genetic engineering technology and are applied to bacterial wilt resistance tobacco molecular breeding, so that the method has important practical significance for guaranteeing the quality and yield of tobacco.

The invention discovers a SWEET protein related to the bacterial wilt resistance of the tobacco, namely a tobacco NtSWEET gene for the first time, and provides a new way for the bacterial wilt resistance of the tobacco.

Disclosure of Invention

The primary aim of the invention is to provide a tobacco NtSWEET gene related to tobacco bacterial wilt resistance, and a recombinant over-expression vector constructed by utilizing the NtSWEET gene related to tobacco bacterial wilt resistance is utilized to transform tobacco, so that the NtSWEET gene expression level is improved, and the resistance of the tobacco to bacterial wilt can be further enhanced, thereby providing a breeding intermediate material for improving the tobacco bacterial wilt resistance and tobacco bacterial wilt resistance breeding.

A tobacco NtSWEET gene and a gene CDS sequence are shown in SEQ ID NO. 1.

Further, the gene sequence also comprises a gene sequence with a similarity of not less than 95% and a similar function; such similar functions include expression of proteins resistant to bacterial wilt.

Further, the specific object for resisting bacterial wilt is a plant, and more preferably tobacco.

The second object of the present invention is to provide NtSWEET protein, the protein sequence of which is shown as SEQ ID NO. 2.

Further, the protein sequence also comprises a protein sequence with a similarity of not less than 95% and a similar function; similar functions include resistance to bacterial wilt.

The third object of the invention is to provide the application of the tobacco NtSWEET gene in improving bacterial wilt resistance.

Further, it is used for improving the resistance of plants, especially tobacco, to bacterial wilt.

Further, tobacco transformed plants with improved resistance to tobacco bacterial wilt are obtained by over-expressing the tobacco NtSWEET gene.

Further, the vector for over-expressing the tobacco NtSWEET gene was pCHF3.

The recombinant overexpression vector pCHF is a binary agrobacterium vector. When constructing the recombinant expression vector, the NtSWEET gene CDS base sequence is inserted into the cauliflower mosaic virus (CAMV) 35S promoter.

Vectors for use in the present invention include, but are not limited to pCHF, as long as the vectors satisfy normal expression of NtSWEET gene in tobacco.

The transformed tobacco is prepared by infecting tobacco callus by using agrobacterium containing a recombinant overexpression vector, and integrating a cauliflower mosaic virus 35S promoter and a tobacco NtSWEET gene into a tobacco genome by using an agrobacterium-mediated transformation method. In tobacco, bacterial wilt resistance of tobacco is improved through over-expression of NtSWEET gene.

Cloning, expression and functional analysis of NtSWEET genes are completed in tobacco for the first time, and analysis results show that the genes are related to bacterial wilt resistance response of the tobacco. In addition, the bacterial wilt resistance of the tobacco can be obviously improved by over-expressing NtSWEET genes in the tobacco, so that materials are provided for improving the bacterial wilt resistance of the tobacco and breeding the bacterial wilt resistance of the tobacco.

Drawings

FIG. 1 is an electrophoretogram of a PCR amplification product of tobacco NtSWEET gene clone;

m in FIG. 1 is a 2000bp DNA maker;1 is NtSWEET gene amplification result; 2 is a negative control.

FIG. 2 analysis of NtSWEET Gene expression patterns after tobacco inoculation with bacterial wilt;

mock in fig. 2 represents a control;

FIG. 3 analysis of the expression level of NtSWEET12 in tobacco NtSWEET gene over-expressed tobacco plants;

FIG. 4 evaluation of bacterial wilt resistance of tobacco NtSWEET gene over-expressed tobacco plants and K326 control;

FIG. 5 tobacco NtSWEET Gene overexpression tobacco plants and K326 control tobacco root bacterial wilt pathogen propagation.

Detailed Description

The application is further illustrated by the following examples without limiting the application; before describing the specific embodiments, the following will briefly describe the basic conditions of some biological materials, experimental reagents, experimental instruments, etc. involved in the following embodiments.

Biological material:

Tobacco material, cultivar K326 (common tobacco main cultivar) of tobacco (Nicotiana tabacum) was kept in the laboratory. The vector plasmid pCHF used to overexpress the tobacco gene was purchased from wunputzert bioengineering limited.

Experimental reagent:

The reagents and kits used in the development process of the experiment are as follows: restriction enzymes were purchased from NEB (beijing) limited; the RNA extraction TRIzol kit was purchased from kang century biotechnology limited; high-fidelity DNA amplification enzyme, reverse transcription kit and fluorescent quantitative kit are purchased from Nanjinouzan biotechnology Co., ltd; DNA gel recovery kit MiniBEST Agarose Gel DNA Extraction Kit, plasmid DNA miniprep kit MiniBEST Plasmid purification Kit were purchased from Invitrogen; antibiotics such as kanamycin and rifampicin were purchased from Shanghai Biotechnology Inc.

Example 1

This example is mainly described below in brief with respect to the process of obtaining NtSWEET gene.

1. Total RNA extraction

RNA is extracted by adopting a TRIzol reagent extraction method of century company, and the method comprises the following specific steps: under the normal growth condition, the cultivated tobacco K326 grown for 4 weeks is rapidly grinded into powder in liquid nitrogen after being obtained, 1ml TRIzon Reagent (cwbiotech) is added into every 30-50mg of tissue, and the materials are uniformly mixed; after 5min at room temperature, 200. Mu.l of chloroform was added and the mixture was vigorously shaken for 15 seconds and allowed to stand at room temperature for 2min. Centrifuge at 12,000rpm for 10 minutes at 4℃and carefully remove the upper aqueous phase, transfer to another centrifuge tube and add an equal volume of 70% ethanol. The whole mixture was transferred to an adsorption column, centrifuged at 12,000rpm for 20 seconds, the waste liquid in the collection tube was discarded, 700. Mu.l Buffer RW1 was added, and centrifuged at 12,000rpm for 20 seconds, and the waste liquid in the collection tube was discarded. Mu.l Buffer RW2 was added and centrifuged at 12,000rpm for 20 seconds to pour out the waste liquid in the collection tube. Air-separating for 2min, pouring out the waste liquid in the collecting tube, standing at room temperature for 5min, adding 30 μl of water, standing at room temperature for 1min, centrifuging at 12,000rpm for 1min, collecting RNA solution, and preserving RNA at-70deg.C to prevent degradation. The RNA extracted was treated with DNase (Fermentas).

2. Reverse transcription reaction

The reverse transcription step adopts an R323 kit of Norwegian company, and comprises the following specific steps: taking 1 mu g K to 326 total RNA for reverse transcription, adding 4X GDNA WIPER Mix 4 mu l, and adding deionized water to make up to 16 mu l; after 2min incubation at 42℃4. Mu.l of 5X HISCRIPT III QRT Supermix was added, the final reaction volume was 20. Mu.l; the reaction was terminated by heating at 37℃for 15min and 85℃for 5 s. The obtained cDNA was stored at-20 ℃.

3. Identification and cloning of NtSWEET Gene

By analyzing transcriptome data before and after bacterial wilt inoculation of tobacco, a tobacco gene NtSWEET with significantly up-regulated expression level after bacterial wilt inoculation is found. Tobacco NtSWEET Gene tobacco genome database in Solanaceae genome website

(Ftp:// ftp. Solgenemics. Net/genomes/nicotiana_tabacum/edwards _et_al_2017) accession No. Nitab4.5_0005940g0020.1, the gene was annotated to encode a SWEET type sugar transporter, the specific function was unknown.

To amplify NtSWEET gene sequences, the upstream and downstream primers were synthesized as follows:

NtSWEET12-F:5 '-ATGCCGGGTATTTCTGGTCACT' as shown in SEQ ID NO.3,

NtSWEET12-R:5 '-TTAGGCTTCGGCAGTTTGCAGC' as shown in SEQ ID NO. 4;

PCR amplification was performed using the whole tobacco seedling cDNA of K326 variety as a template, ntSWEET-F and NtSWEET-R as primers, and high fidelity 2X Phanta Max Master Mix (Dye Plus) (Vazyme); the 50 μl reaction system was designed as follows:

The reaction procedure is 95 ℃ for 3min of pre-denaturation; 95 ℃ for 15s;56 ℃ for 15s;72 ℃ for 1min;35 cycles, and finally extending at 72 ℃ for 5min; after completion of the reaction, the PCR results were detected by electrophoresis (FIG. 1). After electrophoresis, the target gene fragment was recovered by gel cutting under ultraviolet irradiation and gel recovery kit (TAKARA). Sequencing the recovered amplified product to obtain NtSWEET gene, which includes 891bp base and has base sequence shown in SEQ ID No. 1.

Example 2

Analysis of NtSWEET Gene expression Pattern after tobacco seed bacterial wilt

Bacterial wilt disease is carried out on tobacco cultivar K326 plants. Root injury treatment is carried out before bacterial wilt pathogen inoculation. The root injury treatment is specifically implemented by transplanting tobacco seedlings which are cultivated indoors to a three-leaf-one-heart size into a seedling pot with a caliber of 9cm, and then inoculating bacterial wilt when the tobacco seedlings are cultivated to four-leaf-one-heart sizes. Before the preparation and the bacterial wilt are used for treating tobacco plants, root injury pretreatment is carried out, namely, one third of the tobacco roots are cut off by sharp scissors and then transplanted into a flowerpot again. The bacterial wilt specific inoculation method and process are that the preserved bacterial wilt strain CQPS-1 is taken out from a refrigerator with ultralow temperature of minus 80 ℃, NB culture medium is prepared, bacterial wilt is inoculated on an ultra-clean workbench, and the bacterial wilt is cultured at 28 ℃/220rpm overnight. And (3) inoculating 10mL of bacterial suspension with the concentration of about 108cfu/mL at the periphery of the root of each tobacco seedling by adopting a root irrigation inoculation method. And (3) regulating the environment temperature to 30 ℃ and regulating the environment humidity to 80% for culture. Subsequently, a disease investigation was performed and the propagation of ralstonia solanacearum in tobacco roots was examined after 0, 2,4, 6 days, respectively. The method of example 1 was used to extract RNA from roots of diseased tobacco and to extract RNA from roots of non-diseased tobacco at the same time as the control. The extracted RNA was reverse transcribed to obtain cDNA, and the cDNA was used as a template (reverse transcription procedure was the same as in example 1) for real-time quantitative PCR detection using NtSWEET specific primers, the primer sequences were as follows:

The real-time quantitative primer F TGCCTTGTATTTTCCTTGTGTG is shown as SEQ ID NO.5,

Real-time quantitative primer R ATAGAAGAACCACATGACAGCA shown as SEQ ID NO.6

The results showed that NtSWEET gene expression was significantly up-regulated 6 days after bacterial wilt inoculation (fig. 2), approximately 63-fold compared to the control.

Example 3

Using the NtSWEET gene obtained in example 1, the inventors further constructed the transformation overexpression vector pCHF-NtSWEET, and related procedures are briefly described below.

The amplification primer of NtSWEET gene was ligated with the Sac I cleavage site linker sequence of pCHF plasmid and synthesized by referring to the In-fusion seamless ligation protocol of Clontech, inc. The sequences are as follows, with the linker sequence of the vector underlined:

5'-AGAACACGGGGGACGAGCTCATGCCGGGTATTTCTGGTCACT-3', shown as SEQ ID NO. 7;

r is 5'-GATCCCCGGGTACCGAGCTCTTAGGCTTCGGCAGTTTGCAGC-3' as shown in SEQ ID NO. 8.

First, the NtSWEET gene obtained in example 1 was ligated to the pCHF plasmid digested with Sac I, and a 10. Mu.L ligation reaction system was established as required by the kit as follows: 5x in-fusion 2 μl; pCHF3 (Sac I cleavage) 4. Mu.l; ntSWEET12 4. Mu.L of gene amplification product; at 50℃for 15min, put on ice for the next transformation. The connection product is transformed into escherichia coli competent cells by adopting a heat shock method, and the specific process is as follows: adding 2 μl of the ligation product into competent cells under aseptic conditions, gently mixing, and ice-bathing for 30min; heat shock at 42 ℃ for 90s, rapidly transferring the centrifuge tube into an ice bath, and placing for 2-3min; 800 μl of LB culture medium without antibiotics is added, and the shaking table is gently shaken for about 1h at 37 ℃;200 μl of the culture broth was applied to LB solid medium containing 100 μg/ml spectinomycin, and cultured upside down at 37℃for 12-16h.

White bacterial plaques grow in the culture medium, the white bacterial plaques are inoculated into LB liquid culture medium containing 100 mug/ml spectinomycin for 12-16 hours of shaking culture, and PCR verification is carried out by using self primers and carrier primers, wherein the sequences of the primers are as follows:

Self primer: GTAGCACCCTTGGGCATTGTG as shown in SEQ ID NO. 9;

vector primer: GTGTGTGCGCAATGAAACTG as shown in SEQ ID NO. 10;

the positive clones with correct results were further sequenced by company to ensure that the recombinant plasmid was constructed correctly.

Example 4

The pCHF-NtSWEET 12 vector prepared in example 3 was transformed into Agrobacterium GV3101 (purchased from Beijing full gold Biotechnology Co., ltd.) by heat shock method, and single colonies were selected for PCR verification to confirm successful transformation of the expression vector pCHF3-NtSWEET with Agrobacterium.

Transforming tobacco plants:

the transgenic tobacco plants are obtained by adopting an agrobacterium-mediated leaf disc transformation method, and the specific steps are as follows:

1. Culturing aseptic seedlings: taking a proper amount of K326 seeds, sterilizing the surfaces of the seeds with 75% alcohol for 30 seconds, cleaning the seeds with sterile water for 3 times, soaking the seeds with 15% hydrogen peroxide for 8 minutes, cleaning the seeds with sterile water for 3 times, and soaking the seeds in the sterile water for 24 hours. The sterilized seeds are sown on an MS culture dish, after 3 leaves grow out, seedlings are transferred into a tissue culture bottle containing MS for culture, and the seedlings are cultured for about 45 days in a climatic chamber, and the strong leaves are selected for agrobacterium infection.

2. Infection with agrobacterium: the correctly identified and preserved agrobacteria liquid is taken out, after complete thawing, 500uL is sucked into 50mL YEP liquid culture medium with corresponding resistance, and cultured at 28 ℃/220rpm until OD ₆₀₀ is 0.6. 50mL of the bacterial liquid was centrifuged at 4000rpm for 10 minutes, and the supernatant was removed. The cells were collected and resuspended to an OD ₆₀₀ of 0.6, and AS was then added at a final concentration of 20mg/L for infection. The edges of the leaves of the aseptic seedlings are cut off, and leaf discs which are cut into 1cm ² along the main leaf veins are placed into agrobacterium infection liquid for 5 minutes.

3. Co-culture and subculture: fishing out the infected leaves, sucking the agrobacterium with filter paper, spreading the leaves on a co-culture medium downwards, and placing the leaves in a climatic chamber for dark culture for 3 days. S1, subculture: leaf surfaces of leaves which are co-cultured for 3 days are upwards transferred into an S1 differentiation culture medium, and the leaves are transferred to illumination for continuous culture in a dark culture room for about 1 week until cluster buds of about 0.5cm grow on the edge of the leaves. S2, subculture: transferring the clump buds growing on the S1 to an S2 differentiation medium, removing leaf parts without clump buds, and culturing for 2 weeks by illumination until clump buds grow into seedlings. S3, subculturing: the plantlets on S2 were transferred to S3 differentiation medium and light cultured for 2 weeks. Rooting culture: removing the swelling part and yellowing leaves at the bottom of the young seedling, transferring the young seedling into a tissue culture bottle containing a rooting culture medium, and culturing for 2 weeks under illumination.

4. Obtaining transgenic tobacco: when the seedlings grow about 8 roots with the length of about 3cm, the cover of the culture flask is opened to exercise the seedlings. After 3 days, the seedlings are transferred into a flowerpot filled with sterile soil, covered with a plastic film and kept warm. And removing the preservative film after one week to enable the preservative film to grow rapidly under natural conditions.

5. Positive identification of transgenic tobacco: the obtained total RNA of transgenic tobacco was extracted and subjected to reverse transcription to obtain cDNA according to the method of example 1. Real-time quantitative PCR detection was performed using the specific primers for NtSWEET gene in example 2. The results showed that the amount of NtSWEET gene expression in two transgenic tobacco strains, OE4 and OE5, was significantly increased compared to the control (control refers to a plant not transformed with agrobacterium), 63-fold and 75-fold, respectively, compared to the control (fig. 3).

Identification of bacterial wilt resistance

Positive plants OE4 and OE5 of the above-mentioned pCHF-NtSWEET tobacco were transferred to greenhouse culture, selfed and transgenic seeds were collected. Meanwhile, tobacco K326 with pCHF empty vector is used as a control for subsequent identification of bacterial wilt resistance.

When the plants grow to 45 days, bacterial wilt inoculation and investigation methods are adopted, wherein bacterial wilt inoculation and investigation methods are adopted, ntSWEET gene over-expression tobacco plants and pCHF empty vector-transferred tobacco control plants are respectively subjected to bacterial wilt inoculation treatment, and the disease condition of the plants is observed after 6 days. As shown in FIG. 4, ntSWEET gene over-expressed tobacco plants had significant resistance to bacterial wilt compared to the control. Meanwhile, from the propagation condition of the bacterial wilt in the tobacco root, the bacterial wilt propagation rate of the tobacco plant root with NtSWEET gene over-expression is obviously slower than that of the control (figure 5). Taken together, it is shown that over-expression NtSWEET gene in tobacco has obvious enhancement effect on tobacco bacterial wilt resistance.

Sequence listing

<110> Nannong Smoke industry Limited liability company in lake

<120> A tobacco NtSWEET gene and application thereof

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 891

<212> DNA

<213> Tobacco (Nicotiana tabacum)

<400> 1

atgccgggta tttctggtca ctgggctttt gcttttggtg tccttggtaa cattatctca 60

ttcattgtgt tcctttctcc actgcccacg ttttataaaa tttacaagaa gaaatcaaca 120

gaaggctatc aatcaattcc atatgtggtt gctctcttca gttccatgct ttggatttat 180

tatgcttttc tcaagacaaa cacgaccctt atcatcacca taaactcttt tggctgcttc 240

attgaaacta tctacgtcgg tttctacctt ttctacgcac caaagaaagc cagggtccaa 300

actctaaaga tgctcttatt atcagtggtg ggtggctttg gcgttattgt ccttgttacg 360

caatttctat tcaaaggtgc cgctcgtggt caagcagttg gatggatttg ccttgtattt 420

tccttgtgtg tgtttgtagc acccttgggc attgtgagac aagtaataaa aacaaagagt 480

gtggaataca tgccacttct cctatccgtt ttcctcacat taagtgctgt catgtggttc 540

ttctatggtc ttctcgtaaa agacattaac attgctattc caaacatatt gggattcatc 600

ctaggaattc tccaaatagt gctctatata atatacaaca aaaaggagaa ggccatttta 660

aaggagcaga aactttcaga gaagatacaa aaccatgtca ttatcgtaga tgagaacaat 720

aatcagaagc ttccagaact tacagaggaa cagattattg acattgtaaa gcttggttca 780

ctaatttcct caggaaaaat tcacgtggct tcgtgtctgc ataattctac atgtggagtt 840

gaagcagcta aagttgagaa tatgcccaag ctgcaaactg ccgaagccta a 891

<210> 2

<211> 296

<212> PRT

<213> Tobacco (Nicotiana tabacum)

<400> 2

Met Pro Gly Ile Ser Gly His Trp Ala Phe Ala Phe Gly Val Leu Gly

1 5 10 15

Asn Ile Ile Ser Phe Ile Val Phe Leu Ser Pro Leu Pro Thr Phe Tyr

20 25 30

Lys Ile Tyr Lys Lys Lys Ser Thr Glu Gly Tyr Gln Ser Ile Pro Tyr

35 40 45

Val Val Ala Leu Phe Ser Ser Met Leu Trp Ile Tyr Tyr Ala Phe Leu

50 55 60

Lys Thr Asn Thr Thr Leu Ile Ile Thr Ile Asn Ser Phe Gly Cys Phe

65 70 75 80

Ile Glu Thr Ile Tyr Val Gly Phe Tyr Leu Phe Tyr Ala Pro Lys Lys

85 90 95

Ala Arg Val Gln Thr Leu Lys Met Leu Leu Leu Ser Val Val Gly Gly

100 105 110

Phe Gly Val Ile Val Leu Val Thr Gln Phe Leu Phe Lys Gly Ala Ala

115 120 125

Arg Gly Gln Ala Val Gly Trp Ile Cys Leu Val Phe Ser Leu Cys Val

130 135 140

Phe Val Ala Pro Leu Gly Ile Val Arg Gln Val Ile Lys Thr Lys Ser

145 150 155 160

Val Glu Tyr Met Pro Leu Leu Leu Ser Val Phe Leu Thr Leu Ser Ala

165 170 175

Val Met Trp Phe Phe Tyr Gly Leu Leu Val Lys Asp Ile Asn Ile Ala

180 185 190

Ile Pro Asn Ile Leu Gly Phe Ile Leu Gly Ile Leu Gln Ile Val Leu

195 200 205

Tyr Ile Ile Tyr Asn Lys Lys Glu Lys Ala Ile Leu Lys Glu Gln Lys

210 215 220

Leu Ser Glu Lys Ile Gln Asn His Val Ile Ile Val Asp Glu Asn Asn

225 230 235 240

Asn Gln Lys Leu Pro Glu Leu Thr Glu Glu Gln Ile Ile Asp Ile Val

245 250 255

Lys Leu Gly Ser Leu Ile Ser Ser Gly Lys Ile His Val Ala Ser Cys

260 265 270

Leu His Asn Ser Thr Cys Gly Val Glu Ala Ala Lys Val Glu Asn Met

275 280 285

Pro Lys Leu Gln Thr Ala Glu Ala

290 295

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 3

atgccgggta tttctggtca ct 22

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 4

ttaggcttcg gcagtttgca gc 22

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 5

tgccttgtat tttccttgtg tg 22

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 6

atagaagaac cacatgacag ca 22

<210> 7

<211> 42

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 7

agaacacggg ggacgagctc atgccgggta tttctggtca ct 42

<210> 8

<211> 42

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 8

gatccccggg taccgagctc ttaggcttcg gcagtttgca gc 42

<210> 9

<211> 21

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 9

gtagcaccct tgggcattgt g 21

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence (ARTIFICIAL SEQUENCE)

<400> 10

gtgtgtgcgc aatgaaactg 20

Claims

1. The application of tobacco NtSWEET gene in improving bacterial wilt resistance is characterized in that tobacco transformed plants with improved bacterial wilt resistance are obtained by over-expressing tobacco NtSWEET gene.

2. The use according to claim 1, wherein the vector over-expressing the tobacco NtSWEET gene is pCHF.