CN107974455A - Rubber tree powdery mildew endogenesis promoter WY7 and application thereof - Google Patents
Rubber tree powdery mildew endogenesis promoter WY7 and application thereof Download PDFInfo
- Publication number
- CN107974455A CN107974455A CN201711429330.2A CN201711429330A CN107974455A CN 107974455 A CN107974455 A CN 107974455A CN 201711429330 A CN201711429330 A CN 201711429330A CN 107974455 A CN107974455 A CN 107974455A
- Authority
- CN
- China
- Prior art keywords
- promoter
- nucleotide sequence
- seq
- gene
- powdery mildew
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a kind of rubber tree powdery mildew endogenesis promoter WY7 and application thereof, the promoter WY7 to have SEQ ID NO：Nucleotide sequence shown in 1, or its variation with promoter function.The invention further relates to the nucleic acid construct containing the promoter, carrier, recombinant cell, genetically modified plants, explant and callus.The promoter can be used in regulating and controlling the expression of dicotyledon and the external source target gene in monocotyledon, and a kind of brand-new instrument and selection are provided for the gene expression of genetically modified plants.
Description
Technical field
The invention belongs to gene engineering technology field, and in particular to rubber tree powdery mildew endogenesis promoter WY7 and application thereof.
Background technology
Promoter is a kind of important cis-acting elements of gene expression, positioned at structural gene 5' ends upstream, can be activated
RNA polymerase simultaneously is allowed to accurately be combined with template DNA, has the specificity of transcription initiation.Promoter can provide RNA polymerase spy
The binding site of different identification, can control the expression of the transcription initiation and gene of gene, be usually located at gene transcription start site
In the nucleotide sequence of near-end, mainly it is made of core promoter region, upstream element and response element.
The product and the species of RNA polymerase encoded according to eukaryotic gene, can be divided into three classes promoter, and I types start
Son is rRNA gene promoters, II types promoter, that is, mRNA gene promoters subtype and type III promoter, that is, tRNA gene promoters.
The promoter of higher plant belongs to mRNA gene promoters, its nuclear structure is mostly comprising a TATA box and starting.
According to the transcriptional profile of gene, promoter can be roughly divided into three classes, inducible promoter, tissue specificity open
Mover and constitutive promoter.Inducible promoter be it is a kind of specifically grow in plant, the stage of development, in some specific things
Under the stimulation of reason or chemical signal, the expression of target gene can be significantly increased, stress can also be released, make gene
Express the promoter stopped.Tissue-specific promoter is also referred to as organ specific promoters, under these promoter regulations,
Gene can orient, exclusively only in the expression of some specific organ or tissue positions, and often show the spy of growth adjustment
Property.Expression of the foreign gene that such promoter is started in plant has specificity, composing type can be overcome to open
Waste of the foreign gene that mover starts in recipient plant caused by nonspecific lasting, high efficient expression, and needing to be somebody's turn to do
The particular organization position of gene great expression then falls flat and thus triggers a series of because expression quantity is too low
Metabolic disorder problem.Constitutive promoter is the continual and steady promoter of a kind of expression, control structure gene and can be made
Its transcriptional level constant, does not have notable difference in different tissues, organ expression, does not show Space-time speciality.From plant
Thing clones the hot spot that constitutive promoter is research in itself, and current most popular two constitutive promoters are Tobacco mosaics
Viral (CaMV) 35S promoter and the rouge alkali synthetase gene promoter from Agrobacterium tumefaciems Ti-plasmids T-DNA regions
(Nos) and octopine synthase gene promoter (Ocs).In addition, rice Atcl promoter sequences structure, which is also studied, must compare clearly
Chu.These are also promoter most widely used in transgenic plant research.
As the application of constitutive promoter 35S is more and more extensive, there are many problems to be also exposed therewith.Current
Being found in research, the enhancer core sequence of plant constitutive promoter is identical with the enhancer of animal, but in animal system,
The tissue expression of enhancer be it is specific, and expression of the gene in plant is respectively organized of 35S drivings be it is nonspecific,
Some problems are gradually exposed in.Such as foreign gene is expressed in plant different tissues, produce metabolic product accumulation and exist
Break its original metabolic balance in plant, influence its normal growth and development.In addition, also contain at 35S promoter
Six aggressiveness pattern structures of the repetition of one nucleotide, the mutation of this sequence may weaken the startup expression energy of promoter
Power, all avoids the generation of this phenomenon without effective measure so far.
Obligatory parasitism refers to that parasitic animal and plant leaves the phenomenon that host cannot survive.Obligate parasite is in vitro due to that can not carry out
Culture, brings huge difficulty, so that obligate parasite is big to research of the various researchs especially in terms of molecular biology
Genetic conversion system is all not yet established more, various molecular mechanism researches seriously lag.Rubber tree powdery mildew is a kind of important special
Property parasitical fungi, affects the development of Rubber Industry indirectly.Its genetic conversion system is not yet established.We utilize bioinformatics
Method is predicted its endogenesis promoter and is verified, it is intended to the endogenous strong promoter of some rubber tree powdery mildews is found, with
Solve it and regulate and control the molecule mechanism of external source target gene and endogenous gene, the molecular mechanism infected to rubber tree powdery mildew, its heredity
The structure of transformation system, and the research of Expressed in Transgenic Plant foreign gene provide some new thinkings.
The content of the invention
For in place of above the deficiencies in the prior art, the present invention provides a kind of rubber tree powdery mildew endogenesis promoter WY7.
The technical solution that the present invention takes is as follows：
A kind of rubber tree powdery mildew endogenesis promoter WY7, the promoter, which contains selected from following any one group and has, to be opened
The nucleotide sequence of mover function：
a、SEQ ID NO：Nucleotide sequence shown in 1；
B, with SEQ ID NO：1 complementary nucleotide sequence；
C, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b；
D, the core that substitution, missing, the addition of one or more bases are modified is carried out to nucleotide sequence shown in above-mentioned a or b
Nucleotide sequence；
E, there is the nucleotide sequence of at least 90% homology with nucleotide sequence shown in above-mentioned a or b.
Preferably, the preparation method of the promoter includes：Using rubber tree powdery mildew genomic DNA as template, one is used
Amplimer is expanded, the amplimer is according to SEQ ID NO：1 sequence in rubber tree powdery mildew genomic DNA
It is designed respectively for head and the tail.
Further, the invention further relates to a kind of nucleic acid construct, it includes the promoter of the present invention, can be grasped with promoter
Make the gene order connected.
Further, the invention further relates to a kind of recombinant vector, the carrier is promoter and pGEM-T of the invention
Easy or 121 plasmids of PBI are through restructuring gained.
Further, the invention further relates to a kind of recombinant cell, the cell contains the promoter or right of claim 1
It is required that 3 nucleic acid construct or the recombinant vector of claim 4.
Preferably, the recombinant cell is recombinant Bacillus coli cells or restructuring Agrobacterium tumefaciens cell.
Further, the invention further relates to one group of primer pair, two primers of the primer pair to contain SEQ ID respectively
NO：2 and SEQ ID NO：Sequence shown in 3；Restricted digestion is also respectively connected at 5 ' ends in two primers of the primer pair
Site and/or protection base.
Further, the invention further relates to a kind of genetically modified plants, the genetically modified plants conversion the startup of the present invention
The recombinant cell of son or nucleic acid construct or recombinant vector or the infection present invention.
Further, the invention further relates to a kind of plant callus or explant, the callus or explant to turn
Change the promoter for having the present invention or nucleic acid construct or recombinant vector or the recombinant cell infected with the present invention.
Further, the invention further relates to the promoter WY7 or described nucleic acid constructs or the recombinant vector or institute
Recombinant cell is stated in destination gene expression in regulating and controlling plant or the purposes in plant breeding.
Compared with prior art, the beneficial effects of the invention are as follows：
A kind of new promoter WY7 from rubber tree powdery mildew is provided, it is double that the promoter can be used in regulation and control
The expression of external source target gene in cotyledon plant and monocotyledon, one kind is provided entirely for the gene expression of genetically modified plants
New instrument and selection.
Brief description of the drawings
Fig. 1 is the plasmid map of recombinant vector PBI121-WY7.
The three lives tobacco leaf disk for the restructuring Agrobacterium-Mediated Transformation that Fig. 2 is promoter WY7 recombinant vectors PBI121-WY7
GUS coloration results.
In figure, WY7 is the GUS coloration results that PBI121-WY7 converts three lives tobacco leaf disk；CK+(CaMV35S)：By
The GUS coloration results of the PBI121 empty carriers conversion three lives tobacco leaf disk of CaMV35S regulation and control gus gene transcriptions；CK-(aseptic seedling) is
The GUS coloration results of unconverted three lives cigarette aseptic seedling leaf dish.
Fig. 3 is each growth period figure of WY7 transgenosis three lives cigarettes；
In figure, co-cultivation phase, callus phase, lateral bud phase, the phase of taking root, Adult plant are followed successively by from left to right.
Fig. 4 is the PCR amplification testing result that WY7 regulates and controls gus gene transgenosis three lives cigarette；
In figure, M：Marker2000；WY7：WY7 regulates and controls gus gene transgenosis three lives Tobacco Leaves DNA；CK+：Turn PBI121
The transgenosis three lives cigarette of empty carrier；CK-：Wild type three lives cigarette.
Rice (the Japan for the restructuring Agrobacterium-Mediated Transformation that Fig. 5 is promoter WY7 recombinant vectors PBI121-WY7
It is fine) the GUS coloration results of callus；
In figure, WY7：The GUS coloration results of PBI121-WY7 rice transformation callus leaf dishes；CK+(CaMV35S)：By
The GUS coloration results of the PBI121 empty carrier rice transformation callus of CaMV35S regulation and control gus gene transcriptions；CK-：Unconverted day
The GUS coloration results of this fine rice callus.
Embodiment
The present invention is described in further detail below by embodiment combination attached drawing.
The PCR amplification of embodiment one, WY7 promoter fragments
Use fungal genomic DNA extracts kit (OMEGA, D3390-01) extraction rubber tree powdery mildew (Hainan Province's heat
There is provided with living resources sustainable use key lab) genomic DNA, according to the sequence of WY7 promoters, design a pair of special
(sense primer WY7F, adds restriction enzyme site Hind III and protection base, anti-sense primer WY7R, adds limit to specific amplification primers
Property restriction enzyme site BamH I processed and protection base).Using the genomic DNA of the rubber tree powdery mildew of said extracted as template, height is used
Fidelity Ex Taq polymerases (TRANSGEN, AP122) carry out PCR amplification.As shown in table 1.
The PCR system of 1 gene promoter of table amplification
PCR amplification program is：94 DEG C of pre-degeneration 5min, then with 94 DEG C of denaturation 60s, 55 DEG C of annealing 50s, 72 DEG C extend
60s, carries out 35 reaction cycles, last 72 DEG C of extensions 5min.
Wherein, sense primer WY7F：CCCAAGCTTTTGGAGGTTTCTACAGCCTT, wherein underscore represent Hind III
Restriction enzyme site.Anti-sense primer WY7R：CGGGATCCCGCTTGTCTGAAGTTTTTGC, wherein underscore represent I digestion positions of BamH
Point.
Pcr amplification product is separated through 1.0% agarose gel electrophoresis, obtains band of the size for 260bp or so, is used
OMEGA Ago-Gel DNA QIAquick Gel Extraction Kit (catalog number (Cat.No.)s：D2500-01 purifying recycling) is carried out.
The structure of embodiment two, pGEM-T easy-WY7 recombinant vectors
Pcr amplification product obtained above is subjected to T/A clones (pGEM-T easy plasmids, PROMEGA, A1360) conversion
Escherichia coli (TRANSGEN, CD201), picking positive colony sequencing, it was demonstrated that accurate.
Wherein, the condition of contact of T/A clones is as follows：
T/A linked systems：10ul
PGEM-T Easy Vector (PROMEGA, A137A):1ul
2×Rapid ligation Buffer:5ul
Pcr amplification product (recycling Insert Fragment)：2ul
T4DNA ligase:1ul
ddH2O:1ul
First be placed in room temperature 1 it is small when, then in 4 DEG C connection overnight, obtain pGEM-T easy-WY7 recombinant vectors.It will pass through
Product after above-mentioned connection converts Escherichia coli as follows：
In refrigerator take out according to《Molecular Cloning:A Laboratory guide》Prepared by Calcium Chloride Method shown in (third edition, Science Press)
100 μ l DH5 α (Transgene, CD201) of competent cell, after melting on ice, add 10 μ l connection products as obtained above,
That is pGEM-T easy-WY7 recombinant vectors, gently stir evenly, ice bath 30min, 42 DEG C of heat shock 60s, ice bath 3min, add 600 μ l 4
(specific formula refers to the LB culture mediums of DEG C precooling《Molecular Cloning:A Laboratory guide》, the third edition, Science Press), 37 DEG C of 220rpm
Recovery 60min, 8000rpm centrifugation 30s, removes supernatant, leaves and takes 200 μ l, the mixing after precipitation is resuspended with remaining 200 μ l supernatants
Thing, gently blows even, and (specific formula refers to tablet glass rod coating LB (ampicillin, IPTG, X-gal)《Molecular Cloning: A Laboratory
Guide》, the third edition, Science Press), 37 DEG C are inverted culture 12h~16h.Acquisition contains pGEM-T easy-WY7 cloning vectors
Recombination bacillus coli, be named as DH5 α-WY7.Shenzhen Huada Genetic Technology Co., Ltd clones pGEM-T easy-WY7 and carries
WY7 in body is sequenced, sequencing result such as SEQ ID NO：Shown in 1.
Sequencing result shows that WY7 promoter sequences are correct in the pGEM-T easy-WY7 cloning vectors of acquisition.
The structure of embodiment three, PBI121-WY7 recombinant vectors
DH5 α-WY7 bacterial strain picking the single bacterium colonies that above-mentioned structure obtains are carried out shaking bacterium, 37 DEG C of 220rpm shake bacterium and stay overnight, and use
The small extraction reagent kit of OMEGA plasmids (D6943-01) extracts plasmid, then with Hind III (NEB, R0104S) and BamH I (NEB,
R0136V) restriction enzyme carries out double digestion, and digestion products carry out recycling WY7 with OMEGA QIAquick Gel Extraction Kits (D2500-01)
Promoter fragment.
Recovery product obtained above and PBI121 plasmids (TIANNZ, 60908-750y) are attached, then converted
Escherichia coli, picking positive colony sequencing, it was demonstrated that accurate.
Wherein, the condition of contact of T/A clones is as follows：
T/A linked systems：10ul
PBI121Vector:1ul
10×T4DNA Ligase Buffer:1ul
Recovery product (WY7 promoter fragments)：6ul
T4DNA Ligase (Ta Ka Ra, D2011A)：0.5ul
ddH2O:1.5ul
16 DEG C of connections overnight, obtain PBI121-WY7 recombinant vectors.By the product after above-mentioned connection according to such as lower section
Method converts Escherichia coli：
In refrigerator take out according to《Molecular Cloning:A Laboratory guide》Prepared by Calcium Chloride Method shown in (third edition, Science Press)
100 μ l DH5 α (Transgen, CD201) of competent cell, after melting on ice, add 10 μ l connection products as obtained above, i.e.,
PBI121-WY7 recombinant vectors, gently stir evenly, ice bath 30min, 42 DEG C of heat shock 60s, ice bath 3min, add 600 μ l, 4 DEG C of precoolings
LB culture mediums (specific formula refers to《Molecular Cloning:A Laboratory guide》, the third edition, Science Press), 37 DEG C of 200rpm recoveries
60min, 8000rpm centrifuge 30s, remove supernatant, leave and take 200 μ l, the mixture after precipitation are resuspended with remaining 200 μ l supernatants, gently
Featheriness is even, and (specific formula refers to glass rod coating LB (kanamycins) tablet《Molecular Cloning:A Laboratory guide》, the third edition, science
Publishing house), 37 DEG C are inverted culture 16h~24h.The recombination bacillus coli containing PBI121-WY7 cloning vectors is obtained, is named as
DH5α-PWY7.The WY7 in PBI121-WY7 cloning vectors is sequenced in Shenzhen Huada Genetic Technology Co., Ltd, sequencing knot
Fruit such as SEQ ID NO：Shown in 1.
Sequencing result shows that WY7 promoter sequences are correct in the PBI121-WY7 cloning vectors of acquisition.
Example IV, the preparation for recombinating agrobacterium tumefaciens lba4404-WY7 cells
By recombination bacillus coli DH5 α-PWY7 pickings single bacterium colonies in the LB liquid medium containing 50ug/ml kanamycins
In shake bacterium, 37 DEG C of 200rpm, grow into OD600For 0.5 or so, with containing the Escherichia coli HB101 for assisting plasmid pRK2013 and
The competent cell of acceptor Agrobacterium LBA4404 mixes in equal volume, is coated on paint daubs and does not contain any antibiotic solid
On LB culture medium flat plates, 28 DEG C of overnight incubations.With transfer needle by the bacterium colony grown be transferred to the kanamycins containing 50ug/ml and
On the solid LB media tablet of 100ug/ml rifampins, 28 DEG C are cultivated 3-4 days.By the single bacterium colony grown be transferred to again containing
On the kanamycins of 50ug/ml and the solid LB media tablet of 100ug/ml rifampins, picking single bacterium colony is with containing 50ug/ml
Kanamycins and the LB fluid nutrient mediums of 100ug/ml rifampins shake bacterium, 37 DEG C of 200rpm, are carried out with primer pair WY7F, WY7R
Bacterium colony PCR is verified, while is extracted plasmid and carried out double digestion verification with Hind III and I restriction enzymes of BamH.Band is 260bp
Left and right is restructuring agrobacterium tumefaciens lba4404-WY7 cells.
Embodiment five, restructuring Agrobacterium-Mediated Transformation three lives cigarette
1) acquisition of tobacco aseptic seedling
Three lives cigarette seed is loaded into 1.5ml centrifuge tubes (＜ 50/pipe), adds 1ml ddH2O, is put into 4 DEG C of refrigerators, immersion
Carry out vernalization within 2 to 3 days.
The good three lives cigarette seed of vernalization suctions out ddH with liquid-transfering gun2O, adds the soaked in absolute ethyl alcohol 2min of 1ml 75%, uses
Liquid-transfering gun suctions out absolute ethyl alcohol, uses ddH2O is washed 3 to 5 times repeatedly, is cleaned seed, is used ddH every time2O1ml.Then liquid-transfering gun is used again
The liquor natrii hypochloritis for adding 3% soaks seed 3min, then uses ddH2O is washed 3 to 5 times, finally suctions out ddH with liquid-transfering gun2O。
The moisture of the surface of the seed is blotted with aseptic filter paper, then three lives cigarette seed is inoculated in MS solid mediums with suction nozzle and is put down
Sprouted on plate, per 10-20, ware, be placed in 26 DEG C of illumination boxs (16h light 8h is dark) and cultivate one week, intensity of illumination is
2000lx (all illumination cultivations of the invention carry out under this intensity of illumination).After three lives cigarette grows seedling, it is transferred to and is equipped with
The tissue culture bottle of fresh MS solid mediums, every bottle (Φ 6cm, H 11cm, 50ml culture medium/bottle) 1 plant of tobacco seedling, 26 DEG C of illumination
In 3-5 week of incubator (16h light 8h is dark) culture, obtain three lives cigarette aseptic seedling.
The blade and root of three lives cigarette aseptic seedling are wiped out, cane is cut to the segment with axillary bud, per segment length about 2-3cm, is used
Rifle tweezer lives its morphology lower end is inserted perpendicularly into the tissue culture bottle containing fresh MS solid mediums.Every bottle of inoculation one carries
The stem section of axillary bud, 26 DEG C of weeks of illumination cultivation 3-5, this material i.e. to be transformed.
2) preparation of bacterium solution is infected
Will restructuring agrobacterium tumefaciens lba4404-WY7 picking single bacterium colonies be transferred to the kanamycins containing 50ug/ml and
The LB fluid nutrient mediums of 100ug/ml rifampins shake bacterium, and 28 DEG C of 200rpm shake bacterium and stay overnight.Draw a small amount of bacterium solution and be transferred to 30 times of volumes
The kanamycins containing 50ug/ml and 100ug/ml rifampins LB fluid nutrient mediums, the same terms carry out rereeling.Culture is extremely
OD600For 0.6-0.8, bacterium solution is as infected.
3) infect
The blade larger from clip in the sterile three lives tobacco seedlings in the week of culture 3-5, is contained into equipped with a little ddH2The sterile training of O
Support in ware.
Tobacco leaf is broken into leaf disc with the card punch of diameter about 1cm, or is cut tobacco leaf with aseptic operation knife
For the leaf dish of the approximating square of the length of side about 1cm, it is put into another and a little ddH is housed2In the sterile petri dish of O.
Tobacco Leaf disk folder is gone out with rifle tweezer, is put into equipped with the sterile 50ml centrifuge tubes for infecting bacterium solution in right amount.Gently shake
Centrifuge tube, it is ensured that Agrobacterium is adequately exposed to the wound at leaf dish edge, soaks 10-25min, during which constantly rocks several times.Pull out
Tobacco leaf disc, is transferred on dry aseptic filter paper, blots bacterium solution.It is transferred to and is free of any antibiotic, contains 1.0mg/L 6-
In the MS solid medium tablets of BA and 0.1mg/L NAA, blade face upward, 4-10 pieces of leaf dishes, 26 DEG C of light cultures 2 is inoculated with per ware
My god.
4) screen
The tobacco leaf disc that light culture terminates is transferred to containing 5-10ug/ml kanamycins and 1.0mg/L 6-BA, 0.1mg/
In the MS solid medium tablets of L NAA and 100ug/ml Ticarcillin/Clavulanate Acids, 26 DEG C of illumination cultivations.
After culture 2-4 days, the leaf dish not bleached is taken to carry out GUS dyeing.With 75% ethanol solution after 37 DEG C of stained over night
Decolourized three times, to eliminate chlorophyll, taken pictures.The results are shown in Figure 4, through the recombinant vector PBI121- containing promoter WY7
The three lives tobacco leaf disk of the restructuring Agrobacterium-Mediated Transformation of WY7 becomes blue after GUS is dyed.The WY7 of the results show present invention is opened
Mover has regulating and controlling effect in dicotyledonous model plant three lives cigarette to gus gene.
GUS prescription of its dyeing liquor：
0.25mM K3Fe(CN)6,0.25mM K4Fe(CN)6,64mM Na2HPO4·12H2O,36mM KH2PO4,10mM
Na2EDTA, 0.1%Trition X-100,10%CH3OH,2.5mg/ml X-Gluc。
The expression of gus gene in embodiment six, transgene tobacco
Take the above-mentioned transformed three lives tobacco leaf disk in part to continue illumination cultivation, about subculture after two weeks, about clump occur after four weeks
Sprout.When Multiple Buds grow into 1-2cm, cut, be inoculated into containing 5-10ug/ml kanamycins with the scalpel to sterilize
In the 1/2MS culture mediums of 100ug/ml Ticarcillin/Clavulanate Acids, 1 plant every bottle.26 DEG C of illumination cultivations about 2 weeks.Take the cigarette that condition of rooting is good
Careless seedling, opens the lid of tissue culture bottle, hardening 2-3 days in incubator.
Most of blade of transgene tobacco seedling is wiped out, root major part culture medium is carefully washed off, is transplanted to sterilized
Soil in, carry out it is potted plant.In the week of growth about 2-3, take the young leaves grown to extract DNA and carry out PCR amplification verification.Amplimer is
WY7F、WY7R.Through 1% agarose electrophoresis, as a result such as Fig. 5 is shown amplified production, the band of a treaty 250bp has been obtained, with WY7
It is in the same size, turn PBI121 empty carriers positive control and three lives cigarette wild type aseptic seedling then without band.
The induction and conversion of embodiment seven, Rice Callus
Inducing paddy rice callus, the callus is converted with restructuring agrobacterium tumefaciens lba4404-WY7.
1) rice paddy seed sterilizes
Ripe Nipponbare rice paddy seed is shelled by hand, adds 70% 1-2min of Ethanol Treatment, evacuation ethanol, use is sterile
Water flushes three times.Add 0.1%HgCl215min is soaked, with aseptic water washing three times.Dry, it is spare.
2) induction of Rice Callus and subculture
The grain of rice containing embryo after disinfection is inoculated on N6D culture mediums, 29 DEG C of biochemical cultivation case cultures 2 weeks or so, induction is cured
Injured tissue produces.
The Rice Callus grown is peeled off from seed, is transferred on new N6D culture mediums, squamous subculture.About
Subculture is once every two weeks.
3) prepared by the activation of Agrobacterium LBA4404-WY7 and transformed bacteria solution
Yellow-white is selected, dry enlivens callus, is inoculated on new N6D culture mediums and cultivates three days.
The single bacterium colony of picking restructuring Agrobacterium tumefaciems LBA44O4-WY7, in kanamycins and 100ug/ml containing 50ug/ml
In on the liquid YM/YEP/LB culture mediums of rifampin, 28 DEG C, 250rpm shake cultures to OD600=0.8-1.0.
Draw the YM/YEP/LB fluid nutrient mediums that the cultured bacterium solutions of 1ml add kanamycins of the 50ml containing 50ug/ml
In, continue culture to OD600=0.8-1.0.4 DEG C, 4000rpm centrifugations precipitate thalline, then use containing appropriate MS resuspended bacterium solutions extremely
OD600=0.5 or so, it is spare.
4) convert
The Rice Callus of squamous subculture is put into sterilizing culture dish, LBA4404-WY7 re-suspension liquids are poured into culture
Ware, 15-30min of immersion Rice Callus.Rice Callus is removed and is placed in sterilizing filter paper, filters surplus liquid.N6
Co-culture and put a sterilizing filter paper on base.Rice Callus is put on filter paper, sealing culture, 28 DEG C of light cultures 48-60 are small
When.
5) screen
Infected Rice Callus is cleaned 3-4 times with 1% mannitol solution, is then vibrated with sterile water clear
Wash 3-4 times, clarified until supernatant becomes.Most Hou is with the nothing of the cephalosporin of 300mg/L or the carbenicillin of 500mg/L
Bacterium aqueous cleaning 3-4 times.Callus is placed on aseptic filter paper, removes excessive moisture.Finally callus is inoculated into
The N6 culture mediums of the cephalosporin of kanamycins and 300mg/L containing 5-10ug/ml or the carbenicillin of 500mg/L
On, sealing, 29 DEG C of light cultures, about two weeks subcultures are once.
Embodiment eight：The expression of gus gene in Nipponbare Rice Callus
The Rice Callus converted with LBA4404-WY7 is subjected to GUS dyeing.
The formula (1ml) of GUS dyeing liquors：0.25mM K3Fe(CN)6,0.25mM K4Fe(CN)6,64mM Na2HPO4·
12H2O,36mM KH2PO4,10mM Na2EDTA, 0.1%Trition X-100,10%CH3OH,2.5mg/ml X-Gluc。
It is immersed in the LBA4404-WY7 Rice Callus converted in 37 DEG C in GUS dyeing liquors, overnight.
Take pictures, the results are shown in Figure 5, the Nipponbare of the Agrobacterium-Mediated Transformation containing recombinant vector PBI121-WY7
Become blueness after Rice Callus GUS dyeing.The Japan of Agrobacterium-Mediated Transformation without recombinant vector PBI121-WY7
Color is constant after fine Rice Callus GUS dyeing.The result shows that the expression of WY7 promoters of the invention to gus gene has
Regulating and controlling effect.
2 MS culture medium prescriptions of table
PH is adjusted to 5.8,121 DEG C of sterilizing 20min.
3 N6 culture medium prescriptions of table
PH is adjusted to 5.2,121 DEG C of sterilizing 20min.
Above content is to combine specific embodiment further description made for the present invention, it is impossible to assert this hair
Bright specific implementation is confined to these explanations.For general technical staff of the technical field of the invention, do not taking off
On the premise of from present inventive concept, some simple deduction or replace can also be made.
Sequence table
<110>University Of Hainan
<120>Rubber tree powdery mildew endogenesis promoter WY7 and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 251
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
attggaggtt tctacagcct ttctgccagc cactctattg cattctctaa tagtttcgat 60
ctccaatctc ccccatttag tccaaaagtc tgtggggctt tttttttcta aatcttttag 120
ttattttgtt agttagttgg tgtcactatc ctgtttttta ggggcctatt atccgaattt 180
tgatgaattg tgattggatg taatcggttt atatatttcc aacattaaaa agcaaaaact 240
tcagacaagc g 251
<210> 2
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
ttggaggttt ctacagcctt 20
<210> 3
<211> 20
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
cgcttgtctg aagtttttgc 20
Claims (10)
1. rubber tree powdery mildew endogenesis promoter WY7, it is characterised in that the promoter contains selected from following any one group and has
There is the nucleotide sequence of promoter function：
a、SEQ ID NO：Nucleotide sequence shown in 1；
B, with SEQ ID NO：1 complementary nucleotide sequence；
C, can be with the nucleotide sequence of the nucleotide sequence hybridization of above-mentioned a or b；
D, the nucleotide that substitution, missing, the addition of one or more bases are modified is carried out to nucleotide sequence shown in above-mentioned a or b
Sequence；
E, there is the nucleotide sequence of at least 90% homology with nucleotide sequence shown in above-mentioned a or b.
2. promoter according to claim 1, it is characterised in that the preparation method of the promoter includes：With rubber tree
Powdery mildew genomic DNA is template, is expanded using pair for amplification primer, and the amplimer is according to SEQ ID NO：1
Sequence in rubber tree powdery mildew genomic DNA is designed for head and the tail respectively.
3. a kind of nucleic acid construct, it is characterised in that it includes the promoter described in claim 1, with the operable company of promoter
The gene order connect.
A kind of 4. recombinant vector, it is characterised in that the carrier for the promoter described in claim 1 and pGEM-T easy or
PBI121 plasmids are through restructuring gained.
5. a kind of recombinant cell, it is characterised in that the cell contains the promoter of claim 1 or the nucleic acid of claim 3
The recombinant vector of construct or claim 4.
6. a kind of recombinant cell according to claim 5, it is characterised in that the recombinant cell is thin for recombination bacillus coli
Born of the same parents or restructuring Agrobacterium tumefaciens cell.
7. one group of primer pair, it is characterised in that two primers of the primer pair contain SEQ ID NO respectively：2 and SEQ ID
NO：Sequence shown in 3；Restriction enzyme site and/or protection is also respectively connected at 5 ' ends in two primers of the primer pair
Base.
8. a kind of genetically modified plants, it is characterised in that the promoter or core that the genetically modified plants conversion is had the right described in requirement 1
The recombinant cell of acid con-struct or recombinant vector or the infection present invention.
9. a kind of plant callus or explant, it is characterised in that callus or the explant conversion has the present invention's
Promoter or nucleic acid construct or recombinant vector or the recombinant cell infected with the present invention.
10. promoter WY7 according to claim 1, it is characterised in that promoter target gene table in plant is regulated and controled
Reach or plant breeding in purposes；Nucleic acid construct containing the promoter, the recombinant vector obtained using the promoter or again
Group cell is in destination gene expression in regulating and controlling plant or the purposes in plant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429330.2A CN107974455B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY7 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711429330.2A CN107974455B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY7 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107974455A true CN107974455A (en) | 2018-05-01 |
| CN107974455B CN107974455B (en) | 2020-03-03 |
Family
ID=62007472
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711429330.2A Expired - Fee Related CN107974455B (en) | 2017-12-26 | 2017-12-26 | Rubber powdery mildew endogenous promoter WY7 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107974455B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110885365A (en) * | 2019-12-11 | 2020-03-17 | 海南大学 | Application of ATAF2 protein and related biological materials thereof in regulation and control of disease resistance of plants to rubber tree powdery mildew |
| CN113999859A (en) * | 2021-10-29 | 2022-02-01 | 海南大学 | Screening method of rubber tree powdery mildew avirulence gene, effector protein and application |
| CN114317586A (en) * | 2021-12-31 | 2022-04-12 | 海南大学 | Fluorescent vector for marking rubber tree powdery mildew and expression method and application thereof |
| CN114540401A (en) * | 2022-01-06 | 2022-05-27 | 海南大学 | Carbendazim resistance screening vector for genetic transformation of rubber tree powdery mildew |
| CN114540402A (en) * | 2022-01-11 | 2022-05-27 | 海南大学 | Method for evaluating transformation efficiency of rubber tree powdery mildew genetic transformation system |
| CN116254267A (en) * | 2023-02-24 | 2023-06-13 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
-
2017
- 2017-12-26 CN CN201711429330.2A patent/CN107974455B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| JONG AD等: "PePPER ：a webserver for prediction of prokaryote promoter elements and regulons", 《BMC GENOM》 * |
| XIANG LI等: "Identification of Powdery Mildew Responsive Genes in Hevea brasiliensis through mRNA Differential Display", 《INT. J. MOL. SCI.》 * |
| 李宁 等: "植物抗病相关启动子及其研究进展", 《植物遗传资源学报》 * |
| 王义 等: "橡胶树白粉菌真核表达启动子的预测、克隆及功能鉴定", 《中国植物病理学会2016年学术年会论文集》 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110885365A (en) * | 2019-12-11 | 2020-03-17 | 海南大学 | Application of ATAF2 protein and related biological materials thereof in regulation and control of disease resistance of plants to rubber tree powdery mildew |
| CN113999859A (en) * | 2021-10-29 | 2022-02-01 | 海南大学 | Screening method of rubber tree powdery mildew avirulence gene, effector protein and application |
| CN114317586A (en) * | 2021-12-31 | 2022-04-12 | 海南大学 | Fluorescent vector for marking rubber tree powdery mildew and expression method and application thereof |
| CN114540401A (en) * | 2022-01-06 | 2022-05-27 | 海南大学 | Carbendazim resistance screening vector for genetic transformation of rubber tree powdery mildew |
| CN114540402A (en) * | 2022-01-11 | 2022-05-27 | 海南大学 | Method for evaluating transformation efficiency of rubber tree powdery mildew genetic transformation system |
| CN116254267A (en) * | 2023-02-24 | 2023-06-13 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
| CN116254267B (en) * | 2023-02-24 | 2024-04-05 | 海南大学 | Specific expression promoter of rubber grass milk tube and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107974455B (en) | 2020-03-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107974455A (en) | Rubber tree powdery mildew endogenesis promoter WY7 and application thereof | |
| CN108374012A (en) | Rubber tree powdery mildew endogenesis promoter WY51 and application thereof | |
| CN107974454A (en) | Rubber tree powdery mildew endogenesis promoter WY193 and application thereof | |
| CN107760681A (en) | Promoter WY195 and application thereof | |
| CN113774067A (en) | Cymbidium kanran gene expression vector for promoting seed germination, construction method and application | |
| CN106636099B (en) | A kind of citrusfruit specificity promoter and application | |
| CN105400814B (en) | A method of cultivating insect-resistant transgenic corn | |
| CN102399795A (en) | Method for improving tropane alkaloid content in atropa belladonna by using atropa belladonna tropinone reductase I gene | |
| CN102533809B (en) | Jujube glutathione peroxidase gene | |
| CN111961675B (en) | Clonotus sinensis-free Clinopodium polycephalum closed flower gene CsCly and application thereof | |
| CN110106171A (en) | Long-chain non-coding RNA and its application in regulation plant frigostabile | |
| CN104651359A (en) | Bidirectional promoters separated out of corn and application thereof | |
| CN104513831B (en) | Method for promoting plant growth | |
| CN102399813A (en) | Application of jasmonic acid carboxyl methyltranferase gene in cultivation of atropa belladonna with high yield of tropane alkaloids | |
| KR101317891B1 (en) | High-efficiency and rapid method for producing transgenic rice plant using germinating rice seeds and the plant thereof | |
| CN105018493B (en) | The promoter of the rice Os AHL1 genes and recombinant vector comprising it, transformant and its application | |
| CN114540354B (en) | Expression vector containing hot pickled mustard tuber IFL1 promoter fusion GUS gene and application thereof | |
| CN117721111B (en) | Mangrove plant avicennia marina endogenous promoter AMGT P5 and application thereof | |
| CN109234308A (en) | A kind of Agrobacterium tumefaciens mediated transgenosis woaded blue regeneration plant method for transformation | |
| CN102851294B (en) | Vascular tissue specific expression promoter VSPl and applications thereof | |
| KR101198648B1 (en) | Method for transforming Cucumis sativus line through direct shoot induction and Cucumis sativus line transformant produced by the same | |
| CN110106172A (en) | A kind of long-chain non-coding RNA and its application in regulation plant frigostabile | |
| CN102485893A (en) | Two preferentially expressed strong promoters during cotton fiber development initiation and their application | |
| CN117721112A (en) | Endogenous promoter AMDREP8 of mangrove plant avicennia marina and application thereof | |
| CN106282199B (en) | Gene of dwarf plant and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200303 Termination date: 20211226 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |