CN117721112A - Endogenous promoter AMDREP8 of mangrove plant avicennia marina and application thereof - Google Patents

Abstract

The invention discloses an endogenous promoter AMDREP8 of mangrove plant avicennia marina and application thereof, belonging to the technical field of genetic engineering, wherein the nucleotide sequence of the endogenous promoter AMDREP8 comprises the following components: as set forth in SEQ ID NO:1, a sequence shown in seq id no; or, with SEQ ID NO:1 and has at least 70% homology and the same function; or, SEQ ID NO:1, and a sequence having one or more bases added, substituted, inserted or deleted in the sequence shown in 1 and having the same function. AMDREP8 contains a reported dehydration reaction cis-acting element DRE (TACCGACAT), can provide a new direction for the research of the salt tolerance mechanism of mangrove plants, can also regulate and control the expression of exogenous target genes in dicotyledonous plants and monocotyledonous plants, provides a brand-new tool and selection for the expression of exogenous genes of transgenic plants, and lays an important foundation for genetic improvement of plants.

Description

Endogenous promoter AMDREP8 of mangrove plant avicennia marina and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to an endogenous promoter AMDREP8 of mangrove plant avicennia marina and application thereof.

Background

Mangrove plants are evergreen shrubs or trees grown in tropical and subtropical coastal zones and estuary intertidal zones. Mangrove is a special forest type of seaside beach, has the characteristics of high productivity, high return rate and high decomposition rate, and has great ecological significance, social significance and economic value with coral reefs, seaside marsh wetland and upward flow and is called as the four most productive marine ecosystems in the world. The special habitat of the mangrove plant enables the mangrove plant to have unique salt tolerance and salt tolerance resources to have extremely strong potential, wherein Avicennia marina (forsk.) can be propagated through seeds in a sexual manner, and the mangrove plant with the strongest water flooding and salt tolerance has stronger soil adaptability and can grow in silt, sediment and even sandy soil. However, mangrove plants are of a large variety and the salt tolerance mechanism is different. At present, salt tolerance mechanisms of mangrove plants such as avicennia marina are not thoroughly studied, and salt tolerance gene reports of mangrove plants are relatively few. While few reports have been made on the endogenous promoters of mangrove plants.

In plant transgenic engineering, constitutive promoters can make the target gene be expressed efficiently and continuously, but the efficient expression of exogenous genes often leads to consumption of a large amount of plant energy and nutrients, and can not effectively regulate the expression of the target gene in time and space, affecting the growth and development of plants. In addition, if two or more exogenous genes are driven by repeatedly using the same type of promoter, it is possible to trigger gene silencing. Therefore, in order to control the time and accuracy of the expression of the exogenous gene in the plant and reduce the influence on the growth, development and metabolic pathways of the plant, the expression of the target gene can be controlled more flexibly by using an inducible or tissue-specific promoter instead of a constitutive promoter.

Avicennia marina (forsk.) can be propagated sexually through seeds, is mangrove plants with the strongest water and salt tolerance, has stronger soil adaptability, and can grow in silt, sediment and even sandy soil. The bioinformatics method is utilized to predict and verify the avicennia marina endogenous promoters, and an attempt is made to find some salt-tolerant related endogenous promoters of the avicennia marina so as to know the molecular mechanism of regulating and controlling exogenous target genes and endogenous genes, and a few new ideas are provided for the construction of the salt-tolerant molecular mechanism of the avicennia marina, the genetic transformation system of the avicennia marina and the research of salt-tolerant transgenic crops.

Disclosure of Invention

The invention aims to provide an endogenous promoter AMDREP8 of mangrove avicennia marina and application thereof, so as to solve the problems in the prior art, and the endogenous promoter contains a reported dehydration reaction cis-acting element DRE (TACCGACAT), so that a new direction can be provided for the study of the salt tolerance mechanism of mangrove plants, and meanwhile, the expression of exogenous target genes in dicotyledonous plants and monocotyledonous plants can be regulated, a brand-new tool and selection are provided for the expression of exogenous genes of transgenic plants, and an important foundation is laid for genetic improvement of plants.

In order to achieve the above object, the present invention provides the following solutions:

the invention provides an avicennia marina endogenous promoter AMDREP8, wherein the nucleotide sequence of the endogenous promoter AMDREP8 is any one of the following:

(1) As set forth in SEQ ID NO:1, a sequence shown in seq id no;

(2) And SEQ ID NO:1 and has at least 70% homology and the same function;

(3) SEQ ID NO:1, and a sequence having one or more bases added, substituted, inserted or deleted in the sequence shown in 1 and having the same function.

The invention also provides a recombinant vector containing the endogenous promoter AMDREP8.

The invention also provides a host cell comprising the recombinant vector.

The invention also provides application of the endogenous promoter AMDREP8 or the recombinant vector or the host cell in promoting exogenous gene expression in plants.

Further, the plants include avicennia, tobacco, and barley.

Further, the foreign gene includes a GUS gene.

The invention also provides application of the endogenous promoter AMDREP8 or the recombinant vector or the host cell in culturing transgenic plants.

The invention also provides a method for cultivating transgenic plants by utilizing the endogenous promoter AMDREP8, which comprises the following steps: and connecting an exogenous gene to the downstream of the endogenous promoter AMDREP8, transferring the exogenous gene into plants, and screening plants specifically expressing the exogenous gene, namely transgenic plants.

Further, the plants include dicotyledonous plants and monocotyledonous plants.

Further, the foreign gene includes a GUS gene.

The invention discloses the following technical effects:

the invention provides a novel promoter AMDREP8 from avicennia marina, which contains a reported dehydration reaction cis-acting element DRE (TACCGACAT), can provide a novel direction for the salt tolerance mechanism research of mangrove plants, and can regulate and control the expression of exogenous target genes in dicotyledonous plants and monocotyledonous plants. The invention provides a brand new tool and selection for the exogenous gene expression of the transgenic plant, and lays an important foundation for the genetic improvement of the plant.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 is a plasmid map of recombinant vector pCAMBIA1304-AMDREP 8;

FIG. 2 is a recombinant vector pCAMBIA1304-AMDREP8 of the promoter AMDREP8. Tumefaciens-mediated recombinationGUS staining results of the transformed three-raw tobacco leaf trays; in the figure, A is GUS staining result of agrobacterium-transformed three-raw tobacco leaf trays containing recombinant vector pCAMBIA1304-AMDREP 8; b is CK ^- : GUS staining results of untransformed three-smoke aseptic seedling leaf discs; c is CK ⁺ : GUS staining results of agrobacterium-transformed three-raw tobacco trays containing pCAMBIA1304 empty vector transcribed from the GUS gene regulated by CaMV 35S;

FIG. 3 is a graph of the growth stages of AMDREP8 transgenic three-stage smoke; in the figure, A is the co-culture period; b is a callus period; c is the lateral bud stage; d is a rooting period; e is the adult plant period;

FIG. 4 shows the PCR amplification detection result of AMDREP 8-regulated GUS gene transgenic three-stage tobacco; in the figure, M: marker2000; a: AMDREP8 regulates GUS gene transgenic three-way smoke; b: CK (CK) ^- Wild type three-way tobacco;

FIG. 5 shows GUS staining results of the recombinant Agrobacterium tumefaciens-mediated transformation of barley young leaves with the recombinant vector pCAMBIA1304-AMDREP8 of the promoter AMDREP 8; in the figure, A is GUS staining result of agrobacterium tumefaciens transformed barley young leaves containing recombinant vector pCAMBIA1304-AMDREP 8; b is CK-: GUS staining results of untransformed barley young leaves; c is CK ⁺ : GUS staining results of young leaves of barley transformed with pCAMBIA1304 empty vector containing transcription of GUS gene regulated by CaMV 35S.

Detailed Description

Various exemplary embodiments of the invention will now be described in detail, which should not be considered as limiting the invention, but rather as more detailed descriptions of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. In addition, for numerical ranges in this disclosure, it is understood that each intermediate value between the upper and lower limits of the ranges is also specifically disclosed. Every smaller range between any stated value or stated range, and any other stated value or intermediate value within the stated range, is also encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the invention described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from consideration of the specification of the present invention. The specification and examples of the present invention are exemplary only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are intended to be inclusive and mean an inclusion, but not limited to.

The MS medium formulations used in the following examples are shown in table 1:

TABLE 1MS Medium formulation

The pH was adjusted to 5.8 and sterilized at 121℃for 20min.

The GUS staining solution formulation used in the following examples was: 0.25mM K ₃ Fe(CN) ₆ 、0.25mM K ₄ Fe(CN) ₆ 、64mM Na ₂ HPO ₄ ·12H ₂ O、36mM KH ₂ PO ₄ 、10mM Na ₂ EDTA、0.1％Trition X-100、10％CH ₃ OH and 2.5mg/mL 5-bromo-4-chloro-3-indolyl glucoside (X-Gluc).

Example 1 PCR amplification of AMDREP8 promoter fragment

The genomic DNA of avicennia marina was extracted using a polysaccharide polyphenol plant genomic DNA extraction kit (TIANGEN, DP 360), and a pair of specific amplification primers (upstream primer AMDREP8F, restriction enzyme site HindIII and protecting base added, downstream primer AMDREP8R, restriction enzyme site Nco I and protecting base added) was designed based on the sequence of AMDREP8 promoter. PCR amplification was performed using the genomic DNA of avicennia marina extracted as described above as a template, using high fidelity DNA polymerase (Vazyme, P520). As shown in table 2.

TABLE 2 PCR System for AMDREP8 promoter amplification

The PCR amplification procedure was: pre-denaturation at 98℃for 30s, then denaturation at 98℃for 10s, annealing at 54.5℃for 5s, extension at 72℃for 5s, 35 reaction cycles were performed, and extension at 72℃for 1min.

Wherein, the upstream primer AMDREP8F:5' -CCCAAGCTTAGTTATAAATTATGGATTTGAATTTCAC-3' (SEQ ID NO: 2), wherein the underlined represents the HindIII cleavage site. Downstream primer amdre 8R:5' -CATGCCATGGGAATAAAATATTATACATCTTTTCA-3' (SEQ ID NO: 3), wherein the underlined represents the Nco I cleavage site.

The PCR amplified product was separated by 1.0% agarose gel electrophoresis to obtain a band of about 150bp in size, and purified and recovered using a common agarose gel DNA recovery kit for Tiangen (TIANGEN, DP 209-03). The nucleotide sequence of the PCR amplified product fragment is shown as SEQ ID NO:1 is shown as follows:

AGTTATAAATTATGGATTTGAATTTCACATGTTACGATTTATTACTGTATTTAGTACAC TTGTATACCGACATGTTAAGAGTGAGTCACTCAATGTATAATGAATTTAAAATTTCAAAT GTGAAAAGATGTATAATATTTTATTC(SEQ ID NO：1)。

the nucleotide sequence of the promoter contains a reported dehydration reaction cis-acting element DRE (TACCGACAT), and can provide a new direction for the research of the salt tolerance mechanism of mangrove plants.

EXAMPLE 2 construction of pCAMBIA1304-AMDREP8 recombinant vector

The PCR amplification product obtained in example 1 and pCAMBIA1304 plasmid (MIAOLING Biology, P0279) were digested with HindIII (NEB, R3104S) and NcoI (NEB, R3193S) restriction enzymes, respectively, and the resultant digested products were recovered using a common agarose gel DNA recovery kit (TIANGEN, DP 209-03) to obtain an AMDREP8 promoter fragment and a pCAMBIA1304 plasmid backbone fragment from which 35S promoter was excised.

The AMDREP8 promoter fragment obtained above and the pCAMBIA1304 plasmid skeleton fragment of the 35S promoter (HindIII and NcoI double enzyme cutting) for cutting and regulating GUS gene expression are connected, and AMDREP8 is used for replacing the 35S promoter, so that a recombinant vector for regulating GUS gene expression by AMDREP8 is constructed, and the recombinant vector is shown in figure 1. Then, E.coli is transformed, positive clone sequencing is selected, and accuracy is proved.

Wherein, the connection conditions are as follows:

10. Mu.L of T/A ligation system comprising:

pCAMBIA1304 Vector 1. Mu.L, 10 XT 4 DNALigase Buffer 1. Mu. L, AMDREP8 promoter fragment 7.5. Mu.L and T4 DNALigase (TaKa Ra, D2011A) 0.5. Mu.L.

And (3) connecting at 16 ℃ overnight to obtain the pCAMBIA1304-AMDREP8 recombinant vector. The product after the connection is transformed into escherichia coli according to the following method:

the competent cells 100 mu LDH5α (Shanghai Wei, DL 1001) prepared according to the calcium chloride method shown in the molecular cloning experiment guide (third edition, scientific Press) were taken out in a refrigerator, after melting on ice, 10 mu L of the ligation product obtained as above, namely pCAMBIA1304-AMDREP8 recombinant vector, was gently stirred, ice-bath was carried out for 30min, heat-shock at 42℃for 90s, ice-bath was carried out for 3min, 600 mu L of LB medium precooled at 4℃was added (specific formulation details were found in the molecular cloning experiment guide (third edition, scientific Press), 60min was resuscitated at 37℃for 200rpm, centrifugation was carried out at 800 rpm for 30s, 200 mu L of supernatant was left, the mixture after precipitation was resuspended with the remaining 200 mu L of supernatant, and gently blown up, and the coated bars were coated with LB (kanamycin) plates (specific formulation details were found in the molecular cloning experiment guide (third edition, scientific press) were cultured for 12h to 18h in an inverted state at 37 ℃. Recombinant E.coli, designated DH 5. Alpha. -PAMDREP8, containing the pCAMBIA1304-AMDREP8 cloning vector was obtained. The Shenzhen large gene technology Co., ltd, sequences AMDREP8 in the pCAMBIA1304-AMDREP8 cloning vector, and the sequencing result is shown as SEQ ID NO: 1.

Sequencing results show that the AMDREP8 promoter sequence in the obtained pCAMBIA1304-AMDREP8 cloning vector is correct.

EXAMPLE 3 preparation of recombinant Agrobacterium tumefaciens pCAMBIA1304-AMDREP8 cells

Single colony of recombinant E.coli DH5 alpha-PAMDREP 8 was picked up and grown to OD by shaking in liquid LB medium containing 50. Mu.g/mL kanamycin at 37℃and 200rpm ₆₀₀ About 0.5, and competent cells of E.coli HB101 and recipient Agrobacterium LBA4404 containing helper plasmid pRK2013 were mixed together in equal volumes, spread on LB medium plates without any antibiotic solid with a spreading bar, and cultured overnight at 28 ℃. The grown colonies were transferred to a solid LB medium plate containing 50. Mu.g/mL kanamycin and 100. Mu.g/mL rifampicin with an inoculating needle, and cultured at 28℃for 3-4 days. Single colonies were transferred again to solid LB medium plates containing 50. Mu.g/mL kanamycin and 100. Mu.g/mL rifampicin, single colonies were picked and shaken with LB liquid medium containing 50. Mu.g/mL kanamycin and 100. Mu.g/mL rifampicin, colony PCR was verified with primers on AMDREP8F, AMDREP R at 37℃200rpm, and plasmids were extracted and double digested with HindIII and Nco I restriction enzymes. The band is about 150bp, namely the recombinant Agrobacterium tumefaciens LBA4404-AMDREP8 cell.

Example 4

Recombinant agrobacterium tumefaciens mediated transformation of three-stage tobacco from cumic spots:

1) Three-stage smoke-producing aseptic seedling

Seed of three-stage tobacco with dead spots (Nicotiana tabacum var. Samsunnn.) was loaded into a 1.5mL centrifuge tube (< 50 particles/tube), and 1mL ddH was added ₂ O, soaking in a refrigerator at 4 ℃ for 2 to 3 days to carry out vernalization.

Vernalized three-smoke seed is sucked out ddH by a pipette gun ₂ O, soaking in 1mL of 75% absolute ethanol for 2min, sucking out absolute ethanol with a pipette, and using ddH ₂ Repeatedly washing O for 3-5 times, cleaning seed, and applying ddH each time ₂ O1 mL. Soaking the seeds in 3% sodium hypochlorite solution with a pipette for 3min, and adding ddH ₂ O-washing 3-5 times, and finally sucking ddH out by using a pipette ₂ O。

The surface of the seeds was dried by sucking the water from the sterile filter paper, and then the three-stage tobacco seeds were inoculated on a plate of MS solid medium (formula shown in Table 2) by a suction head for germination, 10-20 of each plate was cultured in a 26℃light incubator (16 h light for 8h dark) for one week at an illumination intensity of 2000lx (all light cultures of the present invention were performed at this illumination intensity). After the seedlings of the three-growing cigarettes grow out, the three-growing cigarettes are transferred into tissue culture bottles filled with fresh MS solid culture medium, 1 plant of tobacco seedling is cultured in each bottle (phi 6cm, H11 cm,50mL culture medium/bottle) in a 26-DEG C illumination incubator (16 h light 8h dark) for 3-5 weeks, and the three-growing-cigarette aseptic seedlings are obtained.

Cutting off leaves and roots of the three-smoke aseptic seedling, cutting stems into small sections with axillary buds, wherein each section is about 2-3cm long, clamping the lower morphological end of each section by using gun forceps, and vertically inserting the lower morphological end of each section into a tissue culture bottle containing fresh MS solid culture medium. Each bottle is inoculated with a stem segment with axillary buds, and the culture is carried out at 26 ℃ for 3-5 weeks under illumination, thus obtaining the material to be transformed.

2) Preparation of infectious microbe liquid

Recombinant Agrobacterium tumefaciens LBA4404-AMDREP8 was picked as a single colony and transferred to LB liquid medium containing 50. Mu.g/mL kanamycin and 100. Mu.g/mL rifampicin for shaking, 200rpm shaking at 28℃overnight. A small amount of the bacterial liquid was pipetted into 30 volumes of LB liquid medium containing 50. Mu.g/mL kanamycin and 100. Mu.g/mL rifampicin, and the same conditions were followed by shaking again. Culturing to OD ₆₀₀ 0.6 to 0.8, namely the infectious microbe liquid.

3) Infestation of the human body

Cutting larger leaf from sterile three-raw tobacco seedling cultured for 3-5 weeks, and filling with small ddH ₂ O in sterile petri dishes.

Cutting tobacco leaf into leaf disk with a hole punch with diameter of about 1cm, or cutting tobacco leaf into leaf disk with a sterile scalpel and cutting into approximately square shape with side length of about 1cm, and placing into another leaf disk with a small ddH ₂ O in sterile petri dishes.

The tobacco leaf disc is clamped out by gun forceps and placed into a sterile 50mL centrifuge tube filled with a proper amount of infectious microbe liquid. The centrifuge tube was gently shaken to ensure that the Agrobacterium was in full contact with the wound at the edge of the leaf disk, and soaked for 10-25min, during which time shaking was continued several times. Taking out the tobacco leaf disc, transferring to dry sterile filter paper, and sucking the bacterial liquid. Transfer to MS solid medium plates without any antibiotics, containing 1.0 mg/L6-BA and 0.1mg/L NAA, leaf surface up, 4-10 leaf discs were inoculated per dish, and dark culture at 26℃for 2 days.

4) Screening

The dark culture-finished tobacco leaf discs were transferred to MS solid medium plates containing 12.5. Mu.g/mL hygromycin B and 1.0 mg/L6-BA, 0.1mg/LNAA and 300. Mu.g/mL timentin, and incubated at 26℃with light.

After 2-4 days of culture, leaf discs without whitening were taken for GUS staining. After dyeing overnight at 37 ℃, decoloring with 75% ethanol solution for three times, removing chlorophyll completely, and photographing. As a result, as shown in FIG. 2, the three-raw tobacco leaf disks transformed by the recombinant Agrobacterium tumefaciens mediated transformation of the recombinant vector pCAMBIA1304-AMDREP8 containing the promoter AMDREP8 were blue-colored by GUS, while the wild-type tobacco leaf disks without the recombinant vector pCAMBIA1304-AMDREP8 were not discolored by GUS. The result shows that the AMDREP8 promoter has a regulation and control effect on GUS genes in dicotyledonous mode plant three-generation cigarettes.

Expression of GUS gene in transgenic tobacco:

and (5) taking part of the transformed three-raw tobacco leaves, continuing to carry out illumination culture for about two weeks, and carrying out subculture for about four weeks, wherein cluster buds appear. When the cluster buds grow to 1-2cm, they are excised with a sterilized scalpel and inoculated into 1/2MS medium containing 12.5. Mu.g/mL hygromycin B and 300. Mu.g/mL timentin, 1 strain per bottle. The cells were incubated at 26℃for about 2 weeks with light. Taking tobacco seedlings with good rooting condition, opening the cover of the tissue culture bottle in an incubator, and hardening the seedlings for 2-3 days.

Most of the leaves of the transgenic tobacco seedlings are cut off, most of the culture medium at the roots is carefully washed off, the transgenic tobacco seedlings are transplanted into sterilized soil, potting is carried out, and the whole process of the formation of the transgenic tobacco plants is shown in figure 3. Growing for about 2-3 weeks, taking out the new leaf extracted DNA, and carrying out PCR amplification verification. The amplification primer is AMDREP8F, AMDREP R. The amplified products were subjected to 1% agarose electrophoresis, and the result was shown in FIG. 4, which gave a band of about 150bp, consistent with the size of AMDREP8, and no band was observed for the positive control of the pCAMBIA1304 empty vector and for the wild-type sterile seedlings of Sansheng smoke.

Example 5

Induction and transformation of young barley leaves:

the young leaves of barley were transformed with recombinant Agrobacterium tumefaciens pCAMBIA1304-AMDREP8, co-cultured for 48 hours and subjected to GUS staining.

1) Cultivation of barley (Zhejiang beer 33) plants

Barley (beer 33) plants were grown in a controlled growth chamber at 25 ℃ (16 h light 8h dark). Tender leaves were obtained 40 days after sowing, cut into She Panhou, and transformed into barley tender leaves for transient expression by the same agrobacterium-mediated method as in example 4 above.

2) Activation of agrobacterium LBA4404-AMDREP8 and preparation of transformed bacterial liquid

Single colonies of recombinant Agrobacterium tumefaciens LBA4404-AMDREP8 were picked and shake-cultured to OD at 28℃at 250rpm in liquid YM/YEP/LB medium containing 50. Mu.g/mL kanamycin and 100. Mu.g/mL rifampicin ₆₀₀ ＝0.8-1.0。

1mL of the cultured bacterial liquid was aspirated, and the mixture was added to 50mL of YM/YEP/LB liquid medium containing 50. Mu.g/mL of kanamycin, and the culture was continued until OD ₆₀₀ =0.8-1.0. Centrifuging at 4 deg.C and 4000rpm, precipitating the bacterial cells, and re-suspending the bacterial liquid to OD with a proper amount of MS ₆₀₀ =0.5 or so, ready for use.

3) Infestation of the human body

Cutting barley leaf into approximately square leaf disk with side length of about 1cm with sterile scalpel, placing into another leaf disk with small ddH ₂ O in sterile petri dishes.

The barley leaf tray is clamped out by gun forceps and placed into a sterile 50mL centrifuge tube filled with a proper amount of infectious microbe liquid. The centrifuge tube was gently shaken to ensure that the Agrobacterium was in full contact with the wound at the edge of the leaf disk, and soaked for 10-25min, during which time shaking was continued several times. Taking out barley leaf disc, transferring to dry sterile filter paper, and sucking to dry bacterial liquid. Transfer to MS solid medium plates without any antibiotics, containing 1.0 mg/L6-BA and 0.1mg/L NAA, leaf surface up, 4-10 leaf discs were inoculated per dish, and dark culture at 26℃for 2 days.

4) Screening

The dark-cultured barley leaf discs were transferred to MS solid medium plates containing 12.5. Mu.g/mL hygromycin B and 1.0 mg/L6-BA, 0.1mg/LNAA and 300. Mu.g/mL timentin, and incubated at 26℃with light.

Expression of GUS gene in young leaves of barley (Zhejiang beer 33):

barley leaf discs transformed with LBA4404-AMDREP8 were GUS stained. After 2-4 days of culture, leaf discs without whitening were taken for GUS staining. After dyeing overnight at 37 ℃, decoloring with 75% ethanol solution for three times, removing chlorophyll completely, and photographing. As a result, as shown in FIG. 5, the barley leaf discs transformed with recombinant Agrobacterium tumefaciens mediated transformation with the recombinant vector pCAMBIA1304-AMDREP8 containing the promoter AMDREP8 became blue after GUS staining. The color of the wild barley leaf disk without the recombinant vector pCAMBIA1304-AMDREP8 subjected to agrobacterium tumefaciens-mediated transformation is unchanged after GUS staining. The results show that the AMDREP8 promoter has a regulatory expression effect on GUS genes in monocot barley.

The above embodiments are only illustrative of the preferred embodiments of the present invention and are not intended to limit the scope of the present invention, and various modifications and improvements made by those skilled in the art to the technical solutions of the present invention should fall within the protection scope defined by the claims of the present invention without departing from the design spirit of the present invention.

Claims (10)

1. An endogenous promoter amadrep 8 of avicennia marina, wherein the nucleotide sequence of the endogenous promoter amadrep 8 is any one of the following:

(1) As set forth in SEQ ID NO:1, a sequence shown in seq id no;

(2) And SEQ ID NO:1 and has at least 70% homology and the same function;

(3) SEQ ID NO:1, and a sequence having one or more bases added, substituted, inserted or deleted in the sequence shown in 1 and having the same function.

2. A recombinant vector comprising the endogenous promoter amdropep 8 of claim 1.

3. A host cell comprising the recombinant vector of claim 2.

4. Use of the endogenous promoter amdrpep 8 according to claim 1 or the recombinant vector according to claim 2 or the host cell according to claim 3 for promoting expression of exogenous genes in plants.

5. The use according to claim 4, wherein the plants comprise avicennia, tobacco and barley.

6. The use according to claim 4, wherein the exogenous gene comprises a GUS gene.

7. Use of the endogenous promoter amdre 8 according to claim 1 or the recombinant vector according to claim 2 or the host cell according to claim 3 for the cultivation of transgenic plants.

8. A method of growing transgenic plants using the endogenous promoter amdropep 8 of claim 1, comprising: and connecting an exogenous gene to the downstream of the endogenous promoter AMDREP8, transferring the exogenous gene into plants, and screening plants specifically expressing the exogenous gene, namely transgenic plants.

9. The method of claim 8, wherein the plant comprises a dicotyledonous plant and a monocotyledonous plant.

10. The method of claim 8, wherein the exogenous gene comprises a GUS gene.