CN115807010B

CN115807010B - Honeysuckle leaf glandular hair-growing gene and application thereof

Info

Publication number: CN115807010B
Application number: CN202310030649.7A
Authority: CN
Inventors: 辛华; 王庆佳; 安慧玥; 刘汉柱
Original assignee: Qingdao Agricultural University
Current assignee: Qingdao Agricultural University
Priority date: 2023-01-10
Filing date: 2023-01-10
Publication date: 2024-04-05
Anticipated expiration: 2043-01-10
Also published as: CN115807010A

Abstract

The invention discloses a lonicera japonica leaf glandular hair-growing gene and application thereof, and belongs to the technical field of genetic engineering. The LjMYB16 gene provided by the invention has a nucleic acid sequence shown in SEQ ID NO. 1, can regulate and control the development of multi-cell glandular hair of the honeysuckle, increases the surface gland Mao Midu of the honeysuckle and then increases the content of secondary metabolites, thereby providing support for innovation of medicinal germplasm resources and providing gene resources for subsequent metabolic engineering.

Description

Honeysuckle leaf glandular hair-growing gene and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a lonicera japonica leaf glandular hair-growing gene and application thereof.

Background

The honeysuckle is a plant rich in glandular wool, is a traditional Chinese medicinal material and has wide application. The flower is called honeysuckle, the branch is called honeysuckle stem, has good curative effect (Wang et al 2020;Shang et al,2011) on treating cold, headache, fever and rash, has good inhibition effect on influenza virus, and plays an important role in both new crown and atypical stage. The main active components of honeysuckle are chlorogenic acid and luteolin, and the existence of the two components is detected in glandular wool (Duan Huifang. The production quality standard research of honeysuckle, a raw material medicine of a Reduning injection [ D ]. Nanjing university of Chinese medicine, 2020.), which shows that the number of glandular wool has a certain relation with the medicinal quality of the honeysuckle.

In recent years, with the deep research of glandular hairs and secretion substances thereof, the research of molecular mechanisms of glandular hair growth has also been advanced. Mainly around the initiation and morphogenesis of plant glandular hairs such as tomatoes, artemisia annua and the like. Studies have shown that genes regulating glandular hair initiation in tomato and artemisia annua are mostly assigned to two subfamilies, R2R3-MYB and HD-ZIP IV (Chalvin et al 2009). SlMX1 as a member of the R2R3-MYB family, overexpression of SlMX1 in tomato increased glandular wool density (Ewas et al 2016). The density of the type I glandular hairs of tomatoes can be regulated by the SlWo, the density of the type I glandular hairs is obviously reduced after the expression of the SlWo is inhibited, the density of the type I glandular hairs is obviously increased by the overexpression of the SlWo, and the density of the glandular hairs on the surfaces of tobacco leaves is also obviously increased when the SlWo is overexpressed in tobacco (Yang, li et al 2011). In Artemisia annua, overexpression of AaHD1 or AaHD8 can significantly increase the density of glandular hairs (Yan et al 2016). The over-expression of AaMYB1 can also improve the glandular hair density, and the GC-MS experimental result shows that the content of artemisinin is also obviously improved (Soetaert S et al), and the over-expression or knockout of AaMIXTA1 respectively leads to the increase or decrease of the glandular hair number and the artemisinin content of leaves of transgenic artemisia annua plants (Shi et al 2018). These results all demonstrate that the content of the medicinal ingredient can be increased by increasing the density of glandular hairs.

According to the invention, the stem leaves of the honeysuckle are used as experimental materials, and the possible regulatory genes in the glandular hair MYB family of the stem leaves are researched and analyzed, so that the purpose of excavating the glandular hair-growing genes of the honeysuckle leaves is achieved, further basis is provided for researching the molecular regulatory mechanism of glandular hair-growing, and a foundation is laid for improving the pharmaceutical quality of the honeysuckle.

Disclosure of Invention

The invention aims to provide a gene for regulating and controlling the growth of multi-cell glandular hair of honeysuckle, which is transformed into a honeysuckle plant body, so as to increase the surface gland Mao Midu of the honeysuckle and then increase the content of secondary metabolites, thereby providing support for innovation of medicinal germplasm resources and providing gene resources for subsequent metabolic engineering.

The technical scheme of the invention is as follows:

the invention provides a lonicera japonica leaf glandular hair-growing gene LjMYB16, the nucleic acid sequence of which is shown as SEQ ID NO. 1. The gene is proved to be capable of regulating and controlling the growth of the multi-cell glandular hair of the honeysuckle and increasing the density of the glandular hair on the surface of the honeysuckle.

The invention provides a primer group for amplifying the LjMYB16 gene, and the nucleic acid sequences of the primer group are shown as SEQ ID NO. 2 and SEQ ID NO. 3.

The invention provides application of the LjMYB16 gene in regulation and control of lonicera japonica glandular hair development.

The invention also provides a recombinant expression vector, an expression cassette, a transgenic cell line, recombinant bacteria or recombinant viruses containing the LjMYB16 gene.

A method for improving the surface glandular hair density of honeysuckle is to construct the LjMYB16 gene into an expression vector to form a recombinant expression vector, then to transform the recombinant expression vector into the honeysuckle, and finally to regulate and control the glandular hair growth of the honeysuckle and improve the surface glandular hair density of the honeysuckle through the overexpression of the LjMYB16 gene. The method can finally obtain the transgenic honeysuckle with the surface glandular wool density larger than that of the wild type.

The recombinant expression vector comprises LjMYB16 genes and the following cloning vectors, but is not limited to the following vectors: binary agrobacterium vector and vector for plant microprojectile bombardment; such as pROKII, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Co.), etc.;

the recombinant expression vector may also comprise the 3' -untranslated region of a foreign gene, i.e., a poly-A signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can guide the addition of polyadenylation to the 3 'end of the mRNA precursor, and the untranslated regions transcribed from the 3' end of, for example, the Agrobacterium tumefaciens induction (Ti) plasmid gene (e.g., nopaline synthase Nos gene) and plant gene (e.g., soybean storage protein gene) all have similar functions;

when the LjMYB16 gene is used for constructing a recombinant expression vector, any one of enhanced promoters such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin promoter (Ubiquitin) of corn and constitutive promoter can be added before transcription initiation nucleotide; or tissue-specific expression promoters, such as promoters for seed-specific expression; or an inducible promoter; they may be used alone or in combination with other plant promoters;

in addition, when the aforementioned LjMYB16 gene is used to construct a recombinant expression vector, enhancers including translational enhancers or transcriptional enhancers may be used, and these enhancers may be ATG initiation codon or adjacent region initiation codon, etc., but must be identical to the reading frame of the coding sequence to ensure proper translation of the entire sequence;

the sources of the translation control signals and initiation codons are broad, and can be natural or synthetic; the translation initiation region may be derived from a transcription initiation region or a structural gene; to facilitate identification and selection of transgenic plant cells or plants, the plant expression vectors used may be processed, for example by adding genes encoding enzymes or luminescent compounds which produce a color change (selected marker genes such as GUS genes, luciferase genes, etc.), antibiotic marker genes (such as nptII genes conferring resistance to kanamycin and related antibiotics, bar genes conferring resistance to the herbicide phosphinothricin, hph genes conferring resistance to the antibiotic hygromycin, dhfr genes conferring resistance to methtrexa, EPSPS genes conferring resistance to glyphosate) or chemical reagent marker genes, etc. (such as herbicide resistance genes), mannose-6-phosphate isomerase genes providing the ability to metabolize mannose. If safety of transgenic plants is concerned, transformed plants can be screened directly for phenotypic traits without adding any selectable marker gene.

The plant expression vector carrying the LjMYB16 gene of the present invention may be obtained by transforming plant cells or tissues by using Ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction, agrobacterium-mediated transformation, etc. conventional biological methods, and cultivating the transformed plant tissues into plants.

The Agrobacterium may be selected from Agrobacterium tumefaciens (e.g., GV3101, LBA4404, and EHA 105), agrobacterium rhizogenes, and the like.

The beneficial effects of the invention are as follows:

the LjMYB16 gene provided by the invention can regulate and control the development of multi-cell glandular hair of the honeysuckle, increase the surface gland Mao Midu of the honeysuckle and then increase the content of secondary metabolites, thereby providing support for the innovation of the germplasm resource of the medicinal use and providing gene resources for the subsequent metabolic engineering.

Drawings

FIG. 1 shows the relative expression levels of the genes related to glandular hair growth in honeysuckle leaves, wherein the first pair of leaves, the second pair of leaves, the third pair of leaves and the fourth pair of leaves are arranged in sequence from left to right;

FIG. 2 shows the relative expression levels of the genes related to glandular hair-growth in honeysuckle stems, wherein the first pair of stems, the second pair of stems and the third pair of stems are arranged in sequence from left to right;

FIG. 3 shows the relative expression level of the genes related to the middle-gland hair-growth of honeysuckle, which are sequentially from left to right in the small young bud stage, three green stage, large white stage and silver stage;

FIG. 4 is a growth of transgenic tobacco leaves on the medium; wherein, the A graph shows that tobacco leaves grow for about 25 days on a differentiation induction medium; panel B shows tobacco leaves grown on shoot proliferation medium for about 25 days; panel C shows resistant shoots inoculated onto rooting medium; panel D shows resistant shoots inoculated onto rooting medium for 25D;

FIG. 5 shows the results of qRT-PCR analysis of transgenic tobacco;

FIG. 6 is a transgenic tobacco leaf phenotype observation; wherein, the A diagram is transgenic tobacco over-expressed by Super1300 empty vector, and the B diagram is transgenic tobacco over-expressed by Super1300-LjMYB 16;

FIG. 7 is a graph showing the results of transgenic tobacco leaf glandular hair density;

FIG. 8 shows the relative expression levels of the honeysuckle young leaf genes after gene silencing by qRT-PCR analysis;

FIG. 9 is a phenotypic observation of honeysuckle leaves after VIGS silencing associated genes; wherein, panel A is a phenotype without gene silencing and panel B is a phenotype after gene silencing;

FIG. 10 shows glandular hair density on the surface of honeysuckle leaves after VIGS silencing treatment.

Detailed Description

The test materials used in the invention are as follows:

coli DH 5. Alpha. Was maintained by the Qingdao university plant development and genetic laboratory; agrobacterium tumefaciens strain EHA105 was purchased from Beijing Tian Enze Gene technologies Co., ltd; the transgenic acceptor material is a tobacco wild variety and is provided by a plant development and genetic research laboratory of Qingdao agricultural university.

Other terms used herein, unless otherwise indicated, generally have meanings commonly understood by those of ordinary skill in the art. The invention will be described in further detail below in connection with specific embodiments and with reference to the data. The following examples are intended to illustrate the invention and are not intended to limit the scope of the invention in any way.

Example 1

Preliminary identification of the glandular hair-growing gene is as follows:

1. cloning of related genes for regulating and controlling multi-cell glandular hair development of honeysuckle

The genomic DNA of honeysuckle is used as a template, and the primers P1 and P2 are adopted to amplify and control the relevant genes of the multi-cell glandular hair breeding of the honeysuckle, and the genes are named as LjMYB16.

LjMYB16 Gene sequence:

5'-ATGGGGAGATCTCCATGCTGTGACAAAGTGGGCTTAAAGAAAGGGCCATGGACC CCTGAAGAAGATCACAAACTCTTAGCCTACATCGAAGAACACGGCCATGGCAGCTGGCGCGCCTTGCCCTCTAGAGCTGGTCTTCAAAGATGTGGAAAGAGTTGTAGACTGAGGTGGACTAATTACCTTAGACCTGATATTAAGAGAGGAAAGTTTAGTTTGCAAGAAGAACAAACCATCATTCAACTCCATGCTCTCTTAGGCAACAGGTGGTCGGCTATAGCCACTCACTTGCCCAAAAGAACAGACAATGAGATCAAGAACTACTGGAATACGCATCTTAAAAAAAGACTGGCCAAAATGGGGATTGACCCTCTTACCCACAAGCCCAAAAACGATGCTATCTTGTCATCGAGCAACGATGGTCAATCCAAGAATTCAGCAAACCTTAGCCACATGGCTCAGTGGGAAAGTGCCCGCCTCGAAGCCGAAGCAAGGTTGGTTAGGCAATCAAAGCTACGCGGTGGTTCAAATCCGCTCCCCCACCAGCTCGGCTCGCCAGAGTTTGCGCCCCCACTATGCCTCGACATACTAAAATCTTGGAATGGTTCGTGGAGTAATCCACCTGAAGCTAGGGGTAGAGGTGGTGGTCCGGTGGCACTGATTGGTGTTGACCTAGAGTCACCCACCTCTACCCTTAGCTACTCAGACAATGGGCCGCCAATCACTGCCACCAGGATGGGAGAAAGCTCCACGAATTTTATTGACTTCGTTAGCAATTCAGGTTCGTGCGAAGATGGGATGATGAAAGAAGAAGGTGAAGGAGATTGGAAGGGACTTGAAAAATACAATGACGAGCATGTTCCTAGTGGGAATTTTGTCGAGACGTTCACAGACCTTTTACTAAATAAATCTGGTGACCGGAGTTTCTCTGAGGATGGTGGAGAATCAGATGTTGGTGACGGCAGTGGACCCAGTATTGGCGGCGGCGGTGGTGATTACTACGAAGATAACAAGAATTACTGGAATAGCATTCTTAATTTGGTGAGTTCTTCACCTTCTGATTCGCCCGTGTTCTAA-3'(SEQ ID NO:1)

the sequences of primers P1, P2 are as follows:

P1:5'-ATACACCAAATCGACTCTAGAATGGGGAGATCTCCATGCTGT-3'(SEQ ID NO:2)

P2:5'-GCCCTTGCTCACCATGGTACCTTAGAACACGGGCGAATCAGA-3'(SEQ ID

NO:3)

2. expression of LjMYB16 gene in different parts of honeysuckle

The analysis of gene expression level selects three tissues of stem, leaf and flower respectively in different periods:

and (4) respectively taking a first pair of leaves, a second pair of leaves, a third pair of leaves and a fourth pair of leaves from the top end of the honeysuckle branch, quickly freezing with liquid nitrogen, and storing at the temperature of minus 80 ℃. Taking the honeysuckle branches, respectively taking a first stem section, a second stem section and a third stem section from the top end downwards, quick-freezing with liquid nitrogen, and storing at-80 ℃. Respectively taking flower buds of North flowers No. 1, jiufeng No. one, in small bud stage (0.1 cm), in bud stage (0.5 cm), in three green stage (1.0 cm), in white stage (3 cm) and in silver stage (5 cm), quick freezing with liquid nitrogen, and storing at-80deg.C.

RNA extraction was performed according to Accurate Biotechnology (huntan) co. The extracted total RNA was treated with DNaseI and purified.

The samples were reacted on an ABI 7500FAST fluorescent quantitative PCR instrument. The 20. Mu.L reaction system comprises: 10. Mu.L of 2X SybrGreen qPCR Master Mix, 20. Mu. Mol/L of forward and reverse primers each 0.25. Mu.L, 20ng of reverse transcription product. The amplification procedure was: firstly, pre-denaturing for 2min at 94 ℃; then 40 circulation reactions are carried out, denaturation at 94 ℃ for 30s, renaturation at 58 ℃ for 30s and extension at 72 ℃ for 30s are carried out in each circulation; after the cycle was completed, the temperature was slowly raised to 94℃to prepare a melting curve. 3 duplicate wells were set for each reaction.

The LjMYB16 gene quantitative PCR primer is as follows:

forward primer: 5'-AGAGTCACCCACCTCTACCC-3' (SEQ ID NO: 4)

Reverse primer: 5'-TTCGCACGAACCTGAATTGC-3' (SEQ ID NO: 5)

The forward and reverse primer sequences of the internal standard gene action are as follows:

forward primer: 5'-CCCTAAAGCCAACAGAGAGAAG-3' (SEQ ID NO: 6)

Reverse primer: 5'-CGACCACTAGCATACAGAGAAAG-3' (SEQ ID NO: 7)

The expression results are shown in FIGS. 1 to 3:

the relative expression level of LjMYB16 gene decreases along with the maturation of the leaf, and is consistent with the general trend of the variation of the number of glandular hairs on the leaf of different sections, as shown in figure 1; the relative expression amount of LjMYB16 gene shows a trend of increasing and then decreasing along with the maturity of the stem, which is consistent with the overall trend of the variation of the number of glandular hairs on the stems of different knots, as shown in figure 2; the relative expression level of LjMYB16 gene shows a trend of increasing and then decreasing in North flower No. (BH) with the maturation of flower buds, and shows a decreasing trend in Jiufeng No. (JF), as shown in FIG. 3; preliminary, it was shown that this gene was positively correlated with the supralobe gland Mao Fayo and was therefore highly likely a positive regulatory gene for glandular hair growth.

Example 2

Tobacco conversion tests were as follows:

1. construction of LjMYB16 Gene plant expression vector

The genomic DNA of the honeysuckle leaves is used as a template, and the primers P1 and P2 are used as upstream and downstream primers for amplification. KpnI and Xbal cleavage sites were added to the upstream and downstream primers, respectively, during amplification.

The PCR product was recovered and ligated with cloning vector GFP (from TaKaRa) by T4 DNA ligase, and the ligation product was transformed into E.coli DH 5. Alpha. To obtain ampicillin-resistant colonies. The recombinant plasmid is extracted, double enzyme digestion is carried out by KpnI and XbaI, enzyme digestion fragments containing LjMYB16 genes are recovered, and cloned into corresponding enzyme digestion sites of a plant expression vector Super1300, so that the plant expression vector Super1300-LjMYB16 of the genes is obtained.

2. Transformation of tobacco with expression vectors

41.67g of MS solid was dissolved in 1000mL of distilled water, and sterilized in an autoclave at 115℃for 15 minutes together with warm water, a flask, filter paper, toothpick, etc. Placing the solution mixed with 900 mu L of sterilized warm water and 100 mu L of sodium hypochlorite in a sterile environment, adding the solution into a centrifuge tube with the smoke seeds, and oscillating for 1h in an oscillating box at 37 ℃ at the rotating speed of 200 rpm; washing tobacco seeds with sterilized Tween water for 2min, and washing for 6 times; washing the washed tobacco seeds on filter paper by using sterilized distilled water, drying the tobacco seeds, putting the tobacco seeds in MS culture bottles after the tobacco seeds are dried, dibbling 3-4 tobacco seeds in each bottle, carrying out dark treatment for 3d at the temperature of 4 ℃, then putting the tobacco seeds into an illumination incubator for culturing for about 15d, and starting leaf cutting after two true leaves grow out.

Tobacco leaves in the flask were cut to a size of 6mm by 6mm and placed on MS solid medium and cultured for 1d. Expanding and shaking two types of agrobacterium which are recombinant plasmid Super1300-LjMYB16 agrobacterium and Super1300 empty vector agrobacterium and are preserved at the temperature of minus 80 ℃, respectively adding the bacterial liquid into a 50mL sterilizing centrifuge tube according to the proportion of 1:15 to activate the bacterial liquid for the second time to OD ₆₀₀ 0.4-0.6. After centrifugation at 4000rpm for 5min, the supernatant was decanted and resuspended to OD with an equal volume of MS+ (100. Mu.M) AS broth ₆₀₀ Is 0.4-0.6 for standby.

And (3) placing the pre-prepared tobacco in a triangular bottle with the dye liquor, and carrying out infection for 5-10 min. Inoculating the infected leaf explant on a co-culture solid medium, and performing inverted dark culture at 28 ℃ for 2-3 d until white transparent colonies appear at the edge of the leaf. Placing the co-cultured explant into a triangular flask with sterile water, washing for 2-3 times, placing on water absorbing paper to absorb excessive water, spreading on tobacco differentiation medium, and repeating every 15 d. After the explant is transformed into resistant buds, the explant is transferred into bud proliferation medium for continuous culture. When the resistant buds grow to about 3-5 cm, cutting off the resistant buds and inserting the resistant buds into a rooting culture medium for culture. And after rooting is completed, taking out the seedlings, washing off redundant culture medium on the roots, transplanting the seedlings into soil, covering the soil with a preservative film, and removing the preservative film after 1 week. From induction of differentiation to the acquisition of resistant shoots, as shown in FIG. 4.

3. Identification of transgenic tobacco

The resulting Super1300 empty vector and Super1300-LjMYB16 overexpressing plants (three biological replicates, i.e., three transgenic lines) were each taken 100mg of leaf per pot to extract DNA. The DNA extraction method was referred to Rapid Plant Genomic DNA Isolation Kit genome extraction kit (bio). Taking 1 mu L of DNA of the obtained transgenic tobacco as a template, and carrying out PCR amplification by using Super1300F/R as a primer, wherein the amplification method is the same as the colony PCR identification method.

The primer sequences are shown below:

F：5'-ACGACTTTTGAATAGATACGCTGAC-3'(SEQ ID NO:8)

R：5'-CCTTGAAGAAGATGGTGCG-3'(SEQ ID NO:9)

4. analysis of expression level of tobacco over-expressing Super1300-LjMYB16 gene

Taking transgenic tobacco with correct identification strips, using Super1300 empty vector tobacco as a control, analyzing the expression difference of the LjMYB16 gene-transferred tobacco and the Super1300 empty vector tobacco by using a fluorescent quantitative PCR technology, and using an action F/R as an internal reference to identify a transgenic strain with increased gene expression quantity.

The results of the expression level analysis are shown in FIG. 5:

the expression level of the LjMYB16 gene in tobacco leaves over-expressed the gene was greatly increased to a different extent than the blank.

5. Phenotypic observation of tobacco over-expressing LjMYB16 Gene

And (3) placing the Super1300 empty vector and the transgenic tobacco over-expressed by the Super1300-LjMYB16 into a photoperiod environment at 22 ℃ for 16h/8h for growth, collecting seeds for T2-generation cultivation after the T1 generation is mature, and observing the phenotype of tobacco leaves and counting the distribution and density of glandular hairs.

Transgenic tobacco leaf phenotype observations are shown in fig. 6 and 7:

the glandular hairs at the leaf edges of the leaves transformed with the empty vector are sparsely distributed (fig. 6A), while the glandular hairs on the surface of the transgenic tobacco are obviously increased (fig. 6B), and the glandular hairs on the upper surface of the transgenic tobacco are 2.66 times that of the glandular hairs transformed with the empty vector (fig. 7).

Example 3

The honeysuckle gene silencing test is as follows:

1. construction of TRV2-LjMYB16 vector

LjMYB16 gene sequence is analyzed according to website [ SGN-VIGS (solgenomics. Net) ] and corresponding VIGS special fragment is designed to obtain a characteristic sequence of LjMYB16 gene, wherein the length is 300bp, and the characteristic sequence is as follows:

5'-TCTTAAAAAAAGACTGGCCAAAATGGGGATTGACCCTCTTACCCACAAGCCCAAAAACGATGCTATCTTGTCATCGAGCAACGATGGTCAATCCAAGAATTCAGCAAACCTTAGCCACATGGCTCAGTGGGAAAGTGCCCGCCTCGAAGCCGAAGCAAGGTTGGTTAGGCAATCAAAGCTACGCGGTGGTTCAAATCCGCTCCCCCACCAGCTCGGCTCGCCAGAGTTTGCGCCCCCACTATGCCTCGACATACTAAAATCTTGGAATGGTTCGTGGAGTAATCCACCTGAAGCTAGGGG-3'(SEQ ID NO:10)

the primer TRV2-LjMYB 16F/R is designed according to the characteristic sequence, and the primer TRV2-LjMYB 16F/R is shown as follows:

P3：5'-GTGAGTAAGGTTACCGAATTCTCTTAAAAAAAGACTGGCCAAAATG-3'(SEQ ID NO:11)

P4：5'-TCCCCATGGAGGCCTTCTAGACCCCTAGCTTCAGGTGGATTACT-3'(SEQ ID NO:12)

extracting RNA from young leaves of honeysuckle according to the procedure shown in SteadyPure Plant RNA Extraction Kit instruction, and preserving the RNA at-80 ℃.

Reverse transcription was performed according to the procedure shown in the Evo M-MLV RT Mix Kit with gDNA Clean for qPCR kit instruction, and PCR amplification was performed using Prime STAR Max Premix high fidelity enzyme, with the following reaction system:

according toGel DNA Extraction kit (Vazyme) protocol for gel recovery.

The pBI121 vector was digested with QuickCut restriction endonuclease (TaKaRa, dalian), the digestion system was as follows:

reaction components	Volume (mu L)
		Plasmid(s)	7
10×Buffer	1
		EcoR I	1
Xba I	1

After reaction at 37℃for 15min, the mixture was stored at-20 ℃.

According to the specification of homologous recombination enzyme, the amount of target fragments and enzyme digestion vectors required to be added in a recombination connection reaction system is calculated, and the preparation system is as follows:

reaction components	Volume (mu L)
		2×ClonExpress Mix	5
Linearization carrier	a
		Insertion of a Gene fragment of interest	b
ddH ₂ O	Up to 10

Reacting at 50deg.C for 30min, and temporarily storing at 4deg.C.

The E.coli transformation procedure was performed according to DH 5. Alpha. E.coli competent cell (organisms only) instructions.

Recombinant plasmids were extracted by the procedure shown in the FastPure Plasmid Mini Kit (Vazyme, nanjing) specification, competent transformation of Agrobacterium EHA105 was performed by PCR detection after amplification and shaking according to Shanghai Biotechnology Co., ltd, and the correct bacterial solution was subjected to amplification and shaking overnight at 28℃and 180rpm and then preserved at-80 ℃.

2. Infestation of the human body

mu.L of 50mg/L Kan and 10 mu.L of 25mg/L Rif are added to 10mL of LB medium. About 20mL of LB liquid medium is added into a 100mL triangular flask, three kinds of agrobacterium containing empty TRV1 plasmid, empty TRV2 plasmid and TRV2-LjMYB16 recombinant plasmid are respectively added, and the three kinds of agrobacterium are placed into a shaking table at 28 ℃ and 200rpm for shaking overnight. The bacterial liquid of the first amplification is diluted to a reconstituted LB liquid medium in a volume ratio of 1:35, 1mL of 1M MES (final concentration 10 mM), 40 mu L of acetosyringone (final concentration 20 mM), 100 mu L of 100mg/mL Kan, 100 mu L of 100mg/mL Rif are added to each 100mL LB liquid medium, and the bacterial liquid is amplified to OD twice in a 500mL conical flask ₆₀₀ =0.6 to 0.8. The supernatant was discarded by centrifugation at 5000rpm for 10min at normal temperature. The sediment remained after centrifugation is resuspended by using the freshly prepared infection liquid, and the OD is adjusted ₆₀₀ In the range of 1 to 2. Mixing control group (TRV 1/TRV 2), experimental group (TRV 1/TRV2-LjMYB 16) and P19 protective bacteria at a ratio of 1:1:2, and standing in dark for 4-6h. 3 honeysuckle plants with the same growth vigor are taken, tender leaves are sucked and infected by a vacuum pump, the whole branch is immersed in bacterial liquid when sucked and infected, the whole branch is sucked to 0.7 atmosphere from 1 atmosphere, the whole branch is maintained for 5min approximately, and the whole branch is slowly deflated and repeated twice. And after the infection treatment is finished, carrying out dark treatment at room temperature for 7-14 d.

3. Phenotypic observation and qRT-PCR identification

qRT-PCR analysis: extracting total RNA of tender leaves after the LjMYB16 gene is silenced by VIGS, culturing for 14 days normally, reversely transcribing first-strand cDNA, designing qRT-PCR primer, and identifying LjMYB16 gene expression quantity of experimental group by qRT-PCR, wherein the system proportion and reaction condition of each part are referred toGreen Pro Taq HS Premix II.times.1 (AG, hunan) as follows:

the results of the expression level analysis are shown in FIG. 8: after VIGS silencing, the expression levels of LjMYB16 genes in the young leaves of the three transgenic lines (i.e., three biological replicates) were reduced to different extents, indicating that VIGS silencing of the LjMYB1 gene was more efficient.

Phenotypic observation: the density and distribution of the surface glandular hairs of the lonicera japonica leaves after LjMYB16 gene silencing are measured. The phenotypic observations of the VIGS silencing-associated gene honeysuckle leaves are shown in fig. 9 and 10: leaf main vein basal gland hair without gene silencing is denser (fig. 9A); after LjMYB16 gene silencing, the development of the glandular wool of the honeysuckle leaves is changed, the density of the glandular wool on the lower surface of the honeysuckle leaves is obviously reduced (figure 9B), the density of the glandular wool on the upper surface of the honeysuckle leaves is only 6.16 times that of the control, and the density of the glandular wool on the lower surface of the honeysuckle leaves is only 3 times that of the control (figure 10). The result is consistent with the result of the expression quantity of the genes, thereby further indicating that the genes are positive regulation genes for the development of the lonicera japonica thunb glandular hairs.

The above description is only a preferred embodiment of the present invention, and is not intended to limit the invention in any way, and any person skilled in the art may make modifications or alterations to the disclosed technical content to the equivalent embodiments. However, any simple modification, equivalent variation and variation of the above embodiments according to the technical substance of the present invention still fall within the protection scope of the technical solution of the present invention.

Claims

Application of LjMYB16 gene in regulation and control of lonicera glandular hair density; the application is that the density of the surface glandular wool of the honeysuckle is reduced through LjMYB16 gene silencing;

the nucleic acid sequence of the LjMYB16 gene is shown as SEQ ID NO. 1.
2. A method for improving the density of tobacco surface glandular hairs is characterized in that the LjMYB16 gene in claim 1 is constructed into an expression vector to form a recombinant expression vector, then the recombinant expression vector is transformed into tobacco, and finally the development of the tobacco glandular hairs is regulated and controlled through the overexpression of the LjMYB16 gene to improve the density of the tobacco surface glandular hairs.
3. The method according to claim 2, wherein the transformation means is selected from one of the following biological methods: ti plasmid, ri plasmid, plant viral vector, direct DNA transformation, microinjection, electric conduction or Agrobacterium mediation.
4. A method according to claim 3, wherein the agrobacterium is selected from agrobacterium tumefaciens or agrobacterium rhizogenes.