KR101784162B1 - Novel gene promoting early flowering or maturity in plant and use thereof - Google Patents

Abstract

More particularly, the present invention relates to a recombinant vector comprising the nucleotide sequence of SEQ ID NO: 1 or 2, a method for transforming the vector into a plant cell, A method for promoting a flowering period or a mature stage of a plant, a method for producing a transgenic plant promoted to flowering period or mature stage, a method for producing a transgenic plant produced by the above production method, A transgenic plant or a mature stage promoted plant, and seeds thereof.

Description

[0001] The present invention relates to a gene for promoting flowering or maturation of a plant,

More particularly, the present invention relates to a recombinant vector comprising the nucleotide sequence of SEQ ID NO: 1 or 2, which transforms the vector into a plant cell to produce a recombinant vector of SEQ ID NO: 3 A method for promoting the flowering period or mature stage of a plant, a method for producing a transgenic plant promoted to flowering period or mature stage, a method for promoting flowering period or mature stage produced by the above- Transgenic plants and seeds thereof.

In cultivated plants, flowering time is important because it is possible to control the timing of flowering by controlling flowering time. If the flowering time can be controlled, it is possible to harvest at the desired time. For this reason, people in the field of plant biotechnology are trying to control the flowering time by methods of genetic manipulation.

Soybean is a soybean plant that can grow in tropical, subtropical and temperate climates. It contains abundant nutrients such as proteins, carbohydrates, oils, vitamins and minerals, and more than 200 million tons of soybeans are produced annually It is one of the most important crops. Eighteen loci of E1 , E2 , E3 , E4 , E5 , E6 , E7 , E8 and J have been reported to be controlled by genotypes of temperature, The flowering-related gene was found. With the completion of bean standard genome sequencing in 2010, the E1 , E2 , E3 and E4 genes were identified at the molecular level. These genes ( E1 , E2 , E3 , and E4 ) act strongly under long-day conditions, delaying flowering, and vice versa.

Conventional traditional methods are to cultivate soybean varieties suitable for long-latitude long-term conditions by crossing early species (E1E2E3E4) with eulerian species (E1E2E3E4), but it is estimated that it takes about 7 to 10 years to breed varieties through crossing There is a problem.

Virus-induced gene silencing (VIGS) is a reverse genetics tool for analyzing gene functions. It induces gene silencing mechanisms by sequence-specific methods by infecting plants with recombinant viruses containing short sequences of endogenous plant target genes .

Under these circumstances, the inventors of the present invention found out that when the genes affecting the early flowering of soybean were studied using the VIGS system, silencing of specific genes of the plants confirmed that the effect of promoting the flowering or mature stage was excellent, The present inventors have completed the present invention by developing a transgenic soybean cultivar having shortened flowering period or mature stage.

It is an object of the present invention to provide a recombinant VIGS (virus-induced gene silencing) vector derived from soybean yellow commom mosaic virus (SYCMV) for the production of flowering plants or maturation-promoted plants.

It is another object of the present invention to provide a method for promoting the flowering or ripening stage of a plant using the recombinant VIGS vector.

It is another object of the present invention to provide a method for producing a transgenic plant promoted to flowering or mature stage using the recombinant VIGS vector, a transgenic plant produced by the method, and seeds thereof.

In order to solve the above-mentioned problems, the present invention provides a recombinant vector comprising a promoter and a full length SYCMV (soybean yellow commom mosaic virus) nucleic acid sequence, wherein at the 3'-end of the envelope protein coding gene of the full length SYCMV sequence, Or a recombinant VIGS (virus-induced gene silencing) vector into which the nucleotide sequence of SEQ ID NO: 2 is inserted.

The present invention also provides a method for promoting the flowering or maturing phase of a plant, comprising the step of transforming the recombinant VIGS vector into plant cells to inhibit gene expression comprising the nucleotide sequence of SEQ ID NO: 3, which is the target gene of the plant .

The present invention also provides a method for the production of a transgenic or mature-promoted transgenic plant comprising transforming a recombinant VIGS vector into a plant cell.

The present invention also provides a transgenic plant or a mature stage promoted transgenic plant produced by the above production method.

According to a preferred embodiment of the present invention, the plant may be a benthic species.

According to another preferred embodiment of the present invention, the brio variety may be beans.

The present invention also provides a seed of the transgenic plant.

It is possible to provide a novel plant having a shortened production period by developing a transgenic plant inducing early flowering by silencing a specific target gene of a plant using the SYCMV-derived recombinant VIGS vector provided in the present invention. In addition, the early flowering of plants using the SYCMV-derived recombinant VIGS vector of the present invention is effective for the development of various crops such as food, feed, flower, horticulture, energy crops, plant seed industry and agricultural development.

1 is a schematic diagram of a SYCMV-VIGS vector used in the present invention.
Fig. 2 is a graph showing the decrease in the expression level of the corresponding gene through qRT-PCR in each individual in which the flowering-related gene shown in Table 2 is silenced. Here, Mock represents a healthy individual without treatment, SYCMV: empty represents an individual vaccinated with a virus (control), and SYCMV: a flowering-related gene (experimental group).
FIG. 3 is a photograph showing the flowering period and mature stage of a SYCMV-null inoculated individual and a SYCMV-derived recombinant VIGS vector inoculated with a nucleotide sequence of SEQ ID NO: 2 of the present invention.

Hereinafter, the present invention will be described in more detail.

As described above, the conventional traditional method is to cultivate soybean varieties suitable for long-latitude long-term conditions by crossing early maturity (E1E2E3E4) with early maturity (E1E2E3E4), but cultivating breed through crossing is about 7-10 years There is a fatal problem that it takes a long time.

Therefore, the present invention provides a recombinant VIGS vector derived from SYCMV for the production of a plant having a flowering period or a mature stage promoted by using the gene fragment, confirming that the effect of promoting the flowering or mature stage is excellent when silencing a specific target gene of the plant using the VIGS system To solve the above-mentioned problem. Plants transformed with the SYCMV-derived recombinant VIGS vector provided in the present invention induce early flowering because the expression of a specific target gene is silenced in the plant. As a result, a new plant having a shortened production period can be provided. In addition, the early flowering of plants using the SYCMV-derived recombinant VIGS vector of the present invention is effective for the development of various crops such as food, feed, flower, horticulture, energy crops, plant seed industry and agricultural development.

The present invention relates to a promoter comprising a promoter and a full length SYCMV (soybean yellow commom mosaic virus) nucleic acid sequence, wherein a nucleotide sequence of SEQ ID NO: 1 or 2 is inserted at the 3'-end of the envelope protein coding gene And provides a recombinant virus-induced gene silencing (VIGS) vector.

Virus-induced gene silencing (VIGS) is a phenomenon in which expression of an endogenous plant gene of an introduced gene is suppressed by introducing a plant gene into a viral vector and then infecting the plant. It is a type of post-transcriptional gene silencing (PTGS), characterized by post-transcriptional, RNA turnover and nucleotide sequence-specific. Therefore, using VIGS, the function of transgene can be rapidly and easily mass-analyzed.

In the recombinant VIGS vector of the present invention, the promoter is preferably selected from the group consisting of T7 promoter, SP6 promoter, CaMV 35S promoter, actin promoter, ubiquitin promoter, pEMU promoter, MAS promoter or histone promoter And more preferably, it may be a T7 promoter, SP6 promoter or CaMV 35S promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

The recombinant VIGS vector of the present invention may comprise a terminator after the full-length SYCMV sequence. The terminator can be a conventional terminator, such as nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, agrobacterium tumefaciens octopine And the terminator of the Octopine gene, but the present invention is not limited thereto.

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. Recombinant cells can express a gene or a gene fragment that is not found in the natural form of the cell, either in a sense or in an antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used to refer to a DNA fragment (s), nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. The term "carrier" is often used interchangeably with "vector ".

In the SYCMV-derived recombinant VIGS vector of the present invention, the full-length SYCMV nucleic acid sequence is available in a known database, for example, but not limited to, those disclosed in GenBank accession number JF495127. The schematic diagram of the SYCMV-VIGS vector used in the present invention is shown in FIG. 1, and the vector was used from the laboratory of Dr. Kwon Seon Lee of the Korea Research Institute of Bioscience and Biotechnology.

The recombinant VIGS vector of the present invention can be used as a transient expression vector that can be transiently expressed in a plant into which a target gene is introduced and a plant expression vector that can be permanently expressed in a plant into which the target gene is introduced. A preferred example of a plant expression vector is a Ti-plasmid vector which is capable of transferring a so-called T-region to a plant cell when it is present in a suitable host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838.

Binary vectors that can be used for the recombinant VIGS vector of the present invention include the RB (right border) and LB (left border) of T-DNA, which can transform the plant when present together with the Ti plasmid of Agrobacterium tumefaciens (Cat #: 6018-1, Clontech, USA), pBIN19 (Genbank Accession No. U09365), pBI121, pCAMBIA vector, etc., which are frequently used in the art, may be used good.

In the SYCMV-derived recombinant VIGS vector of the present invention, the base sequence inserted at the 3'-end of the coat protein coding gene is a gene fragment complementarily binding to a target gene of the plant to be silenced. In one embodiment of the present invention, a nucleotide sequence of SEQ ID NO: 3, which is a target gene of a plant, is constructed using a virus-induced gene silencing (VIGS) system in which a nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: It was confirmed that the silencing of the constructed gene is more effective in promoting flowering or maturing than silencing other flowering related genes. Specifically, in order to compare the flowering or mature stimulating effect, a VEGS system in which a fragment of E2, E3 or E4 gene known as a flowering-related gene, or a fragment of E2-paralogue or E4-paralogue gene is introduced, E2 (Glyma10g36600), E3 (Glyma19g41210), E4 (Glyma20g22160), E2-paralogue (Glyma20g30980) or E4-paralogue (Glyma10g28170) genes were silenced respectively. These gene fragments can be inserted in the sense or antisense direction at the BsrGI site at the 3 'end of SYCMV.

A total of 12 VIGS constructs were constructed as shown in Table 1, except that the four constructs (the blacks in Table 1) without the target gene inserted were excluded and the eight consensus sequences containing the correct size and the desired gene sequence (Red color in Table 1) was inoculated into the sweetpotato (a kind of a longevity) and examined when the first flower bloomed. As a result, as shown in Table 3, among the plants inoculated with the SYCMV-derived recombinant VIGS vector containing the nucleotide sequence of SEQ ID NO: 2, the plants with the fastest flowering showed shortened flowering on the 13th day than on the control, And confirmed that it accelerated.

In addition, qRT-PCR was performed to confirm reduction of the expression level of target genes in each individual VIGS construct-inoculated individuals. As a result, as shown in Fig. 2, as compared with SYCMV: empty inoculation (control) The recombinant VIGS vector inoculated with the nucleotide sequence of SEQ ID NO: 3 inserted into the recombinant VIGS vector showed a remarkably reduced expression amount of the gene consisting of the nucleotide sequence of SEQ ID NO: 3, which is the target gene of the plant.

Furthermore, the maturation period and the maturation period of SYCMV: empty inoculated (control) and recombinant VIGS vector inoculated with SYSMVV (SEQ ID NO: 2) were examined. As shown in FIG. 3, It was confirmed that the flowering period and ripening period were accelerated and folded faster than the control.

The present invention relates to a promoter comprising a promoter and a full length SYCMV (soybean yellow commom mosaic virus) nucleic acid sequence, wherein a nucleotide sequence of SEQ ID NO: 1 or 2 is inserted at the 3'-end of the envelope protein coding gene Transforming a recombinant VIGS (virus-induced gene silencing) vector into a plant cell to silence the gene consisting of the nucleotide sequence of SEQ ID NO: 3, which is the target gene of the plant, to promote the flowering or mature stage of the plant .

The present invention also provides a method for producing a transgenic plant promoted to flowering period or mature stage, which comprises the step of transforming the recombinant VIGS vector into a plant cell, and a transgenic plant or a mature stage promoted plant produced by the above-mentioned production method do.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. The method is based on the calcium / polyethylene glycol method for protoplasts (Krens et al., 1982, Nature 296: 72-74; Negrutiu et al., 1987, Plant Mol. Biol. 8: 363-373) 1986, Mol. Gen. Genet. 202: 179-185), the use of various plant elements (such as, for example, Shillito et al., 1985, Bio / Technol.3: 1099-1102) (DNA or RNA-coated) particle impact method (Klein et al., 1987, Nature 327: 70), infiltration of plants or Agrobacterium tumefaciens mediated gene transfer by transformation of mature pollen or micro- Virus infection (EP 0 301 316), and the like. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EPA 120 516 and U.S. Pat. No. 4,940,838.

"Plant cell" used for transformation of a plant may be any plant cell. Plant cells are cultured cells, cultured tissues, cultivated or whole plants. "Plant tissue" refers to a tissue of differentiated or undifferentiated plant, including but not limited to roots, stems, leaves, pollen, seeds, cancer tissues, and various types of cells used for culture, protoplasts, shoots and callus tissue. The plant tissue may be in planta or may be in an organ culture, tissue culture or cell culture.

The transgenic plants produced by the above method are silenced in the target gene, that is, the gene consisting of the nucleotide sequence of SEQ ID NO: 2. As used herein, the term " silence " refers to a phenomenon in which the expression of a gene is downregulated or completely suppressed.

In a specific embodiment of the present invention, the plant to be infected by SYCMV is not particularly limited, but may preferably be a longevity variety, more preferably a soybean variety.

In the specification of the present invention, the term " germ line varieties " refers to varieties that mature late due to a long growing period in the same crop.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Production of SYCMV-derived VIGS recombinant vector with target gene inserted

The empty vector, SYCMV-VIGS, in which the target gene was not inserted, To construct the SYSMV clone from the 35S promoter, the pPZP211 binary vector was used and the BsrGI restriction site was modified to clone a foreign sequence. In order to silence the gene consisting of the nucleotide sequence of SEQ ID NO: 3 selected as the target gene in the present invention in order to confirm the effect of promoting the flowering or mature stage, SEQ ID NO: 1, which can complementarily bind to the nucleotide sequence of SEQ ID NO: Or the nucleotide sequence of SEQ ID NO: 2 (antisense) was inserted into the BsrGI site to construct two VIGS constructs. In order to compare the promoting effect of the flowering period or the mature stage, fragments of E2 (GIGANTEA), E3 ( PHYA3 ) and E4 ( PHYA2 ) genes and E2- paralogue and E4- paralogue gene fragments Ten VIGS constructs were constructed by inserting in the sense or antisense orientation at the BsrGI site. Primer sets of flowering-related genes for the production of recombinant VIGS vectors are as shown in Table 1 below.

The fragment sequences of the target genes used in vector production are shown in Table 2 below.

goal
gene The fragment sequence of the target gene SEQ ID NO: 3 sense
(order
No. 1)
TCCATCATTCAAGGCTTTCCTTGAAGTTGTCAAGAACAGGAGCTTACTCTGGAAGGTCTATGAAACGGATGCCATTCATTCATTGCATTTAATACTGAGAGATGCGTTCAAAGAGACAGAGAGCATGAAGATAGCCACATATGCTCCCAATTCAAGGCTTGGTTGTTTGAACATTGAAGAAACGCAAGGACTGGAGGCAGTGACAAATGAGATGGTAAGGTTAATTGAAACAGCAACAGTGCCAGTTTTGGCAGTTGATGTTAATGGGATGGTCAATGGATGGAAC antisene
(order
No. 2) GTTCCATCCATTGACCATCCCATTAACATCAACTGCCAAAACTGGCACTGTTGCTGTTTCAATTAACCTTACCATCTCATTTGTCACTGCCTCCAGTCCTTGCGTTTCTTCAATGTTCAAACAACCAAGCCTTGAATTGGGAGCATATGTGGCTATCTTCATGCTCTCTGTCTCTTTGAACGCATCTCTCAGTATTAAATGCAATGAATGAATGGCATCCGTTTCATAGACCTTCCAGAGTAAGCTCCTGTTCTTGACAACTTCAAGGAAAGCCTTGAATGATGGA E2
sense
(order
No. 4) GGCGGACATCTGTTGTACCTTCAGAAGATTCATTCCCATCAAAACTTGACCATAATTCTAACAAAACCCCATGTCCAAAGGGTGCATCAGATTATACCTTGGGTAAAGGTGTCACAGGTTTCTCATTGGATGCGTCTGATCTAGCCAACTTCCTCACAATGGACAGGCATATAGGATTGAATTGCAATGGACAAATTTTTCTAAGATCCACGCTAGCAGAGAAACAAGAATTATGTTTTTCTGTAGTTTCACTGCTATGGCACAAGC antisense
(order
No. 5) GCTTGTGCCATAGCAGTGAAACTACAGAAAAACATAATTCTTGTTTCTCTACTAGCGTGGATCTTAGAAAAATTTGTCCATTGCAATTCAATCCTATATGCCTGTCCATTGTGAGGAAGTTGGCTAGATCAGACGCATCCAATGAGAAACCTGTGACACCTTTACCCAAGGTATAATCTGATGCACCCTTTGGACATGGGGTTTTGTTAGAATTATGGTCAAGTTTTGATGGGAATGAATCTTCTGAAGGTACAACAGATGTCCGCC E3 sense
(order
No. 6) CTCGGATCTTGACAGCATCATTGATGGCTACATGGATTTGGAGATGGTTGAATTCACTTTGCATGAAGTTTTGGTTGCCTCCCTAAGTCAAGTCATGACAAAGAGTAATGCAAAAGGTATCCGAGTAGTCAATGATGTTGAAGAGAAGATCACAACAGAGACCTTATATGGTGATAGTATCAGGCTTCAGCAGGTCTTAGCTGACTTTTTATTGATTTCCATCAATTTCACACCAACTGGAGGTCAGGTTG antisense
(order
No. 7) TTTACACAACCTGACCTCCAGTTGGTGTGAAATTGATGGAAATCAATAAAAAGTCAGCTAAGACCTGCTGAAGCCTGATACTATCACCATATAAGGTCTCTGTTGTGATCTTCTCTTCAACATCATTGACTACTCGGATACCTTTTGCATTACTCTTTGTCATGGCTTGACTTAGGGAGGCAACCAAAACTTCATGCAAAGTGAATTCAACCATCTCCAAATCCATGTAGCCATCAATGATGCTGTCAAGATCCGAG E4 sense
(order
No. 8) CATGCGAAAGGCAAGATGATTCAGCCTTTTGGGTGCTTGTTGGCCTTAGATGAGAAAACATGCAAGGTCATTGCATACAGTGAGAACGCACACGAAATGCTGACCATGGTGAGCCATGCTGTCCCCAGTGTTGGTGACCACCCTGCCCTTGGTATTGGCACTGACATAAAAACTCTATTCACTGCACCAAGTGCTTCTGCATTGCAGAAGGCTCTAGGATTTGCAGAGGTTTTGCTTCTTAACCCTGTCCTTATCCATTGCAAGACCTCTGGGAAGCCCTTTTA antisense
(order
No. 9) TAAAAGGGCTTCCCAGAGGTCTTGCAATGGATAAGGACAGGGTTAAGAAGCAAAACCTCTGCAAATCCTAGAGCCTTCTGCAATGCAGAAGCACTTGGTGCAGTGAATAGAGTTTTTATGTCAGTGCCAATACCAAGGGCAGGGTGGTCACCAACACTGGGGACAGCATGGCTCACCATGGTCAGCATTTCGGGTGCGTTCTCACTGTATGCAATGACCTTGCATGTTTTCTCATCTAAGGCCAACAAGCACCCAAAAGGCTGAATCATCTTGCCTTTCTGCATG E2-
paralogue sense
(order
No. 10) CAACTCCAAGATGGGCTGTTGCCAATGGTGCTGGTGTTATATTGAGTGTTTGTGATGATGAAGTTGCTCGCAATGAGACTACTACTTTAACAGCAGCTGCTGTCCCTGCACTTTTGCTTCCTCCTCCAACGACAGCTTTGGATGAGCATCTTGTTGCTGGATTACCAGCTCTGGAACCATATGCTCGTTTATTTCATAGATATTATGCAATTGCTACTCCAAGTGCTACACAAAGACTTCTTCTTGGACTTCTTGAAGCACCCCCATCGTGGGCTCCAGATGCACTTGATGCTGCTGT antisense
(order
No. 11) ACAGCAGCATCAAGTGCATCTGGAGCCCACGATGGGGGTGCTTCAAGAAGTCCAAGAAGAAGTCTTTGTGTAGCACTTGGAGTAGCAATTGCATAATATCTATGAAATAAACGAGCATATGGTTCCAGAGCTGGTAATCCAGCAACAAGATGCTCATCCAAAGCTGTCGTTGGAGGAGGAAGCAAAAGTGCAGGGACAGCAGCTGCTGTTAAAGTAGTAGTCTCATTGCGAGCAACTTCATCATCACAAACACTCAATATAACACCAGCACCATTGGCAACAGCCCATCTTGGAGTTG E4-
paralogue sense
(order
No. 12) GCTAGAATGGCTCAGGCAACTGTAGATGCAAAAATCCATGCAACTTTTGAGGAGTCCGGTAGTTCCTTTGATTACTCCAGTTCGGTGCGCGTCTCTGGTACAGCTGATGGAGTCAATCAACCAAGGTCTGACAAAGTTACAACAGCTTACCTCAATCACATGCAGAGAGGCAAGATGATTCAGCCTTTTGGTTGCTTGTTGGCCATTGATGAGAAA antisense
(order
No. 13) TTTCTCATCAATGGCCAACAAGCAACCAAAAGGCTGAATCATTTTGCCTCTCTGCATGTGATTGAGGTAAGCTGTTGTAACTTTGTCAGACCTTGGTTGATTGACTCCATCAGCTGTACCAGAGACGCGCACCGAACTGGAGTAATCAAAGGAACTACCGGACTCCTCAAAAGTTGCATGGATTTTTGCATCTACAGTTGCCTGAGCCATTCTAGC

The target gene Silent  Identification of shortening and flowering-related gene expression in flowering of plants

Four constructs (black in Table 1) in which the target gene was not inserted among the 12 VIGS constructs prepared in Example 1 were excluded, and eight constructs including the correct size and the desired gene sequence ≪ / RTI > red in Table 1) was inoculated into the rosacea using Agrobacterium-mediated invasion. After confirming the phenotype and silencing of the target gene, the infected leaves of silent plants were extracted as a sample. The leaves thus obtained were used to mechanically inoculate 10-day-old 10-day-old perennials and cotyledons in a greenhouse with a 16-hour photoperiod.

The first flowering dates (FFDs) and pod maturities (PMs) of the target gene silenced plants (control) and non-silenced plants (control) were converted to long day (LD) 8 h darkness).

Varietal varieties typically bloom 60 days after sowing. Similarly, SYCMV: empty inoculated individuals bloomed approximately 60 days as shown in Table 3 below. In addition, non-silenced SYCMV: empty inoculated plants bloomed on December 14 (61 das), whereas plants that were silenced with target genes occurred on December 1 to 8 (50-55 das) on flowering. Specifically, the average flowering time of previously silenced individuals of flowering genes E2-F, E3-F and E4-R was 52 ~ 53 days shorter than that of the control by 8 ~ 9 days. These results indicate that the SYCMV-flowering related gene silenced individuals occur earlier than in the flowering of non-silenced SYCMV: empty inoculated individuals. Particularly, among the inoculated recombinant VIGS vectors derived from the SYCMV containing the nucleotide sequence of SEQ ID NO: 2, the flowering time of 13 days was shorter than that of the control, and the flowering speed was about 11 days on average. The ANOVA analysis showed the most significant difference when the gene (D) consisting of the nucleotide sequence of SEQ ID NO: 3, which is the target gene of the plant, was knocked down as compared with the control (A) (Table 3).

In order to compare the observed changes in the flowering period of eight individuals with silenced flowering-related genes to those without silenced flowering-related genes, the fourth and fifth leaves of silent and silent individuals were subjected to qRT-PCR ≪ / RTI > was used to analyze the level of transcription of the target gene as measured by the gene. The primer set used for qRT-PCR is as shown in Table 4 below.

Target gene The primer sequence (5 'to 3') SEQ ID NO: 3 Forward TTGCTGAGGTGAAAAGGCCA Reverse ATATCTTTGGAAGTTATTCT E2 Forward AGAAAATCAAAATACCTAGC Reverse TCCGAATAGGTGCATGAATT E3 Forward GGAAAGCATTTACTCACACT Reverse TCCCAACTCAGTACCCTCTA E4 Forward CAGCAGGTGCCTTGCAATCT Reverse GTTACTCCTAATCTCCATAC E2-paralogue Forward TTCCTAGAAATTGGATGCAT Reverse CAGATGTTTGTAAGTCCTCA E4-paralogue Forward GTTGGTGACCACCCTGCCCT Reverse ATACCTTAGAGGAAAGGGAA

As shown in Fig. 2, the expression amount of the gene consisting of the nucleotide sequence of SEQ ID NO: 3, which is the target gene, in the SYCMV-derived recombinant VIGS vector inoculated with the nucleotide sequence of SEQ ID NO: 2 inserted into the SYCMV: Respectively.

Comparison of promoting effects of flowering and maturing period

In this example, the maturation period and the flowering period of SYCMV: empty inoculated (control) and recombinant VIGS vector inoculated with SYCMV (SEQ ID NO: 2) were compared.

As shown in FIG. 3, when the first flower of the SYCMV: empty inoculation control, which was a control, was bloomed, the experimental group had already been in full bloom. Even in the mature stage, the pods of the experimental group turned brown, indicating that they had entered the harvest, but the SYCMV: empty inoculum still had green pods. It was also confirmed that the individuals in the experimental group matched about two weeks earlier than the SYCMV: empty inoculum.

From the above results, it was confirmed that silencing of the gene consisting of the nucleotide sequence of SEQ ID NO: 3 in the plant markedly promotes the flowering phase and the mature stage. Based on these results, it may be useful to inoculate the recombinant VIGS vector derived from SYCMV with the nucleotide sequence of SEQ. ID. NO. 1 or 2 in the freshman cultivar as a plant material that can accelerate the flowering period and mature stage.

The early flowering of plants using the SYCMV-derived recombinant VIGS vector of the present invention is effective for the development of various crops such as food, feed, flower, horticulture, energy crops, plant seed industry and agricultural development.

<110> THE FOUNDATION OF AG. TECH. COMMERCIALIZATION AND TRANSFER <120> Novel gene promoting early flowering or maturity in plant and use          the <130> 1060676 <160> 37 <170> Kopatentin 2.0 <210> 1 <211> 286 <212> DNA <213> Artificial Sequence <220> <223> fragment of flowering-related gene (sense) <400> 1 tccatcattc aaggctttcc ttgaagttgt caagaacagg agcttactct ggaaggtcta 60 tgaaacggat gccattcatt cattgcattt aatactgaga gatgcgttca aagagacaga 120 gagcatgaag atagccacat atgctcccaa ttcaaggctt ggttgtttga acattgaaga 180 aacgcaagga ctggaggcag tgacaaatga gatggtaagg ttaattgaaa cagcaacagt 240 gccagttttg gcagttgatg ttaatgggat ggtcaatgga tggaac 286 <210> 2 <211> 286 <212> DNA <213> Artificial Sequence <220> <223> fragment of flowering-related gene (antisense) <400> 2 gttccatcca ttgaccatcc cattaacatc aactgccaaa actggcactg ttgctgtttc 60 aattaacctt accatctcat ttgtcactgc ctccagtcct tgcgtttctt caatgttcaa 120 acaaccaagc cttgaattgg gagcatatgt ggctatcttc atgctctctg tctctttgaa 180 cgcatctctc agtattaaat gcaatgaatg aatggcatcc gtttcataga ccttccagag 240 taagctcctg ttcttgacaa cttcaaggaa agccttgaat gatgga 286 <210> 3 <211> 2991 <212> DNA <213> Artificial Sequence <220> <223> flowering-related gene <400> 3 atgataattc ttgtttacgt actcggcatg atgtttctgt cgtttcctgg tcaattaaga 60 tcatcaagac ccagtgctag gaggatatct cagacaagtt tagatgcaaa accgcatgca 120 acatttgagg aatcaggtag ttcttttgg tactcgaatt cagtgaaaat gtctccagct 180 ggtacaggag gaggcactgt cagtggagag catgaaccaa agtctgatag agcagcaaca 240 actgcttacc tccatcagat gcagaaaggc aagcttattc agccatttgg gtgcttgttg 300 gtcttagatg agaaaacata taaggtcatc gcttacagtg agaatgcacc tgaaatgctc 360 accatggcta gtcatgctgt ccccagtgtt gatgaccacc ctgctcttga cattggcact 420 tacataagga ctattttcac tgccccaagt attgcttcta ttcacaaggt acttggattt 480 ggggatcttt cacttcataa caccattcta gtccattgca agacctttgg gaatcccttt 540 tacgcaatta tccatcttgt taccggtagc acaatcatcg attttgagtc ggtccagcct 600 cctgaagttc ccatgactgc atccggttcc ctgcaatcct actacaagct tgcagcaaaa 660 gcaacaacta gattgcaatc cttggctact gtgaacatgg aaacactatg taacacaatg 720 gttcaagagg tttttgagct cacaggttat gacagagtga tggcttataa attccatgac 780 gatgatcatg gggaagtgat tgctgaggtg aaaaggccag gcctagagcc atatctgggg 840 ttgcactacc cagccactga tattccccat gcgacgcgct tttctttatg gagaacaagg 900 tgcgtgattc aagacaaaaa aattccattt gatttagctt tgtatggatc aaccttgagg 960 gctgctcata gttgccactt gcaattcatg gtgaacatga attctagtgc ttccttggta 1020 ttggcagttg tgatcaatga caatgatgaa gatgggaata gttctgatga tgctgctgtt 1080 cagcagccac acaagagtag tacgagtcta tggggtttag tagtttgcca tcacactact 1140 cccaagtttg ttcctcaggg gcgtatttgt catccacgtg tgggcaaaga gctagagatt 1200 gagtatcaga ttgttgagaa gaacatcctg cgaactcaaa cacacttgtt tgatgtgctg 1260 acgcgagatg agcccctagc cattgtttca cagagtccta atatgatgga tcttgtcaag 1320 tgtgatggag cgaccctgtt atataaaaac aaggtgtgga gattaggggt aacgccaagt 1380 gaatctcaga taagagagat agctttgtgg ctctctcagt gccataggga ttccacaggt 1440 ttttttacag atagcttgtc tgatgcaggc ttccctgggg ctgctgctct tggtgatatt 1500 gcatgtggaa tgacatctgc cagaataact tccaaagata tagttttctg gttttggtct 1560 cacacggctg cagaaatccg atgcgacggt gcaaagcatg aacctggtga aagggatgat 1620 gtgtcaaga acaggagctt actctggaag gtctatgaaa cggatgccat tcattcattg 1680 catttaatac tgagagatgc gttcaaagag acagagagca tgaagatagc cacatatgct 1740 cccaattcaa ggcttggttg tttgaacatt gaagaaacgc aaggactgga ggcagtgaca 1800 aatgagatgg taaggttaat tgaaacagca acagtgccag ttttggcagt tgatgttaat 1860 gggatggtca atggatggaa caccaaaatt gctgagttga caggtcttcc aagtgatgaa 1920 gctatgggaa agcattttct cacacttgta gaggattttt cagtagatag agtcaagaag 1980 atgttgcaca tggcattgca gggtgaggaa gaggaagaga gaaatgtcca atttgagatc 2040 aacacatatg atttcaagat tgattctggt cctgccagct tggtagttaa tgcttgtgca 2100 agcagggatc ttcaagataa tattgtggga gtttgttttg tggcacaagg tataactgct 2160 cagaaaacaa tgatggaaaa attcccccga attgaaggtg actacaaggc aattgtacag 2220 aacccaaacc catcgatccc tccattattt agcacagatg aatttggttg gtgttgtgaa 2280 tggaattcag ctatggcaaa attaaccgga tggaagcgag aggaggtgat ggataaaatg 2340 cttttaggag agattttcgg gacccagata gctggttgtc gcctaaggaa tcatgaagct 2400 gttgttaatt ttagcattgt acttaataca gccatggctg gtttggaaac agagaaggtt 2460 cctattggtt tctttactcg cgatggaaag catgtagaat ctagtccaga gctgcaacag 2520 gcattacaca ttcagctcct atctgagcaa actgcaatga aaagactgaa agatttaaat 2580 tatttgaaaa ggcaaatccg gaatccttta tatgggatta tgttctcccg gaaattgtta 2640 gagggtactg agttgggagc tgaacaaaaa caatttctgc aaatgagcac gcagtgtcaa 2700 caccagctta gcaaaattct ggatgactca gatcttgaca gcatcattga tggttgccat 2760 ttgtgtggta ttttgagcat ttatcaacaa gagttcctat taaatcatac aattgtaaac 2820 attacgcatg atggttttgg ggttccagaa acattgctga accagatgtt tggacgtgat 2880 ggacatgaat ctgaggaggg tattagcatg ctgattagca gaaagctcat gaagggagac 2940 gtacgttaca taagggaagc agggaaaatc atctttcatc ttatctgttg a 2991 <210> 4 <211> 267 <212> DNA <213> Artificial Sequence <220> <223> E2 gene fragment (sense) <400> 4 ggcggacatc tgttgtacct tcagaagatt cattcccatc aaaacttgac cataattcta 60 acaaaacccc atgtccaaag ggtgcatcag attatacctt gggtaaaggt gtcacaggtt 120 tctcattgga tgcgtctgat ctagccaact tcctcacaat ggacaggcat ataggattga 180 attgcaatgg acaaattttt ctaagatcca cgctagcaga gaaacaagaa ttatgttttt 240 ctgtagtttc actgctatgg cacaagc 267 <210> 5 <211> 267 <212> DNA <213> Artificial Sequence <220> <223> E2 gene fragment (antisense) <400> 5 gcttgtgcca tagcagtgaa actacagaaa aacataattc ttgtttctct actagcgtgg 60 atcttagaaa aatttgtcca ttgcaattca atcctatatg cctgtccatt gtgaggaagt 120 tggctagatc agacgcatcc aatgagaaac ctgtgacacc tttacccaag gtataatctg 180 atgcaccctt tggacatggg gttttgttag aattatggtc aagttttgat gggaatgaat 240 cttctgaagg tacaacagat gtccgcc 267 <210> 6 <211> 251 <212> DNA <213> Artificial Sequence <220> <223> E3 gene fragment (sense) <400> 6 ctcggatctt gacagcatca ttgatggcta catggatttg gagatggttg aattcacttt 60 gcatgaagtt ttggttgcct ccctaagtca agtcatgaca aagagtaatg caaaaggtat 120 ccgagtagtc aatgatgttg aagagaagat cacaacagag accttatatg gtgatagtat 180 caggcttcag caggtcttag ctgacttttt attgatttcc atcaatttca caccaactgg 240 aggtcaggtt g 251 <210> 7 <211> 257 <212> DNA <213> Artificial Sequence <220> <223> E3 gene fragment (antisense) <400> 7 tttacacaac ctgacctcca gttggtgtga aattgatgga aatcaataaa aagtcagcta 60 agacctgctg aagcctgata ctatcaccat ataaggtctc tgttgtgatc ttctcttcaa 120 catcattgac tactcggata ccttttgcat tactctttgt catggcttga cttagggagg 180 caaccaaaac ttcatgcaaa gtgaattcaa ccatctccaa atccatgtag ccatcaatga 240 tgctgtcaag atccgag 257 <210> 8 <211> 284 <212> DNA <213> Artificial Sequence <220> <223> E4 gene fragment (sense) <400> 8 catgcgaaag gcaagatgat tcagcctttt gggtgcttgt tggccttaga tgagaaaaca 60 tgcaaggtca ttgcatacag tgagaacgca cacgaaatgc tgaccatggt gagccatgct 120 gtccccagtg ttggtgacca ccctgccctt ggtattggca ctgacataaa aactctattc 180 actgcaccaa gtgcttctgc attgcagaag gctctaggat ttgcagaggt tttgcttctt 240 aaccctgtcc ttatccattg caagacctct gggaagccct ttta 284 <210> 9 <211> 285 <212> DNA <213> Artificial Sequence <220> <223> E4 gene fragment (antisense) <400> 9 taaaagggct tcccagaggt cttgcaatgg ataaggacag ggttaagaag caaaacctct 60 gcaaatccta gagccttctg caatgcagaa gcacttggtg cagtgaatag agtttttatg 120 tcagtgccaa taccaagggc agggtggtca ccaacactgg ggacagcatg gctcaccatg 180 gtcagcattt cgggtgcgtt ctcactgtat gcaatgacct tgcatgtttt ctcatctaag 240 gccaacaagc acccaaaagg ctgaatcatc ttgcctttct gcatg 285 <210> 10 <211> 298 <212> DNA <213> Artificial Sequence <220> <223> E2-paralogue gene fragment (sense) <400> 10 caactccaag atgggctgtt gccaatggtg ctggtgttat attgagtgtt tgtgatgatg 60 aagttgctcg caatgagact actactttaa cagcagctgc tgtccctgca cttttgcttc 120 ctcctccaac gacagctttg gatgagcatc ttgttgctgg attaccagct ctggaaccat 180 atgctcgttt atttcataga tattatgcaa ttgctactcc aagtgctaca caaagacttc 240 ttcttggact tcttgaagca cccccatcgt gggctccaga tgcacttgat gctgctgt 298 <210> 11 <211> 298 <212> DNA <213> Artificial Sequence <220> <223> E2-paralogue gene fragment (antisense) <400> 11 acagcagcat caagtgcatc tggagcccac gatgggggtg cttcaagaag tccaagaaga 60 agtctttgtg tagcacttgg agtagcaatt gcataatatc tatgaaataa acgagcatat 120 ggttccagag ctggtaatcc agcaacaaga tgctcatcca aagctgtcgt tggaggagga 180 agcaaaagtg cagggacagc agctgctgtt aaagtagtag tctcattgcg agcaacttca 240 tcatcacaaa cactcaatat aacaccagca ccattggcaa cagcccatct tggagttg 298 <210> 12 <211> 216 <212> DNA <213> Artificial Sequence <220> <223> E4-paralogue gene fragment (sense) <400> 12 gctagaatgg ctcaggcaac tgtagatgca aaaatccatg caacttttga ggagtccggt 60 agttcctttg attactccag ttcggtgcgc gtctctggta cagctgatgg agtcaatcaa 120 ccaaggtctg acaaagttac aacagcttac ctcaatcaca tgcagagagg caagatgatt 180 cagccttttg gttgcttgtt ggccattgat gagaaa 216 <210> 13 <211> 216 <212> DNA <213> Artificial Sequence <220> <223> E4-paralogue gene fragment (antisense) <400> 13 tttctcatca atggccaaca agcaaccaaa aggctgaatc attttgcctc tctgcatgtg 60 attgaggtaa gctgttgtaa ctttgtcaga ccttggttga ttgactccat cagctgtacc 120 agagacgcgc accgaactgg agtaatcaaa ggaactaccg gactcctcaa aagttgcatg 180 gatttttgca tctacagttg cctgagccat tctagc 216 <210> 14 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for SEQ ID NO: 3 <400> 14 aaatgtacat ccatcattca aggctttcc 29 <210> 15 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for SEQ ID NO: 3 <400> 15 aaatgtacagt ttccatccat tgaccatcc 29 <210> 16 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for E2 <400> 16 aaatgtacag gcggacatct gttgtacct 29 <210> 17 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for E2 <400> 17 aaatgtacag cttgtgccat agcagtgaa 29 <210> 18 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for E3 <400> 18 aaatgtacac tcggatcttg acagcatca 29 <210> 19 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for E3 <400> 19 aaatgtacac aacctgacct ccagttggt 29 <210> 20 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for E4 <400> 20 aaatgtacac atgcagaaag gcaagatga 29 <210> 21 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for E4 <400> 21 aaatgtacat aaaagggctt cccagaggt 29 <210> 22 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for E2-paralogue <400> 22 aaatgtacac aactccaaga tgggctgtt 29 <210> 23 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for E2-paralogue <400> 23 aaatgtacaa cagcagcatc aagtgcatc 29 <210> 24 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> forward primer for E4-paralogue <400> 24 aaatgtacag ctagaatggc tcaggcaac 29 <210> 25 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for E4-paralogue <400> 25 aaatgtacat ttctcatcaa tggccaaca 29 <210> 26 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > qRT-PCR forward primer for SEQ ID NO: 3 <400> 26 ttgctgaggt gaaaaggcca 20 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > qRT-PCR reverse primer for SEQ ID NO: 3 <400> 27 atatctttgg aagttattct 20 <210> 28 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR forward primer for E2 <400> 28 agaaaatcaa aatacctagc 20 <210> 29 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR reverse primer for E2 <400> 29 tccgaatagg tgcatgaatt 20 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR forward primer for E3 <400> 30 ggaaagcatt tactcacact 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR reverse primer for E3 <400> 31 tcccaactca gtaccctcta 20 <210> 32 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR forward primer for E4 <400> 32 cagcaggtgc cttgcaatct 20 <210> 33 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR reverse primer for E4 <400> 33 gttactccta atctccatac 20 <210> 34 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR forward primer for E2-paralogue <400> 34 ttcctagaaa ttggatgcat 20 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR reverse primer for E2-paralogue <400> 35 cagatgtttg taagtcctca 20 <210> 36 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR forward primer for E4-paralogue <400> 36 gttggtgacc accctgccct 20 <210> 37 <211> 20 <212> DNA <213> Artificial Sequence <220> QRT-PCR reverse primer for E4-paralogue <400> 37 ataccttaga ggaaagggaa 20

Claims (7)

(SEQ ID NO: 1 or 2) inserted at the 3'-end of the envelope protein coding gene of the full-length SYCMV sequence, and a recombinant VIGS (SEQ ID NO: virus-induced gene silencing vector. A method for promoting the flowering or maturing stage of a plant, comprising the step of transforming the recombinant VIGS vector of claim 1 into a plant cell to inhibit the expression of the gene consisting of the nucleotide sequence of SEQ ID NO: 3 which is the target gene of the plant. A method for producing a transgenic or mature stage promoted transgenic plant comprising transforming a plant cell with the recombinant VIGS vector of claim 1. A transgenic plant or a mature stage promoted plant produced by the method of claim 3. 5. The transgenic plant according to claim 4, wherein the plant is a benthic species. 6. The transgenic plant according to claim 5, wherein the benthic varieties are soybeans. A transformed seed of a plant according to claim 4.

Images