WO2020093128A1

WO2020093128A1 - Method for producing castor oil plant seeds lacking ricin/rca, castor oil plants lacking ricin/rca, method for identifying castor oil plants lacking ricin/rca, polynucleotides, constructs and uses thereof

Info

Publication number: WO2020093128A1
Application number: PCT/BR2019/050480
Authority: WO
Inventors: Francisco José LIMA ARAGÃO; Glaucia BARBOSA CABRAL; Aisy BOTEGA BALDONI TARDIN; Natalia LIMA DE SOUSA
Original assignee: Empresa Brasileira De Pesquisa Agropecuária - Embrapa
Priority date: 2018-11-09
Filing date: 2019-11-06
Publication date: 2020-05-14
Also published as: BR102018073082A2; US20210395764A1

Abstract

The present invention relates to a method for producing castor oil plants lacking ricin/RCA protein by inserting gene constructs in plant cells, particularly castor oil plant cells, resulting in the production of castor oil plant seeds lacking ricin/RCA. One aspect of the invention relates to providing castor oil plants, and parts thereof, containing said gene construct. The method of the present invention has proven to be effective in generating castor oil plants lacking ricin protein, or with a low expression level of said protein, allowing use of the seeds from the castor oil plant for producing detoxified cakes, for use in animal feed or fertilizers, as well as allowing production thereof in countries with restrictions due to the toxicity of ricin. Thus, a method and kit for identifying transformed plants containing the gene constructs provided herein are also provided.

Description

METHOD FOR OBTAINING MAMMONINE SEEDS WITHOUT RICIN / RCA, MAMMONA PLANTS WITHOUT RICIN / RCA, METHOD OF IDENTIFYING MAMMONA PLANTS WITHOUT RICIN / RCA, POLYNUCLEOTIDES, CONSTRUCTIONS, AND USES OF THE SAME. FIELD OF THE INVENTION

[l] The present invention is related to the field of plant biotechnology and molecular biology. More specifically, the present invention relates to a method for obtaining castor plants without the presence of ricin / RCA protein by inserting gene constructs in plant cells, particularly castor, resulting in the production of castor seeds without the protein ricin / RCA. Another aspect of the invention is in obtaining castor plants, and parts of it, containing said gene construction. In addition, the transformed plant identification method and the transformed plant identification kit are provided.

STATEMENT OF TECHNICAL STATUS

[2] Castor bean (Ricinus communis) is an oilseed belonging to the Euphorbiaceae Family with worldwide distribution, but more cultivated in tropical and subtropical regions. The most important product of this crop is castor oil, which makes up 45-55% of the seed weight. Among the main industrial applications of castor oil and derivatives are the manufacture of nylon, the production of synthetic resins and fibers, plastics, oilcloths and artificial leather (Grand View Research, 2016. Castor Oil And Derivatives Market Analysis By Product (Sebacic Acid, Ricinoleic Acid, Undecylenic Acid, Castor Wax, Dehydrated Castor Oil), By Application (Lubricants, Surface Coatings, Biodiesel, Cosmetics & Pharmaceuticals, Plastics & Resins) And Segment Forecasts To 2024. Retrieved 13 June 2018 from https://www.grandviewresearch.com/industry-analysis/castor- oil-derivatives-industry). Castor oil can also be used in the synthesis of renewable monomers and polymers; in the production of soap, waxes, lubricants, hydraulic and brake fluids; in coatings and paints; and is still important in the cosmetics, pharmaceutical and food industries (Grand View Research (2016) Castor Oil And Derivatives Market Analysis By Product (Sebacic Acid, Ricinoleic Acid, Undecylenic Acid, Castor Wax, Dehydrated Castor Oil), By Application (Lubricants , Surface Coatings, Biodiesel, Cosmetics & Pharmaceuticals, Plastics & Resins) And Segment Forecasts To 2024. Retrieved on 13 June 2018 from https://www.grandviewresearch.com/industry-analysis/castor-oil-derivatives- industry). In cosmetics, castor oil is used as an emollient and in perfumery; in the food sector, it is used in sweets as release and nonstick agents (FDA, 1984); and in the pharmaceutical industry, castor oil has laxative properties and is also used as a drug delivery vehicle, as well as an excipient and additive.

[3] After the extraction of castor oil, the cake remains, which is the most important by-product of the crop. Castor cake can be used as a fertilizer for both conventional and organic farming (MELLO, Gabriel Alves Botelho de et al. Organic cultivation of onion under castor cake fertilization and irrigation depths. Acta Sei., Agron., Maringá, v. 40, e34993, 2018. Epub Feb 05, 2018. http://dx.doi.org/10.4025/actasciagron.v40i1 .34993), as it is an important source of nitrogen, phosphorus, potassium, as well as micronutrients (Lima , RLS, Severino, LS, Sampaio, LR, Sofiatti, V., Gomes, JA, Beltrão, NEM, 201 1. Blends of castor meai and castor husks for optimized use as organic fertilizer. Ind. Crops Prod. 33, 364- 368).

[4] Castor cake could also be used in animal feed if not for its high toxicity. Such toxicity occurs mainly due to the presence of ricin (RCA60), a highly toxic protein, but with low hemagglutination potential. In addition, some compounds with low toxicity are present: ricinin, CB-1A and RCA120 complex (Severino LS, 2005. What we know about castor bean cake. Documents, 134. Embrapa Cotton, Campina Grande, PB; Barnes DJ, Baldwin BS, Braasch DA, 2009. Ricin accumulation and degradation during castor seed development and late germination.Ind Crops Prod 30: 254-258; Bozza WP, Tolleson WH, Rosado LAR, Zhanga B, 2015. Ricin detection: Tracking active toxin. Biotechnol Adv 33: 11-17-123). The presence of ricin can cause inactivation of ribosomes, cellular organelles, which can cause the death of animals, including humans. Lethal doses for animals vary from

0.1 g / kg for horses up to 2.3 g / kg for pigs (FONSECA; SOTO-BLANCO. Toxicitiy of ricin present in castor bean seeds Semina: Ciências Agrárias, Londrina, v. 35, n. 3, p. 1415 -1424. 2014). For humans, the ingestion of five seeds can be lethal (OSNES, S. The history of ricin, abrin and related toxins. Toxicon, v.44, n.4, p.361 -370, 2004). To use the cake as animal feed, prior detoxification is necessary, but the methods previously developed are generally inefficient and / or economically unfeasible on a large scale (Severino LS, Auld DL, Baldanzi M, Cândido MJD, Chen G, Crosby W , Tan D, He X, Lakshmamma

P, Lavanya C, Machado OLT, Mielke T, Milani M, Miller TD, Morris JB, Morse SA, Navas AA, Soares DJ, Sofiatti V, Wang ML, Zanotto MD, Zieler H (2012) A review on the challenges for increased production of beaver. Agron J 104: 853-880.).

[5] Regarding the patent documents related to the development of castor plants without ricin, there are described in the state of the art few documents on the subject, and none aimed at obtaining castor plants without ricin by molecular biology techniques. What has been reported are documents aimed at improving the production of ricinoleic acid, as in the case of patent document W0200070052, which concerns a gene isolated from the genomic DNA of Ricinus communis and which encodes a protein capable of interact with the enzyme oleate 12-hydroxylase. However, when we analyze patent documents aiming to obtain detoxified castor plants, we find more technologies available, as is the case with seed detoxification processes and castor cake (BR102015030887, CN103766598, CN103766599, CN103892145 and FR2940804).

[6] Several copies of the ricin gene are known to exist in the castor bean genome (Chan AP, Crabtree J, Zhao Q, Lorenzi H, Orvis J, Puiu D, Melake-Berhan A, Jones KM, Redman J, Chen G , Cahoon EB, Gedil M, Stanke M, Haas BJ, Wortman JR, Fraser-Liggett CM, Ravel J, Rabinowicz PD (2010) Draft genome sequence of the oilseed species Ricinus communis. Nat Biotechnol 28: 951 -956) and the quantity of ricin varies according to variety (Baldoni AB, Araújo ACG, Carvalho MH, Gomes ACMM, Aragão FJL (2010) Immunolocalization of ricin accumulation during castor bean (Ricinus communis L.) seed development. Int J Plant Biol 1: 61 -65. ), but there is no report of the existence of ricin-free plant varieties.

[7] Post-transcriptional gene silencing refers to the transactivation of homologous genes due to RNA degradation. Although PTGS induction works exist with single-copy inserts, the presence of inverted repetitions and multiple copies of the transgenes are typically associated with silencing (as mentioned in patent application US20030135888, Jorgensen et al, Plant Mol. Biol., 31: 957 (1996)). Ectopic DNA-DNA or DNA-RNA pairing or the formation of antisense transcripts that give rise to dsRNA (double-stranded RNA), results in the formation of aberrant RNA transcripts (including loss of RNA polyadenylation, or short polyadenylation) of RNA, usually as a result of incomplete transcription) that activate silencing (as mentioned in patent application US20030135888, Baulcombe et al. Curr. Opin. Biotechnol., 7: 173 (1996); Depicker et al., Curr. Opin. Cell Biol., 9: 373 (1997); Metzlaff et al., Cell, 88: 845 (1997); Montgomery et al., Trends Genet., 14: 255 (1998); Que et al., Dev. Genet. , 22: 1 10 (1998); Stam et al., Mol Cell Biol. , 18: 6165 (1998); and Wassenegger et al., Plant Mol. Biol., 37: 349 (1998)). The simplest method of PTGS with dsRNA formation involves a construct containing a nucleic acid sequence, or fragment thereof, whose orientation towards the promoter is in the opposite direction, resulting in the formation of an antisense mRNA. This antisense mRNA, when transcribed inside the organism's cell, will complementarily bind to an endogenous mRNA molecule leading to the formation of a double-stranded mRNA molecule that will trigger a process involving several enzymes to amplify the response resulting in gene silencing specific for mRNA, that is, in the reduction or absence of the protein encoded by that gene (US5107065, US20030135888, US20040216190).

[8] A form derived from antisense technology is the insertion of gene constructs into organisms containing nucleic acid sequences in sense and antisense orientation separated by a spacer sequence, such as introns, which will lead to the formation of a clamp-like structure. double-stranded mRNA (dsRNA). This technology, also called interfering RNA, proved to be much more efficient than just inserting the nucleic acid molecule in the antisense orientation, since the mRNA molecule does not need to find the complementary molecule. The use of RNA interference (RNAi) has shown that it is possible to obtain plants with undetectable or absent levels of transcription (Wesley SV, Heliwell CA, Smith NA, Wang M, Rouse DT, Liu Q, Gooding PS, Singh SP, Abbott D , Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG & Waterhouse PM (2001) Construct design for efficient, effective and high-throughput gene silencing in plants, The Plant Journal. 27: 581 -590, W09953050, US20030175783,

US20030180945, US20050120415), showing an effective methodology for silencing ricin in plants.

[9] Thus, the present invention brings a novelty with great industrial application, which is the production of castor plants without the toxin ricin / RCA, obtained through post-transcriptional gene silencing of ricin genes.

SUMMARY OF THE INVENTION

[10] The present invention relates to a method for obtaining castor plants without ricin / RCA through the insertion of gene constructs in plant cells, particularly castor, resulting in the production of castor seeds without ricin / RCA.

[11] A first embodiment of the invention is to provide synthetic polynucleotide molecules comprising a first region with nucleic acid sequence with at least 90% similarity to the sequence described in SEQ ID No 12 and a second region with the complement of the sequence of the first region.

[12] A further embodiment of the invention provides a synthetic polynucleotide comprising a first region with a nucleic acid sequence as described in SEQ ID No 12, a second region with a nucleic acid sequence as described in SEQ ID No 13 and a spacer region between the first region and the second region with nucleic acid sequence according to the sequence described in SEQ ID No 5.

[13] A gene construct is also provided comprising a synthetic polynucleotide comprising a first region with nucleic acid sequence with at least 90% similarity to the sequence described in SEQ ID No 12 and a second region with the complement of the first region sequence and a region of active gene promoter operationally linked to the synthetic polynucleotide. A vector containing the aforementioned gene construct is also provided.

[14] Additionally, the present invention provides a vector comprising a gene promoter as described in SEQ ID No 4, a first coding region with a nucleic acid sequence as sequence described in SEQ ID No 12, a second coding region with nucleic acid sequence as described in SEQ ID No 13, a spacer region between the first region and the second region with nucleic acid sequence according to the sequence described in SEQ ID No. 5 , a termination signal as described in SEQ ID NO 6, a marker gene comprising the promoter described in SEQ ID NO 7, a coding region described in SEQ ID NO 8 and a termination signal described in SEQ ID NO 9 and a gene selection method comprising the promoter described in SEQ ID NO 1, a coding region described in SEQ ID NO 2 and a termination signal described in SEQ ID NO 3.

[15] In another embodiment, the double-stranded ribonucleotide molecule produced by the expression of any of the aforementioned nucleotide molecules is provided.

[16] A method for obtaining castor plants without ricin / RCA is also provided in this document, comprising the steps of: a. Insert any of the nucleic acid molecules mentioned above into plant castor cells;

B. Grow or regenerate cells in specific media;

ç. Select plants with the mutated ricin gene.

[17] The present invention also provides eukaryotic cell and plant comprising any of the nucleic acid molecules mentioned above. The plant's seed is also provided.

[18] Another embodiment concerns the method of identifying the genetically transformed plant and comprises the following steps:

The. forming a mixture comprising a biological sample containing castor DNA and a pair of primers capable of amplifying a specific nucleic acid molecule from a genetically modified castor plant without ricin / RCA;

B. reacting the mixture under conditions that allow the nucleic acid primer pair to amplify a specific molecule of nucleic acid from a genetically modified castor plant without ricin / RCA;

ç. detect the presence of the specific amplified nucleic acid molecule of a genetically modified castor plant without ricin / RCA.

[19] A castor nucleic acid molecule identification kit in biological sample is also provided comprising a nucleic acid primer pair selected from the following pairs SEQ ID NO 19 with SEQ ID NO 20, SEQ ID NO 21 with SEQ ID NO 22, SEQ ID NO 23 with SEQ ID NO 24 or SEQ ID NO 25 with SEQ ID NO 26.

[20] The present invention also provides a method of obtaining a castor plant without ricin / RCA comprising the steps of:

I. crossing the castor plant containing a nucleic acid molecule from the TB14S-5D event with a second castor plant; II. obtain seeds from the crossing of step I;

III. obtain sample of DNA from the seed; and

IV. detect the presence of the nucleic acid molecule of the castor bean plant TB14S-5D event.

[21] Finally, the present invention provides castor seed oil extracted from transgenic seed and castor seed cake obtained by a process using transgenic seed.

BRIEF DESCRIPTION OF THE FIGURES

[22] Figure 1 - Schematic representation of the construction used for the transformation of castor. Vector for biobalistics pRicRNAi composed of the transformation cassette, a fragment of the ricin (ric) gene in sense and antisense interspersed by an intron, under the control of the 35SCaMV promoter and OCS terminator, the ahas gene (AtAhas) and the directed gus gene promoter AtACT2. [23] Figure 2 - Expression of the gus in the TB14S-5D event from a histochemical assay. Non-transgenic (NT) embryos do not show gus expression.

[24] Figure 3 - The Southern blot assay shows the presence of transgenes representing Aricin (interference cassette) integrated into the genome in two plants of the TB14S-5D event while no signal is observed in non-transgenic (NT) plants.

[25] Figure 4 - The Northern blot shows the presence of siRNAs (small RNAs) and the absence of ricin gene transcripts in the TB14S-5D (+) event. In contrast, siRNAs were not observed and transcripts of the ricin gene were present in NT plants or negative TB14S-5D (-) event segregants.

[26] Figure 5 - Detection of ricin silencing in the TB14S-5D event. An ELISA test was performed to detect and quantify ricin in seed endosperm from the TB14S-5D event. Ricin was detected in the endosperm of non-transgenic seeds and in negative segregating seeds. However, ricin cannot be detected in positive TB14S-5D event seeds.

[27] Figure 6 - RCA120 silencing can be seen in the hemagglutination test. Proteins from seeds of the TB14S-5D event did not agglutinate red blood cells, as occurred with negative control (PBS) forming a dot at the bottom of the plate, while non-transgenic seed (NT) proteins agglutinated red blood cells as occurred in the positive control (RCA120) forming a background diffuse.

[28] Figure 7 - PCR analysis showing the presence of fragments resulting from the amplification of a fragment corresponding to an interference cassette sequence (Aricin). NT is a non-transgenic plant and pRIcRNAi is the vector used in the genetic transformation of castor bean.

[29] Figure 8 - PCR analysis showing the presence of fragments resulting from the amplification of a fragment corresponding to SEQ ID NO 27, specific marker for the TB14S-5D event. 1 - 1 kb marker (Fermentas); 2 to 4 - GM plants TB14S-5D event; 5 - pRicRNAi vector; 6 - Control (non-transgenic plant).

[30] Figure 9: Schematic representation of the region amplified by the primers AHASCD2F (SEQ ID NO 25) and SOJAE1 R (SEQ ID NO 26), whose sequence is described in SEQ ID NO 27.

DETAILED DESCRIPTION OF THE INVENTION

[31] The present invention addresses the production of castor plants without the ricin / RCA toxin, obtained through post-transcriptional gene silencing of the ricin gene.

[32] In the context of this description, a number of terms will be used and will therefore be detailed below.

[33] The term "nucleic acid" refers to a large molecule which can be single-stranded or double-stranded, composed of monomers (nucleotides) containing a sugar, a phosphate and a purine or pyrimidine base. A "nucleic acid fragment" is a fraction of a given nucleic acid molecule. “Complementarity” refers to the specific pairing of purine bases and pyrimidines that consist of nucleic acids: pairs of adenine with thymine and pairs of guanine with cytosine. So, the "complement" of a first nucleic acid fragment refers to the second nucleic acid fragment whose nucleotide sequence is complementary to the first nucleotide sequence.

[34] In more developed plants, deoxyribonucleic acid (DNA) is the genetic material while ribonucleic acid (RNA) is involved in the transfer of DNA information into proteins. A "genome" is every major part of the genetic material contained in each cell in an organism. The term "nucleotide sequence" refers to the sequences of nucleotide polymers, forming a strand of DNA or RNA, which can be single or double stranded, optionally synthetic, unnatural or with altered nucleotide bases capable of incorporation into DNA or RNA polymers. The term "oligomer" refers to short sequences of nucleotides, usually up to 100 bases in length. The term "homologous" to the connection between the nucleotide sequences of two nucleic acid molecules or between the amino acid sequences of two protein molecules. Estimation of such homology is provided by hybridizing DNA-DNA or RNA-RNA under stringent conditions as defined in the prior art (as mentioned in US20030074685, Hames and Higgins, Ed. (1985) Nucleic Acid Hybridization, IRL Press , Oxford, UK); or by comparing sequence similarity between two nucleic acid or protein molecules (as mentioned in US20030074685, Needleman et al., J. Mol. Biol. (1970) 48: 443-453).

[35] "Gene" refers to the nucleotide fragment that expresses a specific protein, including preceding (5 'untranslated region) and later (3' untranslated) regulatory sequences to the coding region. “Native gene” refers to an isolated gene with its own regulatory sequence found in nature. “Chimeric gene” refers to the gene that comprises coding, regulatory and heterogeneous sequences not found in nature. "Endogenous gene" refers to the native gene normally found in its natural location in the genome and is not isolated. An "exogenous gene" refers to a gene that is not normally found in the host organism, but which is introduced by gene transfer. "Pseudogene" refers to a nucleotide sequence that does not encode a functional enzyme.

[36] "Coding sequence" refers to the DNA sequence that encodes a specific protein and excludes the non-coding sequence. An "interrupted coding sequence" means the sequence that acts as a separator (for example, one or more introns connected through junctions).

[37] An "intron" or "spacer region" is a nucleotide sequence that is transcribed and is present in the pre mRNA, but is removed by cleavage and re-binding of mRNA within the cell generating a mature mRNA that can be translated into a protein. Examples of introns include, but are not limited to, intron pdk, pdk2, intron catalase of castor, intron Delta 12 denaturation of cotton, Delta 12 denaturation of Arabidopsis, ubiquitin intron of corn, intron of SV40, introns of the ricin gene. The present invention used the intron pdk (SEQ ID NO 5)

[38] "RNA transcript" refers to the product resulting from transcription catalyzed by the RNA polymerase of a DNA sequence. When the RNA transcript is a perfect copy of the DNA sequence, it is referred to as a primary transcript or it can be an RNA sequence derived from a post-transcriptional process of the primary transcript and is then referred to as a mature transcript. “Messenger RNA ( mRNA) "refers to RNA that is intron-free." RNA sense "refers to an RNA transcript that includes mRNA. “Antisense RNA” refers to an RNA transcript that is complementary to all parts of a primary transcript or mRNA and that can block the expression of a target gene by interfering with the processing, transport and / or translation of its primary transcript or mRNA. The complementarity of an antisense RNA can be with any part of the specific gene transcript, i.e., 5 'untranslated sequence, 3' untranslated sequence, introns or coding sequence. In addition, antisense RNA may contain regions of ribozyme sequences that increase the effectiveness of antisense RNA to block gene expression. “Ribozyme” refers to catalytic RNA and includes specific endoribonuclease sequences. “DsRNA (double-stranded)” refers to the clamp structure formed between the sequence of the mRNA or sense RNA, the sequence of a spacer / intron region and the sequence of the antisense RNA.

[39] The term “similarity” refers to fragments of nucleic acids in which changes in one or more nucleotide bases do not affect the ability of the nucleic acid fragment to mediate the alteration of gene expression by gene silencing through, for example, antisense technology, co-suppression or interference RNA (RNAi). Fragments of similar nucleic acids of the present invention can also be characterized by the percentage of similarity of their nucleotide sequences with the nucleotide sequences of the nucleic acid fragment described here (SEQ ID NO 12 and SEQ ID NO 13), as determined by common algorithms employed in the state of the art. The sequence alignment and the similarity percentage calculation of the present invention were performed using the DNAMAN for Windows Program (Lynnon Corporation, 2001), using sequences deposited at Gene Bank, through the integration of the Web browser. For the present invention, other regions of the A chain with similar effect can also be used, as well as sequences of the B chain, without, however, in this case, with effect on the RCA / RCA120 (Ricinus communis agglutinin).

[40] For dsRNA to be formed, the nucleotide sequence of the target gene in the sense orientation and a nucleotide sequence in the antisense orientation must be present in the DNA molecule, whether or not there is a spacer / intron region between the sense and antisense nucleotide sequences. The mentioned nucleotide sequences can consist of about 19 nt to 470 nt or even about 1740 nucleotides or more, each having a substantial total sequence similarity of about 40% to 100%. The longer the sequence, the less stringency is required for substantial total similarity of the sequence. Fragments containing at least 19 nucleotides should preferably have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of sequence identity when compared to the sequence reference, with the possibility of having about 2 distinct non-contiguous nucleotides. Preferably fragments above 60 bp are used, more preferably fragments between 150 to 500 bp.

[41] In one aspect of the invention, the dsRNA molecule can comprise one or more regions having substantial sequence similarity to regions with at least about 14 nucleotides consecutive sense nucleotides of the target gene, defined as the first region, and one or more regions having substantial sequence similarity for regions with about 15 consecutive nucleotides of the complement of the sense nucleotides of the target gene, defined as the second region, where these regions may have base pairs separating them from one another. For the present invention, 461 nucleotide fragments (SEQ ID NO 12 and SEQ ID NO 13) of the castor bean ricin gene were used.

[42] Conveniently, dsRNA (double-stranded RNA) as described can be expressed in host cells from introduced gene construction and possibly integrated into the host cell genome. Therefore, in one embodiment, the invention relates to a synthetic polynucleotide comprising a first region with a nucleic acid sequence with similarity of at least 90, 95, 99 or 100% with the sequence described in SEQ ID No 12 and a second region with the complement of the sequence of the first region. Such polynucleotide may have a spacer region between the first and the second region, and this spacer region may be an intron sequence selected from pdk intron (SEQ ID No 5), pdk2 intron, castor catalase intron, Delta 12 cotton desaturase intron, Delta 12 desaturase from Arabidopsis, ubiquitin corn intron, SV40 intron and ricin gene introns.

[43] "Promoter" refers to the DNA sequence in a gene, usually located upstream of the coding sequence, which controls the expression of the coding sequence by promoting recognition by RNA polymerase and other factors required for the transcription itself. In an artificial DNA construct, promoters can also be used to transcribe dsRNA. Promoters may also contain DNA sequences that are involved in binding protein factors which control the effect of initiation of transcription in response to physiological or developmental conditions. [44] In one aspect of the invention, a gene construct is provided comprising the polynucleotide characterized above and a region of active gene promoter operatively linked to said polynucleotide.

[45] Such a promoter may be a promoter expressed in plants. As used here, the term "plant-expressed promoter" means a DNA sequence that is capable of initiating and / or controlling transcription in a plant cell. This includes any promoter of plant origin; any promoter of non-plant origin which is capable of directing expression in a plant cell, for example promoters of viral or bacterial origin such as CaMV35S (as mentioned in patent application US20030175783, Hapster et al, 1988 Mol. Gen. Genet. 212, 182-190) and gene promoters present in Agrobaterium T-DNA, tissue-specific or organ-specific promoters, including but not limited to seed-specific promoters (WO8903887), specific promoters of primordial organs (as mentioned in the application US20030175783, An et al., 1996 The Plant Cell 8, 15-30), stem-specific promoters (as mentioned in patent application US20030175783, Keller et al., 1988 EMBO J. 7: 3625-3633), promoters leaf specific (as mentioned in patent application US20030175783, Hudspeth et al., 1989 Plant Mol Biol 12: 579-589), mesophilic specific promoters, root specific promoters (as mentioned in patent application US200301 75783, Keller et al., 1989 Genes Devei. 3: 1639-1646), tuber-specific promoters (as mentioned in patent application US20030175783, Keil et al., 1989 EMBO J. 8: 1323: 1330), vascular tissue-specific promoters (as mentioned in patent application US20030175783, Peleman et al., 1989 Gene 84: 359-369), specific stamen promoters (WO8910396, W09213956), specific promoters of the dehiscence zone (W09713865); and the like. For the present invention, the following promoters were preferably used: 1) Ahas gene promoter from Arabidopsis thaliana that directs the expression of the ahas gene (pAtAhas - SEQ ID NO 1); 2) CaMV35S constitutive promoter that directs the expression of the RNAi K7 to the Ricin fragment (pCaMV35S - SEQ ID NO 4) and 3) A constitutive promoter of the Actin 2 gene from Arabidopsis thaliana that directs the expression of the gus gene (pAtAct2 - SEQ ID NO 7).

[46] The promoter may contain elements "enhancers". An "enhancer" is a DNA sequence that can stimulate the activity of the promoter. It can be an innate element of the promoter or a heterologous element inserted to increase the level and / or tissue-specificity of a promoter. In the present invention, the enhancer sequence of the Alfalfa mosaic virus (35SCaMV) was used.

[47] "Constitutive promoters" refer to those who direct gene expression in all tissues and at all times. “Tissue-specific” or “development-specific” promoters are those that direct gene expression almost exclusively in specific tissues, such as leaves, roots, stems, flowers, fruits or seeds, or at specific stages of development in a tissue, as at the beginning or end of embryogenesis. The term "expression" refers to the transcription and stable accumulation of RNA derived from the nucleic acid fragments of the invention which, together with the cell's protein production apparatus, results in altered levels of myo-inositol 1-phosphate synthase. "Interference inhibition" refers to the production of dsRNA transcripts capable of preventing expression of the target protein.

[48] "Termination signal" or "terminators" are sequences that indicate to the RNA polymerase enzyme that it must stop RNA transcription. The transcription / terminator termination signal of the present invention includes, but is not limited to, SV40 termination signal, HSV TK adenylation signal, Agrobacterium tumefasciens (nos) nopaline synthase gene termination signal, termination signal of the CaMV RNA 35S gene, termination signal from the virus that attacks the subterranean Trifolium (SCSV), termination signal from the trpC gene of Aspergillus nidulans, and the like. For the present invention, the following “termination signals” or “terminators” were preferably used: 1) Sequence of terminator of the Arabidopsis thaliana Ahas-3 'gene (SEQ ID NO 3); 2) Sequence of the ocs-3 'terminator that terminates the expression of the K7 of RNAi Ric (SEQ ID NO 6); and 3) Sequence of the nos-3 'terminator that terminates the transcription of the gus or uidA reporter gene (SEQ ID NO 9).

[49] "Appropriate regulatory sequences" refer to nucleotide sequences in native or chimeric genes that are located above (5 'untranslated region), within, and / or below (3' untranslated region) of nucleic acid fragments of the invention, which control the expression of the nucleic acid fragments of the invention.

[50] “Altered levels” refer to the production of gene products in transgenic organisms in quantities or proportions that differ from those in normal or non-transgenic organisms. The present invention also reports vectors / gene constructs, which include fragments of castor bean gene sequences in the sense and antisense orientation, and host cells, which are genetically engineered with vectors of the invention. "Transformation" refers to the transfer of the exogenous gene into the genome of a host organism and its genetically stable inheritance.

[51] "Plants" refer to photosynthetic organisms and eukaryotes. The nucleic acids of the invention can be used to impart desired treatments to essentially any plant. So, the invention has use on several species of plants, including species of the genera Anacardium, Anona, Arachis, Artocarpus, Asparagus, Atropa, Avena, Brassica, Carica, Citrus, Citrullus, Capsicum, Carthamus, Cocos, Coffea, Cucumis, Cucurbita, Daucus, Elaeis, Fragaria, Glycine, Gossypium, Helianthus, Heterocallis, Hordeum, Hyoseyamus, Lactuca, Linum, Lolium, Lupinus, Lycopersicon, Malus, Manihot, Majorana, Medicago, Nicotiana, Olea, Oryza, Panieum, Pannesetum, Passes Phaseolus, Pistachia, Pisum, Pyrus, Prunus, Psidium, Raphanus, Ricinus, Secale, Senecio, Sinapis, Solanum, Sorghum, Theobromus, Trigonella, Triticum, Vicia, Vitis, Vigna, and Zea. Preferably for the present invention the plants are plants of the genus Ricinus. More specifically, the present invention concerns plants of Ricinus communis.

[52] Another object of the present invention is to provide eukaryotic cells, and eukaryotic organisms containing dsRNA molecules of the invention, or containing the gene constructs capable of producing dsRNA molecules of the invention. Such gene constructs can be stably integrated into the cell genome of eukaryotic organisms.

[53] In another aspect of the invention, gene constructs may be provided in a DNA molecule capable of replicating autonomously in the cells of eukaryotic organisms, such as viral vectors. In the present invention, a sequence of the origin of replication of the pKannibal Plasmid (SEQ ID NO 10) was used. The chimeric gene or dsRNA may also be transiently arranged in the cells of eukaryotic organisms.

[54] The gene constructs of the present invention also feature coding sequences for selection genes and marker genes to assist in the process of recovery from the transgenic event. There are several merchant genes and selection genes that can be used in the present invention, such as, but not limited to: nptll, hpt, neo, bar, tabs, epsps. In the present invention, the following were preferably used: 1) Sequence of the coding region of the Ahas gene from Arabidopsis thaliana (SEQ ID NO 2); 2) Sequence of the gus or uidA reporter gene (SEQ ID NO 8); and 3) Sequence of the ampicillin resistance gene of the plasmid of pKannibal (SEQ ID NO 11).

[55] One embodiment of the invention concerns a plant transformation vector comprising:

• Gene promoter according to the sequence described in SEQ ID No

4;

• A first coding region with a nucleic acid sequence as described in SEQ ID No 12;

• A second coding region with a nucleic acid sequence as described in SEQ ID No 13; • A spacer region between the first region and the second region with nucleic acid sequence according to the sequence described in SEQ ID No 5;

• Termination signal according to the sequence described in SEQ ID No 6;

• Marker gene comprising the promoter described in SEQ ID NO 7, a coding region described in SEQ ID NO 8 and a termination signal described in SEQ ID NO 9;

• Selection gene comprising the promoter described in SEQ ID NO 1, a coding region described in SEQ ID NO 2 and a termination signal described in SEQ ID NO 3.

[56] The polynucleotides, gene constructs and vectors of the invention can be introduced into the genome of the desired host plant through a variety of conventional techniques. For example, it can be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation and microinjection of plant cell protoplasts, or the construct can be introduced directly into the plant tissue using ballistic methods, such as bombardment of coated particles with DNA.

[57] Microinjection techniques are known in the art and well described in scientific and patent literature. The introduction of gene constructs using polyethylene glycol precipitations is described in Paszkowski et al. Embo J. 3: 2717-2722, 1984 (as mentioned in patent application US20020152501). Electroporation techniques are described in From et al. Proc. Natl. Acad. Know. USA 82: 5824, 1985 (as mentioned in patent application US20020152501). Ballistic transformation techniques are described in Klein et al. Nature 327: 70-73, 1987 (as mentioned in patent application US20020152501).

[58] Alternatively, the gene constructs can be combined with appropriate T-DNA flanking regions and introduced into a conventional host vector Agrobacterium tumefasciens. The function of virulence of the host Agrobacterium tumefasciens will direct the insertion of the gene constructs and adjacent marker into the DNA of the plant cell when the cell is infected by the bacterium. Transformation techniques mediated by Agrobacterium tumefasciens, including disarmament and the use of binary vectors, are well described in the scientific literature (as mentioned in patent application US 20020152501, Horsch et al. Science 233: 496-498, 1984; and Fraley et al Proc. Natl. Acad. Sci. USA 80: 4803, 1983). For the present invention, the biobalistic technique was preferably used. However, genetically modified castor plants can be obtained by A. tumefaciens.

[59] Transformed plant cells that are derived from any of the transformation techniques described above can be grown to regenerate an entire plant that has the transformed genotype and then the desired phenotype such as the absence or reduction of seed mass. Such regeneration techniques rely on the manipulation of certain phytohormones in tissue culture growth medium, typically containing a biocidal and / or herbicidal marker, which must be introduced together with the desired nucleotide sequence. Plant regeneration from protoplast culture is described in Evans et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, pp. 124-176, MacMillilan Publishing Company, New York, 1983; and Binding, Regeneration of Plants, Plant Protoplasts, pp. 2173, CRC Press, Boca Raton, 1985 (as mentioned in patent application US20020152501). Regeneration can also be achieved through plant calluses, explants, organs, or part of it. Such regeneration techniques are generally described in Klee et al., Ann. Ver. Of Plant Phys. 38: 467-486, 1987 1985 (as mentioned in patent application US20020152501).

[60] The present invention therefore relates to a method for obtaining castor plants without ricin / RCA characterized by comprising the stages of: The. Insert the nucleic acid molecule described in castor plant cells, which may be a polynucleotide, gene construct, vector or double-filament ribonucleotide, already defined;

B. Grow or regenerate castor cells in specific media;

ç. Select the castor plants with the mutated ricin gene.

[61] Without restricting the invention to a particular mode of action, it is expected that the enzyme in eukaryotic cells responsible for generating small RNA molecules, such as DICER in Drosophila, can be saturated by including an excess of dsRNA sequences (i.e., double-stranded RNA molecules) that are not related to the nucleotide sequence of the target gene or the gene to be silenced.

[62] The natural variation in the subsequent regulation of target gene expression occurring between different strains of eukaryotic organisms comprising the same dsRNA molecule will be replaced by manipulating the gene silencing spectrum. This fact can occur through the inclusion of extra dsRNA nucleotide sequences unrelated to the target gene, which are operationally linked to the dsRNA formed by the first and second regions.

[63] The invention also relates to the use of the double-stranded ribonucleotide molecule of the present invention for suppressing the expression of the ricin / RCA gene.

[64] In another embodiment of the invention, a method of identifying castor bean plants without ricin / transgenic RCA is provided, comprising the steps of:

The. forming a mixture comprising a biological sample containing castor DNA and a pair of primers capable of amplifying a specific nucleic acid molecule from a genetically modified castor plant without ricin / RCA; B. reacting the mixture under conditions that allow the nucleic acid primer pair to amplify a specific nucleic acid molecule from a genetically modified castor plant without ricin / RCA;

C. detect the presence of the specific amplified nucleic acid molecule of a genetically modified castor plant without ricin / RCA.

[65] Primers for identifying the transgenic castor bean event are described in table 1.

10

Table 1: primer pairs used to identify castor plants genetically modified without ricin / RCA.

[66] The invention is also accomplished through an identification kit of a nucleic acid molecule of the castor bean TB14S-5D event in a biological sample comprising a pair of nucleic acid primers selected from the following pairs SEQ ID NO 19 with SEQ ID NO 20, SEQ ID NO 21 with SEQ ID NO 22, SEQ ID NO 23 with SEQ ID NO 24 or 20 SEQ ID NO 25 with SEQ ID NO 26, which are capable of amplifying a nucleic acid molecule from the TB14S- event Castor 5D, this amplified molecule being the sequence shown in SEQ ID NO 27. [67] The present invention also provides a method of obtaining a castor plant without ricin / RCA, characterized by the steps of:

1. cross the castor plant containing a nucleic acid molecule from the TB14S-5D event with a second castor plant;

2. obtain seeds from the crossing of step (a);

3. obtain sample of DNA from the seed; and

4. detect the presence of the nucleic acid molecule of the castor bean plant TB14S-5D event.

[68] Finally, the present invention provides castor seed oil extracted from transgenic seeds of transformed plants comprising the nucleic acid molecules provided and castor seed cake obtained by a process that also uses said seeds.

[69] Several experiments have been carried out to check for the presence / absence of ricin and are described in the examples in this report. While the endosperm of the genetically modified seeds were used for the hemagglutination tests, survival of rat intestinal epithelial cells (IEC-6) and rats, the embryonic axes (T1) were cultured in vitro and then transferred to the greenhouse. In addition, GM plants have a strong GUS histochemical activity, which turns leaves, endosperm and embryonic axes visibly blue in 20 minutes. The use of this marker will be very useful to determine, even in field conditions, whether a specific variety is genetically modified. This and should be important for the safe use of GM varieties for animal feed, since the use of varieties with ricin is fatal.

EXAMPLES

[70] The complete sequence of the gene construct used in the present invention is described in SEQ ID NO 14 and any specialist in the field may be able to synthesize this sequence to insert it into the desired eukaryotic organism.

[71] The present invention is further defined in the following Examples. It should be understood that these Examples, while indicating part of the invention, are given as a form of illustration only, and therefore have no limiting feature on the scope of the present inventions.

[72] Usual techniques of molecular biology such as transformation of bacteria and electrophoresis in agarose gel of nucleic acids are referred to through common terms to describe them. Details of the practice of these techniques, well known in the prior art, are described in Sambrook, et al. (Molecular Cloning, A Laboratory Manual, ^2nd ed. (1989), Cold Spring Harbor Laboratory Press). Various solutions used in experimental manipulations are referred to by their common names such as "lysis solution", "SSC", "SDS", etc. The compositions of these solutions can be found in reference Sambrook, et al. (above).

Example 1

Construction of vectors for genetic transformation of castor

[73] For the construction of the vector, a fragment of the RcRCAI gene (SEQ ID NO 12, - sense and SEQ ID NO 13 - antisense) was used, which encodes the ricin A chain with high similarity to RCA120, because the A chain is responsible for toxicity.

[74] Total DNA from fresh castor tissues was isolated using the DNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA) and PCR reactions were performed to clone the RcRCAI gene using the RcRINF primers (5 '- GTCT AG ACT CG AG AC AT G AAAT AC C AGTGTTG C - 3 ') and RcRINR (5' - GAAGCTTGGTACCTAATTCTCGTGCGCAT - 3 ') plus Kpnl / Xhol and Hindi I l / Xbal enzyme sites at the end of each. The amplified fragment of about 480 bp was cloned into the pGEM-TEasy vector (Kobs, G. (1997) Cloning blunt-end DNA fragments into the pGEM®-T Vector Systems. Promega Notes 62, 15-18). So, the construction of the intron-hairpin type was made from the insertion of the RcRCAI gene fragment in sense (SEQ ID NO 12) and antisense (SEQ ID NO 12) in the pKANNIBAL (Wesley, S., Helliwell, C., Smith, N., Wang, M. , Rouse, D., Liu, Q., Gooding, P., Singh, S., Abbott, D., Stoutjesdijk, P., Robinson, S., Gleave, A., Green, A., and Waterhouse, P 2001. Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J. 27: 581 -590.) Separated by the intron PDK (SEQ ID NO 5), under promoter domain 35SCaMV (SEQ ID NO 4) and with OCS terminator (SEQ ID NO 6), allowing the expression of the ribbon RNA as a source of the generation of interfering RNAs. The transformation cassette (Promoter 35SKaMV - fragment of ricin sense - intron - fragment of antisense ricin - OCS primer) was removed from the vector pKANNIBAL at the Notl site and inserted into the vector pAG1 (Aragon, FJ L, Sarokin, L., Vianna, GR , and Rech, EL 2000. Selection of transgenic meristematic cells using a herbicidal molecule results in the recovery of fertile transgenic soybean (Glycine max (L.) Merrill) plants at high frequency. Theor. Appl. Genet. 101: 1 -6. ) containing the gus gene (b-glucuronidase - uidA) as a reporter gene and the ahas gene as a selection gene, forming the pRICRNAi gene vector / construct. (Figure 1, SEQ ID NO 14). The expression of the gus reporter gene (SEQ ID NO 8) is regulated, in this construction, by the constitutive promoter of the Actin 2 gene from Arabidopsis thaliana (SEQ ID NO 7) and by the terminator nos-3 '(SEQ ID NO 9). The ahas selection gene (SEQ ID NO 2) is regulated by the promoter of the Ahas gene from Arabidopsis thaliana and by the terminator of the Ahas-3 'gene from Arabidopsis thaliana (SEQ ID NO 3).

Example 2

Transformation of castor plants

[75] The methodology for obtaining genetically modified castor strains was developed from the bombardment of particles in meristematic regions of zygotic castor embryo. [76] Healthy seeds of the EBDA-MPA-34 cultivar were selected and disinfected with a wash in 70% alcohol for 1 minute, followed by a wash in 2% sodium hypochlorite plus Tween 20 (20pL for each 100 ml_ of solution) for 20 minutes. The method described here is not restricted to the EBDA-MPA-34 variety (other varieties can be used with similar results). The seeds were washed 4 times with autoclaved distilled water and left to soak for 24 hours. After the period, the seed coat was broken with pliers and the zygotic embryos were removed with tweezers and left in water to avoid dehydration. The embryos were washed three times with autoclaved distilled water, disinfected in 0.5% sodium hypochlorite for 10 minutes and washed five times with autoclaved distilled water, then the excess water was removed and the embryos were placed in an initial induction medium ( Mil) containing MS (Murashige and Skoog basal medium - Sigma M5519) plus casein 300 mg.L-1, thiamine 100 mg.L-1, sucrose 3%, indole-butyric acid (AIB) 0.05 mg.L- 1, thidiazuron (TDZ) 0.5 mg.L-1, agar 1, 4% and pH 4.0, in which they remained for 48 hours in an oven at 28 ° C in the dark.

[77] After this period, the embryos meristem was exposed by removing the cotyledons and the primordial leaves with the aid of a scalpel, and were placed back in the Mil mil, for 24 hours before the transformation.

[78] Zygotic castor embryos with exposed meristem were placed in bombardment medium (MB), containing 0.5X DM (Murashige and Skoog basal medium - Sigma M5519) plus 3% sucrose, 0.8% phytagel and pH 5 , 8, so that the meristem is positioned upwards, and the genetic transformation by biobalistics was performed according to Aragão et al. 2000 (Aragon, FJL, Sarokin, L., Vianna, GR, and Rech, EL 2000. Selection of transgenic meristematic cells using a herbicidal molecule results in the recovery of fertile transgenic soybean (Glycine max (L.) Merrill) plants at high frequency, Theor, Appl, Genet, 101: 1-6). [79] From histological and anatomical analyzes of explants induced and cultured in culture media, before and after genetic transformation, aiming at visualizing the cell layers of the apical meristem of the zygotic embryo that were being transformed, cells competent for genetic transformation and for regeneration they were induced in the specific culture media to generate new gems, and in this way, to obtain transgenic shoots. The second bottleneck in the process was the in vitro rooting of transgenic shoots, which was induced, making it possible to obtain an entire GM plant with transfer of the transgenes to their offspring.

[80] Thus, after the transformation, the embryos were transferred again to the Mil medium where they remained for 24 hours and then they were transferred to the MIS induction and selection medium containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L · ¹ , casein 300 mg.L · ¹ , thiamine 100 mg.L · ¹ , sucrose 3%, AIB 0.05 mg.L ¹ , TDZ 0.5 mg.L ¹ , imazapyr 150 nM , 1, 4% agar and pH 4.0 where they remained for seven days. After this period, the explants were transferred to multibrotation and selection maintenance (MMM) containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L · ¹ , casein 300 mg.L · ¹ , thiamine 100 mg.L · ¹ , sucrose 3%, AIB 0.1 mg.L · ¹ , zeatin 1 mg.L · ¹ , imazapyr 150 nM, agar 1, 4% and pH 4.0 for 15 days. After the period, the sprouts were separated and transferred to sprout elongation medium (MAB) containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L · ¹ , casein 300 mg.L · ¹ , thiamine 100 mg.L · ¹ , sucrose 3%, AIB 1 mg.L · ¹ , gibberellic acid (GA3) 1 mg.L · ¹ , 5 mM silver nitrate, 200 nM imazapyr, 1% 4 agar and pH 4, 0, and maintained, with peaks every 15 days, until the appearance of well-structured and elongated explants of about 2-3 cm which were transferred to rooting medium ME containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L · ¹ , casein 300 mg.L · ¹ , thiamine 100 mg.L · ¹ , sucrose 3%, AIB 2 mg.L ^{· 1} , gibberellic acid (GA3) 0.5 mg.L ^{· 1} , 5 mM silver nitrate, 1, 4% agar and pH 4.0. Seedlings of about 3-4 cm and with roots were acclimatized in a greenhouse in 700 ml cups containing soil and vermiculite (1: 1) with a plastic bag to maintain an age. After being acclimatized, the plants were transferred to an 8 L pot containing soil.

Example 3

Regeneration of castor plants

[81] After the transformation, the embryos were transferred again to the Mil medium where they remained for 24 hours and then they were transferred to the MIS induction and selection medium containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L-1, casein 300 mg.L-1, thiamine 100 mg.L-1, sucrose 3%, AIB 0.05 mg.L-1, TDZ 0.5 mg.L-1, imazapyr 150 nM, agar 1, 4% and pH 4.0 where they remained for seven days. After this period, the explants were transferred to multibrotation and selection maintenance (MMM) containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L-1, casein 300 mg.L-1, thiamine 100 mg.L-1, sucrose 3%, AIB 0.1 mg.L-1, zeatin 1 mg.L-1, imazapyr 150 nM, agar 1, 4% and pH 4.0 for 15 days. After the period, the sprouts were separated and transferred to sprout elongation medium (MAB) containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L-1, casein 300 mg.L-1, thiamine 100 mg.L-1, sucrose 3%, AIB 1 mg.L-1, gibberellic acid (GA3) 1 mg.L-1, 5 mM silver nitrate, 200 nM imazapyr, agar 1, 4% and pH 4, 0, and maintained, with peaks every 15 days, until the appearance of well-structured and elongated explants of about 2-3 cm which were transferred to rooting medium ME containing MS (Murashige and Skoog basal medium - Sigma M5519) plus inositol 100 mg.L-1, casein 300 mg.L-1, thiamine 100 mg.L-1, sucrose 3%, AIB 2 mg.L-1, gibberellic acid (GA3) 0.5 mg.L-1, 5 pM silver nitrate, 1.4% agar and pH 4.0. Seedlings about 3-4 cm and with roots were acclimatized at home of vegetation in 700 ml_ cups containing red latosol and vermiculite (1: 1) with a plastic bag to maintain moisture. After being acclimatized, the plants were transferred to pots containing red latosol.

Example 4

Identification of genetically modified mamoma plants by histochemical analysis of aus

[82] TB14S-5D event tissues can be used in a histochemical assay to identify the TB14S-5D event from the expression of the GUS protein on the x-gluc substrate according to (Jefferson, RA, Kavanagh, TA & Bevan, MW GUS fusions: b-glucuronidase as a sensitive and versatile gene fusion marker in higher plants (EMBO J. 6, 3901-3907, 1987).

[83] Figure 2 shows that the transgenic plant has the construction containing the GUS gene while the control plant did not show expression of the GUS marker.

Example 5

Identification of genetically modified mamoma plants by

Southern blot

[84] It is possible to detect the TB14S-5D event by fixing the total DNA of the TB14S-5D event on a membrane and hybridize with a probe homologating the Aricin region corresponding to the amplified region with the primers PSIUINTF (SEQ ID NO 19) and PSIUINTR ( SEQ ID NO 20). Methodology according to [Lacorte, C., Vianna, G., Aragon, FJL & Rech, EL Molecular Characterization of Genetically Manipulated Plants in Plant Cell Culture: Essential Methods (ed. Davey, MR & Anthony, P.) 261 -279 (John Wiley & Sons, 2010)].

[85] Figure 3 shows the results of Southern blot with the identification of transgenic events. Example 6

Identification of genetically modified mamoma plants by Northern blot analysis

[86] RNAi analyzes of T1 seed endosperm made it possible to identify Ricina / RCA mRNAs in non-GM plants, and to identify siRNAs in the endosperm of genetically modified T1 seeds.

[87] Silence of ricin in the TB14S-5D event can be detected from RNA isolation and hybridization with a probe homologating the ricin region corresponding to a 148 bp fragment amplified using the Ric149RNAiF primer pair (SEQ ID NO 23 ) / RcRinf: (SEQ ID NO 24). The methodology was carried out according to (Aragon, FJ L, Nogueira, EOP L, Tinoco, MLP & Faria, JC Molecular characterization of the first commercial transgenic common bean immune to the Bean golden mosaic virus. J. Biotechnol. 166, 42- 50; 10.1016 / j.jbiotec.2013.04.009, 2013).

[88] Figure 4 shows the transgenic plants of the event identified via Northern blot.

Example 7

Identification of genetically modified mamoma plants by ELISA

[89] It is possible to detect ricin silencing in the TB14S-5D event from the extraction of total proteins and quantification of ricin in mature seeds of the TB14S-5D event by ELISA (Enzyme-Linked Immunosorbent Assay) according to (Baldoni, AB , Araújo, ACG, Carvalho, MH, Gomes, ACMM & Aragão, FJL Immunolocalization of ricin accumulation during castor bean (Ricinus communis L.) seed development. Int. J. Plant Biol. 1: e12, 61-65, 2010).

[90] ELISA analysis was used to detect and quantify ricin in segregating seeds of the TB14S-5D transgenic strain. The results showed that wild type (non-GM) seeds showed 20 ng ricin / pg of total protein, while segregating seeds that do not contain transgenes, showed statistically similar amounts of ricin compared to the control (non-transgenic plants). In contrast, ricin was not detectable by ELISA in transgenic seeds. Considering that the antibody produced against the ricin A chain reacts crosswise with RCA120 due to the high identity between them, our results indicated that both ricin and RCA120 were silenced.

[91] Figure 5 shows the detection of ricin silencing in the TB14S-5D event. Ricin was detected in the endosperm of non-transgenic seeds and in negative segregating seeds. However, ricin could not be detected in positive seeds of the TB14S-5D event.

Example 8

Hemaqglutination test

[92] Silencing of RCA120 in the TB14S-5D event can be detected from a red blood cell hemagglutination assay from the extraction of total proteins from the TB14S-5D event and addition in a serially diluted blood solution, which can be red blood cell hemagglutination was observed.

[93] Ricin is a lectin that has been described as weak hemagglutinin, while RCA120 has a strong hemagglutination activity. Therefore, we performed a hemagglutination test with total proteins isolated from the endosperm of transgenic and non-transgenic castor seeds. We observed strong hemagglutination when proteins isolated from non-transgenic seeds were used at a concentration of 2.5 pg / pL of total protein, and it was evident up to a concentration of 19 ng / pL of total protein. In contrast, no hemagglutination activity was visible with proteins isolated from transgenic seeds, even at the highest protein concentration. (approximately 131 times more concentrated). In addition, agglutination activity was not observed in ox blood cells incubated with PBS (white), while the purified RCA120 showed strong hemagglutination activity even at a concentration of 0.39 ng / pL. In addition to the absence of transcripts, the proteins ricin and RCA120 were not detected in the endosperm of T1 seeds of the TB14S-5D strain, confirming the efficient silencing of Ricina and RCA120.

[94] Figure 6 shows the result of a hemagglutination assay done with seed proteins from the TB14S-5D event and a control showing that seed proteins from the TB14S-5D event did not agglutinate red blood cells, as occurred with negative control (PBS) forming a point at the bottom of the plate, while non-transgenic seed proteins agglutinated red blood cells as occurred in the positive control (RCA120) forming a diffuse background.

Example 9

Identification of genetically modified mamoma plants by PCR

[95] It is possible to detect the TB14S-5D event by PCR using primer pairs PSIUINTF (SEQ ID NO 19) with PSIUINTR (SEQ ID NO 20) and AHASCD2F (SEQ ID NO 25) with SOJAE1 R (SEQ ID NO 26). Methodology used according to Lacorte, C., Vianna, G., Aragon, FJL & Rech, EL Molecular Characterization of Genetically Manipulated Plants in Plant Cell Culture: Essential Methods (ed. Davey, MR & Anthony, P.) 261 -279 (John Wiley & Sons, 2010). Figure 9 schematically shows the region amplified by the first AFIASCD2F and SOJAE1 R.

[96] Figures 7 and 8 show that the event's transgenic plants were detected with the primers used. In Figure 8, it is possible to observe the presence of the 396 bp band referring to SEQ ID NO 27, which is a specific marker for the TB14S-5D event. Example 10

Cell viability test

[97] Rat gut epithelial cells (IEC-6) were incubated for 24 h with total proteins isolated from transgenic and non-transgenic seed endosperm. The viability of cells exposed to proteins isolated from non-GM plants containing 1 or 10 ng ricin / mL was reduced to 53% and 16%, respectively. However, cells exposed to the equivalent amount of transgenic seed proteins maintained their viability at 97% (at 0.5 pg total protein / m L), and at 78% at the highest protein concentration (50 pg total protein / m L ). There was no statistical difference between the viability values of 97% and 78%, and these results were corroborated by the fact that protein synthesis was inhibited from 40% to 90% in cells grown for 5 h with proteins from non-transgenic seeds containing 0 , 1 and 1 ng ricin / mL, respectively. However, no inhibition was observed in cells cultured in the presence of the equivalent amount of proteins isolated from transgenic seeds, even at the highest concentration of total protein. Therefore, we demonstrated that the seeds of GM plants were not toxic for the cultivation of rat intestinal epithelial cells.

Example 11

Survival test

[98] Rats (Swiss Webster) were treated via intraperitoneal administration with castor seed endosperm to measure ricin toxicosis in the lethal challenge test. We performed the ricin challenge by injecting rats with total proteins isolated from the TB14S-5D event and from non-transgenic seeds. As expected, all animals that were subjected to intraperitoneal injection of 20 pg of wild-type seed proteins / g of body weight (552 pg of ricin / kg of body weight) died in the first 24 h period. However, animals injected with the equivalent amounts of total proteins isolated from seeds of the TB14S-5D event survived, with no visible symptoms of ricin intoxication (diarrhea, weakness, low appetite, dark stools and weight loss). In fact, there has been a noticeable decrease in blood glucose from animals injected with proteins from non-GM seeds. However, there was no significant change in the glycemia of animals injected with proteins from transgenic seeds for a period of 60 h. The animals were monitored for an additional seven days and no deaths were recorded for those injected with TB14S-5D event proteins. In the in vivo toxicity test with total proteins isolated from seeds of the TB14S-5D event, even in an amount of 15 to 230 times the LD50 values, did not show toxic effects in the rats. Based on our results, it was possible to predict that rats could consume up to 52% of their body weight from castor bean cake derived from the GM plant, without acute intoxication. Generally, cows, sheep and goats consume only 1 to 2% of their body weight per day as a source of protein.

Claims

1. Synthetic polynucleotide characterized by comprising:

A) A first region with a nucleic acid sequence with at least 90% similarity to the sequence described in SEQ ID No 12;

B) A second region with the complement of the sequence of

(THE);

Polynucleotide according to claim 1, characterized in that the nucleic acid sequence of (A) has at least 95% similarity with the sequence described in SEQ ID No 12.

Polynucleotide according to claim 2, characterized in that the nucleic acid sequence of (A) is at least 99% similar to the sequence described in SEQ ID No 12.

Polynucleotide according to claim 3, characterized in that the nucleic acid sequence of (A) has the sequence described in SEQ ID No 12.

Polynucleotide according to any one of claims 1 to 3, characterized in that the first and second regions are capable of producing a double-stranded RNA molecule.

Polynucleotide according to claim 5, characterized in that it has a spacer region between the first region and the second region.

Polynucleotide according to claim 6, characterized in that the spacer sequence is an intron.

Polynucleotide according to claim 7, characterized in that the intron is selected from the group consisting of pdk intron, pdk2 intron, castor catalase intron, Delta 12 cotton desaturase, Delta 12 Arabidopsis desaturase, corn ubiquitin intron, intron SV40 and ricin gene introns.

Polynucleotide according to claim 8, characterized in that the spacer region is the pdk intron.

10. Synthetic polynucleotide characterized by comprising: a) A first region with a nucleic acid sequence as described in SEQ ID No 12; b) A second region with a nucleic acid sequence as described in SEQ ID No 13; c) A spacer region between the first region and the second region with a nucleic acid sequence according to the sequence described in SEQ ID No 5.

11. Gene construction characterized by comprising:

i) A polynucleotide according to any one of claims 1 to 10;

ii) Region of active gene promoter operationally linked to the polynucleotide defined in (i).

Gene construction according to claim 11 characterized in that the gene promoter of (ii) has a nucleic acid sequence as described in SEQ ID No 4.

Plant transformation vector characterized in that it comprises gene construction according to claim 11 or 12.

14. Plant transformation vector characterized by comprising:

• Gene promoter according to the sequence described in SEQ ID No

4;

• A second coding region with a nucleic acid sequence as described in SEQ ID No 13;

• A spacer region between the first region and the second region with a nucleic acid sequence according to the sequence described in SEQ ID No 5;

• Termination signal according to the sequence described in SEQ ID No 6;

15. Double-stranded ribonucleotide molecule characterized by being produced from the expression of a nucleic acid molecule according to any of claims 1 to 14.

16. Use of the molecule of claim 15, characterized in that it results in suppression of the expression of the ricin / RCA gene.

17. Method for obtaining castor plants without ricin / RCA characterized by comprising the following steps: I) Inserting nucleic acid molecule into castor plant cells according to any one of claims 1 to 15;

II) Grow or regenerate cells in specific media; III) Select the plants with the mutated ricin gene.

18. Eukaryotic cell characterized by comprising a nucleotide molecule according to any one of claims 1 to 15.

19. Eukaryotic cell according to claim 18, characterized by being a cell of Ricinus communis.

20. Transformed plant characterized by comprising a nucleotide molecule defined in any one of claims 1 to 15.

21. Plant according to claim 20, characterized by being a plant of Ricinus communis.

22. Plant according to claim 21, characterized by being the TB14S-5D event.

23. Transgenic seed or propagating part characterized by being of a plant according to claim 20.

24. Method of identifying a genetically transformed plant characterized by comprising the steps of: A. forming a mixture comprising a biological sample containing castor DNA and a pair of primers capable of amplifying a specific nucleic acid molecule of a genetically modified castor plant without ricin / RCA;

B. reacting the mixture under conditions that allow the nucleic acid primer pair to amplify a molecule nucleic acid specific of a genetically modified castor plant without ricin / RCA;

C. detect the presence of the specific amplified nucleic acid molecule of a castor plant genetically modified without ricin / RCA.

25. Method according to claim 24, characterized in that the genetically modified castor plant without ricin / RCA is the TB14S-5D event.

26. Method according to claim 24, characterized in that the primer pair is selected from the following pairs SEQ ID NO 19 with SEQ ID NO 20, SEQ ID NO 21 with SEQ ID NO 22 or SEQ ID NO 23, SEQ ID NO 24 or SEQ ID NO 25 with SEQ ID NO 26.

Method according to claim 26, characterized in that the primer pair is SEQ ID NO 25 with SEQ ID NO 26.

28. Method according to claim 24, characterized in that step B amplifies specific nucleic acid molecule according to the sequence described in SEQ ID NO 27.

29. Kit for identifying a castor oil nucleic acid molecule in a biological sample capable of amplifying the nucleic acid molecule of the TB14S-5D event characterized by comprising a pair of nucleic acid primers selected from the following pairs SEQ ID NO 19 with SEQ ID NO 20, SEQ ID NO 21 with SEQ ID NO 22, SEQ ID NO 23 with SEQ ID NO 24 or SEQ ID NO 25 with SEQ ID NO 26.

Identification kit according to claim 29, characterized in that it comprises the nucleic acid primer pair SEQ ID NO 25 with SEQ ID NO 26.

31. Kit for identification of a castor oil nucleic acid molecule in a biological sample characterized by amplifying the sequence described in SEQ ID NO 27.

32. Method of obtaining a castor plant without ricin / RCA characterized by comprising the following steps:

I. crossing the castor plant containing a nucleic acid molecule from the TB14S-5D event with a second castor plant;

II. obtain seeds from the crossing of step I;

III. obtain sample of DNA from the seed; and

IV. detect the presence of the event nucleic acid molecule

TB14S-5D of castor plant.

33. Method of obtaining a castor plant without ricin / RCA according to claim 32, characterized in that step IV detects the presence of the nucleic acid molecule described in SEQ ID NO 27.

34. Castor seed oil, characterized in that it is extracted from transgenic seed that comprises a nucleotide molecule according to any one of claims 1 to 15.

35. Castor seed cake characterized by being obtained by a process using transgenic seed that comprises a nucleotide molecule according to any one of claims 1 to 15.