CN111778249B - Castor drought inducible promoter PDAT1-2P8 and cloning and application thereof - Google Patents

Abstract

The invention relates to the technical field of genetic engineering and molecular biology, and particularly discloses a castor-oil plant drought-inducible promoter PDAT1-2P8 and cloning and application thereof. The castor drought inducible promoter PDAT1-2P8 has the nucleotide sequence shown as SEQ ID No. 1. The castor drought inducible promoter PDAT1-2P8 can drive the specific expression of exogenous genes in arabidopsis thaliana under drought induction. The new castor drought inducible promoter PDAT1-2P8 obtained by the invention can drive the specific expression of exogenous genes under drought conditions, and the cloning identification of the promoter has important application value for improving plant quality or heterogeneously synthesizing drug protein by taking plants as bioreactors and the like.

Description

Castor drought inducible promoter PDAT1-2P8 and cloning and application thereof

Technical Field

The invention relates to the technical field of genetic engineering and molecular biology, in particular to a castor-oil plant drought-inducible promoter PDAT1-2P8 and cloning and application thereof.

Background

Castor is an annual or perennial herb of the genus ricinus of the family Euphorbiaceae (Euphorbiaceae), and the fruit of the seed is rich in oil and protein, and is an important industrial raw material. The triacylglycerol content of castor seeds ranges from 39.6% to 59.5%, and contains a special hydroxylated fatty acid, ricinoleic acid (Ricinolic acid), which is a Hydroxy Fatty Acid (HFA) and is the main component of castor oil, accounting for 83.65% to 90.00% of the triacylglycerol of castor oil, with an average value of 88.30%. Castor oil is used as an oil crop, namely castor oil is produced by using seeds, and the castor oil is widely applied to a plurality of fields. Phospholipid: the role played by diacylglycerol acyltransferase (PDAT) in TAG synthesis is to transfer the acyl group at the sn-2 position of the Phospholipid to the DAG sn-3 position independently of the acyl-CoA, an important reason for the high ricinoleic acid production in castor oil.

Since the transgenic plant is obtained for the first time in 1983, the plant genetic engineering technology plays a great role in solving the food, energy and environmental crisis faced by human beings and the like and shows good prospects, the exogenous gene can realize normal and even high-efficiency expression in plant tissues, an important condition is to construct an expression vector for high-level expression of heterologous protein, and a high-efficiency expression vector, and a promoter is one of the most important elements. A number of specific promoter sequences have been identified in eukaryotes to date, often in the region from-20 to-220 bp upstream of the nucleotide sequence 5' to the transcription start point of the gene.

Different promoters give genes with different expression characteristics. Selection of an appropriate promoter is important for the expression level of the foreign gene. Promoters which enable the expression of genes in most cell types are known as constitutive promoters, e.g., for many dicotyledonous plant transgenes, the most commonly used promoter is the 35S promoter from cauliflower mosaic virus (CaMV). They are the earliest and most widely used promoters in plant genetic engineering, and are characterized by that its expression is continuous, and its expression quantity is basically constant, and because of said characteristics the exogenous gene product can produce adverse effect on plant growth and development, and can even result in death. In addition, repeated use of the same promoter to drive two or more foreign genes may cause gene silencing or co-suppression phenomena. In order to make the exogenous gene play a role in the plant body efficiently and reduce adverse effects on the plant, people are increasingly paying more attention to research and application of a specific expression promoter and an inducible promoter, so that the promoter can start gene expression in a specific tissue and a certain development period, the gene expression can respond to specific conditions, the effective play of the exogenous gene in the plant body is ensured, and the adverse effects on the plant are reduced. At present, a large number of specific promoters and inducible promoters have been cloned and functionally analyzed, and have been widely used in plant genetic engineering. The clone of the drought inducible promoter disclosed by the invention is identified to have good application value in the next step of plant genetic engineering modification.

Disclosure of Invention

The invention provides a promoter PDAT1-2P8 from castor, and cloning and application thereof, wherein a 1569bp promoter fragment PDAT1-2P is cloned in the castor, and after bioinformatics analysis and onion transgenic transient expression verification, the PDAT1-2P is determined to be a promoter capable of driving exogenous gene expression, and partial fragments are further intercepted and permanently expressed in arabidopsis thaliana to verify that PDAT1-2P8 has drought induced expression characteristics.

The technical scheme of the invention is as follows:

the invention provides a castor drought-inducible promoter PDAT1-2P8, the nucleotide sequence of which is shown as SEQ ID No. 1.

The castor drought inducible promoter PDAT1-2P8 contains RNA polymerase binding sites TATA box, CAAT box, MBS (drought response element), ABRE (abscisic acid response element), GT1-motif (light response element) and other cis-acting elements.

The invention has the advantages and technical effects that: the invention firstly extracts the total DNA of castor leaf, uses promoter specific primers PDAT1-2-1-T and PDAT1-2-3-B to carry out PCR amplification, and connects the amplified fragment glue to cloning vector pMD after recovering the amplified fragment glue^TM-18T. Bioinformatics analysis shows that the PDAT1-2P promoter region contains common TATA-box and CAAT-box, and also contains various cis-acting elements such as elements participating in photoresponse, drought response (MBS), drought induced reaction (MBS), methyl jasmonate response elements (TGACG-motif and CGTCA-motif) and MYB binding sites. From pMD with PstI and Nco I^TMThe fragment was excised from the-18T vector and replaced with 35S in the plant expression vector pCAMBIA 1303. The constructed plant expression vector is transferred into agrobacterium GV 3101. Transient expression analysis in onion shows that the promoter can promote the expression of green fluorescent protein GFP gene, which indicates that the promoter has the function of promoting gene expression.

The PDAT1-2P8 promoter sequence was amplified from the expression vector using the primers PDAT1-2-2-T and PDAT1-2-2-B, ligated first into the cloning vector pMDTM-18T, and then from pMD using PstI and Nco I^TMThe fragment cut by the-18T vector is connected into an expression vector pCAMBIA1303 to replace a 35S promoter, GUS histochemical staining finds that transgenic arabidopsis does not show blue, after being treated by drought for 12h, 24h, 32 h and 48h, the GUS enzyme activity is increased, then reduced and then increased, which are obviously enhanced compared with the control, which shows that PDAT1-2P8 has weak capability of driving the expression of downstream genes under the non-drought condition, and drives GUS reporter genes to be highly expressed in plants under the drought induction condition, and the promoter is a drought induction promoter.

Drawings

FIG. 1 shows the fluorescent quantitative PCR detection of the expression of PDAT 1-2P-driven downstream genes in castor bean (root), stem (stem), leaf (leaf), male flower (flower) and seeds of different developmental stages (5DAP, 10DAP, 15DAP, 20DAP, 25DAP, 30DAP, 35DAP, 40DAP, 50DAP, 60 DAP).

FIG. 2 is a schematic of PCR amplification of the PDAT1-2P promoter.

Wherein, A: the promoter PDAT1-2P PCR amplified fragment is shown schematically, and the length of the amplified PDAT1-2P fragment is 1569 bp; b: PCR identification is carried out on pMD18T-PDAT1-2P plasmid, and the length of the amplified PDAT1-2P fragment is 1569 bp; c: the pCAMBIA1303-PDAT1-2P plasmid is identified by PCR, and the length of the amplified fragment containing PDAT1-2P is 1906 bp; the length of the 35S-containing p-photograph segment was 1107 bp.

FIG. 3 is a schematic diagram of the structure of plant expression vectors pCAMBIA1303 and pCAMBIA1303-PDAT1-2P when PDAT1-2P promoter was constructed.

FIG. 4 is an amplification diagram of the PDAT1-2P8 promoter sequence.

Wherein, A: the PCR amplified fragment of the promoter PDAT1-2P8 is shown schematically, the length of the amplified PDAT1-2P8 fragment is 625bp, and a 7-lane in the figure; b: the pMD18T-PDAT1-2P8 plasmid is identified by PCR, the length of the amplified PDAT1-2P fragment is 625bp, and a 7-lane in the figure; c: the PCR identification of the pCAMBIA1303-PDAT1-2P8 plasmid amplified contains a fragment of 625bp PDAT1-2P, lane 7 in the figure.

FIG. 5 is a schematic diagram of the structure of plant expression vectors pCAMBIA1303 and pCAMBIA1303-PDAT1-2P8 when the PDAT1-2P8 promoter was constructed.

FIG. 6 shows the sequence of the PDAT1-2P8 promoter and analysis of action elements.

FIG. 7 is a GUS histochemical stain in which transgenic Arabidopsis leaves, stems, calyx and fruit pods can be stained blue but in a very light color.

FIG. 8 shows GUS enzyme activity assay of transgenic Arabidopsis leaves containing PDAT1-2P8 promoter at different times before and after drought treatment.

Detailed Description

The technical solution of the present invention will be described in further detail with reference to the accompanying drawings and the detailed description.

Example 1

The present embodiment specifically includes the following test procedures:

1.1 plant Material

The leaf of castor bean No. 5 castor bean in the 4-leaf stage is adopted in the experiment, is quickly frozen by liquid nitrogen and is stored at minus 80 ℃ for standby.

1.2 strains and vectors

The strain is as follows: escherichia coli DH 5. alpha. competent cells were purchased from International Biogene technology Ltd of the Union of Beijing village. Agrobacterium GV3101 competent cells, purchased from Shanghai Fenghui Biotech Co., Ltd.

Carrier: the cloning Vector pMDTM18-T Vector, purchased from Takara Bio Inc. The plant expression vector pCAMBIA1303 was stored in this laboratory.

A protein concentration determination kit (Beijing Solaibao Tech Co., Ltd.),

1.3 analysis of endogenous expression of PDAT 1-2P-driven Gene

Gene specific primers PDAT1-2(F) and PDAT1-2(R) (shown in Table 1) are designed, RNA of the root, stem, leaf, male flower and castor seed in different development stages of 'Tongri No. 5' is extracted, and the RNA is reversely transcribed into cDNA. The expression of the gene in roots, stems, leaves and seeds at different development stages is detected by using an RT-PCR method, and the castor gene 18s rRNA is used as an internal reference gene (Table 1).

The experimental results of fig. 1 show that: the gene has strong expression signals in seeds, and has little expression quantity in roots, stems, leaves and male flowers. This indicates that the gene is strongly expressed in seeds.

1.4 DNA extraction of castor leaf and cloning of PDAT1-2P promoter fragment

The invention uses plant genome DNA extraction kit to extract the genome of 'Tongri No. 5' young leaf. The primer sequence of the PDAT1-2P promoter containing PstI and Nco I cleavage sites is designed by using SnapGene3.2.1, and the upstream primer sequence is PDAT 1-2-1-T: 5' -AACTGCAGGAGGATGAACAGTCTCAGAT-3', the sequence of the downstream primer is PDAT 1-2-3-B: 5' -CATGCCATGGCGTTTTAGTGATTTTGTTG-3', and amplifying RcPDAT1-2 promoter by using castor leaf DNA in the four-leaf stage as a template.

And (3) PCR reaction system: ddH₂O 33.5μL，10x LA PCR buffer(Mg²⁺Plus) 5. mu.L; dNTP mix 8. mu.L; 1 μ L each of PDAT1-2-1-T/PDAT1-2-3-B (10 μ M); TaKaRa LA Taq 0.5 μ L; genome template 2. mu.L.

And (3) PCR reaction conditions: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 45sec, annealing at 59 ℃ for 45sec, annealing at 72 ℃ for 2min, and 30 cycles; extending for 5min at 72 ℃; storing at 4 ℃. The gel containing the desired band was cut after electrophoresis using 1% agarose gel, and the PCR product was recovered using an agarose gel recovery kit (Beijing Solebao technologies Co., Ltd.). The recovered product is connected with a Vector pMDTM18-T Vector, and transformed into escherichia coli DH5 alpha by a heat shock method, the positive clone is sent to China academy of agricultural sciences for sequencing, and the sequence is correctly sequenced and named as pMD18T-PDAT 1-2P.

1.5 construction of promoter PDAT1-2P expression vector

Extracting pCAMBIA1303 and pMD18T-PDAT1-2P plasmids, double digesting with restriction enzymes Nco I and Pst I respectively, recovering pCAMBIA1303 large fragment and pMD18T-PDAT1-2P small fragment, and treating with T₄The DNA Ligase was ligated and transformed into E.coli DH 5. alpha. and the correctly ligated plasmid was identified and named pCAMBIA1303-PDAT 1-2P. Culturing Escherichia coli containing pCAMBIA1303-PDAT1-2P, extracting plasmid, transforming Agrobacterium GV3101 competence, identifying after culturing, using PCR primers pC1303F and pC1303R for identification, and storing after correct identification.

1.6 verification of transient expression activity of PDAT1-2P promoter in onion epidermis

Agrobacterium containing pCAMBIA1303-PDAT1-2P and pCAMBIA1303 plasmids were inoculated into liquid YEB medium containing 250. mu.L Kan and 500. mu.L Rif, respectively, and shake-cultured at 180rpm in a shaking incubator at 28 ℃ for 24 hours. Centrifuging the cultured agrobacterium liquid at 12000 rpm for 5min to collect thalli, discarding supernatant, and resuspending thalli precipitation by MS liquid culture medium containing 10mmol/L MgCl2 and 20mg/L AS, wherein when the OD600 value of the resuspension liquid is about 1.5, the onion epidermal cells can be infected for 20 min. Sucking the bacterial liquid on the surface of the onion epidermis with filter paper, spreading the onion epidermis in an MS solid culture medium, and co-culturing for 48 hours under the conditions of 16 hours of illumination, 8 hours of dark photoperiod and 25 ℃. The co-cultured onion epidermal cells were carefully removed from the solid MS medium, and the epidermal cells were gently washed with sterile water several times to prepare temporary sections, and the fluorescence phenomenon was observed in a fluorescence microscope and photographed.

1.7PDAT1-2P8 promoter sequence amplification and vector construction

The pCAMBIA1303-PDAT1-2P plasmid is used as a template, primers PDAT1-2-2-T and PDAT1-2-2-B in the table 1 are used for amplification, a PCR reaction system is 1.4 except for the selection difference of the primers, amplification parameters are 1.4 except for the annealing temperature of 53 ℃, and detection is carried out by 1% agarose gel electrophoresis.

The PCR product with correct detection is recovered through agarose gel and cloned with vector pMD^TM18-T was ligated overnight at 16 ℃ and designated pMD18T-PDAT1-2P8, transformed into E.coli DH5 α competent cells and identified by PCR. Detecting the correct plasmid, carrying out double enzyme digestion on PstI and NcoI, recovering a small fragment, connecting with pCAMBIA1303 of an expression vector, carrying out double enzyme digestion on PstI and NcoI, recovering a large fragment, transforming, verifying, and carrying out agrobacterium transformation and identification after verification is successful.

The promoter DNA sequence (SEQ IN NO: 1) is as follows:

GACAATACACAAAGGACAGAACATAAAAGACATTAAATAAAAATATAAGAATCTTAAAGGTTCTAAAAGTTAAAGAGATCTTCATTGCATCTCTAATGCTTCCAAAGATTCTTTATGCATGCATCGGAGAAGAATTTTAACCGTTAATATTTTAATTTAATAATATAAAATATATTAATTAATATCATTTACTTTACTGACCTGCATAACTCTCCATTTCCAGTTGCTAAGATTAGAGATTAAACACCGCATATTCTTTTGAGTCGGATTAGTACTAATTTCTATTTTCACAATAAAAATTATTAATTTCCATATCACAAAAGAAATTATTAATTTCTTAAAAGCTTAGAAGAAGGTTAATTAAAATCCTCCGTTGACTAACACGTAGCTACACGTAGCGTTTCATGGAGGCATGTCATGCCAAATGTGCTACAGAAGGAAGCATAAAAGTGAACATCTGCCAACTNNNTGTAATGAATAGATCACCGTTCACATTCGACGCCGCATCACTGAAACAGTAGCCAAGTAGCAAATGCGCTCCTAGATTTCTCTTCATCACGCCACGTGTATATTTTCTCAGCACGGGGTCCACACACCTCGAGGGTATCTTTCAACTTTGAAACTT

1.8PDAT1-2P8 promoter sequence and cis-acting element analysis

The amplified promoter sequence was analyzed on-line by PLACE (http:// www.dna.affrc.go.jp/PLACE/signalscan. html. the PDAT1-2P8 promoter contains important RNA polymerase binding sites TATA box, CAAT box (FIG. 6), and drought response element MBS (FIG. 6). in addition, hormone response elements (such as abscisic acid and methyl jasmonate, etc.), and element sequences responding to light signals, and anaerobic induction (Table 2).

1.9 Arabidopsis genetic transformation and identification of transgenic plants

Transforming Arabidopsis by using a flower dipping method, and collecting Arabidopsis T infected by agrobacterium₀Replacing seeds, placing in 10mL sterilized centrifuge tube, cleaning seeds with sterile water for 1 time, treating with 75% alcohol for 6min, and treating with sterile ethanolContinuously washing the bacteria with water for 4 times; sowing the seeds in a culture dish containing 50mg/L hygromycin, sealing the culture dish by using a parafilm, and placing the culture dish in a constant-temperature incubator at 21 ℃ for about 3 weeks. Transplanting the plant in good growth state into small flowerpot after 3 weeks, wherein the soil composition and culture conditions are the same as T₀The subculture conditions were the same. Extracting genome DNA of each plant, performing PCR detection with 1303F/1303R on the carrier as primer, and identifying correct gene₂Subculturing and collecting T₂And (5) seed generation.

1.10 transgenic Arabidopsis GUS staining analysis

Preparing GUS-stabilizing solution (0.05M sodium phosphate buffer solution; 10mM EDTA; 0.5mM potassium ferricyanide; 0.5mM potassium ferrocyanide; 1mM X-Gluc; 0.1% Triton X-100); washing the material to be detected for 3 times by using GUS-stabilizing solution without X-Gluc; completely soaking a material to be detected in GUS-stabilizing solution containing X-Gluc, placing the material into a vacuum air extractor to extract vacuum for 10min, wrapping a centrifugal tube by using tinfoil paper, placing the centrifugal tube in an oscillation incubator at 37 ℃ overnight at 150rpm, washing the dyed material with water for the next day, then transferring the dyed material into 70% alcohol to decolorize, changing decolorizing solution every 1h until the background of the material is completely decolorized, and placing the material under a microscope to observe and take a picture.

GUS histochemical staining found (fig. 7): transgenic Arabidopsis leaves, stems, flowers and pods were not stained blue.

1.11 functional validation of the drought response element of the RcPDAT1-2P8 promoter

To investigate the effect of drought on the activity of the PDAT1-2P8 promoter. The T of the RcPDAT1-2P8 promoter containing the MBS drought response element₃Transgenic Arabidopsis seeds were generated, vernalized in a refrigerator at 4 ℃ and treated again with 50mg/L hygromycin. Culturing for about 3 weeks, transplanting plants with consistent growth state into small flowerpot, culturing for two weeks, performing drought stress on wild type and transgenic Arabidopsis, placing in 4 deg.C constant temperature incubator for drought treatment, performing 16 hr illumination and 8 hr dark treatment for 48 hr, sampling before treatment as control, sampling every 12 hr, quick freezing with liquid nitrogen, repeating three Arabidopsis for one and three for three, and performing GUS enzyme activityAnd (3) detection:

and (4) quickly freezing and storing the transgenic arabidopsis leaves in different treatment periods in liquid nitrogen, and carrying out the next experiment after all samples are collected. And extracting total protein of the transgenic arabidopsis leaf, determining the protein content, performing operation by referring to a Bradford protein concentration determination instruction for protein content determination, and calculating the protein content in the protein solution through a BSA standard curve regression equation.

Adding 10-100 μ g total protein into 1mL GUS extract containing 1mM 4-MUG (the reaction solution should be preheated), reacting at 37 deg.C, and adding 800uL 0.2M Na into 200 μ L each at 5min, 15min, 25min and 35min₂CO₃。

Preparing 4-MU standard substance with 0.2mol Na₂CO₃The 10mmol 4-MU was diluted with 12 gradients, 1mmol, 0.5mmol, 0.25mmol, … … respectively, to remove the 5 high concentrations, and 7 low concentrations were used as standard curves. The diluted 4-MU can be stored at 4 deg.C for a short period, and is protected from light.

Sucking out 200. mu.L of reaction product, adding into black enzyme label plate, adding 4-MU standard substance into each plate, namely, taking out 40. mu.L of 7 concentration gradient diluents, adding 160. mu.L of 0.2M Na₂CO₃Fluorescence was measured by exciting light at 365nm and emitting light at 455 nm. The fluorescence values are then plotted as ordinate and the 4-MU content (pmol) as abscissa to produce a standard curve. And obtaining a linear regression equation and a correlation coefficient. GUS enzyme activity was calculated before and after treatment at various times. GUS enzyme activity is defined as: per mg protein in pmol 4-MU was produced per minute. The results are shown in FIG. 8. As can be seen from the results, the GUS enzyme activity is prolonged along with the time after drought induction, and the GUS enzyme activity is continuously increased, which indicates that the promoter has the characteristic of drought-induced downstream gene expression.

TABLE 1 primers used in the present invention

Underlined parts are PstI and NcoI recognition sites

TABLE 2 cis-acting elements in the PDAT1-2P8 sequence

TABLE 1 preparation of BSA Standard Curve

Sequence listing

<110> university of inner Mongolia nationality

<120> castor drought inducible promoter PDAT1-2P8 and cloning and application thereof

<130> 2020

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 625

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gacaatacac aaaggacaga acataaaaga cattaaataa aaatataaga atcttaaagg 60

ttctaaaagt taaagagatc ttcattgcat ctctaatgct tccaaagatt ctttatgcat 120

gcatcggaga agaattttaa ccgttaatat tttaatttaa taatataaaa tatattaatt 180

aatatcattt actttactga cctgcataac tctccatttc cagttgctaa gattagagat 240

taaacaccgc atattctttt gagtcggatt agtactaatt tctattttca caataaaaat 300

tattaatttc catatcacaa aagaaattat taatttctta aaagcttaga agaaggttaa 360

ttaaaatcct ccgttgacta acacgtagct acacgtagcg tttcatggag gcatgtcatg 420

ccaaatgtgc tacagaagga agcataaaag tgaacatctg ccaactnnnt gtaatgaata 480

gatcaccgtt cacattcgac gccgcatcac tgaaacagta gccaagtagc aaatgcgctc 540

ctagatttct cttcatcacg ccacgtgtat attttctcag cacggggtcc acacacctcg 600

agggtatctt tcaactttga aactt 625

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgacaggtgg aagcgagaac 20

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aacatgagca ccactctggg 20

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aggggataac caccccatga atcca 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgcatggtct cctgatacgg ccaag 25

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aactgcagga ggatgaacag tctcagat 28

<210> 7

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

catgccatgg gagatgcaat gaagatct 28

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aactgcaggc ctccattttc aattcatt 28

<210> 9

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

catgccatgg gaagtttcaa agttgaaag 29

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgcgcgttgg ccgattcatt a 21

<210> 11

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cgcgatccag actgaatgcc cac 23

Claims (3)

1. A castor drought inducible promoter PDAT1-2P8 is characterized in that: the nucleotide sequence is shown as SEQ ID No. 1.

2. The use of the castor drought-inducible promoter PDAT1-2P8 of claim 1 for driving the specific expression of an exogenous gene in Arabidopsis thaliana under drought induction.

3. The application of the castor drought-inducible promoter PDAT1-2P8 to drive the specific expression of an exogenous gene in arabidopsis thaliana under the drought induction according to claim 2, wherein the promoter PDAT1-2P8 is characterized in that: the exogenous gene is GUS gene.

Images