CN111718938B - High-temperature inducible promoter specifically expressed by plant green tissue and application thereof - Google Patents

Abstract

The invention discloses a high-temperature inducible promoter specifically expressed by plant green tissues and application thereof. The high-temperature inducible promoter is named as pRCA1, and the sequence is shown as SEQ ID No. 1. The promoter pRCA1 has the characteristics of high-temperature induction and specific expression of plant green tissues, and the expression vector of a target gene is constructed by constructing pRCA1, and then the expression vector is introduced into a target plant through transgenosis, so that the target gene can be expressed in the green tissues of the target plant under the high-temperature condition, and the purpose of increasing the expression quantity of the target gene in parts such as leaves and the like under the high-temperature stress condition is achieved. Under the global warming trend, the method has important application prospect for plant stress resistance genetic engineering.

Description

High-temperature inducible promoter specifically expressed by plant green tissue and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a high-temperature inducible promoter specifically expressed by plant green tissues and application thereof.

Background

The plant promoter is a DNA sequence which can be specifically combined with RNA polymerase and transcription factors thereof and determines the initiation of gene transcription. The promoter is a regulation center of gene transcription, not only has basic action elements such as CAAT-box, TATA-box and the like, but also has cis-action elements responding to adversity stress, and can regulate the transcription of genes under different conditions under the influence of factors such as environment, exogenous treatment and the like. Plant promoters can be classified according to their transcription pattern as: constitutive, inducible and tissue-specific promoters. The constitutive promoter can continuously and efficiently drive gene transcription in different types of cells and different stages of cell development, has relatively constant transcription activity, is typically a tobacco mosaic virus (CaMV) 35S promoter, and is widely applied to dicotyledonous plant transgenic engineering. The constitutive promoter can efficiently promote the expression of the exogenous gene, the overexpression has no time and space limitation, and the expression quantity of the exogenous gene is very high at any stage of the growth and development of the plant and in any tissue. However, the constitutive expression of the exogenous gene often causes unnecessary waste of resources, and the accumulation of a large amount of heterologous proteins also breaks the original metabolic balance of plants and hinders the normal growth of the plants, so genetic engineering using a constitutive promoter often shows characters such as dwarfing of plants, and in order to improve the problem, the development and utilization of a tissue-specific promoter and an inducible promoter become a hotspot of genetic engineering research.

Tissue-specific promoters, which are capable of expressing a gene of interest in a specific organ or tissue but not in other organs and tissues or in very low amounts, typically have some specific regulatory elements associated with tissue specificity. At present, the plant tissue specific promoter is mostly applied to a root specific promoter and a seed specific promoter, and the research on the green tissue specific promoter is very little. The root-specific promoter can drive genes related to root production development and water and mineral transport to be specifically expressed in the roots of the plants; seed-specific promoters can drive the expression of some genes in seeds that are involved in oil synthesis and some regulation of crop yield. Adverse stresses such as abiotic stresses like drought, high temperature, low temperature, damage and the like, and biotic stresses like plant diseases and insect pests and the like seriously affect the growth, development and yield of plants, even death. The inducible promoter can receive an induction signal under the adverse condition, specifically start the expression of a target gene and generate a large amount of target protein in a plant body, so that a regulation response is made to resist the external environment stress. In stress-resistant genetic engineering, an inducible promoter responding to stress is selected to construct a plant expression vector for driving a target gene to be efficiently expressed under a specific stress condition, so that the method is an important strategy for solving the problem of stress of plants and has important significance for researching the regulation and control of the stress resistance of the plants.

Photosynthesis is an important component of plant life activities and is the basis for yield development. Under the influence of severe climate, the temperature gradually rises in summer in many regions of the world, the duration is long, and the high temperature becomes one of the main factors influencing the normal growth of plants. Photosynthesis, one of the most sensitive physiological responses of plants to high temperatures, is inhibited by high temperatures before other high temperature-induced nociceptive symptoms occur. The main place for plant photosynthesis is green tissue, and under high temperature and other adverse conditions, the photosynthesis of the green tissue of the plant is easy to be reduced by the stress of the adverse environment, and the growth amount is reduced.

Disclosure of Invention

The purpose of the application is to solve the defects of energy consumption, short plant and the like caused by overexpression of a constitutive promoter under the non-essential condition of a plant, provide a promoter with both induction type and tissue specificity, drive a large amount of target genes to express in a plant green tissue under the high-temperature condition, and be applied to plant stress-resistant genetic engineering.

A high-temperature inducible promoter specifically expressed by plant green tissues is named as pRCA1, and the sequence is shown as SEQ ID No. 1.

The invention also provides an application of the high-temperature inducible promoter, which comprises the following steps: the target gene is stably expressed in green tissues of plants in a high-temperature environment. Under the application, the plant is planted in a high-temperature environment, and the pRCA1 promoter can ensure that the introduced gene is specifically started and stably expressed in green tissues of the plant in the high-temperature environment.

The invention also provides an application of the high-temperature inducible promoter, which comprises the following steps: inducing the target gene to express in the green tissue of plant transiently by using high temperature condition. In this application, the temperature of the environment in which the plant itself is grown is low, but transient expression of the introduced gene can be specifically induced by providing high temperature conditions for a certain period of time.

Experiments prove that the pRCA1 promoter has more efficient expression promoting capacity at 37 ℃ than at 25 ℃.

The plant for high-temperature induction expression can be rhododendron hainanense, arabidopsis thaliana or tobacco, and can also be other plants.

The invention also provides a plant expression vector containing the high-temperature inducible promoter. Preferably, the vector has a backbone of pCAMBIA3301 or pGreen II 0800-LUC plasmid.

The invention also provides a construction method of the transgenic plant for expressing the transgene by high-temperature induction, which comprises the following steps:

(1) constructing a plant expression vector with the high-temperature inducible promoter;

(2) inserting a gene to be expressed by high-temperature induction into the plant expression vector in the step (1) and starting expression by the high-temperature inducible promoter;

(3) transforming agrobacterium with the plant expression vector constructed in the step (2);

(4) infecting the plant with the agrobacterium transformed in the step (3) to obtain the transgenic plant with high temperature induced expression transgene.

Preferably, the framework of the plant expression vector is pCAMBIA3301 or pGreen II 0800-LUC plasmid.

The promoter pRCA1 has the characteristics of high-temperature induction and specific expression of plant green tissues, and the expression vector of a target gene is constructed by constructing pRCA1, and then the expression vector is introduced into a target plant through transgenosis, so that the target gene can be expressed in the green tissues of the target plant under the high-temperature condition, and the purpose of increasing the expression quantity of the target gene in parts such as leaves and the like under the high-temperature stress condition is achieved. Under the global warming trend, the method has important application prospect for plant stress resistance genetic engineering.

Drawings

FIG. 1 shows the expression level of RCA1 in different tissues of Rhododendron hainanensis.

FIG. 2 is a schematic representation of the construction of pRCA1 in vector pCAMBIA 3301.

FIG. 3 is a schematic representation of pRCA1 constructed in vector pGreen II 0800-LUC.

FIG. 4 shows GUS staining results of transgenic Arabidopsis and wild Arabidopsis.

FIG. 5 shows the results of high temperature induced LUC fluorescence imaging.

Detailed Description

The present invention will be described in further detail with reference to examples, but the embodiments of the present invention are not limited thereto.

The quantitative tests in the following examples, all set up three replicates and the results averaged.

Example 1: real-time fluorescent quantitative PCR analysis of RCA1 gene expression characteristics

1. The RNA of samples to be detected (tender leaves, mature leaves, stems, petals, pistils and stamens of three-year-old cutting seedlings of rhododendron hainanensis after high-temperature treatment for 3 hours at 37 ℃) is extracted by using an RNAprep Pure polysaccharide polyphenol plant total RNA extraction kit (Tiangen Biochemical technology Co., Ltd.), the integrity is detected by agarose electrophoresis, and the concentration is determined by Nanodrop.

2. 1. mu.g of RNA was applied to PrimeScript^TMThe RT reagent Kit with gDNA Eraser (Perfect Real Time) Kit (TaKaRa) performs reverse transcription to generate cDNA, and the cDNA is diluted to be used as a quantitative PCR template. Fluorescent quantitative PCR was performed by SYBR staining using Roche LightCycler 480 II, 18S rRNA as internal reference, according to 2^-△△CTThe method analyzes the mRNA expression amount.

The forward primers for detection of pRCA1 were: 5'-TGCTGGTTCAAGAGCAGGAG-3', the reverse primer is: 5'-GTTGAGCTGCTTTGCCATAGA-3' are provided.

The forward primer for detecting the 18S reference gene of rhododendron hainanense comprises the following components: 5'-CGCATTCCCCACTGTATTAGAC-3', the reverse primer is: 5'-CGTAACAAGGTTTCCGTAGGTG-3' are provided.

The real-time quantitative PCR reaction system is as follows: SYBR mixture 10. mu. L, cDNA template 5. mu.L, upper and lower primers 0.8. mu. L, ddH2O make up to 20. mu.L.

Real-time quantitative PCR reaction procedure: 2min at 95 ℃; 5s at 95 ℃, 30s at 58 ℃ and 40 cycles; the dissolution curves were plotted at 95 ℃ for 5s, 65 ℃ for 5s, and 95 ℃ for 5 s.

The results show (FIG. 1) that RCA1 is mainly expressed in green tissues such as mature leaves, young leaves, stems, sepals and the like, the expression level is highest in mature leaves, and the expression level is lowest in stamens, which indicates that the expression of RCA1 has green tissue specificity.

Example 2: pRCA1 Stable expression of GUS Gene

Cloning of pRCA1

1. Extracting rhododendron hainanensis genome DNA by a CTAB method.

2. Taking rhododendron hainanensis genome DNA as a template, utilizing high fidelity enzyme PrimeSTAR Max, and adopting a primer pRCA 1-F1: 5'-ACTCGGCACAGCTACTACC-3' and pRCA 1-R1: 5'-CAAAGGTGGAAACGGCAG-3' and carrying out PCR amplification to obtain a PCR product.

The reaction system is 25 μ L: the upper and lower primers are respectively 1 uL, Max mix 12.5 uL and genome DNA 1 u L, ddH2O 9.5.5 uL; the PCR reaction program is pre-denaturation at 98 ℃ for 60 s; then denaturation at 98 ℃ for 10s, annealing at 57 ℃ for 15s, and extension at 72 ℃ for 60s for 30 cycles; extension at 72 ℃ for 10 min.

3. The PCR amplification product was subjected to agarose gel electrophoresis, a band having a size similar to that of the desired promoter fragment was recovered using a DNA gel recovery kit (TaKaRa Co.), and the recovered fragment was ligated to a cloning vector pEASY-Blunt (purchased from Beijing Kokai Katsuka Co., Ltd.) and transformed into E.coli DH 5. alpha. After screening and sequencing comparison, extracting plasmids from the bacterial liquid with correct sequencing by using a plasmid DNA extraction kit, and storing at-20 ℃. The sequencing result shows that the nucleotide sequence of the PCR amplification product is shown as SEQ ID NO. 1. The DNA molecule shown in SEQ ID NO.1 from position 1 to position 1624 of 5' end is the nucleotide sequence of pRCA 1.

Secondly, pRCA1 promotes GUS gene expression

1. Recombinant plasmid pRCA1: : and constructing GUS.

Recombinant plasmid pRCA1: : the GUS structure is schematically shown in FIG. 2.

(1) The plant expression vector is constructed by a seamless cloning method. The plant expression vector pCAMBIA3301 was digested simultaneously with Nco I and Hind III, and the linearized vector fragment was recovered after agarose gel electrophoresis.

(2) Designing a specific primer pRCA1-F2 containing a vector sequence according to the sequence at the nick after double digestion of pCAMBIA 3301:

5’-ACCTGCAGGCATGCAAGCTTTCACTCAAAGTTGAGGGTTCC-3' (recognition site for restriction enzyme Nco I is underlined)

And pRCA 1-R2:

5-’TTACCCTCAGATCTACCATGGAGAAATCAAGGGTCTGTTTGGGA-3' (underlined is the recognition site for the restriction enzyme Hind III),

the promoter with the vector sequence at both ends is obtained by amplification with high fidelity enzyme PrimeSTAR Max.

(3) Connecting the vector skeleton recovered in the step (1) with the DNA fragment recovered in the step (2) to construct a recombinant plasmid pRCA1: : GUS, transformed e.coli DH5 α, with primers designed pRCA 1-F3: ACCTGCAGGCATGCAAGCTT and pRCA 1-R3: TTACCCTCAGATCTACCATGG after PCR detection, extracting recombinant plasmid with correct sequencing with plasmid DNA extraction kit (TaKaRa), transferring into Agrobacterium GV3101 (from Shanghai Weidi Biotech) by freeze thawing, and storing glycerol at-80 deg.C.

For recombinant plasmid pRCA1: : GUS was structurally described as follows: the sequence between the recognition sequences for restriction enzymes NcoI and HindIII of the pCAMBIA3301 vector was replaced with a DNA molecule shown in SEQ ID NO.1 from position 1 to position 1624 of the 5' terminus. Recombinant plasmid pRCA1: : in GUS, expression of the GUS gene was initiated by pRCA 1.

2. Expression analysis of pRCA1

(1) Recombinant plasmid prRCA1 was transfected according to agrobacterium-mediated inflorescence dip staining method: : and (3) transforming arabidopsis thaliana by GUS, disinfecting harvested T1 generation arabidopsis thaliana seeds, sowing the seeds in an MS culture medium containing 20mg/L glufosinate-ammonium, screening resistant seedlings, and transplanting the seedlings into soil.

(2) Extracting DNA of resistant seedlings of T1 generation, and using primer pair

pRCA1-F4：5’-ACCTGCAGGCATGCAAGCTT-3’

And pRCA 1-R4: 5'-CACGGGTTGGGGTTTCTACA-3'

PCR was performed to identify transgenic plants. Seeds from T2 generations were harvested and screened for single copy insertion lines with a 3:1 isolation ratio. Seeds of T3 generation were harvested and transgenic homozygous lines of Arabidopsis were screened.

(3) The obtained seeds of T3 generation transgenic arabidopsis are sown on an MS culture medium, after the first true leaf grows out, the seeds are respectively treated at 37 ℃ and 25 ℃ for 3h, and GUS staining is carried out on arabidopsis seedlings. Big seedlings of arabidopsis T3 generation plants are treated at 25 ℃ and 37 ℃ for 3h respectively, and leaves, roots, stems, flowers and fruit pods of the big seedlings are taken to be dyed with GUS. GUS staining: different tissues are placed into GUS dye solution (Beijing Huayue Biotechnology Co., Ltd.) to be dyed for 12h at normal temperature, and after being completely decolored by 75% alcohol, the tissues are photographed and observed under a body type microscope. Untransformed wild type Arabidopsis thaliana (Col-0) was used as a control.

Transfer into recombinant plasmid pRCA1: : GUS staining results of Arabidopsis seedlings, roots, mature leaves, flowers and fruit pods with GUS are shown in FIG. 4. GUS staining results of each tissue of wild type Arabidopsis thaliana are shown as wild type in FIG. 4.

The results show that prRCA 1: : blue color is detected in green tissues such as leaves, stems, calyces and fruit pods of GUS arabidopsis thaliana, and the roots and petals are not changed into blue color, so that the promoter has the promoter activity, is specifically expressed in the green tissues and has the tissue specificity. The blue color of the leaves, stems, calyces and fruit pods treated at 37 ℃ for 3h is darker, which indicates that the expression of the leaves, stems, calyces and fruit pods can be obviously enhanced by high temperature, and the heat induction characteristic is shown.

Example 3: pRCA1 promotes transient expression of the LUC gene

1. Recombinant plasmid pRCA1: : and (4) constructing the LUC.

Recombinant plasmid pRCA1: : the schematic structure of the LUC is shown in fig. 3.

(1) The plant expression vector is constructed by a seamless cloning method. The plant expression vector pGreen II 0800-LUC was subjected to single enzyme digestion with Pst I, and the linearized vector fragment was recovered after agarose gel electrophoresis.

(2) Designing a specific primer pRCA1-F5 containing a vector sequence according to the sequence at the nick after pGreen II 0800-LUC single enzyme digestion:

5’-GCTTGATATCGAATTCCTGCAGCTACTACCAAGCACCTCCGC-3’

and pRCA 1-R5:

5’-GGATCCCCCGGGCTGCAGAGAAATCAAGGGTCTGTTTGGGA-3' (the recognition site for the restriction enzyme PstI is underlined),

the promoter with the vector sequence at both ends is obtained by amplification with high fidelity enzyme PrimeSTAR Max.

(3) Connecting the vector skeleton recovered in the step (1) with the DNA fragment recovered in the step (2) to construct a recombinant plasmid pRCA1: : LUC, transformed e.coli DH5 α, with the designed primer pRCA 1-F6: GGCGATTAAGTTGGGTAACGC and pRCA 1-R6: GGTTCCATCTTCCAGCGGATA after PCR detection, recombinant plasmid with correct sequencing was extracted with plasmid DNA extraction kit (TaKaRa), and transferred to Agrobacterium strain GV3101(pSoup-p19) (from Shanghai Dingqing Biotech) by freeze-thaw method, and glycerol was stored at-80 deg.C after detection.

For recombinant plasmid pRCA1: : the LUC is structurally described as follows: the DNA molecule shown in SEQ ID NO.1 from the 1 st to 1624 th positions at the 5' end is inserted into the recognition sequence of the restriction enzyme Pst I of pGreen II 0800-LUC vector. Recombinant plasmid pRCA1: : in LUC, expression of the Luciferase gene was initiated by pRCA 1.

2. pRCA1 promotes expression of LUC gene

(1) The mixture containing prRCA 1: : and (3) carrying out amplification culture on the agrobacterium liquid of the LUC recombinant plasmid, shaking until the OD600 is about 1.0, centrifuging at 4000rpm for 10min, collecting thalli, and suspending the thalli by 1/2MS containing 45mg/L acetosyringone.

(2) Selecting good Nicotiana benthamiana of 2-3 weeks, and injecting the suspension into tobacco leaf from lower surface skin of leaf by using injector.

(3) Culturing the injected tobacco in a climatic chamber, treating at 25 ℃ and 37 ℃ for 3h after 2d, coating 1mM firefly fluorescein (purchased from Promega company) on the reverse side of the leaves, placing in the dark for 5min, cutting the leaves, and performing fluorescence detection in a dark box, wherein the fluorescence detection instrument is a photon single photon counting imaging system.

Transfer into recombinant plasmid pRCA1: : the fluorescence imaging results of the LUCs are shown in fig. 5.

The results show that the tobacco leaves under the control condition of 25 ℃ show weaker fluorescence, and the fluorescence intensity of the tobacco leaves after the heat stress treatment at 37 ℃ is obviously higher than that of the control. The result shows that pRCA1 can drive LUC gene expression, has promoter activity and can be used for further researching the regulation function; and pRCA1 can respond strongly to high-temperature stress and has typical heat induction characteristics.

Sequence listing

<110> Zhejiang university

<120> high-temperature inducible promoter specifically expressed by plant green tissue and application thereof

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1624

<212> DNA

<213> Rhododendron hainanense Merr (Rhododendron hainanense.)

<400> 1

actcggcaca gctactacca agcacctccg cttagcaata tctcccaata atccgaccgg 60

ggattcaggg ttgaatggag tttggagaag aacaatctgg aaataggaag ccaacaagaa 120

tggaaaactt ctagtagtac ccaggagggg actgggagga ccacttctca atcttgccgg 180

atagtgacca caagcataca ccaactatgc acaaacaaga taatgaagat gagatctcat 240

gaggttgtga cacgtggccc taagagtggg tcataggaaa tttgtttggg aaaatgacgc 300

acatgacgtg ttttgataat taatacccac caaagacatt ttcagtatta acaaatgttc 360

tctgcatatt cttggcgggt attaattatc aaaatatatt actgaccgtc attttcccga 420

ttcgtttcac tggttttcat gagatctcat gaggtttgtg acaaattact tgtctaattg 480

ggacattaat gttttattct taaaatcaag agatttttgg ctcaacgact tcagggttcc 540

acttaagtga tcaggagttt aacgtaataa ataggtatat tacttttcaa cgaaacgata 600

tttatttttt cctttttgac atatactatc acttaatctt tcatccttta attgcttctc 660

taaacagaga atccatcatt tcttttaaag aaaaatggct tcagattggg tacttaatta 720

actatcaggt gttcaaatta aaatgagttt ggagttcata gtttcattga atagccacca 780

gtggatccca gagttttttt ttttgaacct acgagtttag aggagtaaac cccattttgc 840

ttttattctt tcactcaaag ttgagggttc ctaatttcat aattaacaaa taattaatga 900

gtttattgta tgagtatgcc ttgaaagttt ctcttttcga aaataaaatt taaaaaaaaa 960

aaaaaaaaac acagagaaga ctgtagattt tccctttcaa aattttgtga aaatcaaatt 1020

acctaatttt gtatggagga aagagaagct taaaccctaa cctcaaaccc acccagttcc 1080

cagaagcctc cattttgttc tcattttgta caatcaatcc cccttccaca ctgttggcac 1140

ctttttgtta tgttagtggt gatctcaggt agtcacatga tctttcaaag ttttcatacg 1200

cactcgattt aaatcatcgc attgcgctca cgctctcaat ctactctact gaatgtttag 1260

tagtacatct atgatgtgtt tcaaagacgc tttcatccac gctttcgcgt tctcattccc 1320

ccatgcactc gcacccccgc ttgcacactc aaatgacgtg gccacataat aaatccaaaa 1380

tcccccattt ctgtggccgt tgggagtttc gtaacccaat ccacaggttt cccccctatt 1440

caattttcca cactccaaca acccacactc aatgacactg accttcgcct atatatagat 1500

cccattcccc atactatttc cccaactaaa ctcttgattc agtttcaatt ttccacttcg 1560

tcagctttct ttctttcaga tattagatcc caaacagacc cttgatttct tcaataccca 1620

aatg 1624

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgctggttca agagcaggag 20

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gttgagctgc tttgccatag a 21

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgcattcccc actgtattag ac 22

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cgtaacaagg tttccgtagg tg 22

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

actcggcaca gctactacc 19

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caaaggtgga aacggcag 18

<210> 8

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acctgcaggc atgcaagctt tcactcaaag ttgagggttc c 41

<210> 9

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttaccctcag atctaccatg gagaaatcaa gggtctgttt ggga 44

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

acctgcaggc atgcaagctt 20

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ttaccctcag atctaccatg g 21

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

acctgcaggc atgcaagctt 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

cacgggttgg ggtttctaca 20

<210> 14

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcttgatatc gaattcctgc agctactacc aagcacctcc gc 42

<210> 15

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ggatcccccg ggctgcagag aaatcaaggg tctgtttggg a 41

<210> 16

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggcgattaag ttgggtaacg c 21

<210> 17

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

ggttccatct tccagcggat a 21

Claims (7)

1. A high-temperature inducible promoter specifically expressed by plant green tissues is characterized by being named as pRCA1, and the sequence is shown as SEQ ID No. 1.

2. The use of a hyperthermia inducible promoter according to claim 1, wherein the use is: the target gene is stably expressed in green tissues of plants in a high-temperature environment.

3. The use of a hyperthermia inducible promoter according to claim 1, wherein the use is: inducing the target gene to express in the green tissue of plant transiently by using high temperature condition.

4. A plant expression vector comprising the hyperthermia inducible promoter of claim 1.

5. The plant expression vector of claim 4, wherein the vector comprises a backbone of pCAMBIA3301 or pGreen II 0800-LUC plasmid.

6. A method for constructing a transgenic plant with transgene expressed by high-temperature induction is characterized by comprising the following steps:

(1) constructing a plant expression vector having the hyperthermostable inducible promoter of claim 1;

(2) inserting a gene to be expressed by high-temperature induction into the plant expression vector in the step (1) and starting expression by the high-temperature inducible promoter;

(3) transforming agrobacterium with the plant expression vector constructed in the step (2);

(4) infecting the plant with the agrobacterium transformed in the step (3) to obtain the transgenic plant with high temperature induced expression transgene.

7. The method of constructing a transgenic plant according to claim 6, wherein the backbone of the plant expression vector is pCAMBIA3301 or pGreen II 0800-LUC plasmid.

Images