CN110194791B

CN110194791B - Application of SPL3 protein in regulation and control of plant inflorescence or carpopodium development

Info

Publication number: CN110194791B
Application number: CN201910482558.0A
Authority: CN
Inventors: 谢钰容; 王海洋; 吴广霞; 赵永平; 赵斌斌
Original assignee: South China Agricultural University; Biotechnology Research Institute of CAAS
Current assignee: South China Agricultural University; Biotechnology Research Institute of CAAS
Priority date: 2019-06-04
Filing date: 2019-06-04
Publication date: 2021-02-19
Anticipated expiration: 2039-06-04
Also published as: CN110194791A

Abstract

The invention discloses an application of SPL3 protein in regulation and control of plant inflorescence or carpopodium development. After the SPL3 protein is driven by a promoter of the SPL3 protein to carry out super expression, the vertical included angle between the inflorescence and the carpopodium of arabidopsis is obviously reduced, and the SPL3 protein plays an important role in regulating and controlling the development of the inflorescence and the carpopodium of arabidopsis. Therefore, the invention provides an application of the SPL3 protein in regulating and controlling the development of plant inflorescences and fruit stalks, which comprises the following steps: operably connecting a promoter sequence and a coding region sequence of the SPL3 gene with an expression regulation element to obtain a recombinant plant expression vector; the recombinant plant expression vector is transformed into a plant, so that the coding region sequence of the SPL3 gene is overexpressed or overexpressed in the plant, the vertical included angle between the inflorescence and the fruit stalk of the transgenic plant is obviously reduced, the plant type improvement of important plants or crops can be realized, the crop yield is improved, or a high-yield new variety is obtained by cultivation.

Description

Application of SPL3 protein in regulation and control of plant inflorescence or carpopodium development

Technical Field

The invention relates to a new application of a transcription factor SPL3, in particular to an application of SPL3 protein in regulating and controlling inflorescence and carpopodium development, belonging to the field of new application of Arabidopsis SPL3 protein.

Background

Pods are a lateral organ derived from the shoot apical meristem of plants. The angle between the pedicel or the pod stalk and the inflorescence shaft is crucial to the morphological characteristics of the plant inflorescence, and the uprush or horizontal shape of the inflorescence and the fruit not only can affect the beauty of ornamental plants, but also can change the photosynthesis efficiency and plant type of the plants so as to further affect the yield of the plants.

At present, some related genes related to the development of the pedicel in the model plant Arabidopsis thaliana are separated and identified, for example, POL and PLL1 genes regulate the length of the pedicel through the interaction with an ERECTA gene; AtEXP10 mediates abscission layer formation of pedicles; the AtMYB13 gene enables the end of the pedicel to form a hook. But the isolation and identification of genes regulating the angle of the carpopodium is very little. Down-growth pods were produced following deletion mutation of the KNAT1 gene; the pod angle to the rachis for the auxin signal mutant axr6 is a sharp distinct angle. Typically, the angle between the wild type pod and the flower stem is about 60 degrees, the Arabidopsis thaliana G-protein ROP2 gene overexpression can reach 90 degrees or more, and the suppression mutants are all less than 60 degrees. The pod angle of the actin filament fasciculin gene VILLIN2 and VILLIN3 double mutant vln2vln3 became smaller. The pod angle is regulated by LBD through lateral organ boundary genes BOP1 and BOP2, pods of over-expression plants of BOP1 and BOP2 grow downwards, while pods of BOP1BOP2 double mutants grow upwards in an upright way, and the included angle between the pods and the inflorescence shaft is obviously smaller than that of a wild type.

SPL (SQUAMOSA promoter-binding protein-like) is a specific transcription factor of a plant and plays an important role in regulating and controlling plant embryonic development, interval period length, leaf development, development stage conversion, flower and fruit development, fertility, apical dominance, anthocyanin accumulation, gibberellin response, light signal transduction, in-vivo copper ion steady balance and the like. SPL contains a highly conserved SBP domain consisting of 80 amino acid residues, which binds to the downstream target gene promoter region to regulate target gene expression. Most SPLs have miR156/157 recognition sites, and miR156/157 can regulate expression of SPLs through mRNA cleavage or translational inhibition. The miR156/157 recognition site of the SPL3 protein is in the 3 'UTR region of the SPL gene, and the SPL3 gene is not sheared or translationally inhibited and controlled by miR156/157 after the 3' UTR region is removed from the genome, so that the level of the gene in vivo is maintained. The SPL3 protein belongs to the SPL (SQUAMOSA promoter-binding protein-like) transcription factor family.

The SPL protein family has a great deal of reports on arabidopsis thaliana, important crops of rice, corn and the like in the aspects of regulating and controlling embryonic development, flower and fruit development, fertility, apical dominance, plant branch tillering, flowering time, adversity stress response and the like of plants, however, the SPL regulating and controlling the plant inflorescence and the fruit angle is not reported at present, so that the research on the SPL gene regulating and controlling the inflorescence/ear included angle and further applying to the plant type improvement of the plants and the important crops has very important significance.

Disclosure of Invention

The invention mainly aims to provide a new application of the SPL3 protein;

the above object of the present invention is achieved by the following technical solutions:

after the SPL3 protein is driven by a promoter of the SPL3 protein to carry out super expression, the vertical included angle between the inflorescence and the carpopodium of arabidopsis is obviously reduced, and the SPL3 protein plays an important role in regulating and controlling the development of the inflorescence and the carpopodium of arabidopsis.

Specifically, the promoter and the genome sequence of the SPL3 gene are constructed to a plant transformation vector to obtain a recombinant plant expression vector; the recombinant plant expression vector is transformed into arabidopsis thaliana to obtain a transgenic plant, each floret/bud in the inflorescence of the transgenic plant is compactly embodied as a contraction type, the pod is uprushed in the early stage, the vertical included angle is about 30 degrees, and the vertical included angle is obviously different from that of a wild type plant and a negative plant (about 60 degrees).

Therefore, the invention provides an application of the SPL3 protein in regulating and controlling the development of plant inflorescences and fruit stalks, which comprises the following steps: operably connecting a promoter sequence and a coding region sequence of the SPL 3-like gene with an expression regulation element to obtain a recombinant plant expression vector; the recombinant plant expression vector is used for transforming plants, so that the coding region sequence of the SPL3 gene is over-expressed or over-expressed in the plants, and the vertical included angle between the inflorescence and the carpopodium of the obtained transgenic plants is obviously reduced.

Wherein the nucleotide sequence of the promoter of the SPL3 gene is shown as SEQ ID No. 1; the genome nucleotide sequence of the SPL3 gene is shown as SEQ ID No. 2. In addition, the nucleotide sequence shown in SEQ ID NO.2 can be optimized by those skilled in the art to enhance the expression efficiency in plants.

The invention also discloses a recombinant expression vector containing the SPL3 gene and a recombinant host cell containing the recombinant expression vector. Operably linking the promoter and coding region sequences of the SPL3 with an expression regulation element to obtain a recombinant plant expression vector; the recombinant plant expression vector can consist of a 5 'end non-coding region, a promoter sequence shown by SEQ ID NO.1, a coding region sequence shown by SEQ ID NO.2 and a 3' non-coding region; wherein, the 5' end non-coding region can also comprise an enhancer sequence or/and a translation enhancing sequence; the 3' non-coding region may comprise a terminator sequence, an mRNA cleavage sequence, and the like. Suitable terminator sequences can be taken from the Ti-plasmid of Agrobacterium tumefaciens, for example the octopine synthase and nopaline synthase termination regions.

The recombinant plant expression vector may further comprise a selectable marker gene for selecting transformed cells, for selecting transformed cells or tissues; the marker gene includes: genes encoding antibiotic resistance, genes conferring resistance to herbicidal compounds, and the like. In addition, the marker gene also comprises phenotypic markers, such as beta-galactosidase, fluorescent protein and the like.

The technical scheme of the invention can be further applied to any other plant species, including that the promoter and the coding region sequence of the transcription factor SPL3 gene are operably connected with an expression regulation element to obtain a recombinant plant expression vector, and the recombinant plant expression vector is transformed into a target plant, so that the development of the inflorescence and the carpopodium of the target plant can be changed, including the contraction of the inflorescence of the plant (or the reduction of the vertical included angle of the inflorescence) or the reduction of the vertical included angle of the carpopodium.

Therefore, the method can be used for carrying out plant type improvement on important plants or crops, and further improving the crop yield or breeding new high-yield varieties.

Such plants or crops include, but are not limited to: a monocotyledonous plant or a dicotyledonous plant. More preferably, the target plant includes crops, vegetables or ornamental plants, fruit trees, etc., and may be, for example, corn, rice, sorghum, wheat, soybean, potato, barley, tomato, kidney bean, peanut, sugarcane, etc.

The transformation protocol and the protocol for introducing the polynucleotide or polypeptide into a plant may vary depending on the type of plant (monocot or dicot) or plant cell used for transformation; suitable methods for introducing the polynucleotide or polypeptide into a plant cell include: microinjection, electroporation, agrobacterium-mediated transformation, direct gene transfer, and high-speed ballistic bombardment, among others. In particular embodiments, the SPL3 gene can be provided to a plant using a variety of transient transformation methods. The transformed cells can be regenerated into stably transformed plants using conventional methods (McCormick et al plant Cell reports.1986.5: 81-84).

Arabidopsis thaliana is a dicotyledonous model plant and has wide application value, and the control of the development of inflorescences and carpopodium of Arabidopsis thaliana by using genetic engineering has very important significance.

The invention further provides a specific amplification primer for amplifying the promoter and coding region sequences of the Arabidopsis SPL3 gene, and the nucleotide sequences are shown as SEQ ID No.3 and SEQ ID No. 4.

The invention also provides another specific amplification primer for amplifying the promoter and coding region sequence of the Arabidopsis SPL3 gene, the nucleotide sequence of the specific amplification primer is shown as SEQ ID No.5 and SEQ ID No. 6; the specific amplification primer can be used for detecting the expression level of the SPL3 gene in Arabidopsis thaliana, thereby providing reference for the research of Arabidopsis thaliana.

The invention has the following beneficial effects: the functional gene SPL3 related to the arabidopsis inflorescence/pod included angle and the promoter thereof have important significance for controlling the development of arabidopsis inflorescence/pod.

Definitions of terms to which the invention relates

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The term "transcription factor" means a class of DNA binding proteins that are capable of specifically binding to cis-acting elements in the promoter region of eukaryotic genes, thereby activating or inhibiting transcription and expression of downstream genes at a particular time and space.

The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides, or ribonucleotides and polymers thereof in either single-or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have binding properties similar to the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specifically limited, the term also means oligonucleotide analogs, which include PNAs (peptide nucleic acids), DNA analogs used in antisense technology (phosphorothioates, phosphoramidates, etc.). Unless otherwise specified, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (including, but not limited to, degenerate codon substitutions) and complementary sequences as well as the sequence explicitly specified. In particular, degenerate codon substitutions may be achieved by generating sequences in which the 3 rd position of one or more selected (or all) codons is substituted with mixed base and/or deoxyinosine residues (Batzer et al, Nucleic Acid Res.19:5081 (1991); Ohtsuka et al, J.biol.chem.260: 2605-S2608 (1985); and Cassol et al (1992); Rossolini et al, Mol cell. probes 8:91-98 (1994)).

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to mean a polymer of amino acid residues. That is, the description for a polypeptide applies equally to the description of a peptide and to the description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues are a non-naturally encoded amino acid. As used herein, the term encompasses amino acid chains of any length, including full-length proteins (i.e., antigens), in which the amino acid residues are linked via covalent peptide bonds.

The term "recombinant host cell strain" or "host cell" means a cell comprising a polynucleotide of the present invention, regardless of the method used for insertion to produce the recombinant host cell, e.g., direct uptake, transduction, f-pairing, or other methods known in the art. The exogenous polynucleotide may remain as a non-integrating vector, such as a plasmid, or may integrate into the host genome. The host cell may be a prokaryotic cell or a eukaryotic cell, and the host cell may also be a monocotyledonous or dicotyledonous plant cell.

The term "operably linked" refers to a functional linkage between two or more elements that may be operably linked and may or may not be contiguous.

The term "recombinant plant expression vector" means one or more DNA vectors used to effect plant transformation; these vectors are often referred to in the art as binary vectors. Binary vectors, together with vectors with helper plasmids, are most commonly used for agrobacterium-mediated transformation. Binary vectors typically include: cis-acting sequences required for T-DNA transfer, selectable markers engineered to be capable of expression in plant cells, heterologous DNA sequences to be transcribed, and the like.

The term "transformation" refers to a process of introducing a heterologous DNA sequence into a host cell or organism.

The term "expression" refers to the transcription and/or translation of an endogenous gene or transgene in a plant cell.

Drawings

FIG. 1 shows that overexpression of SPL3 results in stalk uprush and inflorescence shrinkage.

FIG. 2 shows that overexpression of SPL3 results in stalk uprush and inflorescence shrinkage.

FIG. 3 shows the results of SPL3mRNA level measurements; SPL3 transcript levels were significantly elevated in SPL3-OE transgenic plants.

FIG. 4 shows the results of the detection of GUS reporter gene in different organs of SPL3 overexpression plants.

Detailed Description

The invention is further described below in conjunction with specific embodiments, the advantages and features of which will become apparent from the description. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be within the scope of the invention.

Example 1 construction of recombinant expression vector for SPL3 overexpression plant, transformation of Arabidopsis thaliana, and phenotypic observation

(1) Construction of plant recombinant expression vector for overexpression or overexpression of SPL3

A fragment containing the SPL3 promoter (SEQ ID No.1), the 5 'untranslated region and the coding region (containing a translation terminator but not the 3' untranslated region) (SEQ ID No.2) and having a total length of 3395bp was amplified from Arabidopsis thaliana genomic DNA using primers SPL3-F1(SEQ ID No.3) and SPL3-R1(SEQ ID No.4), and then constructed into a pBI101 vector digested simultaneously with SalI and BamHI using a seamless cloning recombinase. The pSPL3, SPL3-pBI101 vector is obtained after the correct sequence is verified by colony PCR identification and sequencing.

(2) Transformation of Arabidopsis thaliana by SPL3 overexpression plant recombinant expression vector

The vector of pSPL3, SPL3-GUS-101, was transformed into Agrobacterium GV3101, which was screened for rifampicin and kanamycin resistance and transformants were cultured to obtain a strain in the logarithmic phase. Removing terminal bud of Arabidopsis thaliana, and infecting when side bud grows to 10-20cm high and most bud is opened, i.e. pouring bacterial liquid into a dish, and soaking Arabidopsis thaliana flower in the bacterial liquid for 20-30 s. And (3) placing the transformed plant in a dark room for 16-24h in a dark place for keeping moisture, and after the dark place is finished, placing the plant in an artificial climate chamber for growing until the seeds are mature.

Seeds harvested from the above transformed plants were first dried for 1 week, and the seeds were T0 generation seeds. After sterilization, the cells were cultured in 1/2MS (kanamycin-containing antibiotic) medium. And vernalizing in dark for three days, growing in an incubator for 7-10 days, wherein the positive seeds can normally grow in a culture medium containing antibiotics, and are shown as true leaves growing and green, roots are deeply pricked into the culture medium, non-positive seedlings are difficult to survive, no true leaves exist, cotyledons are yellow, and the roots cannot grow. Positive seedlings were transferred to soil for culture, seeds harvested at T1 generation were selected on kanamycin antibiotic medium and survived according to mendelian's law of segregation: non-viable 3:1 is a single copy insertion. Selecting a monoclonal insertion plant, culturing to obtain seeds of T2 generation, collecting seeds of resistant seedlings, culturing on a kanamycin-containing antibiotic culture medium, primarily judging that all plants have resistance to obtain a homozygous strain, and collecting seeds of homozygous T3 generation.

FIGS. 1 and 2 show the phenotype exhibited by overexpression of SPL3 in Arabidopsis; as can be seen from the phenotype of overexpression of SPL3 in Arabidopsis, overexpression of SPL3 (SPL3-OE) results in stalk uprush and inflorescence shrinkage.

Example 2 construction and transformation of SPL3-GUS-101 vector with pSPL3 expressed by fusion of SPL3 with GUS protein

A fragment containing the SPL3 promoter, 5 'untranslated region and coding region (not containing a translation terminator and 3' untranslated region) was amplified from Arabidopsis genomic DNA using primers SPL3-F2 and SPL3-R2, and the total length was 3392 bp:

primers SPL3-F2 and SPL 3-R2:

SPL3-F2:

GCATGCCTGCAGGTCGACCTGTAAAGATAATTGTGTTGG

SPL3-R2:

CTGACCACCCGGGGATCCTTAGTCAGTTGTGCTTTTCCGCCTTCTC

then, the recombinant enzyme was constructed on a pBI101 vector containing the GUS protein reporter gene, which was double-digested with SalI and BamHI. After colony PCR identification and sequencing verification, the pSPL3 vector expressed by fusion of SPL3 and GUS protein, namely SPL3-GUS-101, is obtained.

After the vector is used for transforming agrobacterium GV3101 by a liquid nitrogen freeze thawing method, the wild arabidopsis is transformed by pollen dip-dyeing. The transgenic plants were sampled from seedlings which germinated for 7 days and then grown for 5 weeks, and their roots, stems, leaves, inflorescences and young pods were extracted with Trizol to obtain total RNA, which was further subjected to M-MLV reverse transcription with a kit to synthesize cDNA. The expression level of GUS in each of the above tissues was measured using a fluorescent quantitative PCR kit with actin as an internal reference. Wherein

GUS quantitative PCR primer:

qGUS-F：ACTCGTCCGTCCTGTAGAAC

qGUS-R：CGTCGGTAATCACCATTCC

EIF4A quantitative PCR primers:

qEIF4A-F：CAGAGAACACTCCAACCTGAATC

qEIF4A-R：GGGTATCTATGCTTACGGTTTCG

FIG. 3 shows the result of detection of the level of SPL3mRNA, from which it can be seen that the level of SPL3 transcript in SPL3-OE transgenic plants is significantly increased; FIG. 4 shows the results of the detection of GUS reporter gene in different organs of SPL3 overexpression plants.

SEQUENCE LISTING

<110> institute of biotechnology of Chinese academy of agricultural sciences, southern China university of agriculture

Application of <120> SPL3 protein in regulation and control of plant inflorescence or carpopodium development

<130> 22

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 2570

<212> DNA

<213> Arabidopsis thaliana

<400> 1

ctgtaaagat aattgtgttg gggcttttaa agtaattatc aagtttcttt acaaattggc 60

cacaatatat tttataataa catttgaacc ctcatatcct tttgtttgaa tttgggctct 120

tcgctcactc ctccctcttt gtggcccaat gaagtttctt caagcccata caaaagtaac 180

tagtagtaat ccacatcaaa ccctataggc ttgcggatac atcttaggtt tactaaatct 240

taaaatagaa aagatcagtg accatatgct aattcaacat tttattttta catactttgg 300

tcatttttaa tatggacttt gttttaatta agatcgatta tactaactac aatcgcatat 360

gacaccaacg agcaacgtta attgctttta tgattttaaa agtatgtgat ttgcaaacta 420

attaaaaggt gaccatatat aaaagagtgt actacaaaaa gggcctacta ctattcaatt 480

aacgttgctc gttagtgtca cgtggggaag ttaaggttcc cacttccccc accacttctc 540

tcagttctct tcttcttttt attgtcccat tccaaatttt aaccaacaca tcaagcaaac 600

ttcattaatt tatgttcagt gttgtagttg caaacgttat ttattatttt acgtttacaa 660

gtttagaact agttcgaatc gtgataatct tgaataaatc ataactttgt tcatctaatc 720

ataagaacat agaactttga catggtgtct ccggatcttg ttgacttagt tctatcttaa 780

agttaagcta cacatattat agggacccca tattatagta cccaaacaaa caattagaga 840

gtttgtatgc aaatccataa tatttaccgt agaattgtat gggtttaatg aggaaagaaa 900

aagaaaagaa aaagaaaaga agagaaggac actgaaggag aatgtgatgc tgctgaataa 960

aagatacaat caaaaaattg acaggcagta caataatgat aagtagtgtc atgacagctg 1020

acgactctac tgcccaatct tgacgttatt tatttttgtc cattttttct taagatatta 1080

tttcaactta aaagaagtag aaaataaacc ataagtgcat aacaatattc cttttataaa 1140

ttgggttcaa gatattgatt cgattctgtt tatttcaagt gtcgtggaac tcaattttat 1200

gttatgcctg cctcggcaac aaagattttc gttcaagtgg ctctatgaaa ataagttagg 1260

gcaaactaga tcgattgatg taaacacaaa tagagctaaa tagtggagat agtaaactgg 1320

tgattttgtt tcgtaaatag tcaaaaggag ggggtgacaa aaaatagatt tgtcccttac 1380

ctctaagaga tatagagcaa aacgtttgca tagcgctgta ccatttcctt ctatatttta 1440

tatatgtgga tgtgcatgga tctagctgat gacataacac ggcaaaatca tttaacattt 1500

gattagcatt ggcatcaata tttgacgacg ctcctcatta tttatatatg tggatgtgct 1560

gatgtgcatg aatctagctg atgacataac ctagtatatg tgcatggttt tatggtgtga 1620

acaagttttt tttttttctt ttcttggttt taggtgtgaa ctttaagtta gagatgatct 1680

tcaaatctca cgaaccacaa acctccttgc acgttaagaa tagcctctct ttttttcttt 1740

tgttgcttct agtctcagag tgtcttcgag atatgtgtag tctttagtgt accctgagac 1800

ctgagtacaa gatcgaaaag aaaatatctc gaataacaga gttgtgtttg ctgtttttac 1860

catttaatta tgctaatatc tttgttttac ataataccaa ttgaaaaatg aatacataat 1920

tcaagtttgg accattcttg tatatccact tttggcttcg tggccccgat agctaatttg 1980

attgacctta tcatctacac caaacaagaa attaaattgt caaattaatt tagtggtggc 2040

cctatactat aaaatcgtaa acacttcttt ttgaaactaa atataaacct tacgacacat 2100

ttatgtgcaa attagtggac atattcctca gtaataacgt ttttacaaac ctacagttgg 2160

ataaattatt gagtcactcc atgattaaac caacaacata agagaaaaat aaaatagtac 2220

actacgaatg atcttttaaa tatgttattc ttttttgata cagaaacttt aactaccaaa 2280

aaaaaaaagc gaatgattca taaaaacgca atgtggtatg tttggtctgt tttttagttc 2340

gaatctcaac ttcttgttac cacaaaaata aaacattaca caatgtaaat ttactgttca 2400

gtcttgcttt tccaatcact acattagcac atattcttca catgtatttt ccactaatct 2460

cgcgacaaaa tgttcacagt gtttctcagt ttctctctct caatattttc ttgtcaaaca 2520

acatgcatat ttgaacccgc atggtgaaat agcatcggca ttaacatgat 2570

<210> 2

<211> 828

<212> DNA

<213> Arabidopsis thaliana

<400> 2

caaccacaaa ataaaccggg gtggtgtcat agcatcgaca ttaacttaaa actacaaaat 60

agagctgggt cctcgtcagg ttttaaggat acatatgtat gcatgtatgc atatacaaaa 120

taatagagca ctaaagcttg ttcgtactct tttttacaca acatgctaat aatttttata 180

ccttaggagt gaaattttag tggtccaaca acttaagcac ctaagatcct tccccacttt 240

tgtttggggc tcctttatat ctcttccaat ggttactttt acttcctctt cttctcttct 300

tgttccatct ttcatgtgag agagagagtt gaattttgca gatgagtatg agaagaagca 360

aagcggaagg gaagaggagc ttacgagaac tgagtgagga agaggaagaa gaagaagaaa 420

ctgaagatga agatactttt gaagaagaag aggctttgga gaagaagcag aaaggtaaag 480

ctacaagtag tagtggagtt tgtcaggtcg agagttgtac cgcggatatg agcaaagcca 540

aacagtacca caaacgacac aaagtctgcc agtttcatgc caaagctcct catgttcgga 600

tctctggtct tcaccaacgt ttctgccaac aatgcagcag gtaaattttt gtcatctttt 660

ttcaaaactc ctgcaacaat aaccataaac aagaacaaga aatatgagac cttttacctt 720

ttgtttttaa ggtttcacgc gctcagtgag tttgatgaag ccaagcggag ttgcaggaga 780

cgcttagctg gacacaacga gagaaggcgg aaaagcacaa ctgactaa 828

<210> 3

<211> 39

<212> DNA

<213> Artifical sequence

<400> 3

gcatgcctgc aggtcgacct gtaaagataa ttgtgttgg 39

<210> 4

<211> 46

<212> DNA

<213> Artifical sequence

<400> 4

ctgaccaccc ggggatcctt agtcagttgt gcttttccgc cttctc 46

<210> 5

<211> 39

<212> DNA

<213> Artifical sequence

<400> 5

gcatgcctgc aggtcgacct gtaaagataa ttgtgttgg 39

<210> 6

<211> 46

<212> DNA

<213> Artifical sequence

<400> 6

ctgaccaccc ggggatcctt agtcagttgt gcttttccgc cttctc 46

Claims

The application of the SPL3 protein in regulating the development of fruit stalks or inflorescences of arabidopsis thaliana is characterized in that the encoding gene of the SPL3 protein is overexpressed in arabidopsis thaliana, so that the vertical included angle of the fruit stalks is reduced or the inflorescences are contracted; the genome sequence of the coding gene of the SPL3 protein is shown in SEQ ID No.2, and the nucleotide sequence of a promoter for promoting the overexpression of the coding gene of the SPL3 protein in Arabidopsis is shown in SEQ ID No. 1.
2. The use according to claim 1, wherein the promoter sequence and coding region sequence of the gene encoding the SPL3 protein are operably linked to expression regulatory elements to give a recombinant plant expression vector; and transforming the recombinant plant expression vector into arabidopsis thaliana to enable the encoding gene of the SPL3 protein to be over-expressed in arabidopsis thaliana.