CN112342236A - Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield - Google Patents

Abstract

The invention belongs to the field of biological genetic engineering, and particularly relates to application of rice histone H3K36 methyltransferase in enhancing drought resistance of rice and improving yield of individual plants. The invention constructs a recombinant expression vector by cloning the nucleotide sequence of rice histone H3K36 methyltransferase SDG708 and transforms the recombinant expression vector by an agrobacterium transformation method; by connecting a maize ubiquitin gene promoterSDG708The gene is continuously over-expressed in the transgenic rice; by constructing antisense RNA vector of geneSDG708Expression level down-regulation mutant. Rice (Oryza sativa L.) with improved resistance to stressSDG708The overexpression transgenic plant presents obvious resistance under the condition of simulated osmotic stress, also obviously improves the plant resistance under the soil drought condition, and can obviously increase the yield of a single rice plant under the conditions of normal and drought stress. The invention provides a high-quality gene and breeding material for the research of drought resistance and yield character improvement of rice, and has higher practical application value.

Description

Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield

Technical Field

The invention belongs to the technical field of biological gene engineering, and particularly relates to application of histone H3K36 methyltransferase (SDG 708) related to rice epigenetic regulation in osmotic stress resistance and drought stress resistance, and application of an over-expressed plant in improvement of yield traits under normal and drought stress conditions.

Background

Epigenetics mainly studies the mechanism by which differences in gene expression occur under the condition of invariant genotype. Chromatin structure and function are regulated by a variety of epigenetic mechanisms, including histone modification, DNA methylation, ATP-dependent chromatin remodeling, histone variant replacement, and regulation of non-coding RNA. Histone Lysine methylation modification, which is an important part of Histone modification that has been extensively studied in recent years, plays an important role in the regulation of chromatin structure and gene expression, and mainly involves sites including Histone H3 (Histone 3) K4 (Lysine 4), K9, K27, K36, K79, and K20 site of Histone H4. Methylation of lysine can also be classified into mono-, di-and tri-methylation, and these different residue positions and different states of methylation modification constitute a diversity of histone lysine methylation functions. In general, methylation modifications of H3K4, H3K36, and H3K79 correspond to transcriptional activation, whereas methylation modifications of H3K9, H3K27, and H4K20 are associated with heterochromatin and gene silencing.

Histone H3 lysine K36 (H3K 36) methylation modification is an important apparent modification, while enzymes catalyzing H3K36 methylation modification have been reported in plants to be called SET Domain Group (SDG) proteins because they contain conserved SET domains. H3K36 methyltransferases that have been identified in rice include SDG725, SDG724 and SDG708, which regulate rice growth and development in their own unique manner (Mol Plant, 2013, 6: 975-. Rice SDG708 is a global H3K36 methyltransferase responsible for establishing 1/2/3 methylation modifications,sdg708the mutant showed a significant late flower phenotype (New Phytol, 2016, 210: 577-588). Taken together, H3K36 methyltransferase-mediated methylation modification of H3K36 in plants performs important functions in plant growth and development, particularly in flowering-time regulation.

Due to the sessile growth characteristics, plants must face a large number of adverse environmental influences during the growth process, and in order to survive, plants have evolved a variety of environmental response regulation mechanisms that are quite different from animals. After sensing the adverse environmental stress, the plants can change the expression of a series of metabolic pathways and stress response genes, such as regulating and controlling plant hormones, especially endogenous hormones such as abscisic acid (ABA), and participating in activation of various transcription factors and kinase cascade amplification reactions or inhibiting the expression of a plurality of downstream stress genes (cell, 2016,167(2): 313) -324).

Rice is a very important food crop, 60 percent of the global population takes rice as staple food, and the rice is also an important model organism for researching monocotyledons. Extreme environmental stresses such as drought and the like are main factors causing large-scale yield reduction and even top harvest of grain crops, so that cultivation of high-yield crops with excellent environmental stress tolerance is one of important targets of agricultural science and technology research and application. Previous researches on rice SDG708 prove that the gene is involved in plant flowering regulation process, and transcriptome data analysis also shows that the gene is possibly involved in rice abiotic stress response reaction (New Phytol, 2016, 210: 577-. Therefore, the research on the action mechanism and the application value of drought resistance and yield regulation of the rice histone lysine methyltransferase SDG708 is very important for clarifying the relationship between histone H3K36 methylation modification and environmental response and agronomic character improvement and for cultivating high-quality drought-resistant high-yield rice according to the relationship.

Disclosure of Invention

The invention aims to provide application of rice histone H3K36 methyltransferase in rice drought stress response and agronomic trait improvement.

The histone methyltransferase gene of the present invention endows rice with the ability of improving drought resistance under artificial simulated drought condition and soil drought condition, and endows rice with the ability of improving yield character under normal growth condition and drought condition. Wherein the histone H3K36 methyltransferase related to the invention is derived from rice (Oryza sativa ssp. japonica) and is named asSDG708Is one of the following amino acid residue sequences:

(1) SEQ ID No. 1 in the sequence list;

(2) the protein which is obtained by substituting and/or deleting and/or adding one to fifty amino acid residues of the amino acid residue sequence of SEQ ID No. 1 in the sequence table and has a regulating effect on the growth and development of plants.

SEQ ID No. 1 of the sequence Listing consists of 518 amino acid residues.

Gene encoding histone H3K36 methyltransferase of the present inventionSDG708The nucleotide sequence of (A) is shown as SEQ ID No. 2 in the sequence table, consists of 1557 bases, the coding frame of the nucleotide sequence is the 1 st-1557 th base from the 5' end, and the protein with the amino acid residue sequence of SEQ ID No. 1 in the sequence table is coded.

The invention also comprisesSDG708The gene enhances the action mechanism and the specific application of the drought resistance of rice.

The invention also comprisesSDG708A mechanism for improving the agronomic characters such as rice yield and the like by gene and a specific application.

In practical application, the ubiquitin gene promoter of the maize and the protein are combinedSDG708The full-length CDS sequence connection of the gene, the construction of a recombinant over-expression transformation vector and transformation of rice to obtain over-expressionSDG708The rice has better drought stress resistance. Simultaneously ensuring that the rice grows under normal growth conditions and droughtHigher yield per plant was maintained under forced conditions. On the contrary, the rice is transformed by the antisense expression vector of the gene, and the rice with drought sensitivity and a single-plant yield reduction phenotype is obtained.

In the present invention, the plant includes monocotyledons and dicotyledons.

The invention provides a high-quality drought-resistant yield-increasing gene for the rice breeding industry, and explains SDG708 and a drought response regulation mechanism and a yield-increasing mechanism which are established by the SDG708 and are subjected to methylation modification by H3K36 through deep experimental research. The invention can utilize modern biotechnology to apply the methyltransferase gene to the biological breeding process, and can effectively improve the stress resistance and yield traits of rice plants, thereby having higher agricultural application value and wide application prospect.

Drawings

FIG. 1 shows RNA interference mutant plants of wild rice (WT) and rice histone H3K36 methyltransferase SDG708708Ri-1And708Ri-2) And SDG708 overexpression plant (708OE-1And708OE-2) Resistance phenotype mapping under PEG simulated drought stress.

FIG. 2 shows RNA interference mutant plants of wild rice (WT) and rice histone H3K36 methyltransferase SDG708708Ri-1And708Ri-2) And SDG708 overexpression plant (708OE-1And708OE-2) Resistance phenotype plots under soil drought stress.

FIG. 3 shows RNA interference mutant plants of wild rice (WT) and rice histone H3K36 methyltransferase SDG708708Ri-1And708Ri-2) And SDG708 overexpression plant (708OE-1And708OE-2) Yield phenotype plots under normal conditions and soil drought stress conditions.

FIG. 4 shows RNA interference mutant plants of wild rice (WT) and rice histone H3K36 methyltransferase SDG708708Ri-1And708Ri-2) And SDG708 overexpression plant (708OE-1And708OE-2) Before and after PEG treatmentSDG708And (3) real-time fluorescent quantitative PCR detection results of gene expression.

Detailed Description

The methods in the following examples are conventional methods unless otherwise specified. The primers and sequencing work used were performed by Shanghai Sangni Biotech limited.

Example 1 Histone lysine methyltransferase Gene of RiceSDG708Obtained by

Obtained from the Rice genomic database (http:// rice. plant. msu. edu)Os04g0429100Gene sequence, designing a pair of primers according to 5 'and 3' terminal sequences, wherein the primer sequences are respectively as follows: 5'-ATGGAGGAAGAGCGCATGGA-3' (SEQ ID No: 3), and 5'-TCATGGACCGTTTTCCAAGT-3' (SEQ ID No: 4).

Total RNA from rice seedlings (Promega, SV total RNA isolation system) was extracted, and cDNA was synthesized using AMV reverse transcriptase (TaKaRa) using total RNA from rice as a template (according to the user manual of Plant RT-PCR Kit 2.01 (TaKaRa)). PCR amplification of rice histone lysine methyltransferase gene using cDNA as templateSDG708The full-length cDNA sequence of (1). The 50ul PCR reaction system contained: template 2ul, high fidelity enzyme KOD plus (TOYOBO) 1ul, 10 Xbuffer 5ul, 2.5uM dNTP 8ul, 20uM 5 'and 3' primers each 1ul, water 32 ul. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 2 min; denaturation at 94 ℃ for 30 seconds, annealing at 55 ℃ for 30 seconds, and extension at 68 ℃ for 1.5 minutes for 30 cycles. After the reaction is finished, carrying out 0.8% agarose gel electrophoresis detection on the PCR product, recovering and purifying an amplified fragment of about 1557bp, cloning the amplified fragment into a vector pUC19 (TaKaRa) to obtain a recombinant plasmid containing the recovered fragment, and sequencing to show that the full-length cDNA of the rice histone lysine methyltransferase gene SDG708 has a nucleotide sequence of SEQ ID No. 2 in a sequence table, the SEQ ID No. 2 in the sequence table consists of 1557 bases, the coding frame of the base is the 1 st-1557 th base from the 5' end, the protein with the amino acid residue sequence of the SEQ ID No. 1 in the sequence table is coded, and the coded protein is named as SDG 708.

Example 2.SDG708Over-expression and RNA interference mutant plant acquisition

A,SDG708Construction of overexpression vectors

For analyzing SDG708 geneFunction in thatSDG708Construction of the Gene as a target GeneSDG708A gene overexpression vector. Obtained as in example 1pUC19- SDG708As template, PCR amplification with two different pairs of primersSDG708Nucleotide sequence from 1 to 1557 of 5' end. The primer pairs used were:

5’- GTCGACATGGAGGAAGAGCGCATGGA－3’ （SEQ ID No:5），

5’－GGATCCTCATGGACCGTTTTCCAAGT－3’ （ SEQ ID No:6），

the obtained PCR product isSDG708-CDS. Use ofSalI andBamHi, enzyme cutting products and recovering. Use ofSalI andBamHi carrying by enzyme digestionUbiquitinGenetic transformation vector of gene promoter and EYFP labelpU1301(pU1301Is reconstructed on the basis of a plant genetic transformation vector pCAMBIA1301 commonly used internationally, and carries an agrobacterium-mediated genetic transformation vector of a maize ubiquitin promoter with constitutive and overexpression characteristics). Recovering the fragmentation vector and connecting the PCR fragment recovered by enzyme digestion to obtainpUC1301-SDG708A recombinant vector.

II,SDG708Construction of antisense expression vectors

Using RNA interference (RNAi) technique toSDG708The gene is a target gene, and an RNA interference vector is constructed. Using pUC 19-SDG 708 obtained in example 1 as a template, two pairs of different primers were used for PCR amplificationSDG708The nucleotide sequence from 363 th to 612 th positions of the 5' end is used as a complementary DNA double strand of the hairpin structure. The primer pair 1 used was:

5’- ccatggctgcagATGGAAGGAAGCCAAGAGGA-3’ （ SEQ ID No:7），

5’－ gaattcAAAGTTGTAGTCATAGGATA－3’ （ SEQ ID No:8）；

the obtained PCR product isfSDG708i(forward). The primer pair 2 is:

5’- tctagaATGGAAGGAAGCCAAGAGGA-3’ （SEQ ID No:9），

5’－aagcttAAAGTTGTAGTCATAGGATA－3’ （ SEQ ID No:10）；

the obtained PCR product isrSDG708i（reversed）。

For the convenience of subsequent vector construction, the method is as followsfSDG708iRespectively at the 5 'end and the 3' end addNcoI andEcoRrestriction sites of I inrSDG708iRespectively introduced into the 5 'and 3' ends ofXbaI andHindIII.

For the convenience of RNAi vector construction, the PDK intron (from French plant institute of molecular biology) connecting the positive and negative DNA molecules is introduced separately at both ends by PCR methodHindIII andEcoRrestriction sites for I, primers used were:

5’－aaaagcttCCAATTTGGTAAGGAAATAATT－3’ （ SEQ ID No:11），

5’－aagaattcTTTCGAACCCAGCTTCCC－3’ （ SEQ ID No:12）。

will be provided withfSDG708iWarp beamNcoI andEcoRi double restriction enzyme digestion, PDK intronHindIII andEcoRi, double enzyme digestion is carried out,rSDG708iwarp beamXbaI andHindIII, connecting into the channelNcoI andXbai double digestionpHBThe RNA interference vector is obtained from vector (present in forest Hongxuan subject of Shanghai plant physiological research institute of Chinese academy)pHB－fSDG708i－PDK intron－ rSDG708i(hereinafter abbreviated aspHB-708Ri）。

III,SDG708Rice plant transformed by overexpression vector and antisense expression vector

Reference is made to the method of Hiei et al (Plant Mol Biol 1997, 35: 205-. Mixing the plasmidspUC1301- SDG708AndpHB-708Rirespectively transferred into agrobacterium tumefaciens EHA105 by an electric excitation method, and positive clones are obtained by screening. Agrobacterium EH105 carrying the plasmid was inoculated into 5ml YEB liquid medium containing 100mg/L kanamycin, shake-cultured at 28 ℃ until late logarithmic phase, and 1: 100 to an OD600 of about 0.5. The cells were resuspended in transfection medium. The callus of Nipponbare rice is dip-dyed by a conventional method, and the hygromycin-resistant positive seedling is obtained by co-culture infection, screening of a resistant culture medium and differentiation on a differentiation culture medium. When the seedlings grow to about 10cm, the seedlings are moved to an outdoor net room for planting, and seeds are harvested to obtain T1 generation seeds. To is coming toFurther determining the stable inheritance of the transgenic character, continuously and repeatedly carrying out field cultivation and seed reproduction to obtain enough seeds with stable quantitative characters.

Example 3.SDG708Identification of osmotic stress phenotype of transgenic plants

To further verify the function of SDG708 in drought stress response reactions, a 20% PEG8000 solution was used to cause short-term osmotic stress, simulating a real drought stress environment. Firstly, transferring rice seedlings which normally grow for 21 days under short sunshine to a nutrient solution containing 20% PEG8000 to simulate a drought environment, continuously carrying out stress treatment for 7 days until an obvious withered phenotype appears, then transferring all the rice seedlings to a normal culture solution to recover the growth for 7 days, and comparing the damage conditions of the seedlings under PEG stress. As shown in FIG. 1, the mutant is compared with the wild type708Ri-1And708Ri-2all showed more obvious damage after PEG stress, and the other way round708OE-1And708OE-2both over-expressed materials exhibited stronger PEG stress resistance. Taken together, we believe that SDG708 positively regulates plant resistance to PEG stress in rice.

Example 4.SDG708Identification of drought stress phenotype of transgenic plants

In order to more accurately restore the real drought state of the plant, the invention designs a soil drought experiment of the rice seedling. Wild type WT, two708RiMutant and two708OEOver-expression rice seedlings are transplanted into culture soil and normally cultured for 21 days in short sunlight. Then water is cut off to start soil drought treatment because708RiAnd708OEthe over-expressed plants have different sensitivity to water deficiency, and the WT is adopted to ensure better effect708RiTreatment group is switched off for 10 days, WT-708OEAnd (3) a method for treating the water cut-off group for 12 days, after all tested materials have dehydration phenotypes, recovering water supply for 7 days respectively, observing recovered phenotypes and counting the survival rates of different materials. As shown in figure 2 of the drawings, in which,708Riboth mutants were more sensitive to drought stress, while708OEBoth over-expressed plants were more tolerant to drought. This further demonstrates that SDG708 is involved in rice drought stress responses and can significantly enhance soil drought stress resistance in rice.

Example 5.SDG708Identification of yield traits in transgenic plants

In order to identify the yield traits of each group of rice materials under different conditions, the invention grows the field to the wild type and two wild types at the early stage of tillering708RiMutant and two708OEThe over-expressed rice plants were transferred to greenhouse plastic pots for continued cultivation. And after all the plants are recovered to a normal state, starting to perform water cut-off treatment on the experimental group, and stopping drought treatment and recovering water supply until the rice is mature and harvested after all the tested plants have an obvious water shortage withered phenotype. The control plants were kept with sufficient water supply until the rice was harvested at maturity. And finally, observing and counting the yield traits of the rice materials in each group. The results are shown in FIG. 3, where mutants compared to wild type were grown under normal growth conditions708Ri-1And708Ri-2obviously weak plants and obviously reduced yield, on the contrary708OE-1And708OE-2two over-expressed material plants were stronger and had higher yield.

Example 6 fluorescent quantitative PCR assaySDG708In transgenic plantsSDG708Expression of

Selecting the same batch of seeds, and mixing wild WT and two708RiMutant and two708OEOver-expression rice seedlings are cultured in a plant incubator and normally grow for 21 days under short sunshine, then all experimental group seedlings are transferred to 20% PEG8000 culture solution to simulate drought stress treatment for 3 hours, and samples of a control group and a stress treatment group are respectively collected. Total RNA from rice was extracted and reverse transcribed to synthesize cDNA in the same manner as in example 1. The expression of SDG708 was then detected in each set of samples using fluorescent quantitative PCR. Primers used for detecting SDG708 were:

5’－ AAGCCAATATGCTGCGACAA－3’ （SEQ ID No:13），

5’－ CCAAAAGGCCCCATCCA－3’ （SEQ ID No:14）。

as shown in FIG. 4, the results were compared with those of wild-type rice,SDG708expressed in SDG708 mutant708Ri-1And708Ri-2in the middle, show a clear decrease, on the contrarySDG708The expression quantity is in the over-expression plant708OE-1And708OE-2a significant increase occurred.This further demonstrates that enhanced drought resistance and improved yield traits in over-expressed plants are due toSDG708Is caused by an altered expression of (a).

Sequence listing

<110> university of Compound Dan

Application of rice histone methyltransferase in enhancing crop drought resistance and improving single plant yield

<130> 001

<160> 14

<170> SIPOSequenceListing 1.0

<210> 1

<211> 518

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Met Glu Glu Glu Arg Met Glu Pro Pro Pro Pro Pro Pro Tyr Ile His

1 5 10 15

Ile Glu Thr Asn Asp Phe Leu His Arg Arg His Lys Arg Gln Lys Glu

20 25 30

Glu Asp Ile Ala Val Cys Glu Cys Gln Tyr Asn Leu Leu Asp Pro Asp

35 40 45

Ser Ala Cys Gly Asp Arg Cys Leu Asn Val Leu Thr Ser Thr Glu Cys

50 55 60

Thr Pro Gly Tyr Cys Leu Cys Gly Val Tyr Cys Lys Asn Gln Arg Phe

65 70 75 80

Gln Lys Ser Gln Tyr Ala Ala Thr Arg Leu Val Lys Thr Glu Gly Arg

85 90 95

Gly Trp Gly Leu Leu Ala Asp Glu Asn Ile Met Ala Gly Gln Phe Val

100 105 110

Met Glu Tyr Cys Gly Glu Val Ile Ser Trp Lys Glu Ala Lys Arg Arg

115 120 125

Ser Gln Ala Tyr Glu Asn Gln Gly Leu Thr Asp Ala Tyr Ile Ile Tyr

130 135 140

Leu Asn Ala Asp Glu Ser Ile Asp Ala Thr Lys Lys Gly Ser Leu Ala

145 150 155 160

Arg Phe Ile Asn His Ser Cys Gln Pro Asn Cys Glu Thr Arg Lys Trp

165 170 175

Asn Val Leu Gly Glu Val Arg Val Gly Ile Phe Ala Lys Gln Asp Ile

180 185 190

Pro Ile Gly Thr Glu Leu Ser Tyr Asp Tyr Asn Phe Glu Trp Phe Gly

195 200 205

Gly Ala Met Val Arg Cys Leu Cys Gly Ala Gly Ser Cys Ser Gly Phe

210 215 220

Leu Gly Ala Lys Ser Arg Gly Phe Gln Glu Ala Thr Tyr Leu Trp Glu

225 230 235 240

Asp Asp Asp Asp Arg Phe Ser Val Glu Asn Val Pro Leu Tyr Asp Ser

245 250 255

Ala Asp Asp Glu Pro Thr Ser Ile Pro Lys Asp Ile Leu Ile Lys Asp

260 265 270

Glu Pro Asn Thr Gln Asp Gly Asn Asn Asn Thr Ile Gln Asn Thr Gly

275 280 285

Ile Pro Ile Ile Ala Ser Ser Ser Glu Phe Thr Pro Met Asn Val Glu

290 295 300

Pro Ser Ile Ala Ser Ser Asn Glu Phe Thr Pro Met Asn Val Glu Pro

305 310 315 320

Leu Asn Val Ser Ser Asn Glu Leu Thr Pro Met Thr Ile Glu Pro Leu

325 330 335

Asn Ala Ile Pro Met Gly Val Asp Phe Thr Gln Asn Gly Ser Ile Glu

340 345 350

Tyr Gly Ala Gln Cys Ala Glu Asp Ala Leu Gln Asn Ser Thr Arg Gly

355 360 365

Val Ala Asn Leu Gln Asn Gln Ser Ala Pro Arg Asp Asn Asn His Thr

370 375 380

Glu Leu Val Ala Val Lys Arg Arg Pro Thr Leu Arg Gly Gly Lys Ala

385 390 395 400

Lys Arg Gly Met Arg Lys Gln Leu Asn Val Val Gly Ile Cys Asp Arg

405 410 415

Leu Ala Ser Glu Val Ala Arg Glu Glu Ile Leu Tyr Cys Glu Glu Met

420 425 430

Lys Asn Glu Ala Ala Ala Glu Ile Asp Ser Leu Tyr Asp Glu Ile Arg

435 440 445

Pro Ala Ile Glu Glu His Glu Arg Asp Ser Gln Asp Ser Val Ala Thr

450 455 460

Ser Leu Ala Glu Lys Trp Ile Glu Ala Ser Cys Cys Lys Tyr Lys Ala

465 470 475 480

Asp Phe Asp Leu Tyr Ala Ser Ile Ile Lys Asn Leu Ala Ser Thr Pro

485 490 495

Leu Arg Ser Lys Glu Asp Ala Ala Pro Thr Glu Gln Asn Gly Leu Met

500 505 510

Tyr Leu Glu Asn Gly Pro

515

<210> 2

<211> 1557

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

atggaggaag agcgcatgga gccgccgccg ccgccgccgt acatccacat cgagaccaac 60

gatttcttgc acaggaggca caagaggcag aaagaggagg acatagctgt gtgtgagtgc 120

cagtataatc tgctggatcc ggacagcgcg tgcggggatc ggtgcttgaa cgtcttgact 180

agcacggagt gtacgcctgg atactgcctc tgcggtgtat actgcaagaa ccagcgattt 240

caaaaaagcc aatatgctgc gacaaggctg gtaaaaactg aagggcgtgg atggggcctt 300

ttggctgatg agaatattat ggctggacaa tttgttatgg aatattgtgg agaagtaata 360

tcatggaagg aagccaagag gagatctcaa gcatatgaaa accagggttt aacggatgcc 420

tatattatct atctgaatgc tgatgagtct atcgacgcaa caaagaaggg gagcctggca 480

agattcatca accattcgtg ccaaccaaac tgtgagacaa ggaaatggaa tgttcttggg 540

gaagtaagag tgggaatttt tgcgaaacaa gatattccaa tcggaacgga actatcctat 600

gactacaact ttgagtggtt tggtggtgca atggtgaggt gcctttgtgg agctggcagc 660

tgttctggat ttcttggggc taaatcacgt ggtttccagg aggctacata cctgtgggaa 720

gatgatgatg acaggttttc tgttgagaat gttccccttt atgattctgc tgatgatgaa 780

cctaccagca ttccaaagga catcttaata aaagatgagc caaatacaca ggatggcaac 840

aacaacacaa tccaaaatac tgggattcct attattgcaa gttcaagtga attcacaccg 900

atgaatgttg aaccatcgat tgcgagttca aatgagttca caccgatgaa tgttgaacca 960

ttgaatgtga gctcaaatga attgacacca atgactattg aaccattgaa tgctattcca 1020

atgggagttg attttactca gaatggatca attgaatatg gtgcgcaatg tgctgaagat 1080

gctctgcaaa actcaacgcg tggagttgca aacctccaga atcaaagtgc gccccgggac 1140

aacaaccata cagagttggt tgcggtgaaa cgtagaccca cacttcgtgg tggaaaagct 1200

aaacgtggta tgcgcaagca actgaatgtt gtgggtatct gtgatcggtt agcatcagag 1260

gtggcacgtg aagaaatatt gtattgcgag gaaatgaaga atgaagctgc tgctgaaatt 1320

gacagcctgt acgacgagat aaggccggcg atcgaagagc atgagaggga tagtcaagac 1380

agcgtggcca caagccttgc agagaagtgg attgaggcta gctgctgcaa gtacaaagct 1440

gattttgatc tgtatgcttc cattatcaag aatcttgctt ccacacctct aagatcaaaa 1500

gaagacgcgg cccctacaga gcaaaatgga ttgatgtact tggaaaacgg tccatga 1557

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggaggaag agcgcatgga 20

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcatggaccg ttttccaagt 20

<210> 5

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtcgacatgg aggaagagcg catgga 26

<210> 6

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggatcctcat ggaccgtttt ccaagt 26

<210> 7

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccatggctgc agatggaagg aagccaagag ga 32

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

gaattcaaag ttgtagtcat aggata 26

<210> 9

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tctagaatgg aaggaagcca agagga 26

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aagcttaaag ttgtagtcat aggata 26

<210> 11

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

aaaagcttcc aatttggtaa ggaaataatt 30

<210> 12

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aagaattctt tcgaacccag cttccc 26

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

aagccaatat gctgcgacaa 20

<210> 14

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ccaaaaggcc ccatcca 17

Claims (2)

1. The application of rice histone H3K36 methyltransferase in improving plant drought resistance and improving single plant yield is characterized in that the coding sequence of the rice histone H3K36 methyltransferase gene is connected with an overexpression vector obtained by a maize ubiquitin gene promoter to transform rice, so that the rice with excellent drought resistance and yield traits is obtained; transforming the antisense expression vector of the gene into rice to obtain rice with drought sensitivity and a single-plant yield reduction phenotype; wherein the histone H3K36 methyltransferase is derived from rice, is named SDG708, and has one of the following amino acid residue sequences:

（1）SEQ ID No:1；

(2) the protein which is obtained by substituting and/or deleting and/or adding one to fifty amino acid residues of the amino acid residue sequence of SEQ ID No. 1 and has the regulation and control effects on drought resistance and yield increase of plants.

2. The use of claim 1, wherein said plant is selected from the group consisting of a monocot and a dicot.

Images