NL2030997B1 - Zea mays receptor-like kinase 7 (zmrlk7) gene related to kernel and plant type development of maize and use thereof - Google Patents

Abstract

The present disclosure discloses a Zea mays receptor—like kinase 7 (ZmRLK7) gene related to maize kernel development and use thereof. In the present disclosure, a sequence of the ZmRLK7 gene and the use of the gene in regulating plant height, biomass and yield are provided. Up—regulating expression of the gene leads to a smaller plant and reduced biomass and yield; while down—regulating expression of the gene leads to a larger plant and increased biomass and yield. The present disclosure can cultivate a high— yield maize to provide gene resources for further improving a yield of cereal crops.

Description

P1165/NLpd

ZEA MAYS RECEPTOR-LIKE KINASE 7 (ZMRLKY) GENE RELATED TO KERNEL

AND PLANT TYPE DEVELOPMENT OF MAIZE AND USE THEREOF

TECHNICAL FIELD

The present disclosure relates to a Zea mays receptor-like kinase {(ZmRLK7)} gene related to maize kernel development and use thereof, and relates to the field of genetic engineering.

BACKGROUND ART

Maize is not only an important food crop, but also an im- portant feed and industrial raw material. Cultivating excellent maize cultivars and increasing maize yield per unit play a pivotal role in development of the national economy. The maize yield de- pends on a yield per plant and a planting density, and the yield per plant can be further divided into a kernel number per ear and a kernel weight per ear. Compared with other complex agronomic traits, grain traits have high heritability and easy measurement, which are not only model traits for genetic research, but also im- portant target traits for genetic improvement. The maize is rich in genetic resources. However, little natural variations in the maize have been explored, and the genetic basis for controlling important agronomic traits has also not been clarified clearly. It is of an important practical and theoretical significance to dis- cover key genes that affect grain traits using linkage analysis and genome-wide association analysis. It is also of great signifi- cance to analyze functions and regulatory mechanisms of these key genes to further construct related regulatory networks for breed- ing researches.

In recent years, through genome comparison analysis or asso- ciation analysis methods, a number of rice genes involved in the regulation of kernel type and yield traits have been cloned suc- cessively, and molecular mechanisms of these genes have been ana- lyzed one after another. However, there are few studies of related genes in maize. At present, some maize genes that are homologous to rice yield-related genes have been cloned through homologous cloning , which have shown conserved functions with the rice genes. Homologous genes of GS3 and GW2 genes that control rice kernel type in maize have been cloned, and the two genes are sig- nificantly positively correlated with maize kernel type develop- ment and kernel weight. Mn? and ZmINCWI of maize are two homolo- gous genes of a rice grain filling gene OsGIF!1. Overexpression of the Mnl increases maize kernel yield. Transformation of the

ZmINCW1 into a mutant of an Arabidopsis thaliana AtcwINV2 (a ho- mologous gene of the ZmINCWI in the Arabidopsis thaliana) can com- plement the phenotype of reduction of thousand kernel weight of the mutant. The development of these genes related to the yield in maize provides genetic resources for the cultivation of a high- yield maize. However, most of the above genes have a desirable effect on a certain maize trait. It is of a great significance by developing genes that have desirable effects on various yield- related traits to improve breeding efficiency and economic bene- fits.

SUMMARY

The present disclosure overcomes the above shortcomings, and provides a Zea mays receptor-like kinase (ZmRLK7) gene and use thereof. The ZmRLK7 gene is obtained based on an expression quan- titative trait loci (eQTL) analysis method. Up-regulating expres- sion of the gene leads to a smaller plant and reduced biomass and yield; while down-regulating expression of the gene leads to a larger plant and increased biomass and yield.

The present disclosure provides a ZmRLK7 gene, where the

ZmRLK7 gene has a nucleotide sequence as shown in SEQ ID NO:1.

Further, an amino acid sequence encoding the ZmRLK7 gene is as shown in SEQ ID NO:2.

Further, the ZmRLK7 gene, located in a regulation hotspot re- gion of a chromosome 7, is a leucine-rich repeat receptor-like ki- nase (LRR-RLK) gene.

In Arabidopsis thaliana, compared with a wild type, Arabidop- sis thaliana plants transfected with a sense ZmRLK7 gene are smaller, while Arabidopsis thaliana plants transfected with an an- tisense ZmRLK7 gene are larger.

The present disclosure further provides a recombinant expres- sion vector of the ZmRLK7 gene.

Further, the recombinant expression vector may include a fragment of the ZmRLK7 gene, the fragment is ligated into a vector pCAMBIA3301 through a KpnI restriction site, and forward and re- verse directions are identified to obtain recombinant plasmids

PUbi: Sense-ZmRLK7 and PUbi: Antisense-ZmRLK7 for forward and re- verse gene expressions driven by a maize Ubiquitin promoter, re- spectively.

Further, the recombinant expression vector may be used for overexpression, antisense suppression, RNA interference and clus- tered regularly interspaced short palindromic repeats associated protein 9 (CRISPR/Cas9) gene editing of the ZmRLK7 gene.

The present disclosure further provides use of the ZmRLK7 gene or the recombinant expression vector in increasing a plant height, biomass and a seed yield of a plant.

The present disclosure further provides use of the ZmRLK7 gene or the recombinant expression vector in obtaining a high- yield maize.

The present disclosure further provides a method for increas- ing a plant height, biomass and a seed yield of a plant, including the following steps:

Sl, vector construction: amplifying a full-length coding re- gion of a ZmRLK7 gene, ligating an obtained amplified fragment to a vector pCAMBIA3301 through a Kpnl restriction site after the am- plified fragment is sequenced correctly, identifying forward and reverse directions and selecting a recombinant plasmid PUbi: Anti- sense-ZmRLK7 for reverse gene expression driven by a maize Ubiqui- tin promoter;

S2, Agrobacterium transformation: transforming the recombi- nant plasmid for reverse gene expression obtained in step S1 into competent cells of an AGL1 Agrobacterium; and 83, plant transformation: transferring an Agrobacterium con- taining the recombinant plasmid obtained in step 52 to a yeast ex- tract peptone (YEP) liquid medium to collect cultured bacterial cells, transforming the bacterial cells into Arabidopsis thaliana using a floral dip method, and harvesting seeds at a mature stage to obtain transgenic Tl-generation seeds; alternatively, conduct- ing Agrobacterium mediated genetic transformation of maize imma- ture embryos to obtain transgenic maize plants.

Beneficial effects are as follows:

In the present disclosure, a sequence of the ZmRLK7 gene and effects of the gene in regulating plant height, biomass and yield are revealed. The gene can be used to regulate the growth and de- velopment and comprehensive resistance of plants such as Arabidop- sis thaliana, tobacco and maize. An increased expression of the gene leads to a smaller plant and reduced biomass and yield; while a decreased expression of the gene leads to a larger plant and in- creased biomass and yield. The present disclosure can cultivate maize varieties with high yield and provide gene resources for further improving of crop yields.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows an identification diagram of gene cloning and vector;

FIG. 2 shows an identification diagram of Agrobacterium transformation;

FIG. 3 shows a process diagram of Agrobacterium mediated ge- netic transformation of maize immature embryos;

FIG. 4 shows an identification diagram of a transgenic maize;

FIG. 5 shows a gene expression pattern diagram;

FIG. 6 shows a phenogram of a transgenic Arabidopsis thali- ana;

FIG. 7 shows a statistical analysis of the transgenic maize kernals;

FIG. 8 shows a phenogram of plants of the transgenic maize; and

FIG. 9 shows a subcellular location of ZmRLK7 gene.

DETAILED DESCRIPTION OF THE EMBODIMENTS

Example 1 Construction of an expression vector containing a

ZmRLK7 gene 1. Construction of the expression vector

A binary vector for plant transformation used in the experi-

ment was a modified pCAMBIA3301 carrying a glufosinate-ammonium resistance gene Bar. A full-length coding region of the ZmRLK7 gene was amplified with a high-fidelity enzyme using a maize B73 cDNA as a template, and RLK7-F: 5'-GGTACCTAGTACAAACAATTCATGGGGTCT- 5 3" (SEQ ID No: 3) and RLK7-R: 5'- GGTACCAAGGCTGCTACAAAAACCGACATT- 3! (SEQ ID No: 4) as primers, where the underlined part was a re- striction site of a restriction endonuclease KpnI. A PCR reaction system was 25 pl, including the following components: 12.5 pl of a 2xHigh-fidelity Master Mix, 1 ul for each of upstream and down- stream primers (with a concentration of 10 uM), 2 ul of a cDNA, and 8.5 pl of sterile water. A PCR program was: pre-denaturation at 98°C for 1 min; denaturation at 98°C for 10 sec, annealing at 68°C for 15 sec, extension at 72°C for 45 sec, conducting 35 cy- cles; and over extension at 72°C for 5 min.

An obtained amplified fragment was ligated to a vector pCAM-

BIA3301 through the KpnI restriction site after the amplified fragment was sequenced correctly, forward and reverse directions were identified to obtain recombinant plasmids PUbi: Sense-ZmRLK7 and PUbi: Antisense-ZmRLK7 for forward and reverse gene expres- sions driven by a maize Ubiquitin promoter, respectively.

FIG. 1 shows results of enzyme digestion of a successfully- constructed vector. As shown in the figure, when the plasmid is digested with a BamHI and a PstI: a 1.2Kb+ large band and a 3.7Kb+ large band are obtained, respectively, indicating ligation of the

Sense-ZmRLK7; a 2.2Kb+1.2Kb+631bp+410bp+ large band and a 2.6Kb+2Kb+701bp+520bp+ large band are obtained, respectively, in- dicating ligation of the Antisense-ZmRLK7. 2. Transformation of Agrobacterium competent cells

The above recombinant plasmids were transformed into compe- tent cells of an AGL1 Agrobacterium, where a transformation method referred to instructions of the competent cells. Agrobacterium competent cells stored at -70°C were melted in an ice bath, 1 ug of the recombinant plasmids were added to 100 pl of the competent cells, mixed gently, and quickly frozen in liquid nitrogen for 5 min after an ice bath treatment for 30 min; the cells were placed in a 37°C water bath to conduct incubation for 5 min, and ice bath treatment for 2 min; 800 ul of a YEP (a yeast extract; 10 g-L-1 of tryptone; 5 g°L-1 of sodium chloride; pH 7.0) liquid medium was added, and shake culture was conducted on a shaker at 28°C for 2-3 h. After collecting, bacterial cells were spread on a YEP plates containing kanamycin and rifampicin, and incubation was conducted upside down in an incubator at 28°C for 48-72 h.

After culturing for 72 h, plasmids were extracted from mono- clonal shake bacteria, and PCR identification was conducted using primers UBQlForward: CTTTTTGTTCGCTTGGTTG TGATGA (SEQ ID No: 5);

Sense-ZmRLK7: TCGCAAGCATTG GGATTGTAGAG (SEQ ID No: 6), Antisense-

ZmRLK7: AAGCGTGACGCGTCCGAGCTAC (SEQ ID No: 7). The identification results are shown in FIG. 2. A positive plasmid (P) and the Sense-

ZmRLK7 {lanes 1 and 2) have separately amplified a 509 bp band; and the positive plasmid (P) and the Antisense-ZmRLK7 (lanes 3 and 4) have separately amplified a 777 bp band. This indicates that the Agrobacterium is successfully transformed.

Example 3 Genetic transformation of a ZmRLK7 gene in Ara- bidopsis thaliana and maize 1. Transformation of the Arabidopsis thaliana by a floral dip method

An Agrobacterium containing a recombinant plasmid was trans- ferred to 200 ml of a YEP liquid medium, when OD¢;=0.8-1.2, cen- trifugation was conducted at 5000 r 'min-1 for 10 min to collect bacterial cells. The bacterial cells were resuspended in 200 ml of a 5% sucrose solution (containing 0.02% Silwet L-77) and mixed well. Flower branches were immersed in an obtained bacterial solu- tion for 30 sec and shook up and down gently. Bn infected Ara- bidopsis thaliana was cultured in the dark for 24 h, and normally cultured in the light for 3-5 d to conduct a second transfor- mation. Seeds were harvested at a mature stage to obtain transgen- ic Tl-generation seeds. 2. Agrobacterium mediated genetic transformation of maize im- mature embryos

An Agrobacterium containing a recombinant plasmid was trans- ferred to 200 ml of a YEP liquid medium, when ODs;9=0.8-1.2,; cen- trifugation was conducted at 5000 r 'min-1 for 10 min to collect bacterial cells. Genetic transformation was conducted using HilI maize immature embryos of 1.5-2 mm after pollination as a recep-

tor. After 5 min of transformation, the maize immature embryos were placed on a induction medium for co-cultivation for 7 d, and then on a selection medium until a resistant callus grew. The re- sistant callus was transferred to a regeneration medium, and re- generated plants were transplanted and self-bred to bear fruit.

The transformation process is shown in FIG. 3. 3. Molecular test results of transgenic materials 3.1. PCR identification

DNA extraction was conducted using leaf tissues from trans- genic and non-transgenic materials, and PCR amplification was con- ducted using Ubi-Forward: 5'-GACTCTAATCATAA AAACCCATCTC-3' (SEQ ID

No: 8) and RLK-Reverse: 5'-AAGCGTGACGCGTCCGAGCTA C-3' (SEQ ID No: 9) as primers. The forward primer was a promoter-specific primer, and the reverse primer was a gene-specific primer. The amplifica- tion results are shown in FIG. 4, where no bands can be amplified in a non-transgenic control (WT), while target bands can be ampli- fied in a transgene (lanes 1-19) and a positive plasmid (P). There are also false positive plants such as a Sense-ZmRLK7 amplifica- tion result (lane 17). 3.2. Analysis of gene expression patterns

Tissues of different developmental stages of maize were quick-frozen in liquid nitrogen, an RNA was extracted with a Tri- zol kit, and reverse transcription was conducted using random six primers to obtain a single-stranded cDNA. Real-time fluorescent quantitative PCR ({(gRT-PCR) was conducted with an endogenous gene

Actin of the maize as a reference gene. Real-Time PCR was conduct- ed using a Bio-rad 7500 Real-Time PCR instrument, and experimental results were analyzed using Opticon Monitor”! Software. The results are shown in FIG. 5. The gene is highly expressed in primary roots and in immature embryos 15-25 d after pollination, and has almost no expression in leaves, indicating that this gene plays a key role during kernel development. 4. Trait identification of offspring of the transgenic mate- rials

The offspring of transgenic Arabidopsis thaliana and trans- genic maize were planted, a DNA was extracted from leaves at a seedling stage for PCR detection, and phenotypic statistics was conducted on plants and seeds/grains of positive plants.

The phenotypic results of Arabidopsis thaliana are shown in

FIG. 6. The results show that compared with a wild type, Arabidop- sis thaliana plants transfected with a sense ZmRLK7 gene are smaller, while Arabidopsis thaliana plants transfected with an an- tisense ZmRLK7 gene are larger. Since the results in transgenic

Arabidopsis thaliana proved that this gene was a negative regula- tory gene, only an antisense gene structure was transformed in the maize for functional verification.

The maize phenotype results are shown in FIG. 7 and FIG. 8.

Compared with a non-transgenic control: FIG. 7 shows that the an- tisense gene-transgenic maize has a kernel thickness significantly increased by about 20%, and a 100-kernel weight of significantly increased by about 24%; FIG. 8 shows that the antisense gene- transgenic maize plant is robust, with strong early growth vigor.

This indicates that the down-regulation of expression level of this gene increases the size of maize plant, the kernel thickness and the 100-kernel weight. 5. Maize protoplast transformation and subcellular localiza- tion of genes

A fusion expression vector was constructed using the ZmRLK7 and a GFP gene, and a plasmid was extracted for later use. Maize seeds were sown in vermiculite; buds grew to 1-2 cm under the light, and were cultivated in the dark for 10-11 d. A middle sec- tion of a second leaf was cut into about 1 mm filaments, the fila- ments were added to a prepared enzymolysis solution, and incuba- tion was conducted in the dark at room temperature for 4 h. After incubation, an obtained product was filtered with a 75 pum filter, and subjected to centrifugation at 100xg for 2 min, and maize pro- toplasts were collected; the maize protoplasts were washed twice with a buffer solution, subjected to incubation on ice for 45 min to 1 h, and a status of the protoplasts was examined under micro- scope. The protoplasts were resuspended and adjusted to a concen- tration of ~10-5 cells/100 pl. For each transformation experiment, 100 pl of protoplast cells were added with 20 pug of plasmids and mixed well by flicking, a PEG solution was added in the cells to mix thoroughly, and standing was allowed at 28°C for 15 min in the dark. The cells were collected by centrifugation, resuspended and transferred to a cell culture plate for incubation for 12-16 h in a 28°C incubator protected from light. Microscopic examination was conducted with a fluorescence microscope, and photographing was conducted.

The subcellular localization of a ZmRLK7 protein is on the cell membrane and nuclear membrane, as shown in FIG. 9 (a light and bright part is a location of a fluorescent label of the gene).

This indicates that gene acts on the cell membrane, which is con- sistent with a result by a secondary structure analysis of the gene that there is a transmembrane domain and a conserved ser- ine/threonine kinase domain.

SEQUENCE LISTING

<110> Shandong Academy of Agricultural Sciences <120> ZEA MAYS RECEPTOR-LIKE KINASE 7 (ZmRLK7) GENE RELATED TO KERNEL AND

PLANT TYPE DEVELOPMENT OF MAIZE AND USE THEREOF

<130> HKJP202111765 <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 3586 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of ZmRLK7 gene <400> 1 atggggtctc cccctctaca atcccaatgc ttgcgagagg cgccacctca cagagccagc 60 catccaccgc attgcegcec cectegcete tcctcacgtc acccgccegt ctcagcctca 120 ccaccgaggc gegegetgee aatgccgcca cggtcccgcg ccgcggcacc gaggetegeg 180 tttetegtgc cgetegectt cgccttegec ttgctgctgg tgccgccgtg ccactgcgtc 240 aacgagcagg gccaggcgct getgegatgg aaggacaccctgcggccggc gggeggegeg 300 ctggcgtcgt ggcgcgccgg ggacgcgagt ccgtgccggt ggaccggcgt gtcgtgcaac 360 gcgcgcggcg acgtegtegg gctgagcatc accteggteg atctgcaggg ccctctcccg 420 gccaacctgc agccgcttgc agegtegetg aagacgctgg agctctctgg cacgaacctc 480 accggcgcga tacccaagga gatcggcgag tacggcgagc tgaccaccct cgaccttagc 540 aagaaccagc tcaccggege ggtcccegcc gagctgtgcc ggctggccaa gcttgagtcg 600 ctcgcgctca actccaactc cctgcgtgga gccatcccgg acgacatcgg caacctcacc 660 agcctgacgt atctgacgct ctacgacaat gagctcagtg ggccgatccc geccagcatc 720 ggcaacctga agaagctgca ggtgctccgc gccggcggga accaggggat gaagggtccc 780 ctgccgcagg agatcggcgg atgcactgac ctcaccatgc tcgggctcgc ggagaccggc 840 gtctcaggga gcctcccgga gacgatcggg cagctcaaga agatccagac cattgccatc 900 tacaccactc tgctctecgg ccggatcccg gagtccatcg gcaactgcac ccagctcacc 960 agcctgtacc tgtaccagaa ttctctctec gggccgatac ctccgcagct cggetaccte 1020 aagaagctcc agactctgct tctatggcag aaccagctcg tcggcgcaat tcccccggaa 1080 ctcggacagt gcaaggagct cacgctcatt gacctgtcgc tgaattcgct taccgggagc 1140 atcccggcga gtttgggcgg gctacctaat ctccagcagc tgcagctgag cacgaaccag 1200 ctcactggca ccataccgcc ggagctctcc aactgcacgt cgetgacgga catcgaggtc 1260 gacaacaact tgctgtccgg ggcgatcagc atcgacttcc cgagactgeg caacctcacc 1320 ctgttctacg cgtggaagaa ccggctcact ggcggcgtgc cgacgagcct cgccgaggcc 1380 ccgagcttgc aggcggttga cctgtcatac aacaacctca ccggtcccat ccccaaggcg 1440 ctgttcgggc tccagaactt gaccaagctg ctgcttctca acaacgagct gaccgggctc 1500 ataccgtcgg agatcggtaa ctgcaccaac ctgtacagac tccggctcaa cggcaacagg 1560 ctgtccggcg cgattcccgc cgagatcggc aacctcaaga acctaaactt cctegacatg 1620 agtgagaacc acctcgtcgg cccggtgccc gcggccatat cggggtgege cagcctcgag 1680 ttcctcgacc tgcactccaa tgctctgtcc ggegeattge cggacacgtt gccgcgcagt 1740 ctccagctca ttgacgtctc cgacaaccag ctcaccgggc cgttgagctc cagcatcggg 1800 tcattgccgg agctgacgaa getgtacatg ggaaacaacc ggctgaccgg tggcatcccg 1860 cccgagctcg gttcgtgtga gaagctccag ctgctggacc teggeggeaa cgcgttctcc 1920 ggtggcatce cgtcggagct cgggatgcta ccgtcattgg agatcteget taacctcagc 1980 tgcaaccggc tttcagggga gataccgtcg cagttcgccg gecttgacaa gctcggcagc 2040 ctcgacctgt cgcacaacga gctctccggg agccttgagc cgctcgcggc gctgcagaac 2100 ctcgtcacgt tgaacatatc ctacaatacc ttctctgggg agctcccgaa cactcccttc 2160 ttccagaagc tgcccctcag cgacctagcc ggcaaccgcc atctcgtcgt cagcgacggc 2220 tccgacgagt cctcccggcg tggcgtcatc tcgtcattca agatagccat atccatccte 2280 gccgcagcca gegegetget cetggttgcc gecgectata tgctcgcccg cacgcaccgc 2340 cgcggcggcg gecgcatcat ccacggcgag ggctcgtggg aggtgacact gtaccagaag 2400 ctcgacatca ccatggacga cgtgctccga gggctgacgt ccgcgaacat gatcggcacc 2460 ggcagctcag gggccgtgta caaggtggac acccccaacg gctacaccctcgcegtgaag 2520 aagatgtggt cgtcggacga ggtgacgtcg gcggcgttcc gcagcgagat cgeggegetg 2580 ggctccatcc gccaccgcaa catcgtgcge ctcctcgggt gggccgcgaa cggcggcacg 2640 aggctgctct tetacagcta cctccccaac ggcagcctga geggectect gecacggegge 2700 cgcgccgcca agggctcgce cgeggacgag tggggcgcgc getacgagat cgcgctcggc 2760 gtcgcccacg ccgtggcgta cctgcaccac gactgcgtgc cggccatcct gcacggcgac 2820 gtcaagtcca tgaacgtgct geteggegeg tectacgage cgtacctcgc tgacttcggc 2880 ctcgcccgeg tcctggccge cgcgagctcc atgctcgaca ccggcaagca gccccgcatc 2940 gccggctcgt acggctacat ggcaccagag tacgcgtcga tgcagcggat cagcgagaag 3000 agcgacgtgt acagcttcgg cgtcgtgttg ctggagatct tgacggggcg gcacccgctg 3060 gacccgacgc tgtccggcgg cgcgcacctg gtgcagtggc tgcgcgagca cgtgcaggcg 3120 aagcgtgacg cgtccgagct actggacgcg cggctccggg ccagggcggg cgaggcggac 3180 gtgcacgaga tgcggcaggt gctgtccgtg gccacgctgt gegtgtegeg ccgcgcggac 3240 gaccggcccg ccatgaagga cgtggtggcg ctgctcaagg agatccggcg ccccgcggcg 3300 gtggacgacyg cgaagcagcg gccacccacg gecgeegege cggtgtcgcc ggtgagegeg 3360 cactcgaggg gccaatcgtc gagctgctce ttegeegtgt cggagtacte tgcctgacgg 3420 gacgcgaatt tttgcgagtg tagtgaacct agtaaattac tactaacatc ttagcgagcc 3480 gtaaacagtg ttgattagcc aaagatgtac tactggtaat gttgtactta ggtgtaatct 3540 gccattgtac attactctcg agaatgtcgg tttttgtage agcctt 3586 <210> 2 <211> 1138 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence encoding ZmRLK7 gene <400> 2

Met Gly Ser Pro Pro Leu Gln Ser Gln Cys Leu Arg Glu Ala Pro Pro 1 5 10 15

His Arg Ala Ser His Pro Pro His Cys Arg Pro Pro Arg Leu Ser Ser 20

Arg His Pro Pro Val Ser Ala Ser Pro Pro Arg Arg Ala Leu Pro Met 25

Pro Pro Arg Ser Arg Ala Ala Ala Pro Arg Leu Ala Phe Leu Val Pro 60 30 Leu Ala Phe Ala Phe Ala Leu Leu Leu Val Pro Pro Cys His Cys Val 65 70 75 80

Asn Glu Gln Gly Gln Ala Leu Leu Arg Trp Lys Asp Thr Leu Arg Pro 35 85 90 95

Ala Gly Gly Ala Leu Ala Ser Trp Arg Ala Gly Asp Ala Ser Pro Cys 100 105 110

Arg Trp Thr Gly Val Ser Cys Asn Ala Arg Gly Asp Val Val Gly Leu 115 120 125

Ser Ile Thr Ser Val Asp Leu Gln Gly Pro Leu Pro Ala Asn Leu Gln 130 135 140

Pro Leu Ala Ala Ser Leu Lys Thr Leu Glu Leu Ser Gly Thr Asn Leu 145 150 155 160

Thr Gly Ala Ile Pro Lys Glu Ile Gly Glu Tyr Gly Glu Leu Thr Thr 165 170 175

Leu Asp Leu Ser Lys Asn Gln Leu Thr Gly Ala Val Pro Ala Glu Leu 180 185 190

Cys Arg Leu Ala Lys Leu Glu Ser Leu Ala Leu Asn Ser Asn Ser Leu 195 200 205

Arg Gly Ala Ile Pro Asp Asp Ile Gly Asn Leu Thr Ser Leu Thr Tyr 210 215 220

Leu Thr Leu Tyr Asp Asn Glu Leu Ser Gly Pro Ile Pro Pro Ser Ile 225 230 235 240

Gly Asn Leu Lys Lys Leu Gln Val Leu Arg Ala Gly Gly Asn Gln Gly 245 250 255

Met Lys Gly Pro Leu Pro Gln Glu Ile Gly Gly Cys Thr Asp Leu Thr 260 265 270

Met Leu Gly Leu Ala Glu Thr Gly Val Ser Gly Ser Leu Pro Glu Thr 275 280 285

Ile Gly Gln Leu Lys Lys Ile Gln Thr Ile Ala Ile Tyr Thr Thr Leu 290 295 300

Leu Ser Gly Arg Ile Pro Glu Ser Ile Gly Asn Cys Thr Gln Leu Thr 305 310 315 320

Ser Leu Tyr Leu Tyr Gln Asn Ser Leu Ser Gly Pro Ile Pro Pro Gln 325 330 335

Leu Gly Tyr Leu Lys Lys Leu Gln Thr Leu Leu Leu Trp Gln Asn Gln 340 345 350

Leu Val Gly Ala Ile Pro Pro Glu Leu Gly Gln Cys Lys Glu Leu Thr 355 360 365

Leu Ile Asp Leu Ser Leu Asn Ser Leu Thr Gly Ser Ile Pro Ala Ser 370 375 380

Leu Gly Gly Leu Pro Asn Leu Gln Gln Leu Gln Leu Ser Thr Asn Gln 385 390 395 400

Leu Thr Gly Thr Ile Pro Pro Glu Leu Ser Asn Cys Thr Ser Leu Thr 405 410 415

Asp Ile Glu Val Asp Asn Asn Leu Leu Ser Gly Ala Ile Ser Ile Asp 420 425 430

Phe Pro Arg Leu Arg Asn Leu Thr Leu Phe Tyr Ala Trp Lys Asn Arg 435 440 445

Leu Thr Gly Gly Val Pro Thr Ser Leu Ala Glu Ala Pro Ser Leu Gln 450 455 460

Ala Val Asp Leu Ser Tyr Asn Asn Leu Thr Gly Pro Ile Pro Lys Ala 465 470 475 480

Leu Phe Gly Leu Gln Asn Leu Thr Lys Leu Leu Leu Leu Asn Asn Glu 485 490 495

Leu Thr Gly Leu Ile Pro Ser Glu Ile Gly Asn Cys Thr Asn Leu Tyr 500 505 510

Arg Leu Arg Leu Asn Gly Asn Arg Leu Ser Gly Ala Ile Pro Ala Glu 515 520 525

Ile Gly Asn Leu Lys Asn Leu Asn Phe Leu Asp Met Ser Glu Asn His 530 535 540

Leu Val Gly Pro Val Pro Ala Ala Ile Ser Gly Cys Ala Ser Leu Glu 545 550 555 560

Phe Leu Asp Leu His Ser Asn Ala Leu Ser Gly Ala Leu Pro Asp Thr 565 570 575

Leu Pro Arg Ser Leu Gln Leu Ile Asp Val Ser Asp Asn Gln Leu Thr 580 585 590

Gly Pro Leu Ser Ser Ser Ile Gly Ser Leu Pro Glu Leu Thr Lys Leu 595 600 605

Tyr Met Gly Asn Asn Arg Leu Thr Gly Gly Ile Pro Pro Glu Leu Gly 610 615 620

Ser Cys Glu Lys Leu Gln Leu Leu Asp Leu Gly Gly Asn Ala Phe Ser 625 630 635 640

Gly Gly Ile Pro Ser Glu Leu Gly Met Leu Pro Ser Leu Glu Ile Ser 645 650 655

Leu Asn Leu Ser Cys Asn Arg Leu Ser Gly Glu Ile Pro Ser Gln Phe 660 665 670

Ala Gly Leu Asp Lys Leu Gly Ser Leu Asp Leu Ser His Asn Glu Leu 675 680 685

Ser Gly Ser Leu Glu Pro Leu Ala Ala Leu Gln Asn Leu Val Thr Leu 690 695 700

Asn Ile Ser Tyr Asn Thr Phe Ser Gly Glu Leu Pro Asn Thr Pro Phe 705 710 715 720

Phe Gln Lys Leu Pro Leu Ser Asp Leu Ala Gly Asn Arg His Leu Val 725 730 735

Val Ser Asp Gly Ser Asp Glu Ser Ser Arg Arg Gly Val Ile Ser Ser 740 745 750

Phe Lys Ile Ala Ile Ser Ile Leu Ala Ala Ala Ser Ala Leu Leu Leu 755 760 765

Val Ala Ala Ala Tyr Met Leu Ala Arg Thr His Arg Arg Gly Gly Gly 770 775 780

Arg Ile Ile His Gly Glu Gly Ser Trp Glu Val Thr Leu Tyr Gln Lys 785 790 795 300

Leu Asp Ile Thr Met Asp Asp Val Leu Arg Gly Leu Thr Ser Ala Asn 805 810 815

Met Ile Gly Thr Gly Ser Ser Gly Ala Val Tyr Lys Val Asp Thr Pro 820 825 830

Asn Gly Tyr Thr Leu Ala Val Lys Lys Met Trp Ser Ser Asp Glu Val 835 840 845

Thr Ser Ala Ala Phe Arg Ser Glu Ile Ala Ala Leu Gly Ser Ile Arg 850 855 860

His Arg Asn Ile Val Arg Leu Leu Gly Trp Ala Ala Asn Gly Gly Thr 865 870 875 880

Arg Leu Leu Phe Tyr Ser Tyr Leu Pro Asn Gly Ser Leu Ser Gly Leu 885 890 895

Leu His Gly Gly Arg Ala Ala Lys Gly Ser Pro Ala Asp Glu Trp Gly 900 905 910

Ala Arg Tyr Glu Ile Ala Leu Gly Val Ala His Ala Val Ala Tyr Leu 915 920 925

His His Asp Cys Val Pro Ala Ile Leu His Gly Asp Val Lys Ser Met 930 935 940

Asn Val Leu Leu Gly Ala Ser Tyr Glu Pro Tyr Leu Ala Asp Phe Gly 945 950 955 360

Leu Ala Arg Val Leu Ala Ala Ala Ser Ser Met Leu Asp Thr Gly Lys 965 970 975

Gln Pro Arg Ile Ala Gly Ser Tyr Gly Tyr Met Ala Pro Glu Tyr Ala 980 985 990

Ser Met Gln Arg Ile Ser Glu Lys Ser Asp Val Tyr Ser Phe Gly Val 995 1000 1005

Val Leu Leu Glu Ile Leu Thr Gly Arg His Pro Leu Asp Pro Thr 1010 1015 1020

Leu Ser Gly Gly Ala His Leu Val Gln Trp Leu Arg Glu His Val 1025 1030 1035

Gln Ala Lys Arg Asp Ala Ser Glu Leu Leu Asp Ala Arg Leu Arg 1040 1045 1050

Ala Arg Ala Gly Glu Ala Asp Val His Glu Met Arg Gln Val Leu 1055 1060 1065

Ser Val Ala Thr Leu Cys Val Ser Arg Arg Ala Asp Asp Arg Pro 1070 1075 1080

Ala Met Lys Asp Val Val Ala Leu Leu Lys Glu Ile Arg Arg Pro 1085 1090 1085

Ala Ala Val Asp Asp Ala Lys Gln Arg Pro Pro Thr Ala Ala Ala 1100 1105 1110

Pro Val Ser Pro Val Ser Ala His Ser Arg Gly Gln Ser Ser Ser 1115 1120 1125

Cys Ser Phe Ala Val Ser Glu Tyr Ser Ala 1130 1135 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer RLK7-F <400> 3 ggtacctagt acaaacaatt catggggtct 30 <210> 4 <211> 30 <212> DNA <213> Artificial Sequence

<220> <223> Primer RLK7-R <400> 4 ggtaccaagg ctgctacaaa aaccgacatt 30 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer UBQ1-Forward <400> 5 ctttttgtte gettggttgt gatga 25

<210> 6 <211> 23 <212> DNA <213> Artificial Sequence

<220> <223> Primer Sense-ZmRLK7 <400> 6 tcgcaagcat tgggattgta gag 23 <210> 7 <211> 22 <212> DNA

<213> Artificial Sequence <220> <223> Primer Antisense-ZmRLK7

<400> 7 aagcgtgacg cgtccgagct ac 22 <210>8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer Ubi-Forward <400> 8 gactctaatc ataaaaaccc atctc 25

<210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer RLK-Reverse <400> 9 aagcgtgacg cgtccgagct ac 22

SEQUENCE LISTING

<110> Shandong Academy of Agricultural Sciences <120> ZEA MAYS RECEPTOR-LIKE KINASE 7 (ZmRLK7) GENE RELATED TO KERNEL

AND PLANT TYPE DEVELOPMENT OF MAIZE AND USE THEREOF

<130> HKJP202111765 <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 3586 <212> DNA <213> Artificial Sequence <220> <223> DNA sequence of ZmRLK7 gene <400> 1 atggggtctc cccctctaca atcccaatgc ttgcgagagg cgccacctca cagagccagc 60 catccaccgc attgccgccc ccctcgcctc tcctcacgtc acccgcccgt ctcagcctca 120 ccaccgaggc gcgcgctgcc aatgccgcca cggtcccgcg ccgcggcacc gaggctcgcg 180 tttetegtgc cgctcgcctt cgccttecgcc ttgctgctgg tgccgccgtg ccactgcgtc 240 aacgagcagg gccaggcgct gctgcgatgg aaggacaccc LgCggCCgEgC gggCgEgCgCEg 300 ctggcgtcgt ggcgcgccgg ggacgcgagt ccgtgccggt ggaccggcgt gtcgtgcaac 360 gcgcgcggcg acgtcgtcgg gctgagcatc acctcggtcg atctgcaggg ccctctcccg 420 gccaacctgc agccgcttgc agcgtcgctg aagacgctgg agctctctgg cacgaacctc 480 accggcgcga tacccaagga gatcggcgag tacggcgagc tgaccaccct cgaccttagc 540 aagaaccagc tcaccggcgc ggtccccgcc gagctgtgcc ggctggccaa gcttgagtcg 600 ctcgcgctca actccaactc cctgcgtgga gccatcccgg acgacatcgg caacctcacc 660 agcctgacgt atctgacgct ctacgacaat gagctcagtg ggccgatccc gcccagcatc 720 ggcaacctga agaagctgca ggtgctccgc gccggcggga accaggggat gaagggtccc 780 ctgccgcagg agatcggcgg atgcactgac ctcaccatgc tcgggctcgc ggagaccggc 840 gtctcaggga gcctcccgga gacgatcggg cagctcaaga agatccagac cattgccatc 900 tacaccactc tgctctccgg ccggatcccg gagtccatcg gcaactgcac ccagctcacc 960 agcctgtacc tgtaccagaa ttctctctcc gggccgatac ctccgcagct cggctacctc 1020 aagaagctcc agactctgct tctatggcag aaccagctcg tcggcgcaat tcccccggaa 1080 ctcggacagt gcaaggagct cacgctcatt gacctgtcgc tgaattcgct taccgggagc 1140 atcccggcga gtttgggcgg gctacctaat ctccagcagc tgcagctgag cacgaaccag 1200 ctcactggca ccataccgcc ggagctctcc aactgcacgt cgctgacgga catcgaggtc 1260 gacaacaact tgctgtccgg ggcgatcagc atcgacttcc cgagactgcg caacctcacc 1320 ctgttctacg cgtggaagaa ccggctcact ggcggcgtgc cgacgagcct cgccgaggcc 1380 ccgagcttgc aggcggttga cctgtcatac aacaacctca ccggtcccat ccccaaggcg 14409 ctgttcgggc tccagaactt gaccaagctg ctgcttctca acaacgagct gaccgggctc 1500 ataccgtcgg agatcggtaa ctgcaccaac ctgtacagac tccggctcaa cggcaacagg 1560 ctgtccggcg cgattcccgc cgagatcggc aacctcaaga acctaaactt cctcgacatg 1620 agtgagaacc acctcgtcgg cccggtgccc gcggccatat cggggtgcgc cagcctcgag 1680 ttcctcgacc tgcactccaa tgctctgtcc ggcgcattgc cggacacgtt gccgcgcagt 1740 ctccagctca ttgacgtctc cgacaaccag ctcaccgggc cgttgagctc cagcatcggg 1800 tcattgccgg agctgacgaa gctgtacatg ggaaacaacc ggctgaccgg tggcatcccg 1860 cccgagctcg gttcgtgtga gaagctccag ctgctggacc tcggcggcaa cgcgttctcc 1920 ggtggcatcc cgtcggagct cgggatgcta ccgtcattgg agatctcgct taacctcagc 1980 tgcaaccggc tttcagggga gataccgtcg cagttcgccg gccttgacaa gctcggcagc 2040 ctcgacctgt cgcacaacga gctctccggg agccttgagc cgctcgcggc gctgcagaac 2100 ctcgtcacgt tgaacatatc ctacaatacc ttctctgggg agctcccgaa cactcccttc 2160 ttccagaagc tgcccctcag cgacctagcc ggcaaccgcc atctcgtcgt cagcgacggc 2220 tccgacgagt cctcccggcg tggcgtcatc tcgtcattca agatagccat atccatcctc 2280 gccgcagcca gcgcgctgct cctggttgcc gccgcctata tgctcgcccg cacgcaccgc 2340 cgeggeggeg gccgcatcat ccacggcgag ggctcgtggg aggtgacact gtaccagaag 2400 ctcgacatca ccatggacga cgtgctccga gggctgacgt ccgcgaacat gatcggcacc 2460 ggcagctcag gggccgtgta caaggtggac acccccaacg gctacaccct cgccgtgaag 2520 aagatgtggt cgtcggacga ggtgacgtcg gcggcgttcc gcagcgagat cgcggcgctg 2580 ggctccatcc gccaccgcaa catcgtgcgc ctcctcgggt gggccgcgaa cggeggeacg 2640 aggctgctct tctacagcta cctccccaac ggcagcctga gcggcctcct gCacggcggc 2700

CgCgccgcca agggctcgcc cgcggacgag tggggcgcgc gctacgagat cgcgctcggc 2760 gtcgcccacg ccgtggcgta cctgcaccac gactgcgtgc cggccatcct gcacggcgac 2820 gtcaagtcca tgaacgtgct gctcggcgcg tcctacgagc cgtacctcgc tgacttcggc 2880 ctcgcccgcg tcctggccgc cgcgagctcc atgctcgaca ccggcaagca gccccgcatc 2940 gccggctcgt acggctacat ggcaccagag tacgcgtcga tgcagcggat cagcgagaag 3000 agcgacgtgt acagcttcgg cgtcgtgttg ctggagatct tgacggggcg gcacccgctg 3060 gacccgacgc tgtccggcgg cgcgcacctg gtgcagtggc tgcgcgagca cgtgcaggcg 3120 aagcgtgacg cgtccgagct actggacgcg CggCtCCggg CCagggCggEg Cgaggcggac 3180 gtgcacgaga tgcggcaggt gctgtccgtg gccacgctgt gcgtgtcgcg ccgegeggac 3240 gaccggcccg ccatgaagga cgtggtggcg ctgctcaagg agatccggeg CCCCgCggCg 3300 gtggacgacg cgaagcagcg gccacccacg gccgccgcgc cggtgtcgcc ggtgagegeg 3360 cactcgaggg gccaatcgtc gagctgctcc ttcgccgtgt cggagtactc tgcctgacgg 3420 gacgcgaatt tttgcgagtg tagtgaacct agtaaattac tactaacatc ttagcgagcc 3480 gtaaacagtg ttgattagcc aaagatgtac tactggtaat gttgtactta ggtgtaatct 3540 gccattgtac attactctcg agaatgtcgg tttttgtagc agcctt 3586 <210> 2 <211> 1138 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence encoding ZmRLK7 gene <400> 2

Met Gly Ser Pro Pro Leu Gln Ser Gln Cys Leu Arg Glu Ala Pro Pro 1 5 10 15

His Arg Ala Ser His Pro Pro His Cys Arg Pro Pro Arg Leu Ser Ser

Arg His Pro Pro Val Ser Ala Ser Pro Pro Arg Arg Ala Leu Pro Met

Pro Pro Arg Ser Arg Ala Ala Ala Pro Arg Leu Ala Phe Leu Val Pro 60

Leu Ala Phe Ala Phe Ala Leu Leu Leu Val Pro Pro Cys His Cys Val 65 70 75 80

Asn Glu Gln Gly Gln Ala Leu Leu Arg Trp Lys Asp Thr Leu Arg Pro 85 90 95

Ala Gly Gly Ala Leu Ala Ser Trp Arg Ala Gly Asp Ala Ser Pro Cys 100 105 110

Arg Trp Thr Gly Val Ser Cys Asn Ala Arg Gly Asp Val Val Gly Leu 115 120 125

Ser Ile Thr Ser Val Asp Leu Gln Gly Pro Leu Pro Ala Asn Leu Gln 130 135 140

Pro Leu Ala Ala Ser Leu Lys Thr Leu Glu Leu Ser Gly Thr Asn Leu 145 150 155 160

Thr Gly Ala Ile Pro Lys Glu Ile Gly Glu Tyr Gly Glu Leu Thr Thr 165 170 175

Leu Asp Leu Ser Lys Asn Gln Leu Thr Gly Ala Val Pro Ala Glu Leu 180 185 190

Cys Arg Leu Ala Lys Leu Glu Ser Leu Ala Leu Asn Ser Asn Ser Leu 195 200 205

Arg Gly Ala Ile Pro Asp Asp Ile Gly Asn Leu Thr Ser Leu Thr Tyr 210 215 220

Leu Thr Leu Tyr Asp Asn Glu Leu Ser Gly Pro Ile Pro Pro Ser Ile 225 230 235 240

Gly Asn Leu Lys Lys Leu Gln Val Leu Arg Ala Gly Gly Asn Gln Gly 245 250 255

Met Lys Gly Pro Leu Pro Gln Glu Ile Gly Gly Cys Thr Asp Leu Thr 260 265 270

Met Leu Gly Leu Ala Glu Thr Gly Val Ser Gly Ser Leu Pro Glu Thr 275 280 285

Ile Gly Gln Leu Lys Lys Ile Gln Thr Ile Ala Ile Tyr Thr Thr Leu 290 295 300

Leu Ser Gly Arg Ile Pro Glu Ser Ile Gly Asn Cys Thr Gln Leu Thr 305 310 315 320

Ser Leu Tyr Leu Tyr Gln Asn Ser Leu Ser Gly Pro Ile Pro Pro Gln 325 330 335

Leu Gly Tyr Leu Lys Lys Leu Gln Thr Leu Leu Leu Trp Gln Asn Gln 340 345 350

Leu Val Gly Ala Ile Pro Pro Glu Leu Gly Gln Cys Lys Glu Leu Thr 355 360 365

Leu Ile Asp Leu Ser Leu Asn Ser Leu Thr Gly Ser Ile Pro Ala Ser 370 375 380

Leu Gly Gly Leu Pro Asn Leu Gln Gln Leu Gln Leu Ser Thr Asn Gln 385 390 395 400

Leu Thr Gly Thr Ile Pro Pro Glu Leu Ser Asn Cys Thr Ser Leu Thr 405 410 415

Asp Ile Glu Val Asp Asn Asn Leu Leu Ser Gly Ala Ile Ser Ile Asp 420 425 430

Phe Pro Arg Leu Arg Asn Leu Thr Leu Phe Tyr Ala Trp Lys Asn Arg 435 440 445

Leu Thr Gly Gly Val Pro Thr Ser Leu Ala Glu Ala Pro Ser Leu Gln 450 455 460

Ala Val Asp Leu Ser Tyr Asn Asn Leu Thr Gly Pro Ile Pro Lys Ala

465 470 475 480

Leu Phe Gly Leu Gln Asn Leu Thr Lys Leu Leu Leu Leu Asn Asn Glu 485 490 495

Leu Thr Gly Leu Ile Pro Ser Glu Ile Gly Asn Cys Thr Asn Leu Tyr 500 505 510

Arg Leu Arg Leu Asn Gly Asn Arg Leu Ser Gly Ala Ile Pro Ala Glu 515 520 525

Ile Gly Asn Leu Lys Asn Leu Asn Phe Leu Asp Met Ser Glu Asn His 530 535 540

Leu Val Gly Pro Val Pro Ala Ala Ile Ser Gly Cys Ala Ser Leu Glu 545 550 555 560

Phe Leu Asp Leu His Ser Asn Ala Leu Ser Gly Ala Leu Pro Asp Thr 565 570 575

Leu Pro Arg Ser Leu Gln Leu Ile Asp Val Ser Asp Asn Gln Leu Thr 580 585 590

Gly Pro Leu Ser Ser Ser Ile Gly Ser Leu Pro Glu Leu Thr Lys Leu 595 600 605

Tyr Met Gly Asn Asn Arg Leu Thr Gly Gly Ile Pro Pro Glu Leu Gly 610 615 620

Ser Cys Glu Lys Leu Gln Leu Leu Asp Leu Gly Gly Asn Ala Phe Ser 625 630 635 640

Gly Gly Ile Pro Ser Glu Leu Gly Met Leu Pro Ser Leu Glu Ile Ser 645 650 655

Leu Asn Leu Ser Cys Asn Arg Leu Ser Gly Glu Ile Pro Ser Gln Phe 660 665 670

Ala Gly Leu Asp Lys Leu Gly Ser Leu Asp Leu Ser His Asn Glu Leu 675 680 685

Ser Gly Ser Leu Glu Pro Leu Ala Ala Leu Gln Asn Leu Val Thr Leu 690 695 700

Asn Ile Ser Tyr Asn Thr Phe Ser Gly Glu Leu Pro Asn Thr Pro Phe 705 710 715 720

Phe Gln Lys Leu Pro Leu Ser Asp Leu Ala Gly Asn Arg His Leu Val 725 730 735

Val Ser Asp Gly Ser Asp Glu Ser Ser Arg Arg Gly Val Ile Ser Ser 740 745 750

Phe Lys Ile Ala Ile Ser Ile Leu Ala Ala Ala Ser Ala Leu Leu Leu 755 760 765

Val Ala Ala Ala Tyr Met Leu Ala Arg Thr His Arg Arg Gly Gly Gly 770 775 780

Arg Ile Ile His Gly Glu Gly Ser Trp Glu Val Thr Leu Tyr Gln Lys 785 790 795 800

Leu Asp Ile Thr Met Asp Asp Val Leu Arg Gly Leu Thr Ser Ala Asn 805 810 815

Met Ile Gly Thr Gly Ser Ser Gly Ala Val Tyr Lys Val Asp Thr Pro 820 825 830

Asn Gly Tyr Thr Leu Ala Val Lys Lys Met Trp Ser Ser Asp Glu Val 835 840 845

Thr Ser Ala Ala Phe Arg Ser Glu Ile Ala Ala Leu Gly Ser Ile Arg 850 855 860

His Arg Asn Ile Val Arg Leu Leu Gly Trp Ala Ala Asn Gly Gly Thr 865 870 875 880

Arg Leu Leu Phe Tyr Ser Tyr Leu Pro Asn Gly Ser Leu Ser Gly Leu 885 890 895

Leu His Gly Gly Arg Ala Ala Lys Gly Ser Pro Ala Asp Glu Trp Gly

900 905 910

Ala Arg Tyr Glu Ile Ala Leu Gly Val Ala His Ala Val Ala Tyr Leu 915 920 925

His His Asp Cys Val Pro Ala Ile Leu His Gly Asp Val Lys Ser Met 930 935 940

Asn Val Leu Leu Gly Ala Ser Tyr Glu Pro Tyr Leu Ala Asp Phe Gly 945 950 955 960

Leu Ala Arg Val Leu Ala Ala Ala Ser Ser Met Leu Asp Thr Gly Lys 965 970 975

Gln Pro Arg Ile Ala Gly Ser Tyr Gly Tyr Met Ala Pro Glu Tyr Ala 980 985 990

Ser Met Gln Arg Ile Ser Glu Lys Ser Asp Val Tyr Ser Phe Gly Val 995 1000 1005

Val Leu Leu Glu Ile Leu Thr Gly Arg His Pro Leu Asp Pro Thr 1010 1015 1020

Leu Ser Gly Gly Ala His Leu Val Gln Trp Leu Arg Glu His Val 1025 1030 1035

Gln Ala Lys Arg Asp Ala Ser Glu Leu Leu Asp Ala Arg Leu Arg 1040 1045 1050

Ala Arg Ala Gly Glu Ala Asp Val His Glu Met Arg Gln Val Leu 1055 1060 1065

Ser Val Ala Thr Leu Cys Val Ser Arg Arg Ala Asp Asp Arg Pro 1070 1075 1080

Ala Met Lys Asp Val Val Ala Leu Leu Lys Glu Ile Arg Arg Pro 1085 1090 1095

Ala Ala Val Asp Asp Ala Lys Gln Arg Pro Pro Thr Ala Ala Ala 1100 1105 1110

Pro Val Ser Pro Val Ser Ala His Ser Arg Gly Gln Ser Ser Ser 1115 1120 1125

Cys Ser Phe Ala Val Ser Glu Tyr Ser Ala 1130 1135 <2105 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer RLK7-F <400> 3 ggtacctagt acaaacaatt catggggtct 30 <2105 4 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer RLK7-R <400> 4 ggtaccaagg ctgctacaaa aaccgacatt 30 <216> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Primer UBQl-Forward <400> 5 ctttttgttc gcttggttgt gatga 25 <210> 6 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer Sense-ZmRLK7 <400> 6 tcgcaagcat tgggattgta gag 23 <210> 7

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer Antisense-ZmRLK7

<400> 7 aagcgtgacg cgtccgagct ac 22 <210> 8

<211> 25

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer Ubi-Forward

<400> 8 gactctaatc ataaaaaccc atctc 25 <210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> Primer RLK-Reverse

<400> 9 aagcgtgacg cgtccgagct ac 22

Claims (6)

CONCLUSIONS A Recombinant expression vector of a Zea maize receptor-like kinase 7 (ZmRLK7) gene, wherein the ZmRLK7 gene has a nucleotide sequence as shown in SEQ ID NO:1; an amino acid sequence encoding the ZmRLK7 gene is as shown in SEQ ID NO:2; and the ZmRLK7 gene, which is located in a regulatory hotspot region of a chromosome 7, is a leucine-rich repeat receptor-like kinase (LRR-RLK) gene. The recombinant expression vector of claim 1, wherein a fragment of the ZmRLK7 gene is ligated into a vector pCAM-BIA3301 via a KpnI restriction site, and forward and reverse directions are identified to form recombinant plasmids PUbi: Sense-ZmRLK7 and PUbi: Antisense-ZmRLK7 for forward and reverse gene expressions driven by a maize Ubiquitin promoter, respectively. A recombinant expression vector according to claim 1 or 2, wherein the recombinant expression vector is used for overexpression, antisense suppression, RNA interference and clustered regularly spaced short palindromic repeats associated protein 9 (CRISPR/Cas9) gene editing of the ZmRLK7 gene. Use of the recombinant expression vector according to claim 1 or 2 in increasing a plant height, biomass and seed yield of a plant. Use of the recombinant expression vector according to claim 1 or 2 for obtaining maize with a high yield. A method for increasing plant height, biomass and seed yield of a plant, comprising the following steps: S1, vector construction: amplification of a sequence of the full-length coding region of the gene according to claim 1, ligation of a resulting amplified fragment to a vector pCAMBIA3301 via a KpnI restriction site after the amplified fragment has been properly sequenced, forward and reverse directions identify and select the recombinant plasmid PUbi: Antisense-ZmRLK7 for reverse gene expression vol - according to claim 2; S2, Agrobacterium transformation: transforming the recombinant reverse gene expression plasmid obtained in step S1 into competent cells of an AGL11 Agrobacterium; and S3, plant transformation: transferring an Agrobacterium containing the recombinant plasmid obtained in step S2 to a yeast extract peptone (YEP) liquid medium to collect cultured bacterial cells, transforming the bacterial cells into Arabidopsis thaliana using a floral dip method , and harvesting seeds at a ripe stage to obtain transgenic T1 generation seeds; alternatively, performing Agrobacterium-mediated genetic transformation of immature maize embryos to obtain transgenic maize plants.