CN113136388B - Application of rice OsMAPKKK5 gene in aspect of improving plant height and grain type of rice - Google Patents

Abstract

The application discloses application of a rice OsMAPKKK5 gene in improving plant height and grain type of rice. Selecting a target fragment in a CDS region of a rice OsMAPKKK5 gene, taking pBWA (V) H-cas9 as an expression vector, inserting a target sequence of the target fragment selected in the CDS region of the rice OsMAPKKK5 gene into the pBWA (V) H-cas9 vector, transforming the obtained recombinant plasmid of the pBWA (V) H-cas9-OsMAPKKK5 into a transgenic receptor indica rice propylene 1B, and screening to obtain the mutant strain of the OsMAPKKK5 gene, wherein the plant height is 97.5+/-2.66 cm, the thousand seed weight is 21.83+/-0.42 g, and the plant height is increased by 14.1% at most and the thousand seed weight is increased by 21.7% at most compared with that of the plant height of the indica rice propylene 1B.

Description

Application of rice OsMAPKKK5 gene in aspect of improving plant height and grain type of rice

Technical Field

The invention belongs to the technical field of molecular breeding, and particularly relates to application of a rice OsMAPKKK5 gene in improving plant height and grain type of rice.

Background

Rice is the major food crop in many countries around the world, about 60% of the population is on rice as the main diet, and thus increasing rice yield has been the main goal of breeders. The first green revolution in the fifth sixties of the last century, the utilization of the dwarf gene sd1 and dwarf breeding of crops lead to the rice not being easy to lodge, thereby greatly improving the yield; later on, the rice yield is further improved by utilizing hybrid rice. At present, rice breeding enters a platform stage, and the yield is loitering. The breeding practice shows that on the basis of the current high-yield variety, the plant height is properly increased, the biomass is improved, the thousand seed weight is increased, and the further improvement of the rice yield is hopeful to be realized.

Plant height is an important agronomic trait of rice and is closely related to the yield of the rice. Thousand grain weight directly affects rice yield, grain shape is closely related to appearance quality and eating quality of rice, and consumers in different regions have different preference on the appearance and taste of rice. Thousand grain weight is determined by grain size, which includes grain length, grain width, grain thickness. Since glumes determine the storage capacity of the grain, it plays a dominant role in determining grain size. Plant height and grain type are taken as two important rice yield-related traits, and more regulatory genes are cloned. The genetic and mechanism of plant height and grain formation of the rice are clarified, and the method has very important significance for improving the yield of the rice and improving the quality of the rice, and is one of hot spots of research on functional genomics of the rice. In this experiment, we cloned the OsMAPKKK5 gene and constructed an OsMAPKKK5 mutant.

The application selects a target fragment in the CDS region of the OsMAPKKK5 gene, constructs the target fragment into a vector, and then transfers the vector into the indica rice variety handle 1B so as to obtain mutant strains with improved plant height and grain type.

Disclosure of Invention

In order to improve the plant height and grain type of rice, the application provides application of a rice OsMAPKKK5 gene in improving the plant height and grain type of rice.

The application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice adopts the following technical scheme:

the application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice comprises the steps of firstly selecting a target fragment in a CDS region of the rice OsMAPKKK5 gene, then taking a pBWA (V) H-cas9 plasmid as an expression vector, inserting 23 nucleotides in 23 nucleotides of the target fragment, namely a second exon 2334, selected in the CDS region of the rice OsMAPKKK5 gene into a pBWA (V) H-cas9 plasmid to obtain a pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid, then transforming the pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into indica polypropylene 1B, and obtaining an OsMAPKKK5 gene mutant with improved plant height and grain type through PCR detection and first-generation sequencing screening.

The indica type handle 1B is taken as an example for illustration in the application, but the mutant strain with improved plant height and grain type is not limited to be applied to other rice varieties.

The application of the rice OsMAPKKK5 gene in improving the plant height and grain type of rice specifically comprises the following steps:

(1) Selection of target sequences

The rice OsMAPKKK5 gene (GenBank: XM_ 015776316.2), the whole length of the landing gene sequence 7153bp, wherein the coding region length 2334bp, the 5 '-end non-coding region length 305bp and the 3' -end non-coding region length 536bp are shown in SEQ ID NO 1; the full length of a target sequence selected by the CDS region of the coding region is 23bp, and the sequence is shown as SEQ.ID NO 2; the code has 777 amino acids, and the sequence is shown as SEQ ID NO3.

The structure of the rice OsMAPKKK5 gene is shown in the figure 1, wherein a black frame represents a translation region, a white frame represents an untranslated region, and a line segment represents an intron;

(2) Construction of expression vector containing target sequence in OsMAPKKK5 Gene

The pBWA (V) H-cas9 is adopted as a vector, a target sequence of a CDS region of the rice OsPDCD5 gene is shown as SEQ.ID NO2 and is used as a target site to construct a pBWA (V) H-cas9-OsPDCD5 plasmid for rice OsPDCD5 gene targeting, and finally the pBWA (V) H-cas9-OsPDCD5 recombinant plasmid is obtained;

wherein the pBWA (V) H-Cas9-OsPDCD5 recombinant plasmid contains a guide RNA expression frame and a Cas9 nuclease expression frame with the target sequence, and the structure diagram is shown in figure 2.

(3) Transformation of pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid

The recombinant plasmid pBWA (V) H-cas9-OsMAPKKK5 was transformed into Agrobacterium EHA105 (available from Shanghai Biotechnology Co., ltd., agrobacterium tumefaciens) by the following procedure:

(1) adding 10 mu L of a solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells according to the proportion of 10% by volume, sequentially placing for 30min on ice, immersing in liquid nitrogen for 5min in a water bath at 37 ℃ to finish transformation and obtain agrobacterium EHA105 competent cells containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid;

(2) 110 mu L of the agrobacteria EHA105 competent cells containing the pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid obtained above are added into 500 mu L of LB liquid medium (Sangon Biotech, B540111) without antibiotics according to the proportion of 22 percent by volume, the temperature is controlled to be 28 ℃, the rotating speed is controlled to be 150-160rpm, and the culture solution is obtained; (3) centrifuging the culture solution obtained in the step (2) at 4000rpm for 10min to collect thalli, uniformly mixing the thalli collected by centrifugation with supernatant obtained by centrifuging the thalli accounting for 11% of the volume of the culture solution, and then coating the mixture on an LB plate medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin (the preparation method of the LB plate medium comprises 1000ml LB liquid medium and 15g agar powder (Genebase Gene Tech, A-2180) +three antibiotics), culturing for 36-72h at 28 ℃, and forming bacterial plaques on the LB plate medium;

carrying out plaque PCR identification on the toothpick picked plaque in an LB liquid medium, wherein the plaque successfully identified by the PCR identification is a transformant which is agrobacterium EHA105 containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid and is named EHA105/cas9-OsMAPKKK5;

1 bacterial plaque with positive strips successfully identified by PCR is picked, 1.5ml of EP tube is inoculated and placed in a shaking table at 28 ℃ for culture, so that agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid is obtained;

the 1.5ml EP tube contains 1ml of LB liquid medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin;

(4) Induction and culture of mature seed callus of propylene 1B

Taking mature seeds of the propylene 1B, removing shells, under the aseptic condition, firstly soaking and washing the mature seeds with 75% ethanol for 10-15min, washing the mature seeds with aseptic water for 3-5 times, then transferring the mature seeds into 0.1% mercury chloride aqueous solution for 20-30min, and washing the mature seeds with aseptic water for 3-5 times to obtain the aseptic mature seeds of the propylene 1B;

inoculating the obtained sterile mature propylene 1B seed into an induction culture medium, controlling the temperature to be 26-28 ℃ and performing induction callus for 15-20 days under the dark condition, transferring into a new induction culture medium or a secondary culture medium, and continuously inducing callus for 7-10 days to obtain callus;

(5) Infection with Agrobacterium

(1) Inoculating 500 mu L of agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into 50ml of YEP liquid culture medium, controlling the temperature to 26-28 ℃ for 12-16 hours, collecting bacterial liquid, and diluting the bacterial liquid with the YEP liquid culture medium (the YEP liquid culture medium comprises 10g of beef extract, 10g of yeast extract, 5g of NaCl, pH=7.0 and the balance of water per liter) until the bacterial liquid concentration of agrobacterium containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid is OD600 apprxeq 0.5;

(2) airing the indica rice handle 1B callus obtained in the step (4) on sterile filter paper, transferring the dried indica rice handle 1B callus into an agrobacterium tumefaciens bacterial solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid with OD600 apprxeq 0.5 at one time, uniformly mixing, controlling the temperature to be 28 ℃ and the rotating speed to be 150rpm, soaking for 10-30 min, and pouring out bacterial solution to obtain infected callus;

(3) placing the infected callus obtained in the step (2) on sterile filter paper until bacterial liquid is sucked dry, transferring the infected callus to a co-culture medium, paving a layer of sterile filter paper on the surface of the medium, enabling the callus to be not in direct contact with the medium, and performing dark culture in an incubator at a temperature of 26-28 ℃ for 5-7 days to obtain the callus infected by the agrobacterium EHA 105;

in the co-culture process (3), the incubator is not required to be opened frequently so as to avoid too large temperature change and generate a water film;

(6) Screening of resistant callus

(1) Respectively adding the obtained calli infected by the agrobacterium tumefaciens EHA105 into a 100ml triangular flask, washing 3-5 times with sterile water, pouring out the sterile water, washing 2-3 times with sterile water containing 50mg/L rifampicin and 50mg/L kanamycin resistance, sucking out excessive water with sterile filter paper, transferring the calli into a primary screening culture medium, carrying out primary screening for 15-20min, repeating the actions for 2-3 times, and obtaining the calli infected by the agrobacterium tumefaciens EHA105 with weak resistance;

(2) pouring the weak-resistance callus obtained in the step (1) on sterile filter paper, and sucking the weak-resistance callus for about 2 hours to obtain dry weak-resistance callus infected by agrobacterium EHA 105;

(3) transferring the dried weak-resistance callus into a secondary screening culture medium, and performing secondary screening for 15-20 days at 26-28deg.C to obtain strong-resistance callus infected by Agrobacterium EHA 105.

(7) Differentiation of resistant callus

Transferring the obtained strong-resistance callus infected by the agrobacterium EHA105 into a primary differentiation culture medium, culturing for 15-20 days at 26 ℃ under 16h illumination/day, transferring into a secondary differentiation culture medium, continuously culturing for 15-20 days at 26 ℃ under 16h illumination/day until 1-5cm green buds grow, stripping off superfluous callus around, cutting off roots, reserving about 0.5cm long, and transferring into a rooting and strong seedling culture medium for rooting culture to obtain seedlings;

the obtained seedlings have the height of about 10-15cm, the root system is vigorous, and the seedlings are strong by cutting the root, cutting the leaves and carrying out transfer culture again on the seedlings which are too tiny;

adding 1cm deep normal temperature sterilized water into the obtained seedling, performing transitional culture for 2 days in an environment with the relative humidity of more than 50% at the temperature of 25-30 ℃, then cleaning a culture medium attached to the root, transplanting the seedling into a container with sterilized soil, and transferring the seedling to a greenhouse for culture for 115-125 days to obtain a T0 generation of transformed plant;

culturing T0 generation transformed plants at 28 ℃ in a greenhouse until seeds are established to obtain T1 generation seeds, detecting whether the plants contain pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmids, carrying out generation-adding propagation on positive T1 seeds to obtain T2 generation seeds, detecting whether the plants completely knock out OsMAPKKK5 genes, carrying out generation-adding propagation on positive seeds to obtain T3 generation seeds, wherein cas9-MAPKKK5-2-1 or cas9-MAPKKK5-3-8 are mutant strains with increased plant height and improved grain size.

The application only takes indica rice stalk 1B as an example for illustration, and the obtained 2 OsMAPKKK5 gene mutant strains with improved plant height and grain type compared with indica rice stalk 1B are cas9-OsMAPKKK5-2-1 plants and cas9-OsMAPKKK5-3-8 plants respectively, but the application of the OsMAPKKK5 gene in improving plant height and grain type in other rice varieties is not limited.

The application has the following beneficial effects:

the application of the OsMAPKKK5 gene in improving the plant height and grain type of rice is characterized in that a CDS region selection target sequence of the OsMAPKKK5 gene is constructed into a vector and transferred into a wild type indica type rice handle 1B, so that the plant heights and grain types of the obtained cas9-OsMAPKKK5-2-1 plant and cas9-OsMAPKKK5-3-8 plant are improved, and compared with the wild type indica type rice handle 1B, the plant heights of cas9-OsMAPKKK5-2-1 plant and cas9-OsMAPKKK5-3-8 plant are respectively increased by 7.8 percent, 4.1 percent and up to 14.1 percent and 10.5 percent on average; the grain length is increased by 4.3 percent and 3.6 percent respectively on average, and the maximum can reach 6.8 percent and 6.7 percent; the grain width is respectively increased by 3.7 percent and 2.5 percent on average, and the maximum grain width can reach 6.5 percent and 5.7 percent, so that the grain shape is improved;

further compared with wild indica rice handle 1B, the thousand seed weight of the cas9-OsMAPKKK5-2-1 plant and the cas9-OsMAPKKK5-3-8 plant are obviously improved, and the maximum thousand seed weight is respectively improved by 15.4 percent, 12.7 percent and maximally up to 21.7 percent and 20.4 percent. .

Drawings

FIG. 1 shows the gene structure of OsMAPKKK5 of rice;

FIG. 2 is a block diagram of a pBWA (V) H-cas9-OsPDCD5 recombinant plasmid;

FIG. 3 is a seed particle control diagram of wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 4 is a rice spike morphology control chart of a wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant, cas9-MAPKKK5-3-8 mutant;

FIG. 5 is a graph showing the morphology of whole plants of wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant and cas9-MAPKKK5-3-8 mutant;

FIG. 6a is a bar graph of the plant height of the wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant, cas9-MAPKKK5-3-8 mutant;

FIG. 6b is a thousand seed weight column diagram of a wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant, cas9-MAPKKK5-3-8 mutant;

FIG. 6c is a schematic diagram showing the grain length of a wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant, cas9-MAPKKK5-3-8 mutant;

FIG. 6d is a histogram of the grain width of wild type indica rice handle 1B, cas-MAPKKK 5-2-1 mutant and cas9-MAPKKK5-3-8 mutant.

Detailed Description

The present application is further illustrated by the following specific examples in conjunction with the accompanying drawings, but is not limited thereto.

The composition of the various media used in the examples of the present application is shown in the following table:

(Note: autoclave at 115 ℃ C. For 20 min)

The experimental methods used in the specific examples of the present application are conventional methods unless otherwise specified, and materials, reagents, etc. used, unless otherwise specified, are commercially available.

Example 1

The application of the rice OsMAPKKK5 transgene in improving the plant height and grain type of rice specifically comprises the following steps:

(2) Construction of pBWA (V) H-cas9-OsMAPKKK5 vector:

(1) the cleavage site Eco31I (BsaI) is designed in cas9-MAPKKK5-F: cagtGGTCTCaggcATCCGCAGCCGCGGTTGACC, the sequence of which is shown in SEQ ID NO.4 and cas9-MAPKKK5-R: cagtGGTCTCaaaaCCTGGTCAACCGCGGCTGCG, the sequence of which is shown in SEQ ID NO.5, and then primers cas9-MAPKKK5-F and cas9-MAPKKK5-R are used to amplify a target sequence of 23bp in the CDS region of the OsMAPKKK5 gene, the nucleotide sequence of which is: ATCCGCAGCCGCGGTTGACCAGG PCR products containing the cleavage site Eco31I (BsaI) were obtained:

cagtGGTCTCaggcaATCCGCAGCCGCGGTTGACCAGGttttGAGACCagtg this PCR product was designated OsMAPKKK5.

(2) The PCR product OsMAPKKK5 was recovered by gel cutting after agarose electrophoresis, and the DNA fragment was purified using a kit (Sangon Biotech, B518131) to obtain the PCR purified product OsMAPKKK5.

Preparing an enzyme digestion connecting system, wherein the total volume of the enzyme digestion connecting system is 20 mu L, and the composition and the content of each raw material in the enzyme digestion connecting system are as follows:

20 mu L of the enzyme digestion connection system prepared according to the composition and the content is subjected to 20min and 5cycles at 37 ℃ in a PCR instrument (Bio-Rad S0000Thermal Cycler); 37 ℃ for 10min;20 ℃ for 10min; after treatment at 37℃for 20min, pBWA (V) H-cas9-OsMAPKKK5 ligation product was obtained.

(4) mu.L of the pBWA (V) H-cas9-OsMAPKKK5 ligation product in the pipetting step was added to E.coli DH 5. Alpha. Competent cells (purchased from Shanghai Weidi Biotechnology Co., ltd.), incubated on ice for 30min, heat-shocked at 42℃for 1min, incubated on ice for 2min, 900. Mu.L of LB medium was added, and cultured at 37℃for 1H to perform activation recovery of E.coli DH 5. Alpha. Competent cells.

The recovered competent cells of E.coli DH 5. Alpha. Were spread on a dish containing LB solid medium (containing kanamycin) and cultured upside down in a 37℃incubator for 12 hours, and the obtained E.coli DH 5. Alpha. Monoclonal was subjected to plaque PCR identification.

(5) 8 bacterial plaques are picked for carrying out bacterial plaque PCR identification (Li Hua, liu Yanlin and the like, and the colony PCR technology is applied to the aspects of recombinant plasmid screening and identification, and whether the connection is successful is carried out or not by the university of North-west agriculture and forestry science and technology report (Nature science edition), volume 32 of 9 th month 2004, pages 35-37).

Identification primer pbw2+: GGCGTCTTCTACTGGTGCTA the sequence of which is shown as SEQ ID NO.6, pbw2-: GTCTTTACGGCGAGTTCTGT the sequence is shown as SEQ ID NO.7, the length of the amplified fragment is 422bp, and the positive band sequence successfully identified by PCR is compared with the standard sequence shown as SEQ ID NO. 8.

The corresponding 3 plaques with positive bands were detected by agarose electrophoresis, inoculated into 1.5ml EP tube containing 700. Mu.L LB liquid medium (Sangon Biotech, B540111) containing 50ug/ml kanamycin, shake-cultured at 37℃for 3h, and the bacterial liquid was sequenced and the identity of the results with the sequence shown as SEQ ID NO.8 was judged.

The bacterial liquid with the sequence consistent with SEQ ID NO.8 is taken as bacterial liquid with the correct sequencing result, 500 mu L of bacterial liquid is taken for bacterial preservation (500 mu L of 50% glycerol and 500 mu L of LB bacterial liquid), 200 mu L of bacterial liquid is inoculated into 2ml of LB liquid culture medium and subjected to expansion culture for 12H at 37 ℃, then plasmid extraction kit (Sangon Biotech, B518191) is utilized to extract plasmids, pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmids are obtained, the structural schematic diagram of which is shown in figure 2, and the bacterial liquid contains 35S promoter, U6 promoter, target sequence of OsMAPKKK5 genes, cas9 protein, T-nos terminator, screening genes of kanamicin and the like.

(2) Transformation of pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid

The recombinant plasmid pBWA (V) H-cas9-OsMAPKKK5 was transformed into Agrobacterium EHA105 (available from Shanghai Biotechnology Co., ltd., agrobacterium tumefaciens) by the following procedure:

(1) adding 10 mu L of pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid into 100 mu L of agrobacterium EHA105 competent cells according to the proportion of 10% by volume, sequentially placing for 30min on ice, immersing in liquid nitrogen for 5min in a water bath at 37 ℃ to finish transformation, and obtaining the agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid.

(2) 110. Mu.L of the Agrobacterium EHA105 competent cells containing the pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid obtained above was added to 500. Mu.L of LB liquid medium (Sangon Biotech, B540111) without antibiotics at 28℃and 150rpm for 3 hours to obtain a culture broth.

(3) The culture solution obtained in (2) was centrifuged at 4000rpm for 10min to collect the cells, and the supernatant obtained after centrifugation of 60. Mu.L of the cells was mixed and then spread on LB plate medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin (the preparation method of LB plate medium described herein: 1000ml LB liquid medium +15g agar powder (Genebase Gene Tech, A-2180) +three antibiotics) for 36-72h at 28℃to form bacterial plaques on LB plate medium.

Plaque is picked by toothpick and is identified by plaque PCR in LB liquid medium, and the plaque successfully identified by PCR is a transformant which is agrobacterium EHA105 containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid and named EHA105/cas9-OsMAPKKK5.

8 bacterial plaques were picked and 1.5ml of EP tube-connected bacteria and PCR were performed simultaneously to identify whether the ligation was successful, and the primers Pbw2+: GGCGTCTTCTACTGGTGCTA the sequence of which is shown as SEQ ID NO.6, pbw2-: GTCTTTACGGCGAGTTCTGT the sequence is shown as SEQ ID NO.7, the length of the amplified fragment is 422bp, and the positive band sequence successfully identified by PCR is compared with the standard sequence shown as SEQ ID NO. 8.

1 bacterial plaque successfully identified by PCR with positive bands is picked, subjected to 1.5ml EP tube connection and placed in a shaking table at 28 ℃ for culture, so that agrobacterium EHA105 seed liquid containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid is obtained.

The 1.5ml EP tube contained 1ml of LB liquid medium containing 20ug/ml rifampicin, 40ug/ml gentamicin and 50ug/ml kanamycin.

(3) Induction and culture of mature seed callus of propylene 1B

Taking the mature seed of the propylene 1B, removing the shell, under the aseptic condition, firstly soaking and washing the mature seed with 75% ethanol for 10min, then washing the mature seed with aseptic water for 5 times, then transferring the mature seed into an aqueous solution of mercuric chloride with the volume percentage concentration of 0.1% for soaking for 20min, and then washing the mature seed with aseptic water for 3 times to obtain the aseptic mature seed of the propylene 1B.

And then inoculating the obtained sterile handle 1B mature seeds into an induction culture medium plate, inoculating 10 sterile handle 1B mature seeds on each induction solid culture medium plate with the diameter of 90mm, inoculating 10 plates, controlling the temperature to 26 ℃ and culturing for about 20 days in dark until the calli are available, stripping the induced calli, transferring the calli into a secondary culture medium plate for subculture, and continuing to induce the calli for 7 days to obtain the calli.

If the stripped callus is large, the callus can be divided into small parts by a tool such as forceps;

note that: drying the induced solid culture medium for more than 1h in a sterile operation table after pouring the flat plate, and sucking the transferred callus on sterile filter paper to ensure that no water film exists between the callus and the induced solid culture medium during subculture.

(4) Infection with Agrobacterium

(1) mu.L of an Agrobacterium EHA105 seed solution containing the pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid was inoculated into 50ml of YEP liquid medium, cultured at 26℃for 12 hours, the bacterial solution was collected, and diluted with the YEP liquid medium until the bacterial solution concentration of the Agrobacterium containing the pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid was OD600. Apprxeq.0.5, during which OD600 was measured every 5 min.

(2) Airing the indica rice handle 1B callus obtained in the step (1) on sterile filter paper, transferring the dried indica rice handle 1B callus into an agrobacterium tumefaciens bacterial solution containing pBWA (V) H-cas9-OsMAPKKK5 recombinant plasmid with OD600 apprxeq 0.5 at one time, uniformly mixing, controlling the temperature to be 28 ℃ and the rotating speed to be 150rpm, soaking for 20min, and pouring out the bacterial solution to obtain the infected callus.

(3) Placing the infected callus obtained in the step (2) on sterile filter paper until bacterial liquid is sucked up, transferring the infected callus to a co-culture medium, paving a layer of sterile filter paper on the surface of the medium, enabling the callus to be not in direct contact with the medium, performing dark culture in an incubator at a temperature of 26 ℃ for about 6 days, and enabling a bacterial film to be arranged on a contact part of the infected callus and the YEP liquid medium to obtain the callus infected by the agrobacterium EHA 105.

In the co-cultivation process (3), the incubator is not required to be opened frequently so as not to generate a water film because of too large temperature change.

(5) Screening of resistant callus

(1) The obtained calli infected by the agrobacterium EHA105 are respectively added into a 100ml triangular flask, the triangular flask is washed 3 times with sterile water, the sterile water is poured out, the sterile water containing 50mg/L rifampicin and 50mg/L kanamycin resistance is used for washing 2 times, after the sterile filter paper is used for sucking the excessive water, the calli are transferred into a primary screening culture medium for primary screening for 15min, and the actions are repeated for 2 times, so that the calli infected by the agrobacterium EHA105 with weak resistance are obtained.

(2) Then pouring the weak-resistance callus obtained in the step (1) on sterile filter paper to suck the weak-resistance callus for about 2 hours, and obtaining the dry weak-resistance callus infected by agrobacterium EHA 105.

(3) Transferring the dried weak-resistance callus into a secondary screening culture medium, and performing secondary screening for 15 days at the temperature of 26 ℃ to obtain strong-resistance callus infected by agrobacterium EHA105 after screening.

(6) Differentiation of resistant callus

Transferring the obtained strong-resistance callus infected by the agrobacterium EHA105 into a primary differentiation medium, culturing for 15 days at 26 ℃ under 16h illumination/day, transferring into a secondary differentiation medium, continuously culturing for 15 days at 26 ℃ under 16h illumination/day until 1-5cm green buds grow, stripping off superfluous callus around, cutting off roots, reserving about 0.5cm long, and transferring into a rooting and seedling strengthening medium for rooting culture to obtain 10-15cm seedlings.

And (3) cutting roots, cutting leaves and carrying out transfer culture again on the obtained too fine seedlings to strengthen the seedlings.

Adding 1cm deep normal temperature sterilized water into 10-15cm seedling, culturing at 26 deg.C with relative humidity > 50% for 2 days, cleaning culture medium attached to root, transplanting into sterilized soil container, and culturing in greenhouse for 115-125 days to obtain T0 generation transformed plant.

(7) Screening and detection of transformed plants

(1) The PCR amplification is adopted to detect candidate T0 generation transformed plants, and the amplification primers used are as follows:

Hyg-CX-S: AGATGTTGGCGACCTCGTATT, the sequence of which is shown as SEQ ID NO. 9;

Hyg-CX-A: AAGATCGTTATGTTTATCGGCACT, the sequence of which is shown as SEQ ID NO. 10;

detecting whether the T0 generation transformed plants contain hygromycin screening markers, and obtaining 10 positive transformed plants containing pBWA (V) H-cas9-MAPKKK 5.

Culturing the 10 transformed plants (namely T0 generation, the numbers are T0-1, T0-2 and … … T0-10) containing hygromycin screening markers at the temperature of 28 ℃ in a greenhouse until the transformed plants form seeds, namely T1 generation, carrying out generation-adding propagation on the harvested T1 generation seeds (20 seed seedlings are planted in each serial mode, 10 rice seedlings are randomly selected) in a Hainan island in 2017 month to obtain T2 generation seeds, simultaneously taking leaves corresponding to the single plants, detecting whether homozygous mutation occurs in a target region of single plant DNA, retaining the homozygous seeds, and sowing the seeds in a Taiku-cang city base in Jiangsu province in 10 months in 2017 to obtain T3 generation seeds.

(2) Plant screening and detection of CDS region mutation of OsMAPKKK5

Extracting genome DNA from leaves of the T1 generation seed single plant obtained in the step (1), and using an OsMAPKKK5 detection primer MAPKKK-SEQ-F GTCCCCGTCCTCTTCGTC, wherein the sequence of the primer MAPKKK-SEQ-F is shown as SEQ ID NO.4 and the sequence of the primer MAPKKK-SEQ-R CATGTTACTCGCGGTCCTC is shown as SEQ ID NO.5, performing PCR, and running the PCR product on agarose gel electrophoresis, wherein the target band sequence of 325bp is shown as SEQ ID NO. 8.

The purpose of the PCR sequencing is to detect whether mutation occurs in the 23bp target sequence of the OsMAPKKK5 of the single plant obtained in the step (1); after comparing the sequencing result with the standard SEQ ID NO.2 sequence, we found that the 23bp target sequence of 7 plants OsMAPKKK5 in the 10 plants obtained in the step (7) is changed, that is, the 7 plants are plants with mutated target sequences of OsMAPKKK5 genes, namely cas9-MAPKKK5-1, cas9-MAPKKK5-2, cas9-MAPKKK5-3, cas9-MAPKKK5-5, cas9-MAPKKK5-6, cas9-MAPKKK5-7 and cas9-MAPKKK5-8, and only cas9-MAPKKK5-2 and cas 9-PKKK 5-3 are homozygous lines, which is the T1 generation;

the seeds of cas9-MAPKKK5-1, cas9-MAPKKK5-2, cas9-MAPKKK5-3, cas9-MAPKKK5-5, cas9-MAPKKK5-6, cas9-MAPKKK5-7 and cas9-MAPKKK5-8 are planted, plant leaves which show expected traits (plant height) in each plant line are taken after maturation, DNA is extracted for sequencing, and finally the numbers cas9-MAPKKK5-2-1 and cas9-MAPKKK5-3-8 are selected as research objects.

The sequencing of the target sequences at 23bp of indica rice handle 1B, cas9-MAPKKK5-2-1 and cas9-MAPKKK5-3-8 was as follows:

wherein, the indica rice handle 1B is wild type and is an original 23bp target sequence of OsMAPKKK5, the sequences of the indica rice handle 1B are shown in SEQ ID NO.2, and cas9-MAPKKK5-2-1 and cas9-MAPKKK5-3-8 are mutant strains with mutation of the OsMAPKKK5 target sequence respectively.

Compared with wild type indica rice handle 1B, the cas9-MAPKKK5-2-1 mutant strain and cas9-MAPKKK5-3-8 mutant strain are characterized in that a T base is inserted into the 6 th-7 th base of the 3' -end of a 23bp target sequence, and the sequences of the T base and the mutant strain are shown as SEQ ID NO. 11.

(8) Investigation and statistics of OsMAPKKK5 transgenic T3 generation population yield and quality traits seeds of the cas9-MAPKKK5-2-1 mutant strain (T3 generation), seeds of cas9-MAPKKK5-3-8 mutant strain (T3 generation) and wild type indica rice handle 1B (as a control) were sown in 2019 for 6 months, sown in a seedling field of Taicang base of university of Jiangsu province for 7 months, transplanted in seedlings of 30 plants in each field at a row spacing of 6 inch by 6 inch, 10 plants per row were repeated 3 times (90 seeds in total), and grown under field conditions.

The average value is calculated by counting 10 individual plants in each cell in the mature period, then seeds of each repeated plant (namely 30 plants of seeds are collected together, the seeds are of T3 generation) are counted, the plant height, thousand grain weight, grain length and grain width are counted, and the average value is calculated, wherein the bar graph of the average value is respectively shown in fig. 6a, 6B, 6c and 6d, and the bar graph represents that the data is in a p value of <0.01 and in a very significant level compared with the propylene 1B, and the statistical results are shown in the table below.

As can be seen from the above tables, the plant heights of wild type indica rice handle 1B, cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant are respectively increased by 7.8%, 4.1% and maximally 14.1% and 15.0% on average relative to wild type indica rice handle 1B; the grain length is increased by 4.3 percent and 3.6 percent respectively on average, and the maximum can reach 6.8 percent and 6.7 percent; the grain width is increased by 3.7 percent and 2.5 percent respectively, and the maximum grain width can reach 6.5 percent and 5.7 percent, so that the grain shape is improved;

further, compared with wild indica rice handle 1B, the thousand seed weight of the cas9-OsMAPKKK5-2-1 plant and the cas9-OsMAPKKK5-3-8 plant is obviously improved, and the thousand seed weight is respectively improved by 15.4 percent, 12.7 percent and up to 21.7 percent and 20.4 percent on average, so that the improvement of the grain type is further verified.

The grain length and grain width of the seed grain of the cas9-OsMAPKKK5-2-1 and cas9-OsMAPKKK5-3-8 mutant strain are increased compared with that of the wild type indica rice handle 1B, the obtained comparison graph is shown in figure 3, the grain length and grain width of the seed grain of the cas9-OsMAPKKK5-2-1 and cas9-OsMAPKKK5-3-8 mutant strain are increased compared with that of the wild type indica rice handle 1B, and therefore, the grain types of the cas9-OsMAPKKK5-2-1 and cas9-OsMAPKKK5-3-8 mutant strain are improved, the thousand grain weight is also obviously improved, and the obtained cas 9-OsMAKK 5-2-1 and cas 9-OsMAKK 5-3-8 mutant strain and the wild type indica rice handle 1B are compared with that of the whole wild type indica rice handle 1B in the mature period, and the obtained graph is shown in figure 4, and the obtained graph is higher than that of the cas 9-OsPKKK 5-3-8 mutant strain is shown in figure 5-4, and the figure 9-3 is higher than that of the wild type rice handle 1B.

The present embodiment is merely illustrative of the present application and is not intended to be limiting, and those skilled in the art, after having read the present specification, may make modifications to the present embodiment without creative contribution as required, but is protected by patent laws within the scope of the claims of the present application.

Sequence listing

<110> new technology Co., ltd. In Suzhou

<120> application of OsMAPKKK5 gene of rice in improving plant height and grain type of rice

<141> 2021-03-31

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2944

<212> DNA

<213> full-length cDNA sequence of Rice OsMAPKKK5 Gene (Oryza sativa)

<400> 1

gtggggaaag aaagagcgga agaaaaaaaa aacatcaaca gcaaaaccga ctcccgagaa 60

gcggagaggg aaaaaaaaat tcgcccaaat ggcgggggtc gtcgtcgtcg tcttcgtctc 120

cgatccccct ctcctcatcc gcctccaccc ctcacatcgc cattgccact gtgatcacta 180

gggtttcgcg ctgctcctcg aggtaaggat tcgctcgcct tcgccgatgc ggtggtggaa 240

gcgctcggtc tccccttccc cgtccccgtc ctcttcgtcc gcgtccgcgt ccacgcccgc 300

gtccccggcg cgggcctcga cctcccgcgt tggcggcggt gtccccagcc gccgccggga 360

tgtggtgggg tttggttggg gtggggggag tgatccgcag ccgcggttga ccaggcagag 420

gcggctgcgg cacgtcgacg acatcgaggt cggggtctcg gcgctcgggc tggattcctc 480

cccctcgccc gccgcgccct cgtcgtgccc ctccagtagg gattcggtgg ggttcggcct 540

cctgaccgcg agctccacgc cgatctcgag gaccgcgagt aacatggagg tggcgccgcc 600

gaggtcgtcg tcgtctcccg tgctgctgcc gcacccgctg cccctgcccg atgaggggga 660

ctcgccctgc cgcggctccg ggagatccct cccgtcgccc aagctattcg aaggagactg 720

caacgggtcg gccgtggagt cgaacttgct cggggtttcc gagatcggga gcgacagagc 780

atcgttgttt ccgagagtga tggctaaaac ggtgcaaaaa aaccctgagc atggtgactt 840

gcgatcaaat ggcacaaatg ggattaactg tggacaacgg aggaaggcat ttaaagagaa 900

attacaggat aagagctcag ctgaaacatt gacattcaga ttgaacatac ccgctaaaag 960

tgctccaagc agtggatttt caagccctgt acagagtcct cgaagactga gtagtgtaga 1020

ctttttgtcc actgcaacat ccacccaagg tgccaattta tcgtcagcac agtcagtctg 1080

gtctcctgat ctatatggat cttcacctcg ttgtgcgtca cctgaaaaaa ttatgggtag 1140

tcaggagcga tctcctcgct ccagtccatt gagaagccct gttctaagat caaaaaaccc 1200

aagtgcacct ccttcaccaa tgcatccaaa gttgttcccg gagaaccatg tttctcgtcc 1260

tgagggcaat gggagtgtaa atttccatcc attacccctc ccacccgcct ctgtaagccc 1320

aaagcagacg aattttagtc accagccagt tccaaaagtt gatgcaccct caatggctgg 1380

tcagtggcaa aaaggaaagc tcattggcag tggaacattt ggatgtgtat atgaggccgc 1440

caatagacac actggagctc tgtgtgccat gaaagaggtc aacataattc ccgatgatgc 1500

taaatcagct gagtctctca agcaattgga gcaggaaata aaatttctta gtcaattcaa 1560

gcatgaaaac atagtgcagt actacggcag tgaatatatt gaagatcgat tctacatata 1620

cctggaatat gttcaccctg gttcaattaa taaatatgtt aatcaacatt gtggagcaat 1680

gacagaatca gtaatccgca gcttcacccg ccatatactt aaaggccttg cctttttaca 1740

tagtcagaag attatgcata gagatatcaa aggagcaaat ttgcttgttg atgtgaatgg 1800

tgtagtcaaa ttggctgact ttggaatggc taagcatttg agtactgcag ctcctaatct 1860

ttcactgaag ggaactccat actggatggc tcctgaggtt gttcaggcta cacttgtcaa 1920

agatgtaggg tatgatcttg ctgtggatat ctggagccta ggttgcacaa ttattgagat 1980

gttcacagga aagcctcctt ggagtggtct tgaagggcct gctgcaatgt ttaaggtgtt 2040

gcataaagat ccgtcaattc cagacagttt atccccggag gggaaggaat ttctgagatg 2100

ctgcttcaga agaaatccag ctgagagacc aacagcaagc aagttgctgg agcatccatt 2160

tgtccacaat tcgaataact tcaaccagca cagtgcttta cattctccca ctggacttaa 2220

atccaccgat accggtcaca atgcaagaga caaaaagtcc tgtaagattg tttcatgcat 2280

gagggggaaa aatatgatta caactggtga aacaagcagt gctagatctc ccggttcatt 2340

atctaatcgg gtggcagtag gcttgacagc cctgccaaat ttggaaactc gtagcttatc 2400

ccctacgccg atgagtttga ggtccagtcc tggctctgcg gcccatacac ctagtatgca 2460

cttttctatc gcataccatc agcctagtcc attgccaagg ccaaatggaa aggaagcaat 2520

aaatttgttc accttgaagc atgacgagct gcctacctaa ggtgcggaaa cacatcatct 2580

gtccatccac ccaatctgtt ggatgcgagc ccatctctaa cttctgatcc ctgtactgcc 2640

agtcatcata attgaacatt cgctgggtct tgtaaagtac ttggcatgcg aaggacatca 2700

gcacggtacg atcgcaatag cttctgaaac ctgtaatgtt tgttttcaag gaaatgatgg 2760

cgtttccttt gtaagatatt atttagggtt agctgtaggt taaactaatg gccctgattg 2820

ttgccaacag gtaggacact agggttgtag ttgtagcttg tgttgttttt gctattgtgt 2880

aaccacacca cgatgtaatc attgttgatt ttttgaggcc cagtaataat gataaagagt 2940

tggc 2944

<210> 2

<211> 23

<212> DNA

<213> target sequence of CDS region of Rice OsMAPKKK5 Gene (Oryza sativa)

<400> 2

atccgcagcc gcggttgacc agg 23

<210> 3

<211> 777

<212> PRT

<213> amino acid sequence encoded by OsMAPKKK5 Gene of Rice (Oryza sativa)

<400> 3

Met Arg Trp Trp Lys Arg Ser Val Ser Pro Ser Pro Ser Pro Ser Ser

1 5 10 15

Ser Ser Ala Ser Ala Ser Thr Pro Ala Ser Pro Ala Arg Ala Ser Thr

20 25 30

Ser Arg Val Gly Gly Gly Val Pro Ser Arg Arg Arg Asp Val Val Gly

35 40 45

Phe Gly Trp Gly Gly Gly Ser Asp Pro Gln Pro Arg Leu Thr Arg Gln

50 55 60

Arg Arg Leu Arg His Val Asp Asp Ile Glu Val Gly Val Ser Ala Leu

65 70 75 80

Gly Leu Asp Ser Ser Pro Ser Pro Ala Ala Pro Ser Ser Cys Pro Ser

85 90 95

Ser Arg Asp Ser Val Gly Phe Gly Leu Leu Thr Ala Ser Ser Thr Pro

100 105 110

Ile Ser Arg Thr Ala Ser Asn Met Glu Val Ala Pro Pro Arg Ser Ser

115 120 125

Ser Ser Pro Val Leu Leu Pro His Pro Leu Pro Leu Pro Asp Glu Gly

130 135 140

Asp Ser Pro Cys Arg Gly Ser Gly Arg Ser Leu Pro Ser Pro Lys Leu

145 150 155 160

Phe Glu Gly Asp Cys Asn Gly Ser Ala Val Glu Ser Asn Leu Leu Gly

165 170 175

Val Ser Glu Ile Gly Ser Asp Arg Ala Ser Leu Phe Pro Arg Val Met

180 185 190

Ala Lys Thr Val Gln Lys Asn Pro Glu His Gly Asp Leu Arg Ser Asn

195 200 205

Gly Thr Asn Gly Ile Asn Cys Gly Gln Arg Arg Lys Ala Phe Lys Glu

210 215 220

Lys Leu Gln Asp Lys Ser Ser Ala Glu Thr Leu Thr Phe Arg Leu Asn

225 230 235 240

Ile Pro Ala Lys Ser Ala Pro Ser Ser Gly Phe Ser Ser Pro Val Gln

245 250 255

Ser Pro Arg Arg Leu Ser Ser Val Asp Phe Leu Ser Thr Ala Thr Ser

260 265 270

Thr Gln Gly Ala Asn Leu Ser Ser Ala Gln Ser Val Trp Ser Pro Asp

275 280 285

Leu Tyr Gly Ser Ser Pro Arg Cys Ala Ser Pro Glu Lys Ile Met Gly

290 295 300

Ser Gln Glu Arg Ser Pro Arg Ser Ser Pro Leu Arg Ser Pro Val Leu

305 310 315 320

Arg Ser Lys Asn Pro Ser Ala Pro Pro Ser Pro Met His Pro Lys Leu

325 330 335

Phe Pro Glu Asn His Val Ser Arg Pro Glu Gly Asn Gly Ser Val Asn

340 345 350

Phe His Pro Leu Pro Leu Pro Pro Ala Ser Val Ser Pro Lys Gln Thr

355 360 365

Asn Phe Ser His Gln Pro Val Pro Lys Val Asp Ala Pro Ser Met Ala

370 375 380

Gly Gln Trp Gln Lys Gly Lys Leu Ile Gly Ser Gly Thr Phe Gly Cys

385 390 395 400

Val Tyr Glu Ala Ala Asn Arg His Thr Gly Ala Leu Cys Ala Met Lys

405 410 415

Glu Val Asn Ile Ile Pro Asp Asp Ala Lys Ser Ala Glu Ser Leu Lys

420 425 430

Gln Leu Glu Gln Glu Ile Lys Phe Leu Ser Gln Phe Lys His Glu Asn

435 440 445

Ile Val Gln Tyr Tyr Gly Ser Glu Tyr Ile Glu Asp Arg Phe Tyr Ile

450 455 460

Tyr Leu Glu Tyr Val His Pro Gly Ser Ile Asn Lys Tyr Val Asn Gln

465 470 475 480

His Cys Gly Ala Met Thr Glu Ser Val Ile Arg Ser Phe Thr Arg His

485 490 495

Ile Leu Lys Gly Leu Ala Phe Leu His Ser Gln Lys Ile Met His Arg

500 505 510

Asp Ile Lys Gly Ala Asn Leu Leu Val Asp Val Asn Gly Val Val Lys

515 520 525

Leu Ala Asp Phe Gly Met Ala Lys His Leu Ser Thr Ala Ala Pro Asn

530 535 540

Leu Ser Leu Lys Gly Thr Pro Tyr Trp Met Ala Pro Glu Val Val Gln

545 550 555 560

Ala Thr Leu Val Lys Asp Val Gly Tyr Asp Leu Ala Val Asp Ile Trp

565 570 575

Ser Leu Gly Cys Thr Ile Ile Glu Met Phe Thr Gly Lys Pro Pro Trp

580 585 590

Ser Gly Leu Glu Gly Pro Ala Ala Met Phe Lys Val Leu His Lys Asp

595 600 605

Pro Ser Ile Pro Asp Ser Leu Ser Pro Glu Gly Lys Glu Phe Leu Arg

610 615 620

Cys Cys Phe Arg Arg Asn Pro Ala Glu Arg Pro Thr Ala Ser Lys Leu

625 630 635 640

Leu Glu His Pro Phe Val His Asn Ser Asn Asn Phe Asn Gln His Ser

645 650 655

Ala Leu His Ser Pro Thr Gly Leu Lys Ser Thr Asp Thr Gly His Asn

660 665 670

Ala Arg Asp Lys Lys Ser Cys Lys Ile Val Ser Cys Met Arg Gly Lys

675 680 685

Asn Met Ile Thr Thr Gly Glu Thr Ser Ser Ala Arg Ser Pro Gly Ser

690 695 700

Leu Ser Asn Arg Val Ala Val Gly Leu Thr Ala Leu Pro Asn Leu Glu

705 710 715 720

Thr Arg Ser Leu Ser Pro Thr Pro Met Ser Leu Arg Ser Ser Pro Gly

725 730 735

Ser Ala Ala His Thr Pro Ser Met His Phe Ser Ile Ala Tyr His Gln

740 745 750

Pro Ser Pro Leu Pro Arg Pro Asn Gly Lys Glu Ala Ile Asn Leu Phe

755 760 765

Thr Leu Lys His Asp Glu Leu Pro Thr

770 775

<210> 4

<211> 34

<212> DNA

<213> primer cas9-MAPKKK5-F ("Artificial sequence")

<400> 4

cagtggtctc aggcatccgc agccgcggtt gacc 34

<210> 5

<211> 34

<212> DNA

<213> primer cas9-MAPKKK5-R ("Artificial sequence")

<400> 5

cagtggtctc aaaacctggt caaccgcggc tgcg 34

<210> 6

<211> 20

<212> DNA

<213> primer Pbw2+ ("Artificial sequence") for PCR identification

<400> 6

ggcgtcttct actggtgcta 20

<210> 7

<211> 20

<212> DNA

<213> primer Pbw2- ("Artificial sequence") for PCR identification

<400> 7

gtctttacgg cgagttctgt 20

<210> 8

<211> 325

<212> DNA

<213> Standard sequence ("Artificial sequence")

<400> 8

gtccccgtcc tcttcgtccg cgtccgcgtc cacgcccgcg tccccggcgc gggcctcgac 60

ctcccgcgtt ggcggcggtg tccccagccg ccgccgggat gtggtggggt ttggttgggg 120

tggggggagt gatccgcagc cgcggttgac caggcagagg cggctgcggc acgtcgacga 180

catcgaggtc ggggtctcgg cgctcgggct ggattcctcc ccctcgcccg ccgcgccctc 240

gtcgtgcccc tccagtaggg attcggtggg gttcggcctc ctgaccgcga gctccacgcc 300

gatctcgagg accgcgagta acatg 325

<210> 9

<211> 21

<212> DNA

<213> amplification primer Hyg-CX-S for PCR amplification detection ("Artificial sequence")

<400> 9

agatgttggc gacctcgtat t 21

<210> 10

<211> 24

<212> DNA

<213> amplification primer Hyg-CX-A for PCR amplification detection ("Artificial sequence")

<400> 10

aagatcgtta tgtttatcgg cact 24

<210> 11

<211> 24

<212> DNA

<213> target sequences of cas9-MAPKKK5-2-1 mutant and cas9-MAPKKK5-3-8 mutant ("Artificial sequences")

<400> 11

atccgcagcc gcggttgtac cagg 24

Claims (1)

1. The mutated OsMAPKKK5 gene of rice is characterized in that the amino acid sequence of the mutated OsMAPKKK5 gene is shown as SEQ ID NO. 11.