CN111909939B - Application of rice gene LJS4-2 in controlling rice leaf pillow development and leaf angle - Google Patents

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice geneLJS4‑2The application in controlling the development of the leaf pillow and the leaf angle of the rice. The present invention obtains a geneLJS4‑2（GENE ID：Os07g0674800). Knock-out by Gene knockout technologyLJS4‑2The mutant shows that the included angle is obviously smaller than that of the wild type, and the plant type is upright. The phloroglucinol staining of the cross section thick-walled histiocyte of the leaf occiput of the mutant is more red than that of the wild type through bare-handed slicing and phloroglucinol staining observation of the sword leaf occiput at the heading stage, which shows that the accumulation of lignin is increased compared with that of the wild type (Nipponbare) and the mechanical strength of the leaf occiput is increased. Thus knocking out by genetic engineering techniquesLJS4‑2The gene can change the mechanical strength of the plant leaf pillow and the formation of the leaf included angle, thereby improving the plant type and planting density of the plant and increasing the yield.

Description

Application of rice gene LJS4-2 in controlling rice leaf pillow development and leaf angle

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice geneLJS4-2The application in controlling the development of the leaf pillow and the leaf angle of the rice.

Background

Rice leaves are divided into three categories, including coleoptiles, incomplete leaves and complete leaves. Coleoptiles are the first white coleoptiles to appear during germination, are leaf deformations, and have no chlorophyll. Incomplete leaves are the first green leaves that grow from the coleoptile, only the coleoptile, without leaf and leaf pillow structures. The complete leaf is from the second green leaf, with leaf, leaf sheath, and leaf pillow. The main function of the leaves is as an organ for photosynthesis. The leaf sheath wraps the main stem to enhance the supporting effect of the stem. The leaf pillow is a kind of mechanical tissue specific to monocotyledon gramineous plants, and is a mechanical tissue for connecting leaves and leaf sheaths, and comprises a leaf pillow belt, leaf ears and leaf tongues. The leaf-occipital bands serve as a mechanical tissue that allows the leaves to be angled away from the main stem after growth of the leaf and sheath is complete (Hoshikawa and Ichii, 1989). Therefore, the existence and development degree of the leaf pillow directly determine the size of the leaf angle, thereby influencing the plant type and yield of the rice.

The growing population also has an increasing demand for food. The improvement of the rice yield is always a hotspot and a key point of rice breeding research and gene function research. In 1968, donald proposed the concept of breeding of ideal plant types of crops, i.e. selection of traits related to influence plant photosynthesis, growth and seed yield (Donald, 1968). The traits affecting the plant type of rice mainly include plant height, tillering number, panicle type, grain type, leaf shape, leaf angle, tillering angle and the like, wherein the size of the leaf angle is an important agronomic trait determining the uprightness of the leaf blade (Feng Rong Kun, 2006). The upright leaves can enhance the light capturing ability of photosynthesis, serve as a nitrogen source for grain filling, and can also increase planting density, thereby improving leaf area index and rice yield (Sakamoto, et al, 2006).

Disclosure of Invention

The invention aims to obtain a gene for regulating and controlling the development of a rice leaf pillow and the leaf angleLJS4-2。

It is another object of the present invention to provideLJS4-2The application in controlling the development of the leaf pillow and the leaf angle of the rice.

In order to achieve the purpose, the invention clones genes for regulating and controlling the development of the leaf occiput from rice leaf occiput tissues by a reverse genetics methodLJS4-2。

In particular, for cloningLJS4-2The primer sequences of the genes are as follows:

LJS4-2-F CGGGATCCATGTGTGGCGGCGCGATCATTT

LJS4-2-R GCGTCGACCATCGGCACGGCCGTGTGGAT

in particular, for cloningLJS4-2The PCR conditions for the genes were: denaturation at 94 ℃ for 3 min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min for 35cycles, and elongation at 68 ℃ for 10min.

In particular, for cloningLJS4-2The total volume of the PCR reaction system for the gene was 50. Mu.l, the template was Nipponbare cDNA 1ul (about 50 ng), 10 XKOD enzyme reaction buffer 5. Mu.l, and MgCl 25mM ₂ Mu.l, 5mM dNTP 5. Mu.l, 5 uM primers 5. Mu.l (each primer 2.5. Mu.l), 1. Mu.l KOD enzyme, ddH2O (sterile deionized water) to 50. Mu.ll。

The invention obtains the nucleotide containing SEQ ID NO.1 by the methodLJS4-2A gene sequence.

The invention also obtainsLJS4-2The amino acid sequence of the gene code is shown as SEQ ID NO. 2.

The genes identified by the bioinformatics method are all genes for regulating and controlling the development of the leaf sleepers, and the genes are verified by utilizing RNA-seq data of the leaf sleepers in different periodsLJS4-2Expression specificity during leaf pillow development.

LJS4-2The application of the gene in the improvement of gramineous crops.

LJS4-2The gene is applied to improving the rice plant type and increasing the rice yield.

LJS4-2Application of gene in regulating and controlling development of leaf pillow and leaf angle of rice, and during application, the gene is constructed to containLJS4- 2CRISPR/CAS9 vector for gene, and transfer to Nipponbare, knock-outLJS4-2The gene and the obtained transgenic line show that the leaf angle is smaller than that of a wild type (Nipponbare), so that the method can increase the lignin accumulation of the thick-wall tissue of the leaf pillow, improve the mechanical strength of the leaf pillow, reduce the leaf angle, improve the plant type and the planting density of plants, improve the yield and realize the regulation and control of the growth of the leaf pillow of rice and the size of the leaf angle.

Compared with the prior art, the invention has the beneficial effects that:

1. LJS4-2the gene is specifically expressed in the late development stage of rice leaf pillow, and this makes it possible to change crop angle without affecting other characteristics.

2. LJS4-2The gene is an effective gene for changing the leaf angle, and can change the lignin accumulation and the mechanical strength of thick-wall tissues of the leaf pillow, thereby changing the leaf angle of crops.

3. At present, the genes for regulating and controlling the leaf angle by changing the mechanical strength of the leaf pillow are not many, and the genes disclose that the genes participate in the regulation and control of the leaf angle by controlling the lignin accumulation and the mechanical strength of the thick-wall tissue of the leaf pillow.

4. At present, the mechanism research of improving the yield of the plant with the upright plant type is less,LJS4-2following successful knockout using CRISPR/Cas9, rice yield was increased at high density by increasing the number of fertile ears per area (as shown in figure 6).

Drawings

FIG. 1 shows the result of RNA-seq sequencing, in which FIG. 1a showsLJS1-1Specific expression in early development stage of rice leaf pillow, FIG. 1b isLJS4-1Specific expression in late development stage of rice leaf pillow, FIG. 1c isLJS3-1And homologous genes thereofLJS3-1LSpecific expression in S3 and S4 stages of rice leaf pillow development, respectively, FIG. 1dLJS5-1Specific expression in late development stage of rice leaf pillow, FIG. 1e isLJS1S2-1Specific expression in early development stage of rice leaf pillow, FIG. 1f isLJS4-2Specific expression in late development stage of rice leaf pillow, FIG. 1g isLJS5-2And homologous genes thereofLJS5-2LSpecific expression is carried out in S4 and S5 stages of rice leaf pillow development;

FIG. 2 is a leaf angle phenotype and heading stage plant phenotype of CRISPR/CAS9 target gene-knocked transgenic rice seedlings and leaf angle size statistics of knocked transgenic rice seedlings and wild type (Nipponbare), wherein the target gene in FIG. 2a is the leaf angle size statistics of the target geneLJS1-1And homologous genes thereofLJS1-1L(ii) a FIG. 2b target geneLJS4-1(ii) a FIG. 2c target genesLJS3-1And homologous genes thereofLJS3-1L(ii) a FIG. 2d target geneLJS5-1(ii) a FIG. 2e target geneLJS1S2-1And homologous genes thereofLJS1S2-1L(ii) a FIG. 2f target genesLJS4-2(ii) a FIG. 2g target geneLJS5-2And homologous genes thereofLJS5-2L；

FIG. 3 is a diagram showing the changes of the cytological structures of the leaf pillows of the young leaves of the sword-like leaf of the CRISPR/CAS9 target gene-knocked transgenic rice and wild type (Nipponbare), wherein the target gene in FIG. 3a is the target geneLJS1-1And homologous genes thereofLJS1-1L(ii) a FIG. 3b target geneLJS4-1(ii) a FIG. 3c target geneLJS3-1And homologous genes thereofLJS3-1L(ii) a FIG. 3d target genesLJS5-1(ii) a FIG. 3e target gene isLJS1S2-1And homologous genes thereofLJS1S2-1L(ii) a FIG. 3f target genesLJS4-2(ii) a FIG. 3g target geneLJS5-2And homologous genes thereofLJS5-2L；

FIG. 4a is a graph showing the expression level change of target genes regulated by Real-time PCR (polymerase chain reaction) for verifying that target genes for promoting and inhibiting lignin synthesis in transgenic rice after target genes are knocked out by CRISPR/CAS9, wherein the target genes in FIG. 4a areLJS4-1FIG. 4b target geneLJS3-1And homologous genes thereofLJS3-1LFIG. 4c target geneLJS1S2-1And homologous genes thereofLJS1S2-1LFIG. 4d target geneLJS4-2；

FIG. 5 is a schematic view ofpLJS1S2-1::LJS1S2-1Analyzing the seedling phenotype and expression quantity of the transgenic rice line;

FIG. 6 shows the effect of CRISPR/CAS9 target gene-knocked transgenic rice on yield, in which the target gene in FIG. 6a is LJS1-1 and its homologous gene LJS1-1L, and the target gene in FIG. 6b is LJS1-1LLJS4-1FIG. 6c target geneLJS3-1And homologous genes thereofLJS3-1LFIG. 6d target geneLJS5-1FIG. 6e target geneLJS1S2-1And homologous genes thereofLJS1S2- 1LFIG. 6f target genesLJS4-2FIG. 6g target geneLJS5-2And homologous genes thereofLJS5-2L。

Detailed Description

The invention clones gene from rice leaf pillow tissue by reverse genetics methodLJS1-1 (GENE ID：Os01g0922800) And homologous genes thereofLJS1-1L (GENE ID：Os08g0531900Homology of 45.83%), geneLJS4-1（GENE ID：Os03g0182800) Genes, genesLJS3-1（GENE ID：Os04g0549700) And homologous genes thereofLJS3-1L（GENE ID：Os02g0656600，Homology of 57.58%), geneLJS5-1（GENE ID：Os06g0166400) Genes, genesLJS1S2-1（GENE ID：Os06g0181700) And homologous genes thereofLJS1S2-1L（GENE ID：Os02g0797100，Homology 71.59%), geneLJS4-2（GENE ID：Os07g0674800) Genes, genesLJS5-2（GENE ID：Os10g0536100) And homologous genes thereofLJS5-2L（GENE ID：Os03g0122600Homology of 63.88%), and the obtained genes are all regulated leaf pillows identified by bioinformatics methodDeveloping genes, and verifying the expression specificity of the obtained genes in the development process of the leaf pillows by using RNA-seq data of the leaf pillows at different periods. The gene is transferred into Nipponbare through a transgenic method, and the target gene is found to be capable of regulating and controlling the leaf angle of rice, so that the plant type and the planting density of plants are improved, the yield is increased, and the regulation and control of the leaf pillow development and the leaf angle of the rice are realized.

The specific implementation method is as follows, and it should be noted that the following gene synthesis process or rice application test, if not specifically mentioned, are all routine test methods and technical means in the field; the reagents or biomaterials referred to, if not specifically indicated, are either disclosed or are commercially available products which can be purchased directly.

Examples

(A)LJS1-1Gene and homologous gene thereofLJS1-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice comprises the following specific steps:

1. gene for regulating and controlling development of rice leaf pillow and leaf angleLJS1-1And homologous genes thereofLJS1-1LObtained by

1.1 the total volume of the reaction system was 50. Mu.l, the template was Nipponbare cDNA 1ul (about 50 ng), 10 XKOD enzyme reaction buffer 5. Mu.l, 25mM MgCl ₂ Mu.l, 5mM dNTP 5. Mu.l, 5. Mu.l of 5. Mu.M primer (using stepwise PCR with primers LJS1-1-F and LJS1-1-R and LJS1-1L-F and LJS1-1L-R (each primer is 2.5. Mu.l), 1. Mu.l KOD enzyme, plus ddH ₂ O (sterile deionized water) to 50. Mu.l.

1.2 the reaction sequence was: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min 35cycles, and elongation at 68 ℃ for 10min.

1.3 the primers used were as follows:

LJS1-1-F CGGGATCCATGGCGCGGAGGGGGAGA

LJS1-1-R GCGTCGACTGCACTTCCTTCCTCCTGCC

LJS1-1L-F CGGGATCCATGGAGGGAGGAGGGAGGAGG

LJS1-1L-R GCGTCGACAGAGCTCACTCCTGATCTTGGCT

2. gene validation Using RNA-seq dataLJS1-1And homologous genes thereofLJS1-1LSpecific expression in rice leaf pillow

Under normal conditions, young plants of Nipponbare rice, which grow for 4, 5, 6, 7 and 9 days from seed soaking, are defined as the first stage (S1), the second stage (S2), the third stage (S3), the fourth stage (S4) and the fifth stage (S5) of leaf pillow development. The leaf and leaf pillow of the first full leaf were taken separately, total RNA was extracted using the Tiangen RNAprep pure Plant Kit (Tiangen), and then RNA-seq sequencing was performed.

Obtaining a differential gene set specifically expressed in five periods and corresponding GO terms subjected to function enrichment analysis through bioinformatics analysis, selecting the differential gene set comprising single-period specific expression gene sets M01-M05 and a GO terms gene set related to leaf sleeper development, extracting a promoter sequence, analyzing enriched motifs (motifs) on the promoter by using MEME software, selecting the first 10 genes and meeting the condition that E-value is less than or equal to 10 ^-6 As potential transcription factor binding sites (pTFBSs); then, the pTFBSs are compared with the known TFBSs by using TOMTOM software and JASPAR CORE database, and the consistency of q-value less than or equal to 0.05 and p-value less than or equal to 10 are selected ^-4 Known TFBSs under the conditions, thereby obtaining known TFs corresponding to the pTFBSs; then, BLASTP (e-value ≦ 10) ^-10 ) Searching for homologous genes of the known TFs in rice; the definition of the candidate TFs meets two conditions, wherein the first condition is that the plant TFDB is identified to belong to a corresponding transcription factor family, and the second condition is that the TFs and the corresponding target genes specifically expressed in the same period have high correlation of expression trend (PCC is more than or equal to 0.9). The invention obtains the gene by analyzing the differential gene set M01 specifically expressed in the S1 phase as aboveLJS1-1And homologous genes thereofLJS1- 1L。Finally, the gene was obtainedLJS1-1And homologous genes thereofLJS1-1LExpression levels in leaves and leaf pillows at five stages. Discovery of genesLJS1-1S1 is specifically expressed in leaf occipital development (FIG. 1 a).

3. LJS1-1Gene and homologous gene thereofLJS1-1LRegulation and control of rice leaf pillow

3.1 Construction of CRISPR/Cas9 vector

Using genes containingLJS1-1And homologous genes thereofLJS1-1LThe fragment of CRISPR target site sequence of (1) is cloned into pCXUN-CAS9 vector by using KpnI enzyme cleavage site, and the specific method is described in the literature He, Y, zhang, T, yang, N, xu, M, yan, L, wang, R, and Zhao, Y. (2017) Self-cleaning ribozymes enabling the production of guide RNAs from unlined microorganisms for CRISPR/Cas9 mediated genome editing, journal of genetics and genetics = Yi chon xue bao 44,469-472.

Wherein the gene is obtainedLJS1-1And homologous genes thereofLJS1-1LThe total volume of the reaction system of the CRISPR target site fragment of (3) is 50 μ l,LJS1-1the gene adopts 1 mul (about 50 ng) of U6 vector as a template;LJS1-1Lthe template used for the gene was 1. Mu.l (ca. 50 ng) of U3 vector, 5. Mu.l of 1 XKOD enzyme reaction buffer, 2. Mu.l of 25mM MgCL2, 5mM dNTP, 5. Mu.l of 5 uM primer (2.5. Mu.l for the forward and reverse primers, respectively), 1. Mu.l of KOD enzyme, and ddH2O (sterile deionized water) was added to 50. Mu.l.

The reaction procedure is as follows: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min 35cycles, and elongation at 68 ℃ for 10min.

The primers used were:

LJS1-1-U6F GGTGCGGTTCTCCAAGAGGAgttttagagctagaaatagcaagtta

LJS1-1-U6R TCCTCTTGGAGAACCGCACCAACCTGAGCCTCAGCGCAGC

LJS1-1L-U3F ATCGCACCTGCCGGCTCGTCgttttagagctagaaatagcaagtta

LJS1-1L-U3F GACGAGCCGGCAGGTGCGATgccacggatcatctgcacaactc

to obtainLJS1-1Sequence fragment sequence of target site andLJS1-1Lthe sequence fragment of the target site, and cloning the fragment into pCXUN-CAS9 vector using KpnI enzyme cleavage site.

Taking 2 μ l of the extract containingLJS1-1AndLJS1-1Lthe pCXUN-CAS9 vector of the target was added to 50. Mu.l of EHA105 competence and mixed well. Adding into a pre-cooled electric shock cup for electric shock conversion. Setting parameters of an electric laser: voltage 2.45 kV, resistance 200 omega, capacitance 200 muF.

3.2 Genetic transformation of rice

The rice transformation in the following method adopts agrobacterium EHA105 mediated genetic transformation method, and the specific steps are as follows:

3.2.1 callus Induction

Removing hull from rice seed, soaking plump and clear seed in 70% ethanol for 1min, and washing with sterile water for 1-2 times; then adding NaClO solution containing 2% active chlorine (40 ml NaClO solution containing 5.2% active chlorine and 60 ml water), adding 1-3 drops of Tween 20, and soaking for more than 30 min (generally 40 min, the maximum can be 1 h). Shaking occasionally, and then rinsing with sterile water 4-5 times. Pouring onto sterilized plate and filter paper, and drying for about 1 hr; placing the embryos on an N6D solid medium (10 grains/25 ml/bottle), and culturing the embryos in a dark way for 25-30 days at 28 ℃ with the embryos facing upwards or contacting the medium. N6D medium: n6 salts and vitamins, 0.5g/l casein hydrolysate, 30g/l sucrose, 2mg/l 2,4-D,2.5g/l Phytagel (Sigma), pH5.8.

3.2.2 culture of Agrobacterium and Co-culture with Rice callus

Scraping Agrobacterium with a small sterilized spoon, sticking the thallus on the wall of the tube with the back of the spoon, and gently patting to obtain OD ₆₀₀ = 0.8-1.0; airing the pre-cultured calluses on sterile filter paper, then concentrating the calluses into a plate and transferring the calluses into bacteria liquid at one time, slightly rotating a centrifugal tube to uniformly distribute the bacteria liquid, and standing for about 15-20 min; pouring out the bacterial liquid, placing the callus on sterile filter paper for about 1.5 h to ensure that the bacterial liquid is sucked dry, inoculating into 1/2 N6D AS, culturing in the dark at the temperature of 20 ℃ for 2-3 days, and observing that the contact part of the callus and a culture medium has a bacterial film, so that the bacteria can be removed; 1/2 N6D AS medium: N6D2, 10g/l glucose, 100 to 400. Mu. Mol/l acetosyringone (added at the time of use), pH5.2.

3.2.3 removal of Agrobacterium

Filling the co-cultured callus into a 50 ml centrifuge tube, washing with sterile water for more than 3 times until the liquid is clear, pouring out the sterile water, N6D + Cn 500 mg/L (or AP500 ml/L), 100 rpm, 15-20 min,2-3 times; pouring the callus on sterile filter paper, and sucking for about 2h as the case may be; transferring the dried callus into N6D-AS, adding 250 mg/L of cefamycin Cn, and culturing at 28 ℃ in dark for 7-10 days.

3.2.4 selection of callus

Picking out the callus which is not polluted by agrobacterium, adding Cn250 mg/L and Hn (50 mg/L) for the first time for 15-20 days; the second time is the same as above, adding no Cn, adding hygromycin Hn, and transferring all the calluses once again for 15-20 days. Selecting new callus for the third time, and screening by Hn for 15-20 days; the times part is arranged according to the above, but the callus is screened on Hn for at least 45 days, and the newly grown callus picked for the third time is preferably screened for 20 days; N6D screening medium: N6D + Cn250 mg/L + Hn50 mg/L, pH = 5.8-5.9.

3.2.5 differentiation and rooting

Transferring all callus tissues screened for the fourth time into MS, culturing in dark with Hn50 mg/L, and pre-differentiating (pH 5.9) for 12-15 days. Selecting fresh callus with good growth vigor, transferring the callus into MS (PH 6.0), culturing for 15-20 days by light, and changing culture medium for 15 days generally; selecting green bud with length of more than 1cm, removing peripheral redundant callus, cutting off root (about 0.5cm long), transferring into test tube, and performing 1/2MS rooting culture. MS differentiation medium: MS salts and vitamins, 2g/L casein hydrolysate, 30g/L sucrose, 25g/L sorbitol, 2 mg/L6-BA, 0.5mg/L NAA,0.2mg/L Zeatin (Zeatin), 0.5mg/L KT,3.0g/L Phytagel, pH5.8, 50mg/L hygromycin B,200mg/L cefuroxime. 1/2MS rooting medium: 1/2MS salt, MS vitamins, 30g/l sucrose, 1mg/l paclobutrazol, 0.5mg/l NAA,50mg/l hygromycin, 2.5g/l Phytagel, pH5.8.

4. Transplantation, expression amount identification and phenotype analysis

Genetically constructing 20 lines of each rooted transgenic plant, transplanting in greenhouse, and genetically constructingLJS1-1And homologous genes thereofLJS1-1LThe CRISPR transgenic plant adopts leaves to extract DNA, and amplified and edited segments identify mutant single plants.

The primers used were as follows:

LJS1-1-genomeF CATCCGCCTCGTCAAATGC

LJS1-1-genomeR CGGGATAGCAGAACGAAATGG

LJS1-1L-genomeF GGATTCCCTCACCACCACATTA

LJS1-1L-genomeR CGCAGTGGAGTGGAGTACAT

5. determination of the yield

In the fieldFor is toLJS1-1-cri/LJS1-1L-criAnd carrying out yield measurement under different planting densities with wild type Ni. Normal density (Normal, N) was planted at 30cm row spacing and 15cm plant spacing, with an average of 22.2 rice plants per square meter. High density (Dense, D) was planted at 15cm row spacing and 15cm plant spacing, with an average of 44.4 rice plants per square meter. Each treatment was repeated three times in random blocks. Each cell is 2m long and 2m wide. And (4) character investigation, namely selecting intermediate plants except peripheral plants for statistics. Data processing was performed using SPSS 17.0. Multiple comparisons were performed using Tukey's Home Significant Differencetest (P < 0.05).

(II) LJS4-1The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS4-1-F CGGGATCCATGTGCGGCGGTGCAATCCTC

LJS4-1-R GCGTCGACGTCGAGCAGAAGAGAGGCCTG

step 2. The cell wall related GO term gene set of S4 stage specific expression difference genes is analyzed as above to obtainLJS4-1。Finally, obtainLJS4-1Expression level in leaf pillows in five stages. Discovery of genesLJS4-1S4 is specifically expressed in leaf occipital development (FIG. 1 b).

Gene in step 3.1LJS4-1The template is a U6 carrier, and the primers are as follows:

LJS4-1-U6F GGGGGACGACACACATGACAgttttagagctagaaatagcaagtta

LJS4-1-U6R TGTCATGTGTGTCGTCCCCCAACCTGAGCCTCAGCGCAGC

the primers used in step 4 are:

LJS4-1-genomeF CAATCCTCGCCGATTTCACC

LJS4-1-genomeR GCTCTTCTTGCTCGCCTTC

(III)LJS3-1Gene and homologous gene thereofLJS3-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS3-1-F CGGGATCCATGGAAGCAGACGCGAGCCATA

LJS3-1-R GCGTCGACCTCGGCCCACAAGAGTGGCTCA

LJS3-1L-F CGGGATCCATGGAAGCTGCCGCGATCC

LJS3-1L-R GCGTCGACGTCAGGCTGCACGGGCGC

step 2. The differential gene sets M03 and M04 specifically expressed in S3 stage and S4 stage were analyzed as above to obtainLJS3-1AndLJS3-1L。finally, obtainingLJS3-1And homologous genes thereofLJS3-1LExpression level in leaf pillows in five stages. Discovery of genesLJS3-1And homologous genes thereofLJS3-1LS3 and S4 are specifically expressed in leaf occipital development, respectively (FIG. 1 c).

Step 3.1LJS3-1The gene adopts 1ul (about 50 ng) of U6 vector as a template;LJS3-1Lthe gene used a template of 1ul (about 50 ng) of U3 vector, and the primers used were:

LJS3-1-U6F GGCCGCTCTCTTGCGCTTCTgttttagagctagaaatagcaagtta

LJS3-1-U6R AGAAGCGCAAGAGAGCGGCCAACCTGAGCCTCAGCGCAGC

LJS3-1L-U3F ACAAGCAGCTCAAGCGGAAGgttttagagctagaaatagcaagtta

LJS3-1L-U3R CTTCCGCTTGAGCTGCTTGTgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS3-1-genomeF CAGACCGCACTTCCATCGA

LJS3-1-genomeR GATCTCCGACACCCACTTCC

LJS3-1L-genomeF CATCTCCTTCCTGCGGTATTCT

LJS3-1L-genomeR AGCCAGATGCGCGACTTCT

(IV)LJS5-1The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS5-1-F CGGGATCCATGGATAGGAGGGAGGCCACC

LJS5-1-R GCGTCGACCTCGTCGTCGGAGGTGTCCG

step 2. The differential gene set M05 of S5 phase specific expression is analyzed as above to obtainLJS5- 1。To obtainLJS5-1Expression level in leaf pillows at five stages. Discovery of genesLJS5-1S5 is specifically expressed in leaf occipital development (FIG. 1 d).

The primers used in step 3.1 are:

LJS5-1-U6F GCGAGCCGAACAAGCGGTCGgttttagagctagaaatagcaagtta

LJS5-1-U6R CGACCGCTTGTTCGGCTCGCAACCTGAGCCTCAGCGCAGC

the primers used in step 4 are:

LJS5-1-genomeF GCGAGGATGGATAGGAGGGA

LJS5-1-genomeR TAGAACACGGCGGTGTCGTA

(V)LJS1S2-1Gene and homologous gene thereofLJS1S2L-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS1S2-1-F CGGGATCCATGGCGCGGCCGCAGCA

LJS1S2-1-R GCGTCGACGCAGGAGATCTCCATGGAGAAGT

LJS1S2-1L-F CGGGATCCATGGCGAGGCCGCAGCAACGAT

LJS1S2-1L-R GCGTCGACGTAGCAGATCTCCATGGAGAAG

step 2. The differential gene set M06 with specific expression in both S1 and S2 phases is analyzed as above to obtainLJS1S2-1 and LJS1S2L-1L.Finally, obtainLJS1S2-1AndLJS1S2L-1Lexpression levels in leaves and leaf pillows at five stages. Discovery of genesLJS1S2-1 and LJS1S2L-1LS1 and S2 are specifically expressed in leaf occipital development (FIG. 1 e).

Gene in step 3.1LJS1S2-1Adopts a template as a U6 vector and a geneLJS1S2L-1The template is used as a U3 carrier, and the primers are as follows:

LJS1S2-1-U6F GGCACGCGCGTACGACGAGGgttttagagctagaaatagcaagtta

LJS1S2-1-U6R CCTCGTCGTACGCGCGTGCCAACCTGAGCCTCAGCGCAGC

LJS1S2-1L-U3F AGGCCGCAGCAACGATACCGgttttagagctagaaatagcaagtta

LJS1S2-1L-U3R CGGTATCGTTGCTGCGGCCTgccacggatcatctgcacaactc

and step 3, further comprising the construction of a plant expression vector pLJS1S2-1, wherein the specific steps are as follows:

firstly, by using a step-by-step methodLJS1S2-1Promoter (A)LJS1S2-1Promoter sequence obtained as above) linked to the fusion FLAG tag engineered in this laboratorypCAMBIA1300On the carrier skeleton (LJS 1S2-1-proF and LJS1S 2-1-proR) to obtainpCAMBIA1300-pLJS1S2-1Then will beLJS1S2-1full-Length cDNA was cloned using BamHI/SalIpCAMBIA1300- pLJS1S2-1Obtaining plant expression vectors on the basis of the expression vectors (LJS 1S2-1-OE-F and LJS1S 2-1-OE-R)pLJS1S2-1::LJS1S2-1And transferring to Nipponbare. The primers used were as follows:

LJS1S2-1-OE-F CGGGATCCATGGCGCGGCCGCAGCA

LJS1S2-1-OE-R GCGTCGACGCAGGAGATCTCCATGGAGAAGT

LJS1S2-1-proF CTATGACATGATTACgaattcTGGTTGGCTTGGCTGTGAT

LJS1S2-1-proR CCGCTGCGTGGGGTTggtaccTGCCGACGTCCTCGAGCTCG

and 4, genetically constructing 20 lines of each rooted transgenic plant, transplanting the transgenic plant into a greenhouse, extracting DNA (deoxyribonucleic acid) from the CRISPR transgenic plant of the LJS1S2-1 by adopting leaves, and identifying homozygous single plants (LJS 1S2-1-genome F and LJS1S2-1-genome R) by amplifying and editing fragments. LJS1S2-1 transgenic plants, extracting plant protein by taking leaves, and identifying expression quantity by using western blot. The primers used were as follows:

LJS1S2-1-genomeF GCTCATGGGTCTCCGAGAT

LJS1S2-1-genomeR GAGCTCTGGTCCACGTACTGCTCCT

LJS1S2-1L-genomeF TCGGCGAAGTGCTCGATCA

LJS1S2-1L-genomeR CGAACGTGCCCAGCCATAT

(VI)LJS4-2The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS4-2-F CGGGATCCATGTGTGGCGGCGCGATCATTT

LJS4-2-R GCGTCGACCATCGGCACGGCCGTGTGGAT

obtaining a nucleotide comprising the nucleotide of SEQ ID NO.1LJS4-2The gene sequence, and the amino acid sequence coded by the gene is shown in SEQ ID NO. 2.

Step 2. The cell wall related GO term gene set of the S4 stage specific expression differential gene is analyzed as above to obtainLJS4-2。Finally, obtainLJS4-2Expression level in leaf pillows in five stages. Discovery of genesLJS4-2Specific expression in leaf pillow development S4 (FIG. 1 f)

Gene in step 3.1LJS4-2The template is used as a U3 carrier, and the primers are as follows:

LJS4-2-U3F ACGGCCGCCGCCTGATGCCAgttttagagctagaaatagcaagtta

LJS4-2-U3R TGGCATCAGGCGGCGGCCGTgccacggatcatctgcacaactc

to obtainLJS4-2Sequence fragment of target sitetggca tcaggcggcg gccgt。

The primers used in step 4 are:

LJS4-2-genomeF CAGAGGAGCCGACCAAGAAG

LJS4-2-genomeR GGCGTCGTAGTCCATGAACT

(seven)LJS5-2Gene and homologous gene thereofLJS5-2LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS5-2-F CGGGATCCATGGTGCGGGGGAGGACGGA

LJS5-2-R GCGTCGACACCTGTCTCCGACCGGTTGGA

LJS5-2L-F CGGGATCCATGGTGCGGGGGAAGACGCAGA

LJS5-2L-R GCGTCGACAGAATGGGGCATCGCTTGGCTA

step 2. The differential gene set M05 of S5 phase specific expression is analyzed as above to obtainLJS5- 2AndLJS5-2L。in the end, the flow rate of the gas is controlled,LJS5-2expression level in leaf pillows in five stages. Discovery of genesLJS5-2Specifically expressed in S5 phase of leaf occipital development (FIG. 1 g).

Gene in step 3.1LJS5-2The template adopted by the gene is a U6 vector,LJS5-2Lthe gene adopts a U3 carrier as a template, and the primers are as follows:

LJS5-2-U6F GGATTGAGAACCCGACGAGCgttttagagctagaaatagcaagtta

LJS5-2-U6R GCTCGTCGGGTTCTCAATCCAACCTGAGCCTCAGCGCAGC

LJS5-2L-U3F ATTCGTAGAGCTTGCCGCGCgttttagagctagaaatagcaagtta

LJS5-2L-U3R GCGCGGCAAGCTCTACGAATgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS5-2-genomeF CCTCGTCTCGTCTCGTCTCT

LJS5-2-genomeR TGCTTTATAGCGGTCGATGGT

LJS5-2L-genomeF CGTGTGGTTGGTTGGTTCA

LJS5-2L-genomeR CTGATGCTAATGAGGCTTCTCT。

as referred to in (a) aboveLJS1-1Gene and homologous gene thereofLJS1-1LThe test methods of (2) to (seven) were subjected to the relevant application tests, and the test results are shown in FIGS. 1 to 6.

Test results and conclusions

1. As can be seen from FIG. 1aLJS1-1Specific expression in early development stage of leaf pillow; from FIG. 1b it can be seen thatLJS4-1Specific expression in S4 stage of leaf pillow development; from FIG. 1c it can be seen thatLJS3-1And homologous genes thereofLJS3-1LRespectively expressing specifically in S3 and S4 stages of leaf pillow development; from FIG. 1d, it can be seen thatLJS5-1Specific expression in later development stage of leaf pillow; from FIG. 1e, it can be seen thatLJS1S2-1Specific expression in early development stage of leaf pillow; from FIG. 1f, it can be seen thatLJS4-2Specific expression in S4 stage of leaf pillow development; from FIG. 1g, it can be seen thatLJS5-2And homologous genes thereofLJS5-2LIs specifically expressed in S4 and S5 stages of leaf occipital development.

2. From fig. 2a, it can be seen that after successful knockout, the included angle of the homozygous mutant plant at the seedling stage becomes smaller, the plant type at the heading stage is upright, and the leaf included angle of the homozygous mutant plant at the seedling stage is significantly reduced compared with the wild type (nipponica); as can be seen from FIG. 2b, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; as can be seen from FIG. 2c, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; it can be seen from FIG. 2d that the included angle of the homozygous mutant plant becomes smaller after successful knockout; it can be seen from FIG. 2e that after successful knockout, the leaf angle of the homozygous mutant plant is smaller than that of the wild type (Nipponbare); as can be seen from FIG. 2f, after successful knockout, the included angle of the homozygous mutant plant at heading stage becomes smaller, and the plant type is upright; as can be seen from FIG. 2g, after successful knockout, the included angle of the homozygous mutant plant becomes smaller and the plant type is upright.

3. As can be seen from FIG. 3a, after successful knockout, the leaf occipital structure of homozygous mutant plant at the seedling stage is changed, and the number of leaf occipital cell layers is increased compared with that of wild type (Nipponbare); as can be seen from FIG. 3b, after successful knockout, accumulation of the lignin in the sclerenchyma tissue of the folium xipholi of the homozygous mutant plant at heading stage is increased compared with that of the wild type (Nipponbare), and the mechanical strength is increased; from FIG. 3c, it can be seen that after successful knockout, accumulation of sclerenchyma lignin of the folium xipholi of homozygous mutant plants at heading stage is increased compared with wild type (Nipponbare), and mechanical strength of the folium xipholi is increased; from FIG. 3d, it can be seen that after successful knockout, the leaf occipital structure of homozygous mutant plant at seedling stage is changed, and the leaf occipital paraxial surface parenchyma cell is smaller than that of wild type (Nipponbare); from FIG. 3e, it can be seen that after successful knockout, the leaf-pillow structure of homozygous mutant plant at seedling stage changes, and abaxial sclerenchyma cells are increased compared with wild type (Nipponbare); as can be seen from FIG. 3f, after successful knockout, accumulation of the lignin in the sclerenchyma tissue of the folium xipholi of the homozygous mutant plant at heading stage is increased compared with that of the wild type (Nipponbare), and the mechanical strength is increased; it can be seen from FIG. 3g that after successful knockout, the paraxial parenchyma cells of the leaf pillows of the homozygous mutant plants are smaller than those of the wild type (Nipponbare).

4. From FIG. 4a, it can be seen that qRT-PCR detects that the target gene of LJS4-1 promoting and inhibiting lignin accumulation is inLJS4-1-criThe change of expression amount in the transgenic line indicatesLJS4-1Expression of S4 in leaf occipital development, which is related to lignin accumulation in leaf occipital sclerenchyma tissues; from FIG. 4b, it can be seen that qRT-PCR detects the target gene promoting and inhibiting lignin accumulation inLJS3-1And homologous genes thereofLJS3-1LThe expression amount of the CRISPR transgenic line is changed, which shows thatLJS3-1And homologous genes thereofLJS3-1LExpression of S3 and S4 in leaf occipital development, associated with lignin accumulation in leaf occipital sclerenchyma tissues; from FIG. 4c, it can be seen that the cell cycle-associated genes were detected by qRT-PCRLJS1S2-1-cri/LJS1S2-1L-criAnalysis of expression level in transgenic lines revealed thatLJS1S2-1Expression in early development of leaf occipital, associated with proliferation of leaf occipital cells; from FIG. 4d, it can be seen that qRT-PCR detects that the target gene of LJS4-2 promoting and inhibiting lignin accumulation is inLJS4-2-criThe change of expression amount in the transgenic line shows thatLJS4-2Expression of S4 in leaf occipital development is associated with accumulation of lignin in leaf occipital sclerenchyma.

5. From fig. 5 it can be seen thatLJS1S2-1The promoter and the full-length CDS are cloned on pCAMBIA1300 and transferred into Nipponbare, and the leaf angle of the obtained transgenic line is larger than that of the wild type (Nipponbare), which indicates thatLJS1S2-1Has the function of controlling the development of the leaf pillow of the rice and the size of the leaf angle.

6. As can be seen from FIG. 6, after the target gene is successfully knocked out, the yield of rice is increased by increasing the fertile ear number per unit area under high density.

Sequence listing

Application of rice gene LJS4-2 in controlling growth of leaf pillow and leaf angle of rice

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 651

<212> DNA

<213> Rice (Oryza sativa)

<400> 1

atgtgtggcg gcgcgatcat ttccgacttc atcccgcagc gggaagccca ccgcgcggcc 60

accggcagca agcgtgccct ctgcgcctcc gacttctggc cgtcggcgtc gcaggaagcc 120

gccgacttcg accacctcac cgccccctgc accttcaccc ccgaccaagc ggcagaggag 180

ccgaccaaga agcgggagcg gaagacgctg taccgtggca tcaggcggcg gccgtggggg 240

aagtgggcgg cggagatccg cgacccggcg aagggcgcgc gcgtctggct cggcaccttc 300

gccaccgccg aggcggcggc ccgcgcctac gactgcgccg cccgccgcat ccgcggggcc 360

aaggccaagg tcaacttccc caacgaggac ccgccactcg acgacccggc cgccgacggc 420

cacagccacg gcggcgccgc catcccgtgc agggagttca tggactacga cgccgtcatg 480

gcgggcttct tccaccagcc ctacgtcgtc gccgacggcg tgccggccgt gccggcggag 540

gaggcgccca cggtggcgta cgtgcaccac cacctgccgc cgcagccgca gcaggacgcg 600

gggctggagc tctggagctt tgataacatc cacacggccg tgccgatgtg a 651

<210> 2

<211> 216

<212> PRT

<213> Rice (Oryza sativa)

<400> 2

Met Cys Gly Gly Ala Ile Ile Ser Asp Phe Ile Pro Gln Arg Glu Ala

1 5 10 15

His Arg Ala Ala Thr Gly Ser Lys Arg Ala Leu Cys Ala Ser Asp Phe

20 25 30

Trp Pro Ser Ala Ser Gln Glu Ala Ala Asp Phe Asp His Leu Thr Ala

35 40 45

Pro Cys Thr Phe Thr Pro Asp Gln Ala Ala Glu Glu Pro Thr Lys Lys

50 55 60

Arg Glu Arg Lys Thr Leu Tyr Arg Gly Ile Arg Arg Arg Pro Trp Gly

65 70 75 80

Lys Trp Ala Ala Glu Ile Arg Asp Pro Ala Lys Gly Ala Arg Val Trp

85 90 95

Leu Gly Thr Phe Ala Thr Ala Glu Ala Ala Ala Arg Ala Tyr Asp Arg

100 105 110

Ala Ala Arg Arg Ile Arg Gly Ala Lys Ala Lys Val Asn Phe Pro Asn

115 120 125

Glu Asp Pro Pro Leu Asp Asp Pro Ala Ala Asp Gly His Ser His Gly

130 135 140

Gly Ala Ala Ile Pro Cys Arg Glu Phe Met Asp Tyr Asp Ala Val Met

145 150 155 160

Ala Gly Phe Phe His Gln Pro Tyr Val Val Ala Asp Gly Val Pro Ala

165 170 175

Val Pro Ala Glu Glu Ala Pro Thr Val Ala Tyr Val His His His Leu

180 185 190

Pro Pro Gln Pro Gln Gln Asp Ala Gly Leu Glu Leu Trp Ser Phe Asp

195 200 205

Asn Ile His Thr Ala Val Pro Met

210 215

Claims (2)

1. Knock-out rice geneLJS4-2The application of the gene in regulating and controlling the development of leaf pillows and the size of leaf included angles is characterized in that the rice geneLJS4-2The amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and when in application, the encoded protein is constructed to containLJS4-2CRISPR/CAS9 vector of gene, and transformation into Nipponbare, knock-outLJS4-2The gene can reduce the leaf angle, promote the plant type to be upright and increase the rice yield by improving the fertile ear number per unit area under high density by regulating and controlling the lignin accumulation and the mechanical strength of the thick-wall tissue of the leaf pillow.

2. The use of claim 1, wherein the rice gene is a rice geneLJS4-2Nucleotide sequence of (a)Is shown as SEQ ID NO. 1.

Images