CN116004672B

CN116004672B - Phosphoglycerate kinase gene for improving plant biomass and yield and application thereof

Info

Publication number: CN116004672B
Application number: CN202211603164.4A
Authority: CN
Inventors: 孙培培; 卜培娇; 章林忠; 冯欢; 方从兵; 赵静; 谢兴斌; 郑光辉; 彭艳
Original assignee: Anhui Agricultural University AHAU
Current assignee: Anhui Agricultural University AHAU
Priority date: 2022-12-13
Filing date: 2022-12-13
Publication date: 2023-12-22
Anticipated expiration: 2042-12-13
Also published as: CN116004672A

Abstract

The invention relates to the technical field of plant molecular genetic engineering, in particular to a phosphoglycerate kinase gene for improving plant biomass and yield and application thereof. The invention discloses a phosphoglycerate kinase gene FaPGK4, a nucleotide sequence thereof, coded amino acid and a primer pair thereof, and provides application of the FaPGK4 gene or an expression vector or a host cell containing the FaPGK4 gene in improving plant biomass and/or improving yield and/or leaf net photosynthetic rate, thereby providing a new gene resource for molecular breeding for improving plant biomass and yield.

Description

Phosphoglycerate kinase gene for improving plant biomass and yield and application thereof

Technical Field

The invention relates to the technical field of plant molecular genetic engineering, in particular to a phosphoglycerate kinase gene FaPGK4 for improving plant biomass and yield and application thereof.

Technical Field

The dark reaction of photosynthesis, also known as the karl-benson cycle, is the carbon fixation process of photosynthesis. Plant biomass is mainly derived from photosynthesis captured carbon, and changes in photosynthesis efficiency and capacity directly lead to changes in plant growth rate and productivity, which are important factors affecting species competition and crop yield.

The calvin-benson cycle consists of three phases, (1) CO ₂ Carboxylation to 3-phosphoglycerate (3-PGA) by immobilization of ribulose-1, 5-bisphosphate carboxylase/oxygenase (Rubisco) on ribulose-1, 5-bisphosphate (RuBP); (2) 3-PGA is reduced by phosphoglycerate kinase (PGK) and 3-phosphoglyceraldehyde dehydrogenase (GAPDH) to generate 3-phosphoglyceraldehyde (G3P), and ATP and NADPH are consumed in the reaction; (3) Part of the G3P is used to regenerate RuBP to continue the karl text-benson cycle, and the other part is output as a product in two ways: a starch produced as F6P (fructose 6-phosphate) which remains in the chloroplast; the other is transported to the cytoplasm as G3P or DHAP via triose transporter (TPT) for sucrose and amino acid formation; among them, phosphoglycerate kinase PGK is a key enzyme of the Calvin-Benson cycle. Most eukaryotic organisms contain 2-3 PGK isozymes which are not only distributed differently in the organism but also have individual unique biological functions.

There are reports of related technologies for improving plant biomass or yield by controlling gene expression levels. Matsumura et al (2020) increased photosynthetic efficiency by engineering ribulose-1, 5-bisphosphate carboxylase/oxygenase. Simkin et al (2017) study demonstrated that simultaneous promotion of SBPase, FBPase and GDCH gene expression increased Arabidopsis CO ₂ Fixation efficiency, plant biomass and seed yield. Journal of science (South et al, 2019) written notes that modifying glycolic acid metabolism in the plant light respiration pathway improves tobacco productivity in field trials40%. Patent CN102257146a discloses a purple acid phosphokinase with increased plant growth rate and increased plant yield. To date, studies on PGK to increase plant biomass, yield and photosynthetic rate have not been reported.

Disclosure of Invention

In order to solve the problems in the prior art, one of the purposes of the invention is to provide a phosphoglycerate kinase gene capable of improving plant biomass and yield, wherein the phosphoglycerate kinase gene is a phosphoglycerate kinase gene FaPGK4, the nucleotide sequence of the phosphoglycerate kinase gene is shown as SEQ ID NO.1, and the coded amino acid sequence is shown as SEQ ID NO. 2.

The invention also provides an expression vector containing the phosphoglycerate kinase gene, which is a pCAMBIA1302-FaPGK4-GFP expression vector, and is obtained by connecting a PCR product obtained by taking red strawberry cDNA as a template and carrying out PCR reaction with the pCAMBIA1302-GFP vector.

Preferably, the sequence of the upstream primer used in the PCR reaction is shown as SEQ ID NO.3, and the sequence of the downstream primer is shown as SEQ ID NO. 4.

The invention also provides a host cell containing the strawberry phosphoglycerate kinase gene FaPGK4, and the host cell is agrobacterium tumefaciens GV3101.

The invention also provides application of the phosphoglycerate kinase gene and/or the expression vector and/or the host cell in improving plant biomass and yield, and application of the phosphoglycerate kinase gene and/or the expression vector and/or the host cell in improving net photosynthetic rate of plant leaves.

The invention has the beneficial effects that:

1) The strawberry phosphoglycerate kinase gene FaPGK4 obtained by cloning in the invention is overexpressed in different plants by the existing means, and can improve the biomass, the yield and the leaf net photosynthetic rate of transgenic plants.

2) The invention utilizes biochemical and molecular biology and transgenic technology means to discuss the molecular mechanism of strawberry FaPGK4 gene regulation photosynthesis, and provides new gene resource for molecular breeding to raise plant biomass and yield.

Drawings

FIG. 1 is a PCR gel electrophoresis diagram of FaPGK4 gene clone in example 1 of the present invention;

FIG. 2 is a plasmid map of the plant over-expression plasmid pCAMBIA1302-GFP used in example 2 of the present invention;

FIG. 3 is an electrophoresis chart of transgenic plants of Arabidopsis detected by PCR in example 3 of the present invention; wherein, water: sterile water; WT: wild type Arabidopsis thaliana; 1-12: an Arabidopsis thaliana strain transformed with the FaPGK4 gene;

FIG. 4 shows the expression level of FaPGK4 in transgenic Arabidopsis thaliana according to example 3 of the present invention; wherein, WT: wild type Arabidopsis thaliana; OE-FaPGK4-4/7/9: 3 Arabidopsis positive lines transformed with FaPGK4 gene;

FIG. 5 is a phenotypic chart of transgenic Arabidopsis thaliana and control plants in example 3 according to the present invention;

FIG. 6 is a graph showing root length comparison between transgenic Arabidopsis thaliana and control plants in example 3 of the present invention;

FIG. 7 shows fresh weight measurement results of transgenic Arabidopsis thaliana and control plants in example 3 of the present invention;

FIG. 8 is a transverse and longitudinal comparison of seed sizes of transgenic Arabidopsis thaliana and control plants in example 3 of the present invention;

FIG. 9 is thousand kernel weight of seed of transgenic Arabidopsis thaliana and control plant in example 3 of the present invention;

FIG. 10 is an electrophoresis chart of a tobacco transgenic plant detected by PCR in example 4 of the present invention; wherein, water: sterile water; WT: wild tobacco; 1-17: tobacco lines transformed with the FaPGK4 gene;

FIG. 11 shows the expression level of the FaPGK4 gene in transgenic tobacco in example 4 of the present invention; wherein, WT: wild tobacco; OE-FaPGK4-1/3/4: tobacco positive lines transformed with the FaPGK4 gene;

FIG. 12 is a phenotype diagram of tobacco transformed with FaPGK4 gene in example 4 of the present invention; wherein A is wild type tobacco; B. c, D are tobacco positive strains OE-FaPGK4-1/3/4 transformed with FaPGK4 gene respectively;

FIG. 13 is a graph showing photosynthetic index analysis of tobacco transformed with FaPGK4 gene in example 4 of the present invention; wherein, graph A is net photosynthetic rate, graph B is transpiration rate, and graph C is stomatal conductance.

Detailed Description

For easy understanding, the following description will make more specific use of the technical solution of the present invention in conjunction with the examples:

example 1

Cloning of strawberry phosphoglycerate kinase Gene FaPGK4

Genome information of a cultivated strawberry variety 'red color' is taken as a template, a candidate gene PGK4 for chloroplast localization is obtained through bioinformatics analysis, and a full-length primer pair of the gene is designed.

PCR reactions were performed at 2X Taq Plus Master Mix (25. Mu.L) using "red" leaf cDNA (1. Mu.L) as template, PGK4-F (ATGGCCTCTGCCTCCGCACC, 2. Mu.L, SEQ ID NO. 3) as forward primer, PGK4-R (CACGGGAACTGGAACAGCTT, 2. Mu.L, SEQ ID NO. 4) as reverse primer, and the procedure was as follows: pre-denaturing at 95 ℃ for 3min, denaturing at 95 ℃ for 15sec, annealing for 15sec, extension at 72 ℃ (annealing temperature and extension time are set according to the annealing temperature TM value of the upstream and downstream primers and the size of the target band), thoroughly extending at 72 ℃ for 5min, cloning to obtain PGK4 gene, transforming pMD19-T vector, sending positive colony containing pMD19-T-PGK4 to the division of biological engineering (Shanghai) for sequencing, finally determining the nucleotide sequence of PGK4 gene, and naming the nucleotide sequence as FaPGK4.

FIG. 1 is a PCR gel electrophoresis diagram of FaPGK4 gene clone, the open reading frame length of the FaPGK4 gene sequence is 1443bp, the nucleotide sequence of the FaPGK4 gene is shown as SEQ ID NO.1, the amino acid sequence encoded by the FaPGK4 gene is shown as SEQ ID NO.2, and the encoding is 480 amino acids.

Example 2

Construction of pCAMBIA1302-FaPGK4-GFP expression vector

pCAMBIA1302-GFP is an over-expression vector carrying Green Fluorescent Protein (GFP), and the green fluorescent protein is nontoxic and can spontaneously emit green fluorescence. The fusion expression vector constructed by the vector and the target gene can not only keep the original activity of the target protein, but also observe the position, movement and the like of the target protein in plant organs by utilizing the luminous characteristic of GFP under the ultraviolet condition.

The method comprises the following specific steps:

1. plasmid DNA extraction

Positive colonies of pMD19-T-PGK4 of example 1 were inoculated into 25mL of a strain containing 50 mg.multidot.L ^-1 Kanamycin was shake cultured overnight at 37℃at 200rpm in liquid LB medium. The plasmid DNA was then extracted as follows:

(1) 4mL of activated bacteria liquid is centrifuged for 1min, and the supernatant is removed. 250 μl Buffer S1 was added, and mixed well with shaking. Then 250 mu L Buffer S2 is added, and the mixture is gently turned over and mixed uniformly;

(2) Adding 350 mu L Buffer S3, gently turning over, mixing, and centrifuging at 12000rpm at room temperature for 10min;

(3) Sucking the supernatant in the step (2), centrifuging at 12000rpm at room temperature for 1min, and removing the waste liquid;

(4) Adding 700 μL Buffer W2, centrifuging for 1min, repeating for 1 time; pouring out the waste liquid, and centrifuging for 1 time;

(5) 40. Mu.L of Eluent preheated at 65℃was added thereto, and the mixture was allowed to stand at room temperature for 2 minutes. Centrifuge at 12000rpm for 1min at room temperature. The liquid in a 1.5mL centrifuge tube was the extracted plasmid DNA.

2. Construction of binary expression vector:

PCR amplification was performed using the primer CAGATCTCATGGCCTCTGCCTCCGCACC, GCACTAGTCACGGG AACTGGAACAGCTT and pMD19-T-PGK4 plasmid DNA as a template, and the PCR product was recovered. Plasmid DNA of the pCAMBIA1302 empty vector was extracted using the above plasmid DNA extraction method, and BglII and SpeI double cleavage was performed on the pCAMBIA1302 and PCR recovered products, and the reaction conditions were: 37℃for 3h.

The reaction system: circular plasmid DNA was added at 20. Mu.L, 10 XQuickCut Buffer was added at 4. Mu.L, bglII and SpeI were added at 1. Mu.L, respectively, and ddH was used ₂ O was made up to a total volume of 40. Mu.L.

And (3) performing gel recovery on the enzyme digestion product, and detecting the concentration by a nucleic acid tester. T4 ligase is connected, escherichia coli is transformed, positive colonies containing fusion protein expression vectors are screened out through colony PCR and bacterial liquid sequencing, and positive single colonies are determined through sequencing.

3. Construction of host cells containing FaPGK4

The host cell used is Agrobacterium tumefaciens GV3101, and FaPGK4-pCAMBIA1302-GFP is introduced into competent cells of the Agrobacterium tumefaciens GV3101 by a freeze thawing method, and the specific method is as follows:

(1) Thawing on ice with competence, and gently mixing 30 μl competence with 1 μl recombinant plasmid;

(2) Placing the mixed product on ice for 5min, liquid nitrogen for 5min, and placing on ice for 5min at 37 ℃;

(3) Adding 800 mu L of liquid LB, and shaking and culturing for 2 hours at 28 ℃;

(4) Centrifuging at low speed in a centrifuge for 3min, removing supernatant, collecting 100 μl of liquid, suspending, precipitating, and coating on LB solid medium (50mg.L ^-1 Kanamycin), culturing in a constant temperature incubator, and culturing in the dark at 28 ℃ for 2d.

FIG. 2 is a plasmid map of the plant over-expression vector pCAMBIA1302-GFP carrying a GFP tag.

Example 3

Acquisition of transformed phosphoglycerate kinase gene FaPGK4 Arabidopsis thaliana and influence of transformed phosphoglycerate kinase gene FaPGK4 Arabidopsis thaliana on Arabidopsis thaliana plants

The method comprises the steps of selecting an arabidopsis plant which normally grows in a greenhouse, cutting off the upper part of a main inflorescence in a flowering period to induce the generation of side inflorescences, so that inflorescences in the same period are more, and transformation is facilitated. The specific method comprises the following steps:

(1) The host cells containing pCAMBIA1302-FaPGK4-GFP of example 2 were selected and inoculated into LB solid medium (containing 50 mg.L) ^-1 Kanamycin and 50 mg.L ^-1 Rifampicin), dark culture at 28 ℃ for 2d;

(2) Taking the monoclonal activated in step 1), inoculating to LB solid medium (50mg.L) ^-1 Kanamycin and 50 mg.L ^-1 Rifampicin), in the dark at 28℃for 2d, colonies were collected, resuspended in an aggressive solution (1/2MS+5% sucrose, 0.03-0.05% Silwet L-77) to OD ₆₀₀ 0.5-0.8;

(3) The step 2) of impregnating the arabidopsis inflorescence with the impregnating bacterial liquid, wherein each time of impregnating is 10-15sec, the impregnated plant is cultivated for 1d in the dark, and the plant is taken out and placed under normal light for continuous growth the next day; dip-dyeing is carried out for 1 time per week for 4 weeks;

(4) Continuously culturing until the seeds are mature, and harvesting the seeds of the T0 generation;

(5) T0 generation seeds were spread evenly on MS solid medium (25 mg.L) ^-1 Hygromycin) and screening T1 generation positive plants; and then carrying out PCR identification on the positive plants, screening transgenic lines with proper expression quantity from the positive plants, collecting seeds by a single plant, and harvesting T2 generation seeds.

Spreading the T2 generation seeds on an MS solid culture medium containing corresponding screening markers, wherein the separation ratio of the selected offspring basically accords with 3:1, culturing positive seedlings under proper conditions until the seeds are mature, collecting seeds by a single plant, harvesting T3 generation seeds, and screening T3 generation positive pure lines of which the offspring are not separated.

(6) Identifying positive plants by a PCR method: extracting DNA of a plant after hygromycin screening, intercepting the length of about 500bp from the upstream of a pCAMB IA1302-GFP vector to the downstream of a gene, and carrying out PCR amplification by using specific primers, wherein the primers are pCAMBIA1302-35S-F: AAGTTCATTTCATTTGGAGA, JDFaPGK4-R: CTATCATCCAAAGGGACATT.

Data measurement: total RNA is extracted from transgenic arabidopsis and wild plants, cDN A is reversely transcribed, then fluorescence real-time quantitative qPCR is carried out, and the expression level of the gene in the transgenic plant is analyzed. And then, observing the sizes of roots, plants and seeds and analyzing the fresh weight and thousand seed weight of the plants in different growth periods of the transgenic plant lines.

Results:

FIG. 3 shows PCR positive identification of an Arabidopsis plant transformed with the FaPGK4 gene, and FIG. 4 shows the expression level of the FaPGK4 gene in a transgenic Arabidopsis plant.

FIG. 5 is a phenotype diagram of the transgenic line and the growth of the wild type plant 15 d. The FaPGK4 over-expressed transgenic line is obviously more robust than the wild type Arabidopsis plant, and the plant growth vigor is improved.

FIG. 6 is a graph comparing root lengths of transgenic Arabidopsis and wild type plants, and the root length of the FaPGK4 transgenic plant was observed to be significantly longer than that of the wild type plant after 4d germination.

FIG. 7 shows that the fresh weight of transgenic Arabidopsis plants, germinated 4d transgenic lines 4, 7 and 9, was significantly higher than that of the control group.

FIG. 8 is a graph comparing seed sizes of transgenic Arabidopsis lines with wild type plants, comparing T3 generation seeds of transgenic plants with wild type plant seeds, and finding that the length and width of FaPGK4 over-expressed lines are significantly increased compared with wild type seeds.

FIG. 9 is a thousand kernel weight determination plot of transgenic Arabidopsis lines versus wild type seeds, with 3 overexpressing lines of the FaPGK4 gene each having a 1-fold increase in seed weight over wild type.

Example 4

Acquisition of transformed phosphoglycerate kinase gene FaPGK4 tobacco and influence of transformed phosphoglycerate kinase gene FaPGK4 tobacco on tobacco plants

The host cells containing the pCAMBIA1302-FaPGK4-GFP recombinant vector of example 2 were selected and leaf disks were used to transform tobacco leaves. The specific method comprises the following steps:

1. acquisition of sterile explants

Selecting tobacco (NC 89) seeds with full grains, soaking in 75% alcohol for 10min under aseptic condition, soaking in 95% alcohol for 2min, sucking out the seeds in the solution with a gun head, drying in a super clean bench, and growing on MS culture medium. Wen Chunhua 2d down, and transferred to a light incubator.

2. Agrobacterium-mediated transformation of tobacco

(1) Colony collection was performed as in example 3, and resuspended in a padding solution (1/2MS+5% sucrose+120. Mu.M acetosyringone);

(2) Cutting leaf of sterile tobacco, removing leaf edge and vein, and cutting into 0.5cm pieces ² Placing the leaf disc in the soaking solution of the step (1), shaking the leaf disc for 10min at 90rpm on a horizontal shaking table, sucking the leaf disc with sterile filter paper, placing the leaf disc on a co-culture medium (MS culture medium +2.25 mg/L6-benzylaminoadenine +0.3mg/L naphthylacetic acid), and culturing the leaf disc in dark at 25 ℃ for 2d with the leaf back upward;

(3) The co-cultured tobacco leaves were removed, washed with sterile water until clear, approximately 4 times, with 400mg/L of Cefosporine water 3 times, and sterile filter paper was blotted to remove excess surface water, and the leaves were placed in screening medium (MS medium +2.25 mg/L6-benzylaminoadenine +0.3mg/L naphthylacetic acid +400mg/L Cefoci +400mg/L timentin +15mg/L hygromycin). 5-7 leaves per bottle are cultivated by illumination until differentiation and callus generation of resistant buds;

(4) Cutting off the differentiated plantlet of the callus, inserting about 4 leaves into a tobacco rooting medium (MS medium +400mg/L cephalosporin +15mg/L hygromycin) to allow the plantlet to root;

(5) After rooting, when the tobacco grows strongly, opening a bottle cap to prepare for hardening seedlings, covering a layer of preservative film on a bottle mouth, pricking a plurality of small holes on the preservative film by using toothpicks to prevent the seedlings from dying due to sudden water loss, slightly removing the resistant seedlings after 1d, washing off a culture medium on a root system in clear water, and transplanting the seedlings into sterile soil.

Data measurement: and respectively extracting the transgenic tobacco strain and wild total RNA, carrying out fluorescence real-time quantitative qPCR analysis after cDNA is reversely transcribed, and analyzing the expression level of the gene in the transgenic strain. Plant size observations were then made on the transgenic lines, and net photosynthetic rate, transpiration rate, and stomatal conductance of 3 lines of FaPGK4 transgenic tobacco and wild type tobacco plants were measured using an LI-6800 photosynthetic apparatus under light intensity 300 Lux.

Results:

FIG. 10 shows PCR positive identification of transgenic tobacco with FaPGK4 gene, and FIG. 11 shows transcription level analysis of transgenic tobacco with FaPGK4 gene.

FIG. 12 is a phenotype of transgenic tobacco plants grown under the same conditions for two months. Compared with wild tobacco, the 3 FaPGK4 transgenic lines have better growth vigor, larger leaves and sharper leaf shapes.

FIG. 13 is a photosynthetic index of transgenic tobacco leaves. Partial photosynthetic parameters of 3 lines of FaPGK4 transgenic tobacco and wild type tobacco were measured with an LI-6800 photosynthetic apparatus under illumination intensity of 300 Lux. Compared with wild type, the 3 strains of the FaPGK4 transgenic tobacco have the advantages that the net photosynthetic rate, the transpiration rate and the stomatal conductance are all in an increasing trend, and the result shows that the net photosynthetic rate of the tobacco can be improved through the over-expression of the FaPGK4 gene, the stomatal conductance is increased, the stomatal opening degree is increased, the amount of water passing through the leaf area of unit time unit is increased, and the transpiration rate is increased.

The above examples verify the growth changes of Arabidopsis and tobacco after the FaPGK4 gene is impregnated, and overexpression of the FaPGK4 gene in Arabidopsis increases plant biomass and seed size, and can increase biomass and net photosynthetic rate of tobacco. It should be understood that on the dip-dyeing approach, different plants are transformed with different transgenic methods, such as tobacco leaf disc methods, using leaves; arabidopsis thaliana is a dip-dyed inflorescence, a classical transformation method in 1996 is adopted, stems are used for some plants such as cotton, stems are used for citrus, and the like, and a person skilled in the art selects an existing dip-dyeing mode according to plant types and characteristics. In the result of the infection, different plants show different behavior, for example, tobacco does not involve seeds, so that the size of the seeds cannot be visually seen, but the person skilled in the art knows that this does not affect the conclusion of the invention.

The above embodiments are only for illustrating the technical scheme of the present invention, and are not limiting to the present invention; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Strawberry phosphoglycerate kinase geneFaPGK4Use of the strawberry phosphoglycerate kinase gene for increasing yield and/or increasing net photosynthetic rate of leaves of Arabidopsis or tobacco plantsFaPGK4The nucleotide sequence of (2) is shown as SEQ ID NO. 1.

2. A method of producing a strawberry phosphoglycerate kinase gene as claimed in claim 1FaPGK4The use of an expression vector of (a) for increasing yield and/or increasing net photosynthetic rate of leaves of an Arabidopsis or tobacco plant.

3. The use according to claim 2, wherein the expression vector is pCAMBIA1302-FaPGK4-GFP expression vector obtained by connecting PCR products obtained by PCR reaction with pCAMBIA1302-GFP vector using "red" strawberry cDNA as a template.

4. A method of producing a strawberry phosphoglycerate kinase gene as claimed in claim 1FaPGK4Or a host cell comprising the pCAMBIA1302-FaPGK4-GFP expression vector of claim 3 for use in increasing yield and/or increasing net photosynthetic rate of leaves of Arabidopsis thaliana or tobacco plants.

5. The use according to claim 4, wherein the host cell is agrobacterium tumefaciens GV3101.