CN114921583A

CN114921583A - QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application

Info

Publication number: CN114921583A
Application number: CN202210566066.1A
Authority: CN
Inventors: 李斯深; 靳雪梅; 陈敬川; 郭宝晋; 赵岩; 郭营; 安艳荣
Original assignee: Shandong Agricultural University
Current assignee: Shandong Agricultural University
Priority date: 2022-05-23
Filing date: 2022-05-23
Publication date: 2022-08-19

Abstract

The invention discloses a QTL for controlling the height of a wheat plant, a candidate gene TaDHL-7B thereof and application. The QTL is QPh-7B-1242, is positioned on a 7B chromosome, has a genetic distance of 1234.5-1252.5 cM, and is TaDHL-7B as a candidate gene, and the nucleotide sequence of the candidate gene is shown in SEQ ID No. 1. The candidate gene TaDHL-7B is subjected to gene editing, and experiments prove that the TaDHL-7B gene controls the plant height of wheat and is a constitutive expression and relatively conservative gene, which is beneficial to genetic improvement and molecular breeding of the plant height character of wheat, and can accelerate screening of dwarf wheat varieties or be used for regulating the plant height of wheat.

Description

QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application

Technical Field

The invention belongs to the technical field of wheat molecular genetic breeding, and particularly relates to a QTL for controlling the height of a wheat plant, a candidate gene TaDHL-7B thereof and application thereof.

Background

Wheat (Triticum aestivum L., 2n 6X 42, AABBDD) is one of the most important grain crops in the world, the major problem facing China all the time is to improve the total wheat yield, the population of China is large, the cultivated land area is limited, and the improvement of the yield per unit is a main way for realizing the improvement of the total wheat yield in China. Wheat yield trait QTL has been a hotspot in wheat genetic research, but the cloned genes are still few. The plant height is an important character influencing the yield, and the separation and identification of the wheat plant height gene have important significance for the genetic improvement of the wheat yield.

Currently, 25 plant height reducing genes (Rht) are named in wheat. The green revolution genes of Rht1(Rht-B1B), Rht2(Rht-D1B), Rht8 and Rht9 are widely applied in the world. To date, only a few plant height genes have been cloned. Rht1(Rht-B1B) and Rht2(Rht-D1B) were cloned as early as 1999; in recent years, Rht8(Traes CSU02G024900 or Traes CSU03G0022100), Rht24(Traes CS6A02G221900) and TaWUS-like (WUS CHEL-related homebox-like) were cloned.

The CRISPR/Cas9 genome editing technology can make full use of the existing genome information, quickly verify the preliminarily obtained candidate genes, accelerate the character improvement and further accelerate the breeding process. Through CRISPR/Cas9 gene editing verification of the plant height gene, a theoretical basis can be provided for genetic improvement of the plant height by using the gene.

Disclosure of Invention

The invention aims to provide a QTL for controlling the height of a wheat plant, a candidate gene TaDHL-7B thereof and application. The QTL and the candidate gene TaDHL-7B thereof are beneficial to the breeding of dwarf wheat varieties.

In order to realize the purpose, the invention adopts the technical scheme that:

the invention provides a QTL for controlling the height of a wheat plant, wherein the QTL is QPh-7B-1242, is positioned on a 7B chromosome, and has a genetic distance of 1234.5-1252.5 cM.

Further, the additive effect of the QTL is positive, which increases the plant height allele from the maternal variety tylon 18.

The invention also provides a candidate gene of the QTL for controlling the height of the wheat plant, wherein the candidate gene is TaDHL-7B, and the nucleotide sequence of the candidate gene is shown in SEQ ID No. 1.

The invention also provides a coding protein of the candidate gene, and the amino acid sequence of the coding protein is shown as SEQ ID No. 2.

The invention also provides application of the QTL or the candidate gene in genetic improvement of the wheat plant height trait.

Furthermore, in application, the plant height of wheat can be reduced by knocking out the candidate gene.

Furthermore, the mutant genotypes of the wheat strains obtained by knocking out the candidate genes are AAbbDD (-5bp) and AAbbDD (-1 bp).

Furthermore, the mutant genotype AAbbDD lacks 5bp at 285bp of the No.2 exon region of the candidate gene TaDHL-7B, and encodes an amino acid sequence shown as SEQ ID No. 3.

Furthermore, the mutant genotype AAbbDD lacks 1bp at 286bp of the No.2 exon region of the candidate gene TaDHL-7B, and encodes an amino acid sequence shown as SEQ ID No. 4.

The invention also provides application of the QTL or the candidate gene in identifying or screening wheat dwarf varieties or strains.

Furthermore, the candidate gene is used for detecting the allelic variation of the candidate gene in the wheat variety or strain, so that the process of identifying or screening the dwarf wheat variety or strain is accelerated.

Further, in the detection process, the amplification primers of the candidate genes are:

TaDHL-7B-F：CCTCTCTCGAATCATTCGCC；

TaDHL-7B-R：TGAAGAAGGAACCTAAATG。

compared with the prior art, the invention has the beneficial effects and advantages that:

1. according to the QTL analysis result, a plant height stable main effect QTL-QPh-7B-1242 is positioned on a 7B chromosome from common wheat; and screening a candidate gene TaDHL-7B in the peak interval, wherein the TaDHL-7B gene encodes an ATP-dependent DNA helicase. Colinearity analysis and expression level analysis showed that TaDHL-7B is a constitutively expressed and relatively conserved gene.

2. The invention utilizes CRISPR/Cas9 system to edit the B subgroup of TaDHL-7B gene, T ₂ Two homozygous mutant genotypes of AAbbDD (-5bp) and AAbbDD (-1bp) are obtained together, and the two mutant genotypes can cause frame shift mutation and lead a stop codon to appear in advance, thus leading the function of protein to be inactivated. Pool cultivation and pot cultivation experiments show that the height of the homozygous mutant is obviously reduced compared with that of a wild type plant, and the TaDHL-7B gene is proved to control the plant height. Therefore, the TaDHL-7B gene is beneficial to genetic improvement and molecular breeding of the wheat plant height character, and can accelerate the screening of dwarf wheat varieties or be used for regulating and controlling the wheat plant height.

Drawings

FIG. 1 shows the physical interval, QTL location and gene editing of TaDHL-7B; wherein, a: utilizing TL-RIL population and unigene genetic Map (UPG-Map) thereof to position to 1 plant height QTL-QPh-7B-1242, wherein the peak value interval comprises 1 candidate gene Traes CS7B02G 055300; b: and (3) carrying out gene editing on TaDHL-7B by using a CRISPR/Cas9 system, and proving that the TaDHL-7B controls the plant height.

FIG. 2 shows the DNA sequences of Tainong 18(TN18), Linmai No. 6 (LM6), Fielder and mutant genotypes AAbbDD (-5bp) and AAbbDD (-1 bp).

FIG. 3 shows the characteristics of TaDHL-7B; wherein, a: a phylogenetic tree of the TaDHL-7B gene; b: carrying out collinearity analysis; c: expression levels of the TaDHL-7B gene in different tissues and stages.

Detailed Description

The technical solutions of the present invention are further described in detail below with reference to the drawings and the detailed description, but the scope of the present invention is not limited to the scope described by the examples. In the following examples, unless otherwise specified, the experimental methods used were all conventional methods, and materials, reagents and the like used were all available from biological or chemical reagents companies.

The wheat varieties used in the invention are as follows: QTL positioning materials are winter wheat varieties (lines) 'Tainong 18' and 'Linmai No. 6' and recombinant inbred line populations (TL-RILs) thereof; the gene editing material is Fielder, and the material can be obtained from Shandong university of agriculture.

Example 1: determination of candidate gene of wheat plant height

QTL analysis is carried out on the plant height character of TL-RIL population (Tainong 18/Linmai No. 6) by adopting IcMapping 4.1, WinQTLCart 2.5 and MAPTTL 6.0 software.

QTL analysis of TL-RIL population discovers (Table 1) that 3 pieces of software simultaneously obtain stable QTL-QPh-7B-1242 of plant height; the QTL is not involved in yield-building traits. QPh-7B-1242 has positive additive effect, indicating that the effect of increasing plant height comes from the parent Tainong 18. The peak position of the QTL is between 1234.5 and 1252.5cM, and only one candidate gene Traes CS7B02G055300 is contained (figure 1 a). The gene encodes an ATP-dependent DNA helicase, which is named TaDHL-7B gene. There is a nonsynonymous substitution SNP (mutation from arginine of tylon 18 to tryptophan of Italian 6) at exon 1451bp of TaDHL-7B (ATG start). These results indicate that TaDHL-7B is a candidate gene for QPh-7B-1242.

Table 1: QTL analysis result of TL-RIL group plant height (QPh-7B-1242)

Note: f, field test; m, nutrient test CK, normal N, P and K; LN, low N; LP, low P; LK, low k.11, 2011; 14, 2014; 15, 2015; 2016.

Example 2: characterization of the TaDHL-7B Gene

1. The experimental method comprises the following steps:

carrying out PCR amplification by using a TaDHL-7B amplification primer:

PCR amplification System:

PCR amplification procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 56 ℃ for 30s, extension at 72 ℃ for 5min, and repeating for 30 cycles; extension for 10min at 72 ℃.

Using 3 ‰ H ₂ O ₂ And (3) flatly placing the embryo part of the field seed for germination on a 9cm culture medium with double layers of filter paper downwards, soaking the embryo part in clear water for 2-3 days to expose white and root, and transplanting the embryo part into a flowerpot. In the whole growth period, sampling is respectively carried out according to a tillering period (taking a main stem, tillers and a root), an elongation period (taking ears, leaves and stems), a flag picking period (taking ears, flag leaves, two inverted leaves and stems), a heading period (ears, flag leaves, two inverted leaves and stems), an flowering period (taking ears, flag leaves and stems) and a grain filling period (taking seeds, glumes, flag leaves and stems).

The total RNA extraction test of wheat was performed by referring to the method provided by Beijing Tiangen Biochemical technology Co., Ltd. The extracted RNA is used as a template, and the method is carried out according to a first strand synthesis method provided by Beijing Tiangen Biochemical technology Co. Template RNA, 10 XlnR RT Buffer, lnR RT Enzyme Mix, lnR-RT Primer Mix and RNase-Free ddH ₂ And (4) thawing the product on ice, wherein the reaction system is as follows:

the resulting cDNA was stored at-20 ℃ for further testing.

According to the Chinese spring Refseqv1.1 note, the homologous genes of TaDHL-7B are TaDHL-7A (TramesCS 7A02G151300) and TaDHL-7D (TramesCS 7D02G 153200).

Specific primers are designed by using Primer 5 aiming at the TaDHL and the coding region thereof, TaActin is used as an internal reference gene of the reaction, a qRT-PCR quantitative experiment is carried out by using cDNA which is subjected to reverse transcription in the last step as a template, and the expression difference of the TaDHL gene in different biological periods and different tissue parts is analyzed. The primers were designed as follows:

using the method of SYBR Green, 3 biological replicates were set for each Sample group, and the reaction system was as follows:

the reaction procedure is as follows: 30s at 95 ℃, 5s at 95 ℃ and 30s at 60 ℃ for 40 cycles.

2. The experimental results are as follows:

sequence analysis is carried out on the TaDHL-7B gene, the gene has the full length of 6125bp (SEQ ID No.1), comprises 6 exon parts and 5 intron regions, has the coding sequence of 1593bp (shown in figure 2), and codes 530 amino acids (shown in SEQ ID No. 2).

To study the evolutionary relationships of the TaDHL proteins of different species, we constructed phylogenetic trees of the TaDHL proteins of different species. The results indicated that TaDHL-7B (TramesCS 7B02G055300), TaDHL-7A (TramesCS 7A02G151300) and TaDHL-7D (TramesCS 7D02G153200) were in different branches. The TaDHL-7B protein has close relationship with TRITD7Bv1G021310 of Triticum turgidum and TRIDC7BG008090 protein of Triticum dicoccuides; TaDHL-7A has close relationship with TRITD7Av1G047410 of Triticum turgidum; whereas TaDHL-7D is closely related to AET7Gv2038300 of Aegliops tauschii (FIG. 3 a).

To explore the collinearity relationship between sibling species, we performed collinearity analysis and found that the TaDHL-7B region is conserved between genomes A, B, D and E, while in genome R, the reverse order occurs (FIG. 3B).

The expression levels in different tissues and stages showed that TaDHL-7B is a constitutive gene and is expressed in higher amounts in the shoots at the flag stage and heading stage (FIG. 3 c). Indicating that TaDHL-7B is a constitutively expressed and relatively conserved gene.

Example 3: function verification of TaDHL-7B gene by using CRISPR/Cas9 system

As shown in fig. 1B, gene editing was performed on subgroup B of the TaDHL genes (TaDHL-7B) using CRISPR/Cas9 system, as follows:

(1) design of sgrnas

And carrying out targeted site-specific editing on the protein by using a CRISPR (clustered regularly interspaced short palindromic repeats) technology. The sequence of Chinese spring and Fielder obtained by Ensembl Blast database is used as a reference genome, and the sgRNA sequence of a candidate gene is designed by using an sgRNA online website CRISPR-P (http:// CRISPR. hzau. edu. cn/cgi-bin/CRISPR/CRISPR):

TraesCS7B02G055300-sgRNA：CCGATGCAGGGCAGTCATCTACG

(2) CRISPR editing vector construction

The plasmid extraction method was carried out in accordance with the instructions of the SteadyPure plasmid extraction kit provided by Ikeri bioengineering, Ltd.

Designing an amplification primer according to the characteristics of the sgRNA, the intermediate vector and the large vector as follows:

the PCR amplification system and reaction procedure were as follows:

PCR reaction procedure: pre-denaturation at 98 ℃ for 2 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s, and extension at 68 ℃ for 5s for 35 cycles; extension at 68 ℃ for 5 min.

The product was recovered on agarose gel. Bsa I enzyme is used for digesting the large vector 1246 overnight, and BSA enzyme and T4 ligase are used for cutting edges of the small vectors 3561 and 3571 and the large vector. After the ligation product is transformed into escherichia coli, the escherichia coli is coated on a kanamycin-resistant plate for culture, and a specific primer is used for detecting and screening recombinant plasmids. The agrobacterium transformation and positive seedling screening experiments are finished by a transgenic center of a Li Gen-English team of Shandong province agricultural science research institute.

T ₁ Obtaining 28 positive seedlings in the generation and harvesting according to a single spike. T is ₂ The plants are planted in a greenhouse of Shandong agriculture university in 2021 month and 8 months, and the greenhouse comprises pond planting and pot planting. At the jointing stage of wheat, for T ₂ Sampling young and tender leaves at the lower part of each individual plant, and extracting DNA by adopting a high-efficiency plant genome DNA extraction kit of Tiangen Biochemical technology (Beijing) Co., Ltd according to an instruction. Designing a specific sequence for each group of sgRNA sequences to carry out PCR amplification, wherein the primer sequences are as follows (the lower case letters are joint sequences):

the reaction system is as follows:

the PCR procedure was as follows: pre-denaturation at 94 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 68 ℃ for 30s, extension at 72 ℃ for 30s, and repeating for 30 cycles; extension at 72 ℃ for 10 min.

And sending the PCR product to a sequencing group of rice of Chinese academy of agricultural sciences for Hi-TOM sequencing to obtain a mutation site. The height of the main stem of Fielder and transgenic plants was measured before harvest. And the significance comparison of the phenotype data between the Fielder and the transgenic lines adopts a t test method.

T ₂ Two homozygous mutant genotypes of AAbbDD (-5bp) and AAbbDD (-1bp) are obtained together in generations. AAbbDD (-5bp) lacks 5bp (ATG starting point) at 285bp of the No.2 exon region of TaDHL-7B; AAbbDD (-1bp) deleted 1bp at 286bp in exon 2 region (FIG. 1b and FIG. 3). AAbbDD (-5bp) encodes 102 amino acids (shown in SEQ ID No. 3), and AAbbDD (-1bp) encodes 122 amino acids (shown in SEQ ID No. 4). Both mutant genotypes lead to frame shift mutations and the premature appearance of stop codons, rendering their protein function inactive.

Will T ₂ Generations of wild type and knockout mutants were separately subjected to pool and pot experiments (FIGS. 1b and 1 d)Table 2). In a pond culture test, obtaining 16 homozygous mutant AAbbDD (-5 bp); the plant heights of the wild type and the AAbbDD (-5bp) are 106.6 cm and 98.6cm respectively, and the difference between the wild type and the AAbbDD is obvious; the plant height of AAbbDD (-5bp) is reduced by 8.0cm compared with the wild type. In the pot experiment, homozygous mutants of 9 and 7 plants AAbbDD (-5bp) and AAbbDD (-1bp) were obtained, respectively. The plant heights of the wild type, AAbbDD (-5bp) and AAbbDD (-1bp) are 75.7 cm, 66.8 cm and 67.8cm respectively, and the difference is obvious. Compared with the wild type, the plant heights of AAbbDD (-5bp) and AAbbDD (-1bp) are respectively reduced by 8.9 cm and 7.9 cm. The results show that the TaDHL-7B gene controls the plant height of wheat.

Table 2: wild type and mutant T for pond and pot culture ₂ Plant height

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> Shandong university of agriculture

<120> QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application

<141> 2022-05-23

<160> 25

<170> SIPOSequenceListing 1.0

<210> 1

<211> 6125

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cagccgaagc tccccccctc cctctctctc cccgtcttcc tcattcgcgc cgcccctctc 60

tcgaatcatt cgccgcgccg ccggccgccg atccgatccg agccgacccg ccccgcgcgc 120

cgccgtggca gggccggggt tccgccgatc gacccccatg gtgcagctcc cggccatggg 180

gaagcgccag cacccggagg cggccgagcc gcccatggcg ccggccgccg ccgtgaagat 240

ggaagcggac gagctccggg actatgagca cggcccgctc ggcaagcgcg cccggccggc 300

ccagccctcg ccgcccccgc ccccgcacca ggtagatccg cgctcgccgt gttcatggcc 360

ttccgtttcg tgcttccgtt cgcggccgtg ctggattcgg cgctggggta gctcgtgttc 420

ggcgtcgagc cggagggctt tcatgcgagc tcctgccgtt tttcagtttc cgttgggagc 480

tgggcgggtc ctttcgcgtg gcgttacgcg tttgattttg accgtggctg ttgattcagc 540

aattgaggtg gctccagtgg ggattggtct gcgtggactg attgagtggt gcggattgca 600

gtggctgagc tgctgttatt agatacatag ttcccttttc gtgagagcaa tgggcatttt 660

cacgttagca ttcactctca aaccattggg attgagggat ttaagttaga tcctgttgat 720

gaccctctgg tttgatggag tcacagtctg cttgtgtggt tggcgctgat tgaagggctg 780

gacgtgtacc tccatgggat gctatgtaga ggctggtatt actgtgtgac tgggaaatgc 840

tcaaggttta catttcatac gtttgccgtt tgctgtggat ggctgacgtc ttgagtcaac 900

ctcgtgtggt tagtttattt gctttgcttt tttggatgtt ccaagggtgg ggaaactgct 960

tggttcctta ggagattggg gaaatgtttc agagacaatt acaaatgtaa ttagggaaag 1020

aggtgatacc tgtcgcccca ttggaacttt ggaagtggat gatgcagttg ctggtcaatt 1080

atctggttaa catgcaaggt gctaagcgaa atccttcata gagtttcatg gggatacaat 1140

aggagttgct actgttcatg gtagatgatg tcagtgtgta agtagagaaa aaaaatgtgt 1200

attgatatga gccaaaataa atggatcaat atttgttctc tcaaaattta ccggggtgca 1260

ttcttgtttg ttattactat agctcttttg aggtgtttgt gatatctagt ctccgtaatt 1320

tactgtttaa agtttgtcaa taaagtatga ttagttagta gtatttctta tgatcgacag 1380

atttgggatt catattttgt atgcatacat gaattgcagg acatgtatca caatgtactt 1440

gatgaaccta gcccattggg tcttcggctg aaaaaaagtc catctctgtt ggatctcatt 1500

cagatgaggc tttctcaagc aaattccgat gcagggcagt catctacgga caatgctgag 1560

ccttccaaga agaaagacct taaatctggt acatcatcag ctggtgaacg gttgaaagca 1620

tcaaactttc ctgcaagtgt attgaaaata ggcaaatggg aggtaaggaa atctatgtta 1680

gctgaaatat actatttatg acaattctgc cagattctgt gttttagtac tttggtgtct 1740

tttgtttggc cttctttagg cttgatgctg gcgatgcttt attgaggtac agttggtatg 1800

tgaaacactt atggtcttgt aaattgttgc ttgaaaataa gaaggtggct cagtgccaac 1860

cttatatttc aaaacaggct aaagcctgat gagaggaagt cagttacacg tagcttgcaa 1920

agtgcaccca ggtgcaagat cacaagcggc ctttaggaag aagaaaagag cgaggagaag 1980

aggaggatgt tacatctggc ttagacaaag attagctatc aaatttttgg ctccagacct 2040

gtagatcact cctatcctgt tgctttgtag ctctgtaact ccaaagacta atcatgtcag 2100

ccacatagtg tctagtgtat gactccgtcc aaatcttgga attgaaaact ctgtcattcc 2160

tcgcatgcca gagtgtgatg gcgcaggcag caaaagcaac attccgtttg cgcttgaaag 2220

cgagttgatg aacagcttgc tcaacaaagg ctaagatgtc aggggatagg cgtgccaaag 2280

ggtccagcat cagcttgttc cataaggcag aagctgcatg acagcgtagc accaggtgat 2340

cgatggattt gacagcaggg caagcatcac aatgggcaaa aggagcgacc gcagaccaac 2400

atttcttaac catgttgtcc ttagtgttga gacgccccct gaaagccagc caaaggaagg 2460

ccttgtgctt gagggggatc aaagaatccc aggtccaact ttcaaaactg cacctaatcc 2520

cacagaaggt gagcagccgg tagaagtagc tggtgcttag ctgattacaa gccacagaag 2580

gtgtgcgggc atccttctgc gagctgctgg gaaccactgc tgcagggagc tgattcaggg 2640

ccatcagttc ctgtgtagca gcttgagata ggttacctcc caagccccct gggagaaccg 2700

agattgaaca gaacaatggg ggtttgtagc aaaagaatac agaactggaa gcacctgcca 2760

cagcctgcca gcctccaacc acaaaattgt tgcagtgacg attctactta tctataaaac 2820

tttaagctaa tacacgtaga attgaaatgt tggttcttgt ttgtagtgtc gagtcttagt 2880

ggagcgtcga tgtattcctg tccaatttgc tagtattttt gctcgagcag gcagtcagtt 2940

gcccaaaatt cagtatctgt atgttgatga ttcctgcagt acatattaac tagtgttcag 3000

ttgcatacat aacagcctgt ctggacaatc tttggcctta actgtcttaa tttgattcta 3060

tctctgagca gtacacatcc aaatatgaag gtgatttggt ggcaaaatgt tacttcgcga 3120

agcataaact tgtatgggaa gttctggaag gtggtctcaa gagtaaaata gaaattcagt 3180

ggtcagatat aactgctttg aaggtaactt tgcctgaaat tggagatgga tccttggatg 3240

tgatggtaag tttatccaga ggatgcatat gcttattatt cttatttttt tattgttctc 3300

ttattatttt agtacctcgt tttctgagga gttcccattt ttttatgctt atacagctgg 3360

cccgaccacc tctctttttc aaagagacgg atcctcaacc aagaaagcat acattgtggc 3420

aggctacttc agatttcact tgtggccaag caagtataaa caggtaaaat gattattcac 3480

tgtttgcact acatactgag agtgaagcct catatgcaaa gtgttctttg gggggggggg 3540

gggggggggg gggggacggg ggatgaaatc tgcatgttac agtatcgtag tgatcattac 3600

ttattagtct tgacttcaat ccacattttt ggaagccttg ttgcatctgc aggacatgct 3660

ttatgcttac caggactgga cttttgtagc agatgacctg atatttattc aaggccacct 3720

ctgtagttcc gtatttatca ttagaggaac agaaggaact gttcagtttc tttttagatc 3780

tctgaaaggt tgatagaatc tgtttaatag cctgcagcta catagctgta aaaccaacgc 3840

ggatgtcatg atagctcttt aaatatcagc cagctagata accacagcac ttgggtttat 3900

gagcaaattg ccaatacgtt ggtacggata atcacatgac acatcacatc gagttgttgt 3960

catgggcttg gcttgcttca tgcccttggc tcgactgtca cgcttggctg agatgcactg 4020

gttgctgtcc tgtctccgtt gtcatcggtc ttggcctgct ctgtgccctt gtctccactg 4080

tcgtgctggg ctgagctgcg caccggtcgg tgtcatgcct ctgttgtcat gctcaggctt 4140

caccatgccc tgtgctctgc cgttatgtag atcatgcttt tcttgtgacg tgggtcatga 4200

aagatttgtg aggaagttgg ctaagttaat tcgttagtag attagttgtg tttaagttga 4260

tttgtttgtt tgttgggagg tgttttttcc tactgtgttt attaaagtag tttatattca 4320

tgaaggattt gtgaggaagt tggttaagtt tattcgttag tagattagtt gtgtttaagt 4380

tgatttgttt gtttgttggg aggtattttt cctactgtat ttattaaagt agtttattca 4440

tcgatgtgga acaggggtgg gaggggtgaa tggattgctg ccaccaactt attttgtaga 4500

aataaagata accaaagtac tatctattat aactaatgta ctttcttagc tcctagtctt 4560

ttgatgcctt catctaatac cgtgactctt ccaaaaattt caggcatcat ttcttgaagt 4620

gccctacaac ctcgttaggc aagaattttg aaaagcttgt ccagtgtgat cagaggctac 4680

atcagttgag tcaacaaaca gacgtcatct tggactcttc agtttttgaa cccagatgct 4740

ctatatttga ggatccggtg gaactgaagt gccatgactt tgctaattta aaagatgaac 4800

gtgaagatct gcctgggttt tcagggtctg tgtcaccatg tgctggttca tctatgtcta 4860

ctaagaatga cacaaacgat ttttttggga agcaaccaga atttgtcgct cagccaatga 4920

acccaggtac gtgaaagcta atgacgcccc tcctgcaccg cctaatgtta cattgatgta 4980

cttcttgcag aagaagcatc aataacttaa atatatgtgg gcaatcatgt gcatagtctt 5040

aaaatttcca tgattagcac gtgctttagt tattgttgat caatgcattt caacctcttc 5100

ccgatttagt tgaagtataa caagggagat atgctaactt gtacacgttt gcaacttctg 5160

ttgttgctca ctggatcact tgacagtgcc tttcacatga aacatcaacc tgaatctttc 5220

taatcctttt tgtgttcaat ttgccagggg ctagtgctgt aaatgcacaa ccagtcagca 5280

gaaacgtaaa tggtgtagct caagaattca atatcccgaa ctggtggagt cagctgaaag 5340

tgcccgggct tagaccatca atgtcagtgg atgatttggt cagccaccta ggaaattgca 5400

tcagcgagca gatcacctca ggcaatcctt cgatggccaa caatgaggtg cctacaaaag 5460

aatcgctaga ggagattgcg cagtaccttc ttggtgatgt acagggccca caggcgccgg 5520

cctccgatga gcgactgatg gcacgggtgg actcactttg ctgcctgctt cagaaagaca 5580

cagcgccgac atcccagccg aagcctgagc cgaacaacag tgacagcatt ggtggggtgg 5640

actccgaagg atcagacgat gaattcagct cagcatcaac gaggaaaact gcagatgcta 5700

accagccgcc accagctatg tcccgaaagg actcgtttgg agacctgctg atgaacctgc 5760

cccgcatcgc ctcgataccg cagttcctgt tcaagatacc agaggattcc gagaactgaa 5820

gctggacccc agatgaagca agtccctgta aaaattgtac ctgagcaata agtaagcccc 5880

cctcgcttgt tccgattcag caagccgatt ccccgccctg taaatgtgac ccatttaggt 5940

tccttcttca gctgtgtgat gattcggatg ggtagtcgaa gattgttcct tggttctttt 6000

aactcagact tgtgatttcg ttgtgcaaga tcaagtgcca aattgtttat aataatgttg 6060

tgaaaagtgt ccgcaatgca accgcattgg tttccagtaa tgatatgaga tcaaagtttg 6120

ttatg 6125

<210> 2

<211> 530

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Val Gln Leu Pro Ala Met Gly Lys Arg Gln His Pro Glu Ala Ala

1 5 10 15

Glu Pro Pro Met Ala Pro Ala Ala Ala Val Lys Met Glu Ala Asp Glu

20 25 30

Leu Arg Asp Tyr Glu His Gly Pro Leu Gly Lys Arg Ala Arg Pro Ala

35 40 45

Gln Pro Ser Pro Pro Pro Pro Pro His Gln Asp Met Tyr His Asn Val

50 55 60

Leu Asp Glu Pro Ser Pro Leu Gly Leu Arg Leu Lys Lys Ser Pro Ser

65 70 75 80

Leu Leu Asp Leu Ile Gln Met Arg Leu Ser Gln Ala Asn Ser Asp Ala

85 90 95

Gly Gln Ser Ser Thr Asp Asn Ala Glu Pro Ser Lys Lys Lys Asp Leu

100 105 110

Lys Ser Gly Thr Ser Ser Ala Gly Glu Arg Leu Lys Ala Ser Asn Phe

115 120 125

Pro Ala Ser Val Leu Lys Ile Gly Lys Trp Glu Tyr Thr Ser Lys Tyr

130 135 140

Glu Gly Asp Leu Val Ala Lys Cys Tyr Phe Ala Lys His Lys Leu Val

145 150 155 160

Trp Glu Val Leu Glu Gly Gly Leu Lys Ser Lys Ile Glu Ile Gln Trp

165 170 175

Ser Asp Ile Thr Ala Leu Lys Val Thr Leu Pro Glu Ile Gly Asp Gly

180 185 190

Ser Leu Asp Val Met Leu Ala Arg Pro Pro Leu Phe Phe Lys Glu Thr

195 200 205

Asp Pro Gln Pro Arg Lys His Thr Leu Trp Gln Ala Thr Ser Asp Phe

210 215 220

Thr Cys Gly Gln Ala Ser Ile Asn Arg His His Phe Leu Lys Cys Pro

225 230 235 240

Thr Thr Ser Leu Gly Lys Asn Phe Glu Lys Leu Val Gln Cys Asp Gln

245 250 255

Arg Leu His Gln Leu Ser Gln Gln Thr Asp Val Ile Leu Asp Ser Ser

260 265 270

Val Phe Glu Pro Arg Cys Ser Ile Phe Glu Asp Pro Val Glu Leu Lys

275 280 285

Cys His Asp Phe Ala Asn Leu Lys Asp Glu Arg Glu Asp Leu Pro Gly

290 295 300

Phe Ser Gly Ser Val Ser Pro Cys Ala Gly Ser Ser Met Ser Thr Lys

305 310 315 320

Asn Asp Thr Asn Asp Phe Phe Gly Lys Gln Pro Glu Phe Val Ala Gln

325 330 335

Pro Met Asn Pro Gly Ala Ser Ala Val Asn Ala Gln Pro Val Ser Arg

340 345 350

Asn Val Asn Gly Val Ala Gln Glu Phe Asn Ile Pro Asn Trp Trp Ser

355 360 365

Gln Leu Lys Val Pro Gly Leu Arg Pro Ser Met Ser Val Asp Asp Leu

370 375 380

Val Ser His Leu Gly Asn Cys Ile Ser Glu Gln Ile Thr Ser Gly Asn

385 390 395 400

Pro Ser Met Ala Asn Asn Glu Val Pro Thr Lys Glu Ser Leu Glu Glu

405 410 415

Ile Ala Gln Tyr Leu Leu Gly Asp Val Gln Gly Pro Gln Ala Pro Ala

420 425 430

Ser Asp Glu Arg Leu Met Ala Arg Val Asp Ser Leu Cys Cys Leu Leu

435 440 445

Gln Lys Asp Thr Ala Pro Thr Ser Gln Pro Lys Pro Glu Pro Asn Asn

450 455 460

Ser Asp Ser Ile Gly Gly Val Asp Ser Glu Gly Ser Asp Asp Glu Phe

465 470 475 480

Ser Ser Ala Ser Thr Arg Lys Thr Ala Asp Ala Asn Gln Pro Pro Pro

485 490 495

Ala Met Ser Arg Lys Asp Ser Phe Gly Asp Leu Leu Met Asn Leu Pro

500 505 510

Arg Ile Ala Ser Ile Pro Gln Phe Leu Phe Lys Ile Pro Glu Asp Ser

515 520 525

Glu Asn

530

<210> 3

<211> 102

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 3

Met Val Gln Leu Pro Ala Met Gly Lys Arg Gln His Pro Glu Ala Ala

1 5 10 15

Glu Pro Pro Met Ala Pro Ala Ala Ala Val Lys Met Glu Ala Asp Glu

20 25 30

Leu Arg Asp Tyr Glu His Gly Pro Leu Gly Lys Arg Ala Arg Pro Ala

35 40 45

Gln Pro Ser Pro Pro Pro Pro Pro His Gln Asp Met Tyr His Asn Val

50 55 60

Leu Asp Glu Pro Ser Pro Leu Gly Leu Arg Leu Lys Lys Ser Pro Ser

65 70 75 80

Leu Leu Asp Leu Ile Gln Met Arg Leu Ser Gln Ala Asn Ser Asp Ala

85 90 95

Val Ile Tyr Gly Gln Cys

100

<210> 4

<211> 122

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 4

Met Val Gln Leu Pro Ala Met Gly Lys Arg Gln His Pro Glu Ala Ala

1 5 10 15

Glu Pro Pro Met Ala Pro Ala Ala Ala Val Lys Met Glu Ala Asp Glu

20 25 30

Leu Arg Asp Tyr Glu His Gly Pro Leu Gly Lys Arg Ala Arg Pro Ala

35 40 45

Gln Pro Ser Pro Pro Pro Pro Pro His Gln Asp Met Tyr His Asn Val

50 55 60

Leu Asp Glu Pro Ser Pro Leu Gly Leu Arg Leu Lys Lys Ser Pro Ser

65 70 75 80

Leu Leu Asp Leu Ile Gln Met Arg Leu Ser Gln Ala Asn Ser Asp Glu

85 90 95

Gly Ser His Leu Arg Thr Met Leu Ser Leu Pro Arg Arg Lys Thr Leu

100 105 110

Asn Leu Val His His Gln Leu Val Asn Gly

115 120

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctctctcga atcattcgcc 20

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgaagaagga acctaaatg 19

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgctgagcc ttccaaga 18

<210> 8

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cttccagaac ttcccataca ag 22

<210> 9

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgtgctggtt catctatgtc tact 24

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

cgtttctgct gactggttgt g 21

<210> 11

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgctgagcct tccaagaa 18

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ggcaaagtta ccttcaaagc 20

<210> 13

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ccagcaatgt atgtcgcaat c 21

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

agcatgagga agcgtgtatc 20

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

ccgatgcagg gcagtcatct acg 23

<210> 16

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

gaagcggtct ccggcgaacg ttaccagaat gctacggttt cagagctatg ctggaaacag 60

c 61

<210> 17

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gggttggtct caggaatgtg agagagtctg tgtgcagcgc gtg 43

<210> 18

<211> 50

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

gaagcggtct ccttcctgct gctgcgtttc agagctatgc tggaaacagc 50

<210> 19

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

gggttggtct caaaaccgta gcgagtttct ttccctcaag tctgatgcag caagcgag 58

<210> 20

<211> 61

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

gaagcggtct ccggcgcaga ggttaccgat cccagggttt cagagctatg ctggaaacag 60

c 61

<210> 21

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

gggttggtct cacatcatct gcgaagagtc tgtgtgcagc gcgtg 45

<210> 22

<211> 48

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

gaagcggtct ccgatggagg ccggtttcag agctatgctg gaaacagc 48

<210> 23

<211> 58

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

gggttggtct caaaacattc cgcactctgc taggagcaag tctgatgcag caagcgag 58

<210> 24

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ggagtgagta cggtgtgcta gcccattggg tcttcg 36

<210> 25

<211> 35

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

agttggatgc tggatggctt acctcccatt tgcct 35

Claims

1. The QTL for controlling the height of the wheat plant is characterized in that the QTL is QPh-7B-1242, is positioned on a 7B chromosome and has a genetic distance of 1234.5-1252.5 cM.

2. The QTL for controlling wheat plant height according to claim 1, wherein the additive effect of the QTL is positive, increasing the plant height allele from the female parent variety tainong 18.

3. The candidate gene of QTL for controlling the height of wheat plants as claimed in claim 1, characterized in that the candidate gene is TaDHL-7B, and the nucleotide sequence of the candidate gene is shown in SEQ ID No. 1.

4. The candidate gene encoding protein of claim 3, wherein the amino acid sequence of the encoded protein is represented by SEQ ID No. 2.

5. Use of the QTL of claim 1 or the candidate gene of claim 3 for genetic improvement of a wheat plant height trait.

6. The use according to claim 5, wherein the plant height of wheat can be reduced by knocking out the candidate gene when used.

7. Use of the QTL of claim 1 or the candidate gene of claim 3 for identifying or screening wheat dwarf varieties or lines.

8. The use of claim 7, wherein the candidate gene is used to detect allelic variation of the candidate gene in a wheat variety or line, thereby accelerating the process of identifying or screening dwarf wheat varieties or lines.

9. The use of claim 8, wherein the candidate gene amplification primers during the detection are:

TaDHL-7B-F：CCTCTCTCGAATCATTCGCC；

TaDHL-7B-R：TGAAGAAGGAACCTAAATG。