CN112126633B - Tomato cyclin dependent kinase SlCDK8 gene and application thereof - Google Patents
Tomato cyclin dependent kinase SlCDK8 gene and application thereof Download PDFInfo
- Publication number
- CN112126633B CN112126633B CN202011038566.5A CN202011038566A CN112126633B CN 112126633 B CN112126633 B CN 112126633B CN 202011038566 A CN202011038566 A CN 202011038566A CN 112126633 B CN112126633 B CN 112126633B
- Authority
- CN
- China
- Prior art keywords
- slcdk8
- tomato
- gene
- leu
- dependent kinase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/827—Flower development or morphology, e.g. flowering promoting factor [FPF]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/11—Protein-serine/threonine kinases (2.7.11)
- C12Y207/11022—Cyclin-dependent kinase (2.7.11.22)
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Physiology (AREA)
- Virology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a mediator member-tomato cyclin dependent kinase SlCDK8 gene and application thereof, the invention obtains a tomato cyclin dependent kinase SlCDK8 gene from tomatoes for the first time, and the function verification is carried out on the knockout of SlCDK8 in tomato MT (micro-Tom) by utilizing an agrobacterium-mediated method, so that the deletion of the SlCDK8 gene can simultaneously induce the abnormal development of all organs of the whole tomato, and the symptoms of plant height reduction, male sterility, floral organ abnormality and the like are presented, thus the key role played by the SlCDK8 in the plant development process is reflected.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a cyclin dependent kinase SlCDK8 gene of tomato and application thereof.
Background
One of the most complicated links in the breeding process is artificial emasculation, and the step of artificial emasculation can be omitted by utilizing male sterility, so that the seed production process is simplified, the seed cost is reduced, and the seed purity can be improved. With the continuous development of genetic engineering technology, a male sterility mutant can be created by the genetic engineering technology, and tomato pollen abortion related genes can be accurately edited, so that the development process of tomato male sterility in China is accelerated.
Tomatoes (Solanumlycopersicum) are very important fruit crops and model crops all over the world and are increasingly valued by researchers and breeders. With the genome sequencing of tomatoes in 2012, the related research on large databases such as tomato flavor, metabolome, mutagen and transcriptome is rapidly developed in recent years. Mediator complexes are an important component of eukaryotic transcription machinery. As an important link between transcription factors and RNA polymerase II, mediators transduce different signals into various genes in different pathways, thereby regulating various reactions. Plant mediators influence plant growth, development, defense, flowering, genomic stability and metabolic homeostasis to varying degrees. The tomato cyclin-dependent kinase SlCDK8 is an important member of the cyclin-dependent kinase module in the mediator. CDK8 was originally discovered in plants from alfalfa and later was found to be associated with floral organogenesis in Arabidopsis, and was therefore designated HUA ENHANCER 3. Current studies indicate that CDK8 plays a role in the proliferation of leaf cells, the formation of floral tissue in plants. No further reports have been made in the prior art on whether CDK8 has other applications in plants, and particularly, no further studies on the mechanisms related to the regulation of tomato anther and pollen development are reported. Therefore, the research on the pollen sterility mechanism from the aspect of gene has important significance on the development process of tomato male sterility and the research on the related mechanism of tomato anther and pollen development regulation.
Disclosure of Invention
The invention aims to provide a gene of a tomato cyclin dependent kinase SlCDK8 and application thereof.
In order to achieve the purpose, the invention adopts the following technical scheme:
the nucleotide sequence of the gene of the tomato cyclin dependent kinase SlCDK8 is shown as SEQ ID No. 1.
The protein encoded by the above-mentioned gene for the tomato cyclin dependent kinase SlCDK8 is selected from,
(1) the amino acid sequence is shown as SEQ ID NO:2 is shown in the specification;
(2) converting SEQ ID NO:2 a protein derived from (1) having the protein function of (1) and formed by substitution, deletion or addition of one or more ((e.g., 1 to 30; preferably 1 to 20; more preferably 1 to 10; e.g., 5, 3)) amino acid residues; or
(3) A protein derived from (1) having homology of 80% ((preferably 90% or more, such as 95%, 98%, 99% or more)) or more with the protein sequence defined in (1) and having the protein function of (1).
That is, the functions of the gene protected by the present invention include not only the above-mentioned gene of the tomato cyclin-dependent kinase SlCDK8, but also the nucleotide sequence corresponding to SEQ ID NO: 1 (e.g., homology higher than 40%, preferably higher than 50%, preferably higher than 60%, more preferably higher than 70%, more preferably higher than 80%, more preferably higher than 90%, more preferably higher than 95%, more preferably higher than 98%).
Wherein, SEQ ID NO.1 in the sequence consists of 1404 bases, the 1st base from the 5' end is a transcription initiation site, the 1402-1404 th base is a stop codon, the coding frame is 1401 bases, and 467 amino acids are coded in total.
And expression vectors, recombinant vectors or transgenic cell lines containing the genes and a method for obtaining host cells containing the vectors also fall into the protection scope of the invention.
The main purpose of the invention is to clone and identify the tomato cyclin-dependent kinase SlCDK8 on a molecular level, thereby providing a theoretical basis for the research of analyzing the mechanism related to the tomato anther and pollen development regulation.
The invention also discloses an application of inhibiting the expression of the cyclin dependent kinase SlCDK8 gene in the following aspects:
(1) dwarfing the plant;
(2) causing the plant to develop a male sterile phenotype;
the application obtains the dwarfing and male sterile plants by knocking out the genes.
Wherein the dwarfing phenotype comprises height reduction of average plant height, lobular phenotype comprises reduction of length and width of leaves, and the male sterility phenotype comprises reduction of pollen viability and pollen malformation.
As an embodiment of the present invention, the polynucleotide is cloned into a CRISRP vector by a conventional method, and the recombinant vector with the foreign gene is introduced into a plant cell capable of expressing the SlCDK8 protein, so that the SlCDK8 protein is deleted in the plant cell. Mutant plants deficient in the SlCDK8 gene can be obtained by regenerating the plant cells into plants. And transferring the recombinant plasmid into a plant by utilizing an agrobacterium transformation method.
In the present invention, there is no particular limitation on the plant suitable for use in the present invention, as long as it is suitable for carrying out a gene transformation operation, such as various crops, flowering plants, or forestry plants. The plant may be, for example (without limitation): dicotyledonous, monocotyledonous, or gymnosperm.
As a preferred mode, the "plant" includes but is not limited to: tomato of Solanaceae is suitable for use as the tomato gene or a gene homologous thereto. Especially suitable for plants needing dwarfing, such as apple trees and cherry trees in Rosaceae; the method is also particularly suitable for plants needing to form a male sterile phenotype, such as cultivating a few-seed tomato variety, a seedless pomegranate and the like, and improving the taste; dwarfing plants and male sterile plants can be obtained by knocking out the gene SLCDK 8.
The invention has the following advantages:
(1) the invention screens out the lycopene-dependent kinase for the first time, and obtains the SlCDK8 by cloning.
(2) The inventor utilizes an agrobacterium-mediated method to knock out SlCDK8 from tomato MT for functional verification, is beneficial to elucidating the role of SlCDK8 in regulating and controlling flower morphogenesis in a molecular mechanism, has positive guiding effect on further elucidating a pollen development mechanism and cultivating a new tomato male sterile variety, and provides a theoretical basis for the research and development of a tomato male sterile line.
(3) The deletion of the SlCDK8 gene can simultaneously induce the abnormal development of each organ of the whole tomato plant, and the symptoms of plant height reduction, male sterility, abnormal flower organs and the like appear, which also embodies the key role played by the SlCDK8 in the process of plant development.
(4) For some plants needing dwarfing, such as fruit trees and ornamental plants (unnecessary nutrient consumption is reduced so as to fully utilize light energy and soil fertility, fruit early, improve yield or increase ornamental effect), a new way can be provided for plant dwarfing breeding by knocking out the SlCDK8 gene.
Drawings
FIG. 1 is a SlCDK8 knockout line for 6 different editing types;
figure 2 is the phenotype of different SlCDK8 knockout lines with wild-type tomato WT;
FIG. 3 is a diagram showing phenotypic observations of wild-type tomato WT, SlCDK8CRP 2(-3bp) and SlCDK8CRP 3(-6 bp);
FIG. 4 is the effect of the SLCDK8 gene on the development of tomato pollen.
Detailed Description
The present invention will be described in detail below with reference to specific examples. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art.
Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The test methods in the following examples are conventional methods unless otherwise specified. The reagents and materials used are commercially available, unless otherwise specified.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the practice of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.
The inventor obtains the sequence of the tomato cyclin-dependent kinase SlCDK8 gene on the basis of tomato genome through a bioinformatics technology. The invention leads the tomato to be connected with a plant editing vector and then to be led into a wild tomato for phenotype identification.
Example isolation and functional characterization of the Gene of the tomato cyclin-dependent kinase SlCDK8
1. Isolation of the SlCDK8 Gene
Extracting total RNA of MT tomato seedlings: first Strand cDNA Synthesis according to Trizol extraction reagent (Takara) protocolTMII 1st Strand cDNA Synthesis Kit (Takara) described the procedure. Tomato cDNA was used as template for high fidelity enzymatic amplification (Takara) using Primer STAR Max with an annealing temperature of 58 ℃.
The full-length sequence of the SlCDK8 gene was obtained by PCR amplification using the following sequences as primers. The full-length sequence of the SlCDK8 gene is shown as SEQ ID NO: 1, 1404bp in total, and the amino acid sequence of the codified protein is shown as SEQ ID NO:2, 467 pieces.
The primer sequence is as follows:
SlCDK8-F：5′-ATGGGAGATGTCAGAGGAAAT-3′；
SlCDK8-R：5′-GAACCGCCTAGATTTCTGTTG-3′。
2. functional characterization test of SlCDK8 gene
In order to study whether the SLCDK8 gene regulates the formation of pollen in the pollen development process, the function of the SLCDK8 gene is identified by knocking out a tomato line.
2.1 construction of recombinant vectors
A target site, GAGGAAATTCCAATAGCAAT, was selected on the first exon of the SlCDK8 gene. And recovering and purifying the sgRNA-SlCDK8 fragment and linking the sgRNA-SlCDK8 fragment with the enzyme-cut vector, thereby obtaining the SlCDK8-CRISPR recombinant plasmid. And tomato genetic transformation is carried out through agrobacterium mediation to obtain the transformed seedling of the tomato SlCDK 8-CRISPR.
2.2 screening and phenotypic analysis of transgenic Positive strains
Taking 100mg of resistant plant leaves, and extracting total DNA of the genome by adopting a CTAB method. And designing a specific primer according to the target gene sequence, carrying out PCR amplification, and carrying out sample sequencing.
The primer sequence is as follows:
SlCDK8-g1-F：5′-TCCCAACTCTCCCTCGTACAAC-3′；
SlCDK8-g1-R：5′-TAGAGAGACATATCTGCCTGGTTGA-3′。
through sequencing identification, 6 SlCDK8 knockout lines with different editing types are obtained, such as SlCDK8CRP1(-2bp), SlCDK8CRP 2(-3bp), SlCDK8CRP 3(-6bp), SlCDK8CRP 4(WT/+1bp), SlCDK8CRP 5(WT/-12bp), and SlCDK8CRP 6(-6bp/-2bp) (FIGS. 1 and 2). FIG. 3 is a phenotype observation diagram of wild tomato, SlCDK8CRP 2(-3bp) and SlCDK8CRP 3(-6bp), and the average plant height of the SlCDK8 knockout line is all significantly smaller than that of a wild control, so that a dwarfing phenotype is formed; the growth of leaf size of the SlCDK8 gene knockout line is obviously inhibited, and the leaf length and the leaf width are obviously reduced compared with those of a wild control. As can be seen from FIG. 4, compared with the wild type, the SlCDK8 knockout line has the advantages that the malformed pollen proportion is obviously increased, the pollen viability is obviously reduced, and the male sterile phenotype is formed.
In a whole view, compared with wild type and SlCDK8 gene knockout lines, the gene knockout line plants show reduced plant height, reduced leaf length and leaf width, and form dwarfing phenotype. In addition, the SLCDK8 gene has obvious influence on the development of tomato pollen to form a male sterile phenotype.
The above-mentioned embodiments are merely preferred embodiments of the present invention, which are merely illustrative and not restrictive, and it should be understood that other embodiments may be easily made by those skilled in the art by replacing or changing the technical contents disclosed in the specification, and therefore, all changes and modifications that are made on the principle of the present invention should be included in the scope of the claims of the present invention.
Sequence listing
<110> university of Henan
<120> tomato cyclin dependent kinase SlCDK8 gene and application
<130> 2020
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1404
<212> DNA
<213> Solanum lycopersicum
<400> 1
atgggagatg tcagaggaaa ttccaatagc aatcggccag agtggttgca acagtatgat 60
ttgataggga aaattgggga agggacttac gggttggttt ttttggctaa gatcaaagct 120
aaccgtagca aatctattgc tatcaagaag ttcaagcaat ccaaggacgg tgacggcgtt 180
tcccccaccg ccattcgcga aatcatgttg cttcgggaga tatcccatga gaatgttgta 240
aagcttgtca atgtgcatat caaccaggca gatatgtctc tctatctcgc ttttgactat 300
gccgagcatg acctctatga aattatcaga caccatagag acaaggtcat tctttcaatc 360
aatccgtaca ctgtaaagtc tctgttatgg cagctgctta atggtctcaa ttatcttcac 420
agtaattgga ttgttcatcg agacctaaag ccatcaaaca tcttggtaat gggcgaggga 480
gaagaacatg gagttgttaa aattgctgat ttcggccttg caagaattta tcaagctcca 540
ctgaaaccat tagctgagaa tggggttgta gtcactatct ggtatcgtgc gccggagtta 600
ctgcttgggg ctaaacacta cacaagtgca gttgatatgt gggccgttgg ctgtatattt 660
gctgagcttc ttactctaaa gccactattt caagggcaag aagtgaaggg cacaccaaac 720
cctttccagc ttgaccaact ggacaagata tttaaggttc tcggacatcc cacaccagaa 780
aaatggccaa cactggtaaa ccttccgcat tggcaatctg atgtgcaacg aattcaagga 840
cataagtatg acaatcctgc actttatagt gttctgcaca tgtctcccaa aagtcctgca 900
tacgaccttc tttcaaagat gcttgaatat gatcctcgta aaagaataac agcaacacaa 960
gctctagagc atgagtactt ccggatggaa cctctacctg gccgcaatgc acttgtacca 1020
ccacaacctg gagaaaaagt tgtgaattat ccaactcgac ctgtggacac aactacagac 1080
tttgaaggaa ccattagtct tcaaacgtct cagccggtat catctggaaa tgcagcatct 1140
ggtggcatgc atggtcccca tgttatgcca actagatctg taccccgacc aatgcaaatg 1200
gtgaacatgc caaggatgca acctcagggc atgtctgctt ataatcttgc ttctcaagct 1260
ggcatgagtg ctggaatgaa ccctggaaac atgcccatgc agcgtggtgt tgctgctcag 1320
gcacatcagc agcagatgag aaggaaagat ccaggaatgg gaatacctgg atacccttca 1380
caacagaaat ctaggcggtt ctga 1404
<210> 2
<211> 467
<212> PRT
<213> Solanum lycopersicum
<400> 2
Met Gly Asp Val Arg Gly Asn Ser Asn Ser Asn Arg Pro Glu Trp Leu
1 5 10 15
Gln Gln Tyr Asp Leu Ile Gly Lys Ile Gly Glu Gly Thr Tyr Gly Leu
20 25 30
Val Phe Leu Ala Lys Ile Lys Ala Asn Arg Ser Lys Ser Ile Ala Ile
35 40 45
Lys Lys Phe Lys Gln Ser Lys Asp Gly Asp Gly Val Ser Pro Thr Ala
50 55 60
Ile Arg Glu Ile Met Leu Leu Arg Glu Ile Ser His Glu Asn Val Val
65 70 75 80
Lys Leu Val Asn Val His Ile Asn Gln Ala Asp Met Ser Leu Tyr Leu
85 90 95
Ala Phe Asp Tyr Ala Glu His Asp Leu Tyr Glu Ile Ile Arg His His
100 105 110
Arg Asp Lys Val Ile Leu Ser Ile Asn Pro Tyr Thr Val Lys Ser Leu
115 120 125
Leu Trp Gln Leu Leu Asn Gly Leu Asn Tyr Leu His Ser Asn Trp Ile
130 135 140
Val His Arg Asp Leu Lys Pro Ser Asn Ile Leu Val Met Gly Glu Gly
145 150 155 160
Glu Glu His Gly Val Val Lys Ile Ala Asp Phe Gly Leu Ala Arg Ile
165 170 175
Tyr Gln Ala Pro Leu Lys Pro Leu Ala Glu Asn Gly Val Val Val Thr
180 185 190
Ile Trp Tyr Arg Ala Pro Glu Leu Leu Leu Gly Ala Lys His Tyr Thr
195 200 205
Ser Ala Val Asp Met Trp Ala Val Gly Cys Ile Phe Ala Glu Leu Leu
210 215 220
Thr Leu Lys Pro Leu Phe Gln Gly Gln Glu Val Lys Gly Thr Pro Asn
225 230 235 240
Pro Phe Gln Leu Asp Gln Leu Asp Lys Ile Phe Lys Val Leu Gly His
245 250 255
Pro Thr Pro Glu Lys Trp Pro Thr Leu Val Asn Leu Pro His Trp Gln
260 265 270
Ser Asp Val Gln Arg Ile Gln Gly His Lys Tyr Asp Asn Pro Ala Leu
275 280 285
Tyr Ser Val Leu His Met Ser Pro Lys Ser Pro Ala Tyr Asp Leu Leu
290 295 300
Ser Lys Met Leu Glu Tyr Asp Pro Arg Lys Arg Ile Thr Ala Thr Gln
305 310 315 320
Ala Leu Glu His Glu Tyr Phe Arg Met Glu Pro Leu Pro Gly Arg Asn
325 330 335
Ala Leu Val Pro Pro Gln Pro Gly Glu Lys Val Val Asn Tyr Pro Thr
340 345 350
Arg Pro Val Asp Thr Thr Thr Asp Phe Glu Gly Thr Ile Ser Leu Gln
355 360 365
Thr Ser Gln Pro Val Ser Ser Gly Asn Ala Ala Ser Gly Gly Met His
370 375 380
Gly Pro His Val Met Pro Thr Arg Ser Val Pro Arg Pro Met Gln Met
385 390 395 400
Val Asn Met Pro Arg Met Gln Pro Gln Gly Met Ser Ala Tyr Asn Leu
405 410 415
Ala Ser Gln Ala Gly Met Ser Ala Gly Met Asn Pro Gly Asn Met Pro
420 425 430
Met Gln Arg Gly Val Ala Ala Gln Ala His Gln Gln Gln Met Arg Arg
435 440 445
Lys Asp Pro Gly Met Gly Ile Pro Gly Tyr Pro Ser Gln Gln Lys Ser
450 455 460
Arg Arg Phe
465
Claims (3)
1. Use of inhibiting the expression of the gene of the tomato cyclin dependent kinase SlCDK8 for dwarfing plants and/or for conferring a male sterile phenotype on plants, characterized in that the nucleotide sequence thereof is represented by SEQ ID No. 1.
2. The use according to claim 1, characterized in that the amino acid sequence of the gene for the tomato cyclin-dependent kinase SlCDK8 is shown in SEQ ID No. 2.
3. Use according to claim 1, characterized in that the dwarfing and/or male sterility symptomatic plant is obtained by means of a knockout of the SlCDK8 gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011038566.5A CN112126633B (en) | 2020-09-27 | 2020-09-27 | Tomato cyclin dependent kinase SlCDK8 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011038566.5A CN112126633B (en) | 2020-09-27 | 2020-09-27 | Tomato cyclin dependent kinase SlCDK8 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112126633A CN112126633A (en) | 2020-12-25 |
| CN112126633B true CN112126633B (en) | 2021-11-19 |
Family
ID=73840418
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011038566.5A Active CN112126633B (en) | 2020-09-27 | 2020-09-27 | Tomato cyclin dependent kinase SlCDK8 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112126633B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1807626A (en) * | 2005-12-16 | 2006-07-26 | 厦门大学 | Rice cell cycle protein dependent kinase inhibitor gene |
-
2020
- 2020-09-27 CN CN202011038566.5A patent/CN112126633B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112126633A (en) | 2020-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11447785B2 (en) | Method for base editing in plants | |
| CN110317249B (en) | Chimonanthus praecox CpAP1 gene and coded protein and application thereof | |
| CN115894646B (en) | OsJDG1 gene and application thereof in regulation of rice grain type and thousand grain weight | |
| CN113004383B (en) | Application of corn gene ZmEREB102 in improving corn yield | |
| CN107326035B (en) | Deubiquitinating enzyme gene UBP5 for regulating rice grain shape and leaf color and application thereof | |
| CN114426975B (en) | Tomato glutaredoxin SlGRXC9 gene and application thereof | |
| KR102516522B1 (en) | pPLAⅡη gene inducing haploid plant and uses thereof | |
| CN108341857B (en) | Rice yield related protein and coding gene and application thereof | |
| CN112126633B (en) | Tomato cyclin dependent kinase SlCDK8 gene and application thereof | |
| CN114921583A (en) | QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application | |
| CN108456683B (en) | Function and application of gene SID1 for regulating heading stage of rice | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| CN104805100B (en) | Paddy gene OsS μ 2 applications in plant leaf blade aging is delayed of BP | |
| CN112301035A (en) | Highly-resistant rice bacterial leaf blight gene Xa7 and application thereof | |
| CN112831509B (en) | Tomato SlOST1 gene and application thereof | |
| CN108315336B (en) | Application of gene PIS1 for controlling development of rice spikelets | |
| CN112142831B (en) | Jujube witches broom phytoplasma effector gene Zaofeng3 and application | |
| CN109628462B (en) | Rice root elongation control gene OsKSR7 and encoded protein | |
| CN114854712B (en) | Application of corn ZmWAK02 gene in improving resistance of corn gray spot | |
| CN114015666B (en) | Application of OsPARP3 gene in regulation and control of plant drought tolerance | |
| CN112359134B (en) | Molecular marker primer for improving haploid induction efficiency of rice and application thereof | |
| CN113817754B (en) | Rice short-grain gene SHG1 and application thereof | |
| CN116004570B (en) | Rice chlorophyll content regulating gene OsCTR1, encoding protein and application thereof | |
| CN111944772B (en) | Eggplant cryptochrome blue light inhibitor SmBIC1 protein and coding gene | |
| CN110846325B (en) | Rice multi-flower gene MOF1 and application of protein encoded by same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |