CN112011547A

CN112011547A - Major gene for controlling rape leaf shape and application thereof

Info

Publication number: CN112011547A
Application number: CN202010719919.1A
Authority: CN
Inventors: 范楚川; 周永明; 胡利民; 张�浩; 申潇潇
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-07-23
Filing date: 2020-07-23
Publication date: 2020-12-01
Anticipated expiration: 2040-07-23
Also published as: CN112011547B

Abstract

The invention relates to the technical field of plant genetic engineering, in particular to a major gene for regulating and controlling rape leaf shape and application thereof. The major gene for controlling the leaf shape of the rape provided by the invention is BnaA10.RCO gene or allele thereof, wherein the nucleotide sequence of the BnaA10.RCO gene is shown as SEQ ID NO: 1 is shown. The major gene for controlling the rape leaf shape is a gene positioned on a rape A10 chromosome and encodes an HD-ZIPI transcription factor related to plant leaf shape development, and the gene is separated and cloned by utilizing a method combining map-based cloned gene positioning and genetic transformation, so that a theoretical basis is provided for the improvement and breeding of the rape leaf shape; meanwhile, the method provides reference for the leaf shape regulation and control research of cross mosaic plants such as cabbage type rape, mustard type rape and the like.

Description

Major gene for controlling rape leaf shape and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a major gene for regulating and controlling rape leaf shape and application thereof.

Background

The leaves are one of the most important organs of plants, have the functions of photosynthesis, transpiration, nutrition supply, water transportation and the like, and influence the physiological characteristics of crops and even yield. The change of the leaf morphology affects the leaf surface temperature, the water utilization efficiency of the plant and the photosynthesis intensity, is an adaptive expression of the plant to the environment and is formed by long-term natural selection. The shape and size of the leaf blade have abundant natural variation, and the leaf blade can be divided into full edge, shallow crack, deep crack and the like according to the shape of the leaf edge. In addition, some studies have also found that the floral leaf trait is also associated with stress resistance in plants. To date, studies on leaf shapes have mainly focused on model species such as Arabidopsis, cardamine and tomato, while studies on the location and molecular regulatory mechanism of leaf shape genes in oilseed rape have been rare.

The phenotype of the flower and leaf in the rape can be expressed in the early development stage of the plant, and the phenotype is stable and is not easily influenced by environmental conditions, so the flower and leaf also become an ideal morphological marker for the production of rape hybrids. The current existing application of rape floral leaf phenotype is to utilize the floral leaf dominant character as a marker to carry out breeding of a restorer line, a sterile line and the like so as to ensure the purity of hybrid rape. However, the research on the positioning of the leaf shape gene and the molecular regulation mechanism in rape is few, so how to better understand the formation mechanism of the leaf shape of the leaf has important significance for better genetic improvement of rape by utilizing the leaf shape character.

Disclosure of Invention

The invention aims to provide a major gene for controlling rape leaf shape and application thereof. The major gene provided by the invention can realize the regulation and control of rape leaf shape and provide a theoretical basis for the improvement and breeding of rape leaf shape.

The major gene for controlling the leaf shape of the rape provided by the invention is BnaA10.RCO gene or allele thereof, wherein the nucleotide sequence of the BnaA10.RCO gene is shown as SEQ ID NO: 1 is shown.

The invention also provides a protein for regulating and controlling rape leaf shape, and the protein is coded by the major gene.

The invention also provides an expression vector containing the major gene for controlling rape leaf shape, wherein the expression vector is a PMDC32 vector containing the major gene.

The invention also provides a major gene for controlling rape leaf shape, a protein coded by the gene and application of an expression vector containing the gene in regulation of rape leaf shape.

The invention also provides a construction method of the expression vector containing the main effect gene for regulating and controlling the leaf shape of the rape, which is characterized by comprising the following steps:

s1-1, amplifying BnaA10.RCO genome DNA sequences from HY lacerated leaf and Z9 shallow-lacerated leaf respectively;

s1-2, the sequence amplified in the step S1 is connected to a PMDC32 vector using CaMV35S as a promoter by an enzyme digestion connection method.

Wherein, the primers used for amplifying the BnaA10.RCO genome DNA sequence in the step S1-1 are as follows:

A10-117F GGGCttaattaaCTACCATGGGTAAGGCTGTTGC

A10-118R GACAggtaccATGGAATGGTCAACGACGAGC

the invention also provides a cloning method of the major gene for controlling rape leaf shape, which comprises the following steps:

s2-1, comparing the annotated gene of the BnLLA10 segment in the brassica napus reference genome into the arabidopsis genome, performing function annotation, and determining a candidate gene;

s2-2, designing primers to clone candidate genes of HY lacerated leaves and Z9 shallow lacerated leaves, comparing the sequencing results of cDNA and DNA of the candidate genes, and determining the difference position of the allele of the candidate genes in the two materials;

s2-3, analyzing the specific expression quantity of the candidate gene in an HY and Z9 near isogenic line Z9-NIL, and finally determining the major gene BnaA10.RCO through an overexpression experiment and a gene knockout experiment;

s2-4, connecting the major gene BnaA10.RCO to an expression vector and transferring the gene into a receptor cell by an agrobacterium-mediated hypocotyl transformation method.

Among them, the candidate genes determined in step S2-1 are bnaa10.rco and bnaa10. lmi1.

Wherein the nucleotide sequence of the primer used for cloning the BnaA10.RCO gene in the step S2-2 is as follows:

A10_101F：TCTCCAAGATCCGAAACACCT

A10_101R：ATGGAATGGTCAACGACGAGC。

the invention discloses a main effective gene BnaA10.RCO for regulating rape leaf shape by separating and cloning and nucleotide sequence of allele (HY) thereof is shown as SEQ ID NO: 1 and amino acid sequences shown as SEQ ID NO: 2, the allelic gene difference of two parent materials HY and Z9 is mainly located at the position of a gene 5' regulation region in allele comparative sequencing, expression quantity analysis is carried out on HY and a near isogenic line Z9-NIL by utilizing qRT-PCR technology, the expression quantity of BnaA10.RCO genes in different tissues is obviously higher than that of the near isogenic line in HY, and transgenic experiments of overexpression and gene knockout prove that the BnaA10.RCO genes positively regulate rape leaf shapes.

The invention clones the major gene for regulating the rape leaf shape in the rape, and provides a theoretical basis for improving and breeding the rape leaf shape; meanwhile, the method provides reference for the leaf shape regulation and control research of cross mosaic plants such as cabbage type rape, mustard type rape and the like.

Drawings

FIG. 1 is a gene structure diagram of BnaA10. RCO; wherein the positions in S1 and S2 indicated by the arrows are the target sequence positions;

FIG. 2 is a graph showing an analysis of the expression level of BnaA10.RCO gene; wherein A is the expression quantity in the seedling leaves of HY and Z9-NIL on different days, and B is the expression quantity in different tissues of HY and Z9-NIL seedlings at 10 days;

FIG. 3 is a graph of phenotype and expression levels of BnaA10.RCOHY (HY OE) and BnaA10.RCOZ9(Z9 OE) over-expressed in the J9707 and HY backgrounds; wherein 15d leaf-aged seedlings: (A) j9707; (B) HY OE-16, HY OE-55, HY OE-63, HY OE-141 and HY OE-30 transgenic lines in the J9707 background; (C) HY; (D) z9 OE-7, Z9 OE-17 and Z9 OE-23 in HY background; (E) z9 OE-119 and Z9 OE-122 transgenic lines in an HY background; (F) z9 OE-20 and Z9 OE-25 transgenic lines in an HY background. (G-K) corresponds to the mature leaves when the seedlings in A (G), B (H), C (I), D (J) and F (K) grow to 50d plants, respectively.

Fig. 4 is a bnalco mutant induced with CRISPR/Cas9 system in floral leaf parent HY. (A) Cas9P35s-BnarCO (SRCO) vector scheme. (B) Target sequences designed for RCO, where PAM sequences are underlined. (C) Bnarco editing individual T₀And T₁Genotype and phenotype of the generations. (D) Bnarrco edits the sequence near the sgRNA target site of the individual strain. The PAM sequence is underlined, and the specific mutant sequence information is marked on the right; "A" or "C" represents a wild-type allele and "a" or "C" represents a mutant allele. The scale is 1 cm.

FIG. 5 is a graph of BnaA10.RCO mutant phenotype and the detection of the expression level of BnaLMI1 in the mutant. Comparison of phenotype (A) (two leaf stage) and leaf shape index (B) of individual plants edited for different genotypes; AaCc represents a heterozygous mutant of two RCO gene copies, and AaCc represents a homozygous mutant or a biallelic mutant of two RCO gene copies; (C) expression level of BnaLMI1 in the shoot tips of 7d seedlings in the transgenic line edited by bnaa10.rco was examined by normalization of total RNA amount by qPCR with BnOTC. The scale is 1 cm.

Detailed Description

The principles and features of this invention are described below in conjunction with specific embodiments, the examples given are intended to illustrate the invention and are not intended to limit the scope of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

Test materials:

HY comes from the leaf of "cuprum Mao", a local variety, and the leaf phenotype is deep cracked leaf, also called as mosaic, and is provided by the planting resource library of the agricultural academy of Jiangxi province.

Z9 is 'Zhongshuang No. 9' and is abbreviated as Z9, which is a popularized variety, and the leaf phenotype is a shallow leaf shape.

The semi-winter cabbage type rape J9707 is in a shallow leaf-splitting shape, is used as a transformation receptor in the research, and is provided by rape engineering center of Huazhong university of agriculture.

The expression vector PMDC32 is purchased from the addge website and has the website address ofhttps://www.addgene.org。

PYLCRISPR/Cas935S-H editing vector is provided by the laboratory of Liu flare light teacher at southern China university of agriculture, and the specific sequences of the vector are described in Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y.A robust CRISPR/Cas9 system for meeting, high-efficiency multiplex gene editing in monomer and binary plants, mol Plant,2015,8: 1274-.

Z9-NIL: f1 hybrids are obtained by positive and negative crossing of two parent materials HY and Z9 respectively, wherein F1 hybrids of HY multiplied by Z9 are subjected to selfing and backcross with HY parents to derive F2, F3, BC1F2, BC2F2, BC3F2 and other segregating populations of different generations. In the generation of BC3F2, a single plant which is homozygous Z9 allelic type at the major effective site of leaf shape (BnLLA10 site) and has the same leaf shape as the donor parent Z9 is screened out by a molecular marker-assisted selection method, and the single plant is used as an HY material Near Isogenic Line and is called Z9-NIL (Near-Isogenic Line of HY).

The invention provides a major gene for controlling rape leaf shape, wherein the major gene is BnaA10.RCO gene or allele thereof, and the nucleotide sequence of the BnaA10.RCO gene is shown as SEQ ID NO: 1 is shown. The main effective gene BnaA10.RCO gene related by the invention is a gene positioned on chromosome of rape A10, encodes a HD-ZIPI transcription factor related to plant leaf shape development, and the inventor utilizes a method combining map-based cloning gene positioning and genetic transformation to separate and clone the gene. The present invention utilizes the fine positioning result of BnLLA10, which is the locus controlling the leaf shape on chromosome A10 published by the research group, to reduce the positioning segment to the 41.0kb segment corresponding to A10_87 and A10_88 on chromosome A10. The BnaA10.RCO gene was identified as a candidate gene by functional prediction of 5 genes within this interval. The candidate gene has 2 introns and 3 exons and encodes 223 amino acid sequences. The candidate gene has 1 base mutation from C-T in 35bp of the gene coding region from ATG in HY and Z9 parents, resulting in mutation of HY from Met12 to Thr12 relative to Z9. However, the mutation is not in the conserved motif segment of the RCO gene, and Met12 appears in the cracked leaf material Yuye 87, indicating that Thr12 or Met12 is not the key amino acid for determining leaf shape. However, the 5 '-UTR region of BnaA10.RCO has many differences among parents, including 79 SNPs and 21 INDELs, while the 3' -UTR has only 13 SNP differences. Through expression quantity detection, the expression quantity of BnaA10.RCO gene is obviously up-regulated in HY compared with Z9-NIL in stem apical tissues of 9d seedlings and leaves of 10d and 15d seedlings. By utilizing an overexpression technology and agrobacterium-mediated genetic transformation, the expression quantity of the gene is found to be positively correlated with the leaf-shaped complexity. Through agrobacterium-mediated genetic transformation by using CRISPR/Cas9 gene editing technology, the fact that the flower leaf is mutated into a normal leaf by knocking out the gene in HY is found. In the overexpression transgenic line and the knockout mutant, the expression level of BnalMI1 is not significantly different compared with the wild type. Therefore, the BnaA10.RCO gene is finally determined to be a main effective gene for controlling the leaf margin cutting crack of rape.

A10-117F GGGCttaattaaCTACCATGGGTAAGGCTGTTGC

A10-118R GACAggtaccATGGAATGGTCAACGACGAGC。

s2-2, designing primers to carry out candidate gene sequencing on HY etched leaf and Z9 shallow-cracked leaf, comparing the sequencing results of cDNA and DNA, and determining the position of the candidate gene with larger difference;

Wherein the nucleotide sequence of the primer used in the gene clone sequencing in the step S2-2 is as follows:

A10_101F：TCTCCAAGATCCGAAACACCT

A10_101R：ATGGAATGGTCAACGACGAGC。

example 1BnaA10. cloning and location of RCO Gene

Through a great deal of research by the applicant, the applicant believes that leaf-shaped genes with large effects exist in the A10 chromosome localization segment, and the regulation effect of the locus on the leaf shape in Brassica is relatively conservative.

In the Brassica napus reference genome (http:// www.genoscope.cns.fr/brassicana /), there are 5 annotated genes within 41.0kb of the mapping segment, BnaA10g26 26310D to BnaA10g26350D (Table 1). We aligned the genes annotated in the BnLLA10 segment to the Arabidopsis genome (http:// www.arabidopsis.org /), and performed functional annotation. Wherein BnaA10g26320D (BnaA10.RCO) and BnaA10g26330D (BnaA10.LMI1) are Arabidopsis LMI1-like paralogous genes and encode HD-Zip I transcription factors, and the homologous genes are reported to participate in leaf shape regulation in cardamine abrotanum and Arabidopsis thaliana (Vlad et al 2014, Sicard et al 2014). Of the other 3 genes, BnaA10g26310D is a gastrin family gene; BnaA10g26340D encodes a 3-deoxy-D-mannose octacaprylate transferase; BnaA10g26350D encodes a β -mannan synthase. The annotation information for all 3 genes was not related to leaf shape regulation. Therefore, the tandem homologous genes BnaA10.RCO and BnaA10.LMI1 are the most likely candidate genes for controlling rape flower and leaf.

TABLE 1 annotated genes within the mapped segment in the Brassica napus reference genome

Based on the above, we designed a primer pair of A10-101F/R to amplify the gene sequence of BnaA10.RCO according to the re-sequencing sequences of HY (incised leaf) and Z9 (superficial leaf), wherein the primer sequence is as follows:

A10_101F：TCTCCAAGATCCGAAACACCT

A10_101R：ATGGAATGGTCAACGACGAGC。

simultaneously, the pair of primers is used for amplifying cDNA and genome of the gene and carrying out TA cloning, wherein a PCR reaction system is as follows: 2ul of DNA template, 25ul of Phanta Max Buffer (Vazyme, P505-d1), 2ul of each primer working solution, 10mM dNTP 1ul, Phanta Max Super-Fidelity DNA polymerase 1ul, and double distilled water were mixed to obtain a 50ul system. The reaction procedure is as follows: 1: 4 minutes at 95 ℃; 2: 30 seconds at 95 ℃, 30 seconds at 58 ℃ and 1 minute and 30 seconds at 72 ℃; 3: repeating the step 2 for 33 times; 4: 10 minutes at 72 ℃ and 5 minutes at 25 ℃.

The comparison of cDNA sequencing results with DNA sequencing results shows that BnaA10.RCO has 2 introns and 3 exons, encodes 223 amino acid sequences, has 61% protein similarity compared with BnaA10.LMI1, and is a homologous gene. The gene contains 1 conserved homology box (Homeobox domain) and Leucine zipper domain (Leucine zipper domain). In the result of allele comparison sequencing, we found that the BnaA10.RCO gene has 1 base mutation of C-T35 bp from ATG in the gene coding region in two parents, which results in HY mutation to Thr12 from Met12 relative to Z9. However, the mutation is not in the conserved motif segment of the RCO gene, and Met12 appears in the cracked leaf material Yuye 87, indicating that Thr12 or Met12 is not the key amino acid for determining leaf shape. However, the 5 '-gene regulatory region of BnaA10.RCO has many differences among parents, including 79 SNPs and 21 INDELs, while the 3' -gene regulatory region has only 13 SNPs (FIG. 1).

Cloning primer of 5' gene regulatory region of BnaA10.RCO gene:

A10_111F：GAGCGAGTTGGATGAGTTAG

A10_112F：CTTTAGTCTTGCTGTTCTTGTG

A10_115R：CGGCGATGATGTAGAGATAATA

A10_145F：TTACCTTCGGTTCTTAGCGT

A10_148F：GTAGAGAGGGAAGTCATGTTGTC

A10_150R：CGATGTCTTGCGGTACTTTAT

cloning primer of 3' gene regulatory region of BnaA10.RCO gene:

A10_106F：TTCTTCGCAGGAGGTGTA

A10_107F：CAGGTTACGTTCCTCCTTTC

A10_108F：CGGTCTTGCTCCAACATT

A10_109R：TATCATCGCAACAGCCTTAC

A10_110R：GAGGCAAATGAATCTGAACAAC

example 2 analysis of expression level of BnaA10.RCO

The gene expression level of BnarCO was detected in HY and Z9-NIL. Extracting total RNA of parent HY and Z9-NIL stem top, taking cDNA obtained by reverse transcription as a template, and performing PCR amplification by using gene expression detection primers, wherein the primer sequences are as follows:

RCOF：GGTAGCTGTTTGGTTCCAGAA

RCOR：CCCTCCGGCTATTTGATTGT

the rape gene Ornithline TRANSCARBAMYLASE (OTC) gene (Cnops et al 2004) is used as an internal reference gene, and the primer sequences are as follows:

BnOTC-F：CATAACCACCCTTGCCAAATC

BnOTC-R：TTGTTCCCGTCTCCAACATAG

wherein, the reaction system is as follows: 2 × super mix 7.5ul, left and right primers (2.5uM) each 2ul, cDNA:5.5ul, reaction program 1: 30 seconds at 95 ℃; 2: collecting fluorescence at 95 ℃ for 15 seconds, 56 ℃ for 15 seconds and 72 ℃ for 15 seconds; 3: repeating the step 2 for 45 times; 4: the dissolution curve was generated at 4 ℃ for 10 minutes.

The qRT-PCR result shows that in the stem apex tissue of 9d seedlings and the leaves of 10d and 15d seedlings, the BnarCO gene expression level is obviously up-regulated compared with that in Z9-NIL in HY. In addition, the expression level of the candidate gene was significantly increased in the shoot apical tissue of 9d seedlings compared to the leaves of 10d and 15d seedlings (fig. 2A); the expression level of BnarCO gene was highest in the stem apex in different tissues of the seedling including hypocotyl, root, stem apex, leaf of 10d seedling, cotyledon of 10d seedling (FIG. 2B), suggesting that BnarCO may act on early leaf development to participate in regulation of leaf shape. In FIG. 2, A is the expression level of BnarCO gene in HY and Z9-NIL in the stem apex of 9d seedling, leaf of 10d seedling and leaf of 15d seedling after germination; b is the expression quantity of BnarCO gene in different tissues of HY seedling; qRT-PCR is expressed by taking BnOTC as an internal reference gene and calculating the expression amount by the average value +/-SD of 3 biological repeats; Z9-NIL is an individual homozygous Z9 genotype at the BnLLA10 site in the HY background in the BC3F2 population; significant levels of P <0.01, significant levels of P < 0.05.

Example 3 overexpression assay of BnaA10.RCO

We amplified the DNA sequence of the bnaa10.rco genome from HY and Z9 genomes, respectively, with the primer information:

A10-117F：GGGCttaattaaCTACCATGGGTAAGGCTGTTGC

A10-118R：GACAggtaccATGGAATGGTCAACGACGAGC

the vector was ligated to an expression vector PMDC32 containing CaMV35S as a promoter to construct a overexpression vector.

The vector can simultaneously convert two receptor materials, namely, a shallow-cracked leaf J9707 and a floral leaf HY. Wherein BnaA10.RCO^HYIs a super expression vector of BnaA10.RCO allele in HY, which is called HY OE for short; BnaA10.RCO^Z9Is a overexpression vector of BnaA10.RCO allele in Z9, which is called Z9 OE for short.

Through the agrobacterium-mediated hypocotyl transformation method, most of transgenic positive single plants have obviously increased leaf edge cutting cracks in HY OE transgenic positive line offspring taking J9707 (a shallow-cracked leaf shape and an excellent transformation receptor material) as a receptor material, and individually generate a deep-cracked leaf phenotype, similar to HY (fig. 3B-H). Under the HY transformation background, the leaf shape cutting degree in the positive strain of the Z9 OE transgenic line is more serious than HY, only a small amount of mesophyll tissues are left, the growth and cell proliferation between the cut leaves are inhibited, and the leaf area is obviously reduced. In the HY transgenic background, in Z9 OE, the two transgenic lines Z9_ OE-20 and Z9_ OE-119 showed smooth leaf edges and showed co-expression inhibition (FIGS. 3E, F and K). The expression level detection by utilizing qRT-PCR shows that the expression of BnaA10.RCO is greatly reduced, which indicates that the co-suppression phenomenon exists in the two strains (figure 3M). Wherein, fig. 3 shows phenotype and expression level of overexpressed bnaa10.rcohy (HY OE) and bnaa10.rcoz9(Z9 OE) in the J9707 and HY backgrounds. 15d leaf-aged seedlings: (A) j9707; (B) HY OE-16, HY OE-55, HY OE-63, HY OE-141 and HY OE-30 transgenic lines in the J9707 background; (C) HY; (D) z9 OE-7, Z9 OE-17 and Z9 OE-23 in HY background; (E) z9 OE-119 and Z9 OE-122 transgenic lines in an HY background; (F) z9 OE-20 and Z9 OE-25 transgenic lines in an HY background. (G-K) corresponds to the mature leaves when the seedlings in A (G), B (H), C (I), D (J) and F (K) grow to 50d plants, respectively. Standardizing BnOTC by qRT-PCR, and detecting BnaRCO and BnaLMI1 expression levels in leaves (L) and stem tips (M) of 10d transgenic strains and leaves thereof by qRT-PCR; the expression values represent the mean. + -. SD, scale, 1cm of 3 biological replicates.

The results show that the leaf shape complexity can be increased by increasing the expression level of BnaA10.RCO allele of HY or Z9; in HY, the expression level of BnaA10.RCO gene was reduced to smooth the leaf margin. Therefore, BnaA10.RCO expression level is positively correlated with leaf shape.

The specific steps of the transgenic operation are as follows:

constructing a overexpression vector: 1) construction of p35S BnarCO vector: the BnaA10.RCO gene sequence was amplified from HY and Z9 by using primers A10-117F (PacI)/A10-118R (KpnI), and ligated into pMDC32 vector by enzymatic ligation. And (3) after the constructed vector is verified to be correct through sequencing, extracting a plasmid, and then transforming agrobacterium GV 3101.

Wherein the reaction system of PCR amplification is as follows: 2ul of DNA template, 25ul of Phanta Max Buffer (Vazyme, P505-d1), 2ul of each primer working solution, 10mM dNTP 1ul, Phanta Max Super-Fidelity DNA polymerase 1ul, and double distilled water were mixed to obtain a 50ul system. The reaction procedure was 1: 4 minutes at 95 ℃; 2: 30 seconds at 95 ℃, 30 seconds at 58 ℃ and 1 minute and 30 seconds at 72 ℃; 3: repeating the step 2 for 33 times; 4: 10 minutes at 72 ℃ and 5 minutes at 25 ℃. The reaction system of the enzyme digestion expression vector is plasmid 15ul, Fastdigest buffer 5ul, PacI and KpnI each 1.25ul, and finally double distilled water is added to mix into a 40ul system; the reaction condition is 37 ℃ for 15 minutes, the reaction system during connection is a system formed by mixing 4ul of plasmid, 2ul of T4 DNA ligase buffer, 0.5ul of T4 DNA ligase and double distilled water into 10ul, and the reaction condition is 20-25 ℃ for 10 minutes.

The main steps of genetic transformation, culture medium and the method for preparing the same are as follows:

1) and (3) sterilization: the seeds are put into a small half tube by a 2ml centrifuge tube, 75% alcohol is added to soak the seeds for 1 to 3 minutes, the attention time is not too long, otherwise, the germination is influenced. Removing alcohol, adding 84 disinfectant (diluted by one time with distilled water) to soak the seeds for 5-8 minutes; removing 84 disinfectant, and washing with sterile water for 3-5 times.

2) Sowing: sowing the sterilized seeds on an M0 culture medium by using sterile forceps, wherein 20-25 seeds are sowed in each dish; then, the petri dish was placed in a sterile culture box and incubated in dark light at 24 ℃ for 6 d.

3) Shaking the bacteria: after sowing for 4d, the target Agrobacterium strain was cultured with LB. Adding 4ml of LB culture solution into a sterilized PU bottle, sucking 10 mul of activated target strain, and adding antibiotics, namely adding 4 mul of kana, 4 mul of Gent and 10 mul of bacterial solution into 4ml of LB culture solution; culturing for 12-15h in a shaking table with 220r/min at 180-.

4) Preparation and infection of explants: measuring OD value (preferably about 0.4 OD), sucking 2ml of cultured strain into 2ml of sterile centrifuge tube, centrifuging at 6000r/min for 3 min, and pouring off supernatant; resuspend once with 2ml DM, centrifuge for 3 minutes at 6000r/min, discard the supernatant, add 2ml DM and resuspend, put the suspended bacteria liquid at 4 ℃ for use. Shearing hypocotyls of seedlings cultured in dark for 6d into a sterile plate by using sterile scissors, and adding 18mL of M1 liquid culture medium into the plate; the optimum length of the cut explant is 0.8-1.0cm, and the explant is cut vertically as soon as possible when cut. When each dish contains 150 and 200 explants, 2ml of DM suspension prepared in the first step is added, and the timed dip-staining is started for 10-15 minutes, during which the mixture is shaken every 2 minutes. Then the bacterial liquid is quickly sucked out, the explant is transferred to sterile filter paper, and a large amount of bacterial liquid attached to the explant is sucked away.

5) Transfer to M1 medium, 30-50 explants per dish, and place at 24 ℃ in the dark.

6) After 24-48h, the medium was transferred to M2 medium and cultured under 24 ℃ illumination (16 h day/8 h night).

7) After 15-20 days, the cells are transferred to M3 medium and subcultured every 2-3 weeks until green buds appear.

8) And transferring the green buds larger than 2cm into an M4 rooting culture medium for rooting, wherein the rooting time is 2-4 weeks. After the healthy and complete seedlings are grown, the seedlings can be transplanted to a field or a greenhouse to continue to grow until the seedlings are fruited.

Example 4 Gene knockout assay for BnaA10.RCO

To further demonstrate that bnaa10.RCO is involved in leaf-shape regulation, two sgRNA cassettes were designed for the coding region of bnaa10.RCO gene, and this vector was named Cas9P35S-RCO, SRCO for short (fig. 4A). The sgRNA construction primers are as follows:

BnRCOT1-F：gtcACGGGCGTAGACGAATTTCC

BnRCOT1-R：aaacggaaattcgtctacgcccg

BnRCOT2-F：attGCTTCACCCTCCACCGTGCA

BnRCOT2-R：aaactgcacggtggagggtgaag

these two sgrnas were initiated for expression with the arabidopsis promoters pU3d and pU6-1, respectively, and simultaneously targeted two homologous copies of RCO, BnaA10.RCO (BnaA10g26320D) and BnaC04.RCO (BnaC04g00850D) (fig. 4B). And transforming the constructed SRCO vector into an HY material by using an agrobacterium hypocotyl transformation method. Carrying out transgene positive identification by using a vector specific primer, wherein the sequence of the specific primer is as follows:

PB-L：GCGCGCGGTCTCGCTCGACTAGTATGG

PB-R：GCGCGCGGTCTCTACCGACGCGTATCC

the amplification system is as follows: 2ul of DAN template, 1ul of buffer3, 0.16ul of 10mM dNTP, 0.1ul of Taq DNA polymerase, 0.5ul of each primer, and double distilled water were mixed to obtain a10 ul system. The amplification procedure was: 4 minutes at 95 ℃; 2: 30 seconds at 95 ℃, 30 seconds at 58 ℃ and 1 minute at 72 ℃; 3: repeating the step 2 for 32 times; 4: 10 minutes at 72 ℃ and 5 minutes at 25 ℃.

The result obtained 38T in total₀Transgenic positive individuals were generated, and these individuals were further genotyped by high throughput sequencing (Liu et al 2017), and the primer sequences for gene editing identification were:

C04-1：ggagtgagtacggtgtgcCCTACTTCCCGTTCCCTCAA

A10_266：gagttggatgctggatggATGGAATGGTCAACGACGAG

A10_267：ggagtgagtacggtgtgcGCGTGATAATTCCAAGATTTTTAGAA

A10_269：gagttggatgctggatggGATTCAGACAGGAAGGTGAAG

A10_271：ggagtgagtacggtgtgcACCTCATCGTGCGTTGTC

high throughput sequencing results showed 21T₀The gene editing event happens to the generation individual plant, and the editing efficiency is 55.3%. Of these 21 editing individuals, 12 individuals had homozygous or biallelic mutations in both BnaA10.RCO and BnaC04.RCO copies, and the mutants appeared to have a shallowly split leaf shape. To further confirm whether the mutant phenotype could be inherited, we continued to edit 5T' s₀Breeding the generation line and detecting the genotype. As a result, it was found thatIn a single plant, when both alleles of BnaA10.RCO have a frame shift mutation (homozygous mutation or biallelic mutation, aacc genotype) or only BnaA10.RCO has homozygous mutation or biallelic mutation, the mutants all show the same shallow leaf shape; while the two genes were of heterozygous genotype (AaCc), the mutants appeared to be mesophyllic (FIGS. 4C-D, FIGS. 5A-B). Therefore, we conclude that BnaA10.RCO has a determining effect on leaf shape, and the analysis result of the expression amount of two copies of RCO gene shows that BnaC04.RCO is hardly expressed, which indicates that BnaC04.RCO is not related to leaf shape regulation. The gene expression level of BnalMI1 is detected in the rco mutant strain. The detection results show that the expression level of the gene BnalMI1 in the transgenic line material is not significantly changed compared with the expression level of the gene in the receptor material (FIG. 5C). Wherein, figure 4 is BnarCO mutant induced by CRISPR/Cas9 system in floral leaf parent HY. (A) Cas9P35s-BnarCO (SRCO) vector scheme. (B) Target sequences designed for RCO, where PAM sequences are underlined. (C) Bnarco editing individual T₀And T₁Genotype and phenotype of the generations. (D) Bnarrco edits the sequence near the sgRNA target site of the individual strain. The PAM sequence is underlined, and the specific mutant sequence information is marked on the right; "A" or "C" represents a wild-type allele and "a" or "C" represents a mutant allele. The scale is 1 cm.

This means that the process of BnarCO regulating leaf shape does not need to rely on regulating the expression level of BnalMI 1.

CRISPR/Cas9 editing vector construction: the CRISPR-P (http:// cbi. hzau. edu. cn/cgi-bin/CRISPR) online tool is used for selecting gene target sites, and then the CRISPR/Cas9 editing vector is constructed by referring to the method described by Ma et al (2015), wherein the used backbone vector is PYLCRISPR/Cas 935S-H. The method mainly comprises the following steps:

1) and (3) carrying out enzyme digestion on the skeleton vector by Bsa I, wherein the enzyme digestion reaction system is as follows: taking each of plasmids such as pU3d

Mu.g, at 25. mu.l with 10U Bsa I, cryopreserved under the following reaction conditions: carrying out enzyme digestion at 37 ℃ for 20 minutes, and recovering a skeleton fragment;

2) constructing an sgRNA box, performing 2 rounds of nested PCR, performing 2 reactions in a first round of PCR, and respectively using a U-F joint reverse primer and a joint forward primer gR-R; the second round is Overlapping PCR, and the expression cassette product is amplified by using a position-specific primer. Wherein the U-F joint reverse primer is as follows: CTCCGTTTTACCTGTGGAATCG, the forward primer gR-R of the joint is CGGAGGAAAATTCCATCCAC, and the reaction system is as follows: 0.5ul of ligation product of the expression cassette, 0.3ul of each primer, 1.5ul of 2mM dNTP, 1.5ul of 10 XBuffer (KOD-Plus, TOYOBO), 5mM MgSO₄0.6ul of KOD plus 0.3ul of the double distilled water is added into the mixture to be mixed into a system with 15ul of the reaction conditions: 2 minutes at 94 ℃; 2: 10 seconds at 98 ℃, 10 seconds at 58 ℃ and 10 seconds at 68 ℃; 3: repeating the step 2 for 25 times; 4: 68 ℃ for 4 minutes and 25 ℃ for 4 minutes.

3) And (3) carrying out enzyme digestion-connection on the binary vector and the sgRNA expression cassette. Performing enzyme digestion connection by temperature-changing circulation for about 10-15 circulation at 37 ℃ for 5 minutes; 5 minutes at 10 ℃ and 5 minutes at 20 ℃; finally 5 minutes at 37 ℃.

4) And (3) after the constructed vector is verified to be correct through sequencing, extracting a plasmid, and then transforming agrobacterium GV 3101. The Agrobacterium-mediated transformation of the hypocotyl is carried out as described in example 3.

The genotype detection method for gene editing is as follows: the invention utilizes a high-flux sequencing method to detect the mutant genotype, and the laboratory mainly adopts a Hi-TOM sequencing method developed by a master task group of King kejian to carry out two rounds of overlapping PCR: amplifying a target fragment by using a target primer in the first round of PCR; amplifying the first round PCR product by using a universal primer in the second round PCR, wherein the universal primer adds a next-generation sequencing sequence element and a barcode sequence at two ends of a target fragment; purifying PCR products and then carrying out second-generation high-throughput sequencing; finally, after a simple data extraction, the specific mutation pattern of each individual was analyzed using the online website Hi-Tom (http:// www.hi-Tom. net/Hi-Tom /).

Culture medium used for genetic transformation:

m0 medium: 1/2MS (2.2g/L) and sucrose (30g/L), adjusting pH to about 5.8, adding agar 8g/L, and sterilizing at high temperature;

DM suspension: MS (4.4g/L) + sucrose (30g/L), adjusting pH to about 5.8, adding agar 8g/L, sterilizing at high temperature, and adding acetosyringone to give a final concentration of 100 μ M;

m1 medium: MS (4.4g/L), sucrose (30g/L), mannitol (18g/L), 2,4-D (1mg/L), KT (0.3mg/L), pH is adjusted to about 5.8, agar is added for 8g/L, and then high-temperature sterilization is carried out, and acetosyringone is added to the mixture for use until the final concentration is 100 mu M;

m2 medium: MS (4.4g/L) + glucose (10g/L) + mannitol (18g/L) +2,4-D (1mg/L) + KT (0.3mg/L), adjusting pH to about 5.8, adding agar 8g/L, sterilizing at high temperature, and adding silver thiosulfate (final concentration of 30 μ M) and antibiotics (such as hygromycin and timentin) when in use;

m3 medium: MS (4.4g/L) + sucrose (30g/L) + xylose (0.25g/L) + MES (0.6g/L), pH adjusted to about 5.8, agar 8g/L, and then sterilized at high temperature. When in use, hormones ZT (final concentration is 2mg/L), IAA (final concentration is 0.1mg/L) and AgNO3 (final concentration is 3mg/L), and antibiotics (such as hygromycin and timentin) are added;

m4 medium: MS (4.4g/L) + sucrose (10g/L), adjusting pH to about 5.8, adding agar 8g/L, and sterilizing at high temperature.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of agriculture in Huazhong

<120> major gene for controlling rape leaf shape and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1769

<212> DNA

<213> rape (Brassica campestris L)

<400> 1

atggaatggt caacgacgag caatgttgaa aacacgagag ttgcttttat gccacttcag 60

tggctggagt ctaactcatc caactcgctc caaaacttca gctatgatcc ttatgcaggt 120

atattcattc acatgcatct ttatatccat ctttttgtgg atttgttgta attccggttg 180

agttttaaaa tttccaccaa aatatagcta ggtttgcatt aaattttgaa aaggtagcac 240

cattaatggc gagagattaa aaagaaaata ttagtatttt atttttatga tttttttaaa 300

gaaaattaaa gaaatatgaa tggtcagttg aatgacactt gtataataga attctcaaaa 360

tttgtgcaaa atgtttaaaa ttgaaaccat ttttcctctt tttattattt tctttaattt 420

taattatgag agactcagag aaatacgcct actatttcca tttttggaaa agattcgatt 480

ttatacagta ctccagtata tgactttttt gagggaacgg gaaaaacgtt ttgcaattct 540

aaaaatcttg gaattatcac gcttttctta tgagaagtag gatatagacc accgatattc 600

ttatgacttt cttggaacca tgctcagtgt ttcaaaagta gaaacgtcgc ttttcaaatg 660

ttttgagatt cgttttctcg ctcaagaaaa actggaaagt tttttttttg tattgtattt 720

gaaattatta ttgttgagcg tttgtgtcgt tctctttgtt tttgttgtta agttttacca 780

ggaaattcgt ctacgcccgt ccttacgcaa accggaccgg ttatttctgt accggaatca 840

tcagaaaaga tcaccaatgc gtgcccatat ccaagtaacg acgacgagat gataaagaag 900

aagcagaaac taacgactga acaattagct tcacttgaac agagttttca agaagatatc 960

aaacttgatt cagacaggaa ggtgaagctg tcgaaggagc ttcgtctgca gccacgtcag 1020

gtagctgttt ggttccagaa ccgccgtgca cggtggaggg tgaagcatct cgaggagtcg 1080

tacaactcgc taaggaaaga gtacgacgtg gtttcaagac agaatcaaat gctacacgat 1140

gaggtatata tatatatata tattttcttt ttttgacaac gcacgatgag gtatatatat 1200

gcaccattta aaaaaaaaaa tcatgggatc ttagagcatc cgtctccctt tagatattca 1260

cctaggtaat tgatagataa aatattacta gtagttattt aatatagttt atttaatgat 1320

tacattagaa atcatactaa aagtaagcaa atcatagatt gccatataac tttaagagta 1380

tctccagttt tttttttttt ttttttaagt ttctcaaact ccgtcattta tctctctact 1440

ttttgagttc tttttttttc ttcactacat tttcaaaatt tcttatttta taatgatcag 1500

atattcggtt gagatacacc aatgtgattt ctaaactatt catcctttgt tgttttagcc 1560

ctttagtttt tgattttgtg acgcaggtga tgaatctgag aggtgtaata ctaaaagacc 1620

atttgatgaa gaggcaaatg aatctgaaca acaatcaaat agccggaggg agtcaaattt 1680

acggtactgc agatcaatat aataatccaa tgtgtgttgc ttcaacttgt tggcccccgt 1740

tatcatcgca acagccttac ccatggtag 1769

<210> 3

<211> 223

<212> PRT

<213> rape (Brassica campestris L)

<400> 3

Met Glu Trp Ser Thr Thr Ser Asn Val Glu Asn Thr Arg Val Ala Phe

1 5 10 15

Met Pro Leu Gln Trp Leu Glu Ser Asn Ser Ser Asn Ser Leu Gln Asn

20 25 30

Phe Ser Tyr Asp Pro Tyr Ala Val Leu Pro Gly Asn Ser Ser Thr Pro

35 40 45

Val Leu Thr Gln Thr Gly Pro Val Ile Ser Val Pro Glu Ser Ser Glu

50 55 60

Lys Ile Thr Asn Ala Cys Gln Tyr Pro Ser Asn Asp Asp Glu Met Ile

65 70 75 80

Lys Lys Lys Gln Lys Leu Thr Thr Glu Gln Leu Ala Ser Leu Glu Gln

85 90 95

Ser Phe Gln Glu Asp Ile Lys Leu Asp Ser Asp Arg Lys Val Lys Leu

100 105 110

Ser Lys Glu Leu Arg Leu Gln Pro Arg Gln Val Ala Val Trp Phe Gln

115 120 125

Asn Arg Arg Ala Arg Trp Arg Val Lys His Leu Glu Glu Ser Tyr Asn

130 135 140

Ser Leu Arg Lys Glu Tyr Asp Val Val Ser Arg Gln Asn Gln Met Leu

145 150 155 160

His Asp Glu Val Met Asn Leu Arg Gly Val Ile Leu Lys Asp His Leu

165 170 175

Met Lys Arg Gln Met Asn Leu Asn Asn Asn Gln Ile Ala Gly Gly Ser

180 185 190

Gln Ile Tyr Gly Thr Ala Asp Gln Tyr Asn Asn Pro Met Cys Val Ala

195 200 205

Ser Thr Cys Trp Pro Pro Leu Ser Ser Gln Gln Pro Tyr Pro Trp

210 215 220

Claims

1. The major gene for controlling rape leaf shape is BnaA10.RCO gene or allele thereof, wherein the nucleotide sequence of the BnaA10.RCO gene is shown as SEQ ID NO: 1 is shown.

2. A protein regulating rape leaf shape encoded by the major gene of claim 1.

3. An expression vector containing the main effective gene for controlling the leaf shape of rape.

4. The expression vector containing a major gene controlling rape leaf shape according to claim 3, wherein the expression vector is PMDC32 vector containing the major gene of claim 1.

5. The major gene for controlling rape leaf shape, the protein coded by the gene and the application of the expression vector containing the gene in regulating and controlling rape leaf shape.

6. A construction method of an expression vector containing a main effect gene for regulating and controlling rape leaf shape is characterized by comprising the following steps:

7. The method for constructing an expression vector containing a major gene regulating rape leaf shape according to claim 6, wherein the primers used for amplifying the BnaA10.RCO genomic DNA sequence in the step S1-1 are:

A10-117F：GGGCttaattaaCTACCATGGGTAAGGCTGTTGC

A10-118R：GACAggtaccATGGAATGGTCAACGACGAGC。

8. a cloning method of a major gene for controlling rape leaf shape is characterized by comprising the following steps:

s2-4, connecting the major gene BnaA10.RCO to an expression vector and transferring the gene into a receptor material by an agrobacterium-mediated hypocotyl transformation method.

9. The method for cloning major gene controlling leaf shape of rape as claimed in claim 8, wherein the candidate genes determined in step S2-1 are BnaA10.RCO and BnaA10.LMI 1.

10. The method for cloning a major gene controlling leaf shape of rape as claimed in claim 9, wherein the nucleotide sequence of the primer used in BnaA10.RCO cloning in step S2-2 is:

A10_101F：TCTCCAAGATCCGAAACACCT

A10_101R：ATGGAATGGTCAACGACGAGC。