CN111893123B - Application of rice gene LJS3-1 and homologous gene thereof in controlling growth of leaf pillows and leaf included angle of rice - Google Patents

Abstract

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice geneLJS3‑1And the application of the homologous gene thereof in controlling the development of rice leaf pillows and the size of leaf included angles. The present invention obtains a geneLJS3‑1（GENE ID：Os04g0549700) And homologous genes thereofLJS3‑1L（GENE ID：Os02g0656600，Homology is 57.58%). Knock-out by gene knock-out techniqueLJS3‑1Gene and homologous gene thereofLJS3‑1LThe double mutant shows that the included angle is obviously smaller than that of the wild type, and the plant type is upright. The phloroglucinol staining of the cross section of the leaf pillow of the double mutant is more red than that of the wild type through staining observation of phloroglucinol staining solution of the bare-handed sliced leaf pillow of the flag leaf in the heading period, which shows that the accumulation of lignin is increased compared with that of the wild type (Nipponbare) and the mechanical strength of the leaf pillow is increased. Thus, simultaneous knock-out by genetic engineering techniquesLJS3‑1Gene and homologous gene thereofLJS3‑1LThe gene can change the mechanical strength of the plant leaf pillow and the formation of leaf included angle, thereby improving the plant type and planting density of the plant and increasing the yield.

Description

Application of rice gene LJS3-1 and homologous gene thereof in controlling growth of leaf pillows and leaf included angle of rice

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a rice geneLJS3-1And the application of the homologous gene thereof in controlling the development of the leaf pillow and the leaf angle of the rice.

Background

Rice leaves are divided into three categories, including coleoptiles, incomplete leaves and complete leaves. Coleoptiles are the first white coleoptiles to appear during germination, are leaf deformations, and have no chlorophyll. Incomplete leaves are the first green leaves that grow from the coleoptile, only the coleoptile, without leaf and leaf pillow structures. The complete leaf is from the second green leaf, with leaf, leaf sheath, and leaf pillow. The main function of the leaves is as an organ for photosynthesis. The leaf sheath wraps the main stem to enhance the supporting effect of the stem. The leaf pillow is a kind of mechanical tissue specific to monocotyledon gramineous plants, and is a mechanical tissue for connecting leaves and leaf sheaths, and comprises She Zhendai, leaf ears and leaf tongues. She Zhendai acts as a mechanical tissue that allows the leaves to be angled away from the main stem after they have grown from the sheath (Hoshikawa and Ichii, 1989). Therefore, the existence and development degree of the leaf pillow directly determine the size of the leaf angle, thereby influencing the plant type and yield of the rice.

The growing population also has an increasing demand for food. Improving the rice yield is always a hot spot and a key point of rice breeding research and gene function research. In 1968, donald proposed the concept of breeding of ideal plant types of crops, i.e. selection of traits related to influence plant photosynthesis, growth and seed yield (Donald, 1968). The characteristics influencing the plant type of rice mainly comprise plant height, tillering number, spike type, grain type, leaf shape, leaf angle, tillering angle and the like, wherein the size of the leaf angle is an important agronomic characteristic determining the uprightness of the leaf blade (Feng Rongkun, 2006). The upright leaves can enhance the light capturing ability of photosynthesis, serve as a nitrogen source for grain filling, and can also increase planting density, thereby improving leaf area index and rice yield (Sakamoto, et al, 2006).

Disclosure of Invention

The invention aims to obtain a gene for regulating and controlling the development of a rice leaf pillow and the leaf angleLJS3-1And homologous genes thereofLJS3-1L。

It is another object of the present invention to provideLJS3-1And homologous genes thereofLJS3-1LThe application in controlling the development of the leaf pillow and the leaf angle of the rice.

In order to achieve the purpose, the invention clones genes for regulating and controlling the development of the leaf occiput from rice leaf occiput tissues by a reverse genetics methodLJS3-1Gene and homologous gene thereofLJS3-1L。

In particular, for cloningLJS3-1Gene and homologous gene thereofLJS3-1LThe primer sequences of (a) are as follows:

LJS3-1-F CGGGATCCATGGAAGCAGACGCGAGCCATA

LJS3-1-R GCGTCGACCTCGGCCCACAAGAGTGGCTCA

LJS3-1L-F CGGGATCCATGGAAGCTGCCGCGATCC

LJS3-1L-R GCGTCGACGTCAGGCTGCACGGGCGC

in particular, for cloningLJS3-1Gene and homologous gene thereofLJS3-1LThe PCR conditions of (1) were: denaturation at 94 ℃ for 3 min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min for 35cycles, and elongation at 68 ℃ for 10min.

In particular, for cloningLJS3-1Gene and homologous gene thereofLJS3-1LThe total volume of the PCR reaction system (2) was 50. Mu.l, the template was Nipponbare cDNA 1. Mu.l (about 50 ng), 10 XKOD enzyme reaction buffer 5. Mu.l, and MgCl 25mM ₂ Mu.l, 5mM dNTP 5. Mu.l, 5 uM primers 5. Mu.l (2.5. Mu.l each), 1. Mu.l KOD enzyme, ddH2O (sterile deionized water) to 50. Mu.l.

The invention obtains the nucleotide containing SEQ ID NO.1 by the methodLJS3-1Gene sequence and nucleotide containing SEQ ID NO.2LJS3-1LA gene sequence.

The invention also obtainsLJS3-1The amino acid sequence of the gene code is shown as SEQ ID NO.3,LJS3- 1Lthe amino acid sequence of the gene code is shown as SEQ ID NO. 4.

The genes identified by the bioinformatics method are all genes for regulating and controlling the development of the leaf sleepers, and the genes are verified by utilizing RNA-seq data of the leaf sleepers in different periodsLJS3-1Gene and homologous gene thereofLJS3-1LExpression specificity during leaf pillow development.

LJS3-1Gene and homologous gene thereofLJS3-1LThe application in the improvement of gramineous crops.

LJS3-1Gene and homologous gene thereofLJS3-1LThe application in improving the plant type of rice and increasing the yield of rice.

LJS3-1Gene and homologous gene thereofLJS3-1LApplication in regulating and controlling development of rice leaf pillow and leaf angle, and during application, the construction containsLJS3-1Gene and homologous gene thereofLJS3-1LCRISPR/CAS9 vector of (1), and transferred into Nipponbare, knock-outLJS3-1And homologous genes thereofLJS3-1LThe gene, the obtained transgenic line shows that the included angle of the leaves is smaller than that of the wild type (Nipponbare), so that the method can increase the lignin accumulation of the thick-walled tissues of the leaf pillows to improve the leaf pillows machineryStrength, reduced leaf angle, improved plant type and planting density, increased yield, and controllable leaf pillow growth and leaf angle of rice.

Compared with the prior art, the invention has the beneficial effects that:

1. LJS3-1gene and homologous gene thereofLJS3-1LIs a gene specifically expressed in the late development stage of the rice leaf pillow, which makes it possible to change the crop angle without affecting other characters.

2. LJS3-1Gene and homologous gene thereofLJS3-1LThe gene is an effective gene for changing the leaf angle, can change the lignin accumulation and the mechanical strength of thick-wall tissues of the leaf pillow, and further change the leaf angle of crops.

3. At present, the gene for regulating and controlling the leaf angle by changing the mechanical strength of the leaf pillow is few, and the gene discloses that the gene participates in the regulation and control of the leaf angle by controlling the lignin accumulation and the mechanical strength of the thick-wall tissue of the leaf pillow.

4. At present, the mechanism research of improving the yield of the plant with the upright plant type is less,LJS3-1andLJS3-1Lfollowing successful knockdown using CRISPR/Cas9, rice yield was increased at high density by increasing the number of fertile ears per unit area (as shown in figure 6).

Drawings

FIG. 1 shows the results of RNA-seq sequencing, in which FIG. 1a showsLJS1-1Specific expression in early development stage of rice leaf pillow, FIG. 1b isLJS4-1Specific expression in late development stage of rice leaf pillow, FIG. 1c isLJS3-1And homologous genes thereofLJS3-1LSpecific expression in S3 and S4 stages of rice leaf pillow development, respectively, FIG. 1dLJS5-1Specific expression in late development of rice leaf pillow, FIG. 1eLJS1S2-1Specific expression in early development stage of rice leaf pillow, FIG. 1f isLJS4-2Specific expression in late development stage of rice leaf pillow, FIG. 1g isLJS5-2And homologous genes thereofLJS5-2LSpecific expression is carried out in S4 and S5 stages of rice leaf pillow development;

FIG. 2 shows leaf angle phenotype and heading stage plant phenotype of CRISPR/CAS9 target gene-knocked transgenic rice seedling and leaf angle between knocked transgenic rice seedling and wild type (Nipponbare)Size statistics, wherein the target gene of FIG. 2a isLJS1-1And homologous genes thereofLJS1-1L(ii) a FIG. 2b target geneLJS4-1(ii) a FIG. 2c target gene isLJS3-1And homologous genes thereofLJS3-1L(ii) a FIG. 2d target geneLJS5-1(ii) a FIG. 2e target geneLJS1S2-1And homologous genes thereofLJS1S2-1L(ii) a FIG. 2f target genesLJS4-2(ii) a FIG. 2g target geneLJS5-2And homologous genes thereofLJS5-2L；

FIG. 3 is a diagram showing the changes of the cytological structures of the leaf pillows of the young leaves of the sword-like leaf of the CRISPR/CAS9 target gene-knocked transgenic rice and wild type (Nipponbare), wherein the target gene in FIG. 3a is the target geneLJS1-1And homologous genes thereofLJS1-1L(ii) a FIG. 3b target geneLJS4-1(ii) a FIG. 3c target geneLJS3-1And homologous genes thereofLJS3-1L(ii) a FIG. 3d target genesLJS5-1(ii) a FIG. 3e target geneLJS1S2-1And homologous genes thereofLJS1S2-1L(ii) a FIG. 3f target genesLJS4-2(ii) a FIG. 3g target geneLJS5-2And homologous genes thereofLJS5-2L；

FIG. 4a is a graph showing the expression level change of target genes regulated by Real-time PCR (polymerase chain reaction) for verifying that target genes for promoting and inhibiting lignin synthesis in transgenic rice after target genes are knocked out by CRISPR/CAS9, wherein the target genes in FIG. 4a areLJS4-1FIG. 4b target gene isLJS3-1And homologous genes thereofLJS3-1LFIG. 4c target geneLJS1S2-1And homologous genes thereofLJS1S2-1LFIG. 4d target geneLJS4-2；

FIG. 5 is a drawing showingpLJS1S2-1::LJS1S2-1Analyzing the seedling phenotype and expression quantity of the transgenic rice line;

FIG. 6 shows the effect of CRISPR/CAS9 target gene-knocked transgenic rice on yield, in which the target gene in FIG. 6a is LJS1-1 and its homologous gene LJS1-1L, and the target gene in FIG. 6b is LJS1-1LLJS4-1FIG. 6c target geneLJS3-1And homologous genes thereofLJS3-1LFIG. 6d target geneLJS5-1FIG. 6e target geneLJS1S2-1And homologous genes thereofLJS1S2- 1LFIG. 6f target genesLJS4-2FIG. 6g target geneLJS5-2And homologous genes thereofLJS5-2L。

Detailed Description

The invention clones gene from rice leaf pillow tissue by reverse genetics methodLJS1-1 (GENE ID：Os01g0922800) And homologous genes thereofLJS1-1L (GENE ID：Os08g0531900Homology of 45.83%), geneLJS4-1（GENE ID：Os03g0182800) Genes, genesLJS3-1（GENE ID：Os04g0549700) And homologous genes thereofLJS3-1L（GENE ID：Os02g0656600，Homology of 57.58%), geneLJS5-1（GENE ID：Os06g0166400) Genes, genesLJS1S2-1（GENE ID：Os06g0181700) And homologous genes thereofLJS1S2-1L（GENE ID：Os02g0797100，Homology of 71.59%), geneLJS4-2（GENE ID：Os07g0674800) Genes, genesLJS5-2（GENE ID：Os10g0536100) And homologous genes thereofLJS5-2L（GENE ID：Os03g0122600Homology is 63.88%), the obtained genes are identified to be the genes for regulating the development of the leaf occiput by a bioinformatics method, and the expression specificity of the obtained genes in the development process of the leaf occiput is verified by using RNA-seq data of the leaf occiput at different periods. The gene is transferred into Nipponbare through a transgenic method, and the target gene is found to be capable of regulating and controlling the leaf angle of rice, so that the plant type and the planting density of plants are improved, the yield is increased, and the regulation and control of the leaf pillow development and the leaf angle of the rice are realized.

The specific implementation method is as follows, and it should be noted that the following gene synthesis processes or rice application tests are all conventional test methods and technical means in the field unless otherwise specified; the reagents or biomaterials referred to, if not specifically indicated, are either disclosed or are commercially available products which can be purchased directly.

Examples

(A)LJS1-1Gene and homologous gene thereofLJS1-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice comprises the following specific steps:

1. gene for regulating and controlling development of rice leaf pillow and leaf angleLJS1-1And homologous genes thereofLJS1-1LObtained by

1.1 reactionThe total volume of the reaction system was 50. Mu.l, the template was Nipponbare cDNA 1. Mu.l (about 50 ng), 10 XKOD enzyme reaction buffer 5. Mu.l, and MgCl 25mM ₂ Mu.l, 5mM dNTP 5. Mu.l, 5. Mu.l of 5. Mu.M primer (using stepwise PCR with primers LJS1-1-F and LJS1-1-R or LJS1-1L-F and LJS1-1L-R (each primer is 2.5. Mu.l), 1. Mu.l KOD enzyme, plus ddH ₂ O (sterile deionized water) to 50. Mu.l.

1.2 the reaction sequence is: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min 35cycles, and elongation at 68 ℃ for 10min.

1.3 the primers used were as follows:

LJS1-1-F CGGGATCCATGGCGCGGAGGGGGAGA

LJS1-1-R GCGTCGACTGCACTTCCTTCCTCCTGCC

LJS1-1L-F CGGGATCCATGGAGGGAGGAGGGAGGAGG

LJS1-1L-R GCGTCGACAGAGCTCACTCCTGATCTTGGCT

2. validation of genes Using RNA-seq dataLJS1-1And homologous genes thereofLJS1-1LSpecific expression in rice leaf pillow

Under normal conditions, young Japanese fine rice seedlings growing 4, 5, 6, 7 and 9 days from seed soaking are respectively defined as the first stage (S1), the second stage (S2), the third stage (S3), the fourth stage (S4) and the fifth stage (S5) of leaf pillow development. The leaf and leaf pillow of the first full leaf were taken separately, total RNA was extracted using the Tiangen RNAprep pure Plant Kit (Tiangen), and then RNA-seq sequencing was performed.

Obtaining a differential gene set specifically expressed in five periods and corresponding GO terms subjected to function enrichment analysis through bioinformatics analysis, selecting the differential gene set comprising single-period specific expression gene sets M01-M05 and a GO terms gene set related to leaf sleeper development, extracting a promoter sequence, analyzing enriched motifs (motifs) on the promoter by using MEME software, selecting the first 10 genes and meeting the condition that E-value is less than or equal to 10 ^-6 As possible transcription factor binding sites (pTFBSs); then, the pTFBSs are compared with the known TFBSs by using TOMTOM software and JASPAR CORE database, and the consistency of q-value less than or equal to 0.05 and p-value less than or equal to 10 are selected ^-4 Known TFBSs of the conditions, thereby obtaining pTFKnown TFs corresponding to BSs; then, BLASTP (e-value ≦ 10) ^-10 ) Searching for homologous genes of the known TFs in rice; the definition of the candidate TFs meets two conditions, wherein the first condition is that the plant TFDB is identified to belong to a corresponding transcription factor family, and the second condition is that the TFs and the corresponding target genes specifically expressed in the same period have high correlation of expression trend (PCC is more than or equal to 0.9). The invention obtains the gene by analyzing the differential gene set M01 specifically expressed in the S1 phase as aboveLJS1-1And homologous genes thereofLJS1- 1L。Finally, the gene was obtainedLJS1-1And homologous genes thereofLJS1-1LExpression levels in leaves and leaf pillows at five stages. Discovery of genesLJS1-1S1 is specifically expressed in leaf pillow development (FIG. 1 a).

3. LJS1-1Gene and homologous gene thereofLJS1-1LRegulation and control of rice leaf pillow

3.1 Construction of CRISPR/Cas9 vector

Using genes containingLJS1-1And homologous genes thereofLJS1-1LThe CRISPR target site sequence of (1) is cloned into pCXUN-CAS9 vector by using KpnI enzyme cleavage site, and the specific method is disclosed in He, Y., zhang, T., yang, N., xu, M., yan, L., wang, R., and Zhao, Y. (2017). Self-cleaning ribozymes able the production of guide RNAs from unlimited microorganisms for CRISPR/Cas9 mediated gene editing, journal of genetics and genetics = Yi ch xue bao 44,469-472.

Wherein the gene is obtainedLJS1-1And homologous genes thereofLJS1-1LThe total volume of the reaction system of the CRISPR target site fragment of (3) is 50 μ l,LJS1-1the gene adopts 1 mul (about 50 ng) of U6 vector as a template;LJS1-1Lthe template used for the gene was 1. Mu.l (about 50 ng) of U3 vector, 5. Mu.l of 1 XKOD enzyme reaction buffer, and 25mM MgCL ₂ Mu.l, 5mM dNTP 5. Mu.l, 5 uM primer 5. Mu.l (2.5. Mu.l for forward and reverse primers, respectively), 1. Mu.l KOD enzyme, ddH2O (sterile deionized water) to 50. Mu.l.

The reaction procedure is as follows: denaturation at 94 ℃ for 5min, denaturation at 94 ℃ for 30s, denaturation at 55 ℃ for 1min, denaturation at 68 ℃ for 2min 35cycles, and elongation at 68 ℃ for 10min.

The primers used were:

LJS1-1-U6F GGTGCGGTTCTCCAAGAGGAgttttagagctagaaatagcaagtta

LJS1-1-U6R TCCTCTTGGAGAACCGCACCAACCTGAGCCTCAGCGCAGC

LJS1-1L-U3F ATCGCACCTGCCGGCTCGTCgttttagagctagaaatagcaagtta

LJS1-1L-U3F GACGAGCCGGCAGGTGCGATgccacggatcatctgcacaactc

to obtainLJS1-1Sequence fragment sequence of target site andLJS1-1Lthe sequence fragment of the target site, and cloning the fragment into pCXUN-CAS9 vector using KpnI enzyme cleavage site.

Taking 2 μ l of the extract containingLJS1-1AndLJS1-1Lthe pCXUN-CAS9 vector of the target was added to 50. Mu.l of EHA105 competence and mixed well. Adding into a pre-cooled electric shock cup for electric shock conversion. Electric laser instrument parameter setting: voltage 2.45 kV, resistance 200 Ω, capacitance 200 μ F.

3.2 Genetic transformation of rice

The rice transformation in the following method adopts agrobacterium EHA105 mediated genetic transformation method, and the specific steps are as follows:

3.2.1 callus Induction

Removing hull from rice seed, soaking plump and clear seed in 70% ethanol for 1min, and washing with sterile water for 1-2 times; then adding NaClO solution containing 2% active chlorine (40 ml NaClO solution containing >5.2% active chlorine and 60 ml water), adding 1-3 drops of Tween 20, and soaking for more than 30 min (generally 40 min, the maximum can be 1 h). Shaking occasionally, and then rinsing with sterile water 4-5 times. Pouring on a sterilized flat plate and filter paper, and sucking for about 1 h; placing the seeds on an N6D solid culture medium (10 grains/25 ml/bottle), enabling the seeds to face upwards or contact with the culture medium, and culturing at 28 ℃ in dark for 25-30 days. N6D medium: n6 salts and vitamins, 0.5g/l casein hydrolysate, 30g/l sucrose, 2mg/l 2,4-D,2.5g/l Phytagel (Sigma), pH5.8.

3.2.2 culture of Agrobacterium and Co-culture with Rice callus

Scraping Agrobacterium with a small sterilized spoon, sticking the thallus on the wall of the tube with the back of the spoon, and gently patting to obtain OD ₆₀₀ = 0.8-1.0; air pre-cultured callus on sterile filter paperThen concentrating the bacteria solution into a plate and transferring the bacteria solution into the bacteria solution at one time, slightly rotating the centrifugal tube to uniformly distribute the bacteria solution, and standing for about 15-20 min; pouring out the bacterial liquid, placing the callus on sterile filter paper for about 1.5 h to ensure that the bacterial liquid is sucked dry, connecting the bacterial liquid to 1/2 N6D AS, culturing in dark at 20 ℃ for 2-3 days, and observing that the contact part of the callus and the culture medium has a bacterial film, so that the bacteria can be removed; 1/2 N6D AS medium: N6D2, 10g/l glucose, 100 to 400 mu mol/l acetosyringone (added when used), pH5.2.

3.2.3 removal of Agrobacterium

Putting the co-cultured callus into a centrifuge tube of 50 ml, washing with sterile water for more than 3 times until the liquid is clear, pouring out sterile water, N6D + Cn 500 mg/L (or AP500 ml/L), 100 rpm, 15-20 min,2-3 times; pouring the callus on sterile filter paper, and sucking for about 2h as the case may be; transferring the dried callus into N6D-AS, adding cefamycin Cn250 mg/L, culturing at 28 ℃ in dark for 7-10 days.

3.2.4 selection of callus

Picking out the callus which is not polluted by agrobacterium, adding Cn250 mg/L and Hn (50 mg/L) for the first time for 15-20 days; the second time is the same as above, add no Cn, add hygromycin Hn, all calluses are transferred again, 15-20 days. Selecting new callus for the third time, and screening by Hn for 15-20 days; the number of times part is arranged according to the above, but the callus screening time on Hn is at least 45 d, and the newly grown callus picked out for the third time is preferably 20d; N6D screening medium: N6D + Cn250 mg/L + Hn50 mg/L, pH = 5.8-5.9.

3.2.5 differentiation and rooting

Transferring all callus tissues screened for the fourth time into MS, hn50 mg/L, dark culturing, and pre-differentiation (pH 5.9) for 12-15 d. Selecting fresh callus with good growth vigor, transferring the callus into MS (PH 6.0), culturing by light for 15-20 d to show that green buds grow out, and generally changing 15d into a culture medium once; selecting green buds with the length of more than 1cm, peeling redundant calluses around the green buds, cutting off roots (the length of the cut roots can be about 0.5 cm), transferring the cut roots into a test tube, and carrying out rooting culture on 1/2 MS. MS differentiation medium: MS salts and vitamins, 2g/L casein hydrolysate, 30g/L sucrose, 25g/L sorbitol, 2 mg/L6-BA, 0.5mg/L NAA,0.2mg/L Zeatin (Zeatin), 0.5mg/L KT,3.0g/L Phytagel, pH5.8, 50mg/L hygromycin B,200mg/L cefuroxime. 1/2MS rooting medium: 1/2MS salt, MS vitamins, 30g/l sucrose, 1mg/l paclobutrazol, 0.5mg/l NAA,50mg/l hygromycin, 2.5g/l Phytagel, pH5.8.

4. Transplantation, expression level identification and phenotypic analysis

Genetically constructing 20 lines of each rooted transgenic plant, transplanting in greenhouse, and genetically constructingLJS1-1And homologous genes thereofLJS1-1LThe CRISPR transgenic plant adopts leaves to extract DNA, and amplified and edited segments identify mutant single plants.

The primers used were as follows:

LJS1-1-genomeF CATCCGCCTCGTCAAATGC

LJS1-1-genomeR CGGGATAGCAGAACGAAATGG

LJS1-1L-genomeF GGATTCCCTCACCACCACATTA

LJS1-1L-genomeR CGCAGTGGAGTGGAGTACAT

5. determination of the yield

In the field toLJS1-1-cri/LJS1-1L-criAnd carrying out yield measurement under different planting densities with wild type Ni. Normal density (Normal, N) was planted at 30cm row spacing and 15cm plant spacing, averaging 22.2 rice plants per square meter. High density (Dense, D) was planted at 15cm row spacing and 15cm plant spacing, with an average of 44.4 rice plants per square meter. Each treatment was repeated three times in random blocks. Each cell is 2m long and 2m wide. And (4) character investigation, namely selecting intermediate plants except peripheral plants for statistics. Data processing was performed using SPSS 17.0. Multiple comparisons were performed using Tukey's Home Significant Differencetest (P < 0.05).

(II) LJS4-1The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS4-1-F CGGGATCCATGTGCGGCGGTGCAATCCTC

LJS4-1-R GCGTCGACGTCGAGCAGAAGAGAGGCCTG

step 2. The cell wall-associated GO term gene set of S4 stage-specific differential gene expression was analyzed as aboveTo obtainLJS4-1。Finally, obtainLJS4-1Expression level in leaf pillows in five stages. Discovery of genesLJS4-1S4 is specifically expressed in leaf occipital development (FIG. 1 b).

Step 3.1 GeneLJS4-1The template is a U6 carrier, and the primers are as follows:

LJS4-1-U6F GGGGGACGACACACATGACAgttttagagctagaaatagcaagtta

LJS4-1-U6R TGTCATGTGTGTCGTCCCCCAACCTGAGCCTCAGCGCAGC

the primers used in step 4 are:

LJS4-1-genomeF CAATCCTCGCCGATTTCACC

LJS4-1-genomeR GCTCTTCTTGCTCGCCTTC

(III)LJS3-1Gene and homologous gene thereofLJS3-1LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS3-1-F CGGGATCCATGGAAGCAGACGCGAGCCATA

LJS3-1-R GCGTCGACCTCGGCCCACAAGAGTGGCTCA

LJS3-1L-F CGGGATCCATGGAAGCTGCCGCGATCC

LJS3-1L-R GCGTCGACGTCAGGCTGCACGGGCGC

obtaining a nucleotide comprising the nucleotide of SEQ ID NO.1LJS3-1Gene sequence and nucleotide containing SEQ ID NO.2LJS3-1LThe sequence of the gene(s),LJS3-1the amino acid sequence of the gene code is shown in SEQ ID NO.3,LJS3-1Lthe amino acid sequence of the gene code is shown in SEQ ID NO. 4.

Step 2. The differential gene sets M03 and M04 specifically expressed in S3 stage and S4 stage were analyzed as above to obtainLJS3-1AndLJS3-1L。finally, obtainLJS3-1And homologous genes thereofLJS3-1LExpression level in leaf pillows at five stages. Discovery of genesLJS3-1And homologous genes thereofLJS3-1LS3 and S4 are specifically expressed in leaf occipital development, respectively (FIG. 1 c).

Step 3.1LJS3-1The gene adopts 1ul (about 50 ng) of U6 vector as a template;LJS3-1LgeneThe template used was 1ul (about 50 ng) of U3 vector and the primers used were:

LJS3-1-U6F GGCCGCTCTCTTGCGCTTCTgttttagagctagaaatagcaagtta

LJS3-1-U6R AGAAGCGCAAGAGAGCGGCCAACCTGAGCCTCAGCGCAGC

LJS3-1L-U3F ACAAGCAGCTCAAGCGGAAGgttttagagctagaaatagcaagtta

LJS3-1L-U3R CTTCCGCTTGAGCTGCTTGTgccacggatcatctgcacaactc

to obtainLJS3-1Sequence fragment of target siteagaagc gcaagagagc ggccAndLJS3-1Lsequence fragment of target siteacaagcagct caagcggaag。

The primers used in step 4 are:

LJS3-1-genomeF CAGACCGCACTTCCATCGA

LJS3-1-genomeR GATCTCCGACACCCACTTCC

LJS3-1L-genomeF CATCTCCTTCCTGCGGTATTCT

LJS3-1L-genomeR AGCCAGATGCGCGACTTCT

(IV)LJS5-1The application test of the gene in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS5-1-F CGGGATCCATGGATAGGAGGGAGGCCACC

LJS5-1-R GCGTCGACCTCGTCGTCGGAGGTGTCCG

step 2. The differential gene set M05 of S5 phase specific expression is analyzed as above to obtainLJS5- 1。ObtainingLJS5-1Expression level in leaf pillows at five stages. Discovery of genesLJS5-1S5 is specifically expressed in the development of leaf pillow (shown in FIG. 1 d).

The primers used in step 3.1 are:

LJS5-1-U6F GCGAGCCGAACAAGCGGTCGgttttagagctagaaatagcaagtta

LJS5-1-U6R CGACCGCTTGTTCGGCTCGCAACCTGAGCCTCAGCGCAGC

the primers used in step 4 are:

LJS5-1-genomeF GCGAGGATGGATAGGAGGGA

LJS5-1-genomeR TAGAACACGGCGGTGTCGTA

(V)LJS1S2-1Gene and homologous gene thereofLJS1S2L-1LThe application test in controlling the development of the rice leaf pillow and the leaf angle is the same as the test method.

The primers used in step 1.3 were:

LJS1S2-1-F CGGGATCCATGGCGCGGCCGCAGCA

LJS1S2-1-R GCGTCGACGCAGGAGATCTCCATGGAGAAGT

LJS1S2-1L-F CGGGATCCATGGCGAGGCCGCAGCAACGAT

LJS1S2-1L-R GCGTCGACGTAGCAGATCTCCATGGAGAAG

step 2. The differential gene set M06 with specific expression in both S1 and S2 phases is analyzed as above to obtainLJS1S2-1 and LJS1S2L-1L.Finally, obtainLJS1S2-1AndLJS1S2L-1Lexpression levels in leaves and leaf pillows at five stages. Discovery of genesLJS1S2-1 and LJS1S2L-1LS1 and S2 are specifically expressed in the development of leaf pillows (shown in FIG. 1 e).

Step 3.1 GeneLJS1S2-1Adopts a template as a U6 vector and a geneLJS1S2L-1The template is used as a U3 carrier, and the primers are as follows:

LJS1S2-1-U6F GGCACGCGCGTACGACGAGGgttttagagctagaaatagcaagtta

LJS1S2-1-U6R CCTCGTCGTACGCGCGTGCCAACCTGAGCCTCAGCGCAGC

LJS1S2-1L-U3F AGGCCGCAGCAACGATACCGgttttagagctagaaatagcaagtta

LJS1S2-1L-U3R CGGTATCGTTGCTGCGGCCTgccacggatcatctgcacaactc

step 3, also includes plant expression vectorpLJS1S2-1::LJS1S2-1The method comprises the following specific steps:

firstly, the method of fractional steps is utilizedLJS1S2-1Promoter (A)LJS1S2-1Promoter sequence obtained as above) linked to the fusion FLAG tag engineered in this laboratorypCAMBIA1300On the carrier skeleton (LJS 1S2-1-proF and LJS1S 2-1-proR) to obtainpCAMBIA1300-pLJS1S2-1Then will beLJS1S2-1full-Length cDNA was cloned using BamHI/SalIpCAMBIA1300- pLJS1S2-1Plant expression vectors were obtained from (LJS 1S2-1-OE-F and LJS1S 2-1-OE-R)pLJS1S2-1::LJS1S2-1And transferring to Nipponbare. The primers used were as follows:

LJS1S2-1-OE-F CGGGATCCATGGCGCGGCCGCAGCA

LJS1S2-1-OE-R GCGTCGACGCAGGAGATCTCCATGGAGAAGT

LJS1S2-1-proF CTATGACATGATTACgaattcTGGTTGGCTTGGCTGTGAT

LJS1S2-1-proR CCGCTGCGTGGGGTTggtaccTGCCGACGTCCTCGAGCTCG

and 4, genetically constructing 20 lines of each rooted transgenic plant, transplanting the transgenic plant into a greenhouse, extracting DNA (deoxyribonucleic acid) from the CRISPR transgenic plant of the LJS1S2-1 by adopting leaves, and identifying homozygous single plants (LJS 1S2-1-genome F and LJS1S2-1-genome R) by amplifying and editing fragments. The pLJS1S2-1 comprises that LJS1S2-1 transgenosis plants adopt leaves to extract plant protein, and western blot is used for expression quantity identification. The primers used were as follows:

LJS1S2-1-genomeF GCTCATGGGTCTCCGAGAT

LJS1S2-1-genomeR GAGCTCTGGTCCACGTACTGCTCCT

LJS1S2-1L-genomeF TCGGCGAAGTGCTCGATCA

LJS1S2-1L-genomeR CGAACGTGCCCAGCCATAT

(VI)LJS4-2The application test of the gene in controlling the development of the rice leaf pillow and the leaf angle is the same as the test method.

The primers used in step 1.3 were:

LJS4-2-F CGGGATCCATGTGTGGCGGCGCGATCATTT

LJS4-2-R GCGTCGACCATCGGCACGGCCGTGTGGAT

step 2. The cell wall related GO term gene set of S4 stage specific expression difference genes is analyzed as above to obtainLJS4-2。Finally, obtainingLJS4-2Expression level in leaf pillows in five stages. Discovery of genesLJS4-2Specific expression in leaf pillow development S4 (FIG. 1 f)

Step 3.1 GeneLJS4-2The template is used as a U3 carrier, and the primers are as follows:

LJS4-2-U3F ACGGCCGCCGCCTGATGCCAgttttagagctagaaatagcaagtta

LJS4-2-U3R TGGCATCAGGCGGCGGCCGTgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS4-2-genomeF CAGAGGAGCCGACCAAGAAG

LJS4-2-genomeR GGCGTCGTAGTCCATGAACT

(VII)LJS5-2Gene and homologous gene thereofLJS5-2LThe application test in controlling the development of the leaf pillow and the leaf angle of the rice is the same as the test method.

The primers used in step 1.3 were:

LJS5-2-F CGGGATCCATGGTGCGGGGGAGGACGGA

LJS5-2-R GCGTCGACACCTGTCTCCGACCGGTTGGA

LJS5-2L-F CGGGATCCATGGTGCGGGGGAAGACGCAGA

LJS5-2L-R GCGTCGACAGAATGGGGCATCGCTTGGCTA

step 2. The differential gene set M05 of S5 phase specific expression is analyzed as above to obtainLJS5- 2AndLJS5-2L。in the end of this process,LJS5-2expression level in leaf pillows at five stages. Discovery of genesLJS5-2Specifically expressed in S5 phase of leaf occipital development (FIG. 1 g).

Gene in step 3.1LJS5-2The template adopted by the gene is a U6 vector,LJS5-2Lthe gene adopts a U3 carrier as a template, and the primers are as follows:

LJS5-2-U6F GGATTGAGAACCCGACGAGCgttttagagctagaaatagcaagtta

LJS5-2-U6R GCTCGTCGGGTTCTCAATCCAACCTGAGCCTCAGCGCAGC

LJS5-2L-U3F ATTCGTAGAGCTTGCCGCGCgttttagagctagaaatagcaagtta

LJS5-2L-U3R GCGCGGCAAGCTCTACGAATgccacggatcatctgcacaactc

the primers used in step 4 are:

LJS5-2-genomeF CCTCGTCTCGTCTCGTCTCT

LJS5-2-genomeR TGCTTTATAGCGGTCGATGGT

LJS5-2L-genomeF CGTGTGGTTGGTTGGTTCA

LJS5-2L-genomeR CTGATGCTAATGAGGCTTCTCT。

as referred to in (a) aboveLJS1-1Gene and homologous gene thereofLJS1-1LThe test methods of (2) to (seven) were subjected to the relevant application tests, and the test results are shown in FIGS. 1 to 6.

Test results and conclusions

1. From FIG. 1a, it can be seen thatLJS1-1Specific expression in early development stage of leaf pillow; from FIG. 1b it can be seen thatLJS4-1Specific expression in S4 stage of leaf pillow development; from FIG. 1c it can be seen thatLJS3-1And homologous genes thereofLJS3-1LRespectively expressing specifically in S3 and S4 stages of leaf pillow development; from FIG. 1d, it can be seen thatLJS5-1Specific expression in later development stage of leaf pillow; from FIG. 1e, it can be seen thatLJS1S2-1Specific expression in early development stage of leaf pillow; from FIG. 1f, it can be seen thatLJS4-2Specific expression in S4 stage of leaf pillow development; from FIG. 1g, it can be seen thatLJS5-2And homologous genes thereofLJS5-2LIs specifically expressed in S4 and S5 stages of leaf occipital development.

2. From fig. 2a, it can be seen that after successful knockout, the included angle of the homozygous mutant plant at the seedling stage becomes smaller, the plant type at the heading stage is upright, and the leaf included angle of the homozygous mutant plant at the seedling stage is significantly reduced compared with the wild type (nipponica); as can be seen from FIG. 2b, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; as can be seen from FIG. 2c, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; it can be seen from FIG. 2d that the included angle of the homozygous mutant plant becomes smaller after successful knockout; it can be seen from FIG. 2e that after successful knockout, the leaf angle of the homozygous mutant plant is smaller than that of the wild type (Nipponbare); as can be seen from FIG. 2f, after successful knockout, the included angle of the homozygous mutant plant at the heading stage becomes smaller, and the plant type is upright; as can be seen from FIG. 2g, after successful knockout, the included angle of the homozygous mutant plant becomes smaller and the plant type is upright.

3. As can be seen from FIG. 3a, after successful knockout, the leaf occipital structure of homozygous mutant plant at the seedling stage is changed, and the number of leaf occipital cell layers is increased compared with that of wild type (Nipponbare); as can be seen from FIG. 3b, after successful knockout, accumulation of lignin in the sclerenchyma tissue of the flag leaf pillow at the heading stage of the homozygous mutant plant is increased compared with that of the wild type (Nipponbare), and the mechanical strength is increased; from FIG. 3c, it can be seen that after successful knockout, accumulation of sclerenchyma lignin of the folium xipholi of homozygous mutant plants at heading stage is increased compared with wild type (Nipponbare), and mechanical strength of the folium xipholi is increased; it can be seen from fig. 3d that after successful knockout, the leaf pillow structure of homozygous mutant plant at seedling stage changes, and the leaf pillow paraxial surface parenchyma cell is smaller than that of wild type (Nipponbare); it can be seen from fig. 3e that after successful knockout, the leaf pillow structure of homozygous mutant plant at seedling stage changes, and abaxial sclerenchyma cells are increased compared with wild type (nippon fine); as can be seen from FIG. 3f, after successful knockout, accumulation of the lignin in the sclerenchyma tissue of the folium xipholi of the homozygous mutant plant at heading stage is increased compared with that of the wild type (Nipponbare), and the mechanical strength is increased; it can be seen from FIG. 3g that after successful knockout, the paraxial parenchyma cells of the leaf pillows of the homozygous mutant plants are smaller than those of the wild type (Nipponbare).

4. From FIG. 4a, it can be seen that qRT-PCR detects that the target gene of LJS4-1 promoting and inhibiting lignin accumulation is inLJS4-1-criThe change of expression amount in the transgenic line indicatesLJS4-1Expression of S4 in leaf occipital development, which is related to lignin accumulation in leaf occipital sclerenchyma tissues; from FIG. 4b, it can be seen that qRT-PCR detects the target gene promoting and inhibiting lignin accumulation inLJS3-1And homologous genes thereofLJS3-1LThe expression amount of the CRISPR transgenic line is changed, which shows thatLJS3-1And homologous genes thereofLJS3-1LThe expression of S3 and S4 in the development of leaf pillows is related to the accumulation of lignin in the thick-wall tissues of the leaf pillows; from FIG. 4c, it can be seen that the cell cycle-associated genes were detected by qRT-PCRLJS1S2-1-cri/LJS1S2-1L-criAnalysis of expression level in transgenic lines shows thatLJS1S2-1Expression in early development of leaf occiput, related to proliferation of leaf occiput cells; from FIG. 4d, it can be seen that qRT-PCR detects that the target gene of LJS4-2 promoting and inhibiting lignin accumulation is inLJS4-2-criThe change of expression amount in the transgenic line indicatesLJS4-2Expression of S4 in leaf occipital development is associated with accumulation of lignin in leaf occipital sclerenchyma.

5. From fig. 5 it can be seen thatLJS1S2-1The promoter and the full-length CDS are cloned on pCAMBIA1300 and transferred into Nipponbare, and the leaf angle of the obtained transgenic line is larger than that of the wild type (Nipponbare), which indicates thatLJS1S2-1Has the function of controlling the development of the rice leaf pillow and the size of the leaf angle.

6. As can be seen from FIG. 6, after the target gene is successfully knocked out, the yield of rice is increased by increasing the fertile ear number per unit area under high density.

Sequence listing

<110> university of Henan

<120> application of rice gene LJS3-1 and homologous gene thereof in controlling rice leaf pillow development and leaf angle

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 855

<212> DNA

<213> Rice (Oryza sativa)

<400> 1

atggaagcag acgcgagcca tacacccacc acctcctcct ccgtctccgt ctccttctcc 60

tcctcgtcgc tgtccacttc ctcctccacc tcctccctcg tcgacaatgg cgcgcaagac 120

cggcccaaga gctccaagcc caaacacgcc gccaagaagc gcaagagagc ggccgcggag 180

gaacctgcca atgccgccca cggcgcaggg gaggatacca gcagctgcag caccgacgac 240

aacgcggcgg cgagcggcaa ggcgcaggcg ggcggcggcg gcggcggcgt cgacagcagc 300

agcacctgca ccgccgcctc ggcgccgagg agcggcttca agcacccgtc gtaccgcggc 360

gtgcgccgcc ggagctgggg gaagtgggtg tcggagatcc gggagccccg caagaagtcg 420

cgcatctggc tgggtacctt ccccaccgcg gagatggcgg cgcgcgccca cgacgtggcc 480

gcgctcgcca tcaagggccg gaacgcgcac ctcaacttcc cggacagcgc ccacgagctg 540

ccccgcccgg agtccacctc cccggcagac atccaggccg ccgccgccaa ggctgccgcc 600

gaggtgcggt gcgaggagga gtcgtcgccg tcgtcgtcgc ccaccgccga gcaacccgag 660

gaggaagccg cctgccctga cacggtgcac gccgacggcg gccaggacaa tgctctcttc 720

gacctacccg accttcttct cgacctacgg gacgggctct ggtggtcgcc ggtgtggccg 780

gcggcactgg cggccgagga gtacgacggc ggcgacgccg tcgtgctcaa tgagccactc 840

ttgtgggccg agtag 855

<210> 2

<211> 864

<212> DNA

<213> Rice (Oryza sativa)

<400> 2

atggaagctg ccgcgatcca tgcgcccacc accaccacct cctccgactc cggctcgtgc 60

gtcaccaatg gcacgcgaga gaagcgcgag atctctaagc acaagcagct caagcggaag 120

aggagcacct ctcctgctcc tcctcccggc tgcggcggcg gccaaggaca ggaagcggcg 180

gtggagactg acgctgacgc tggcgccgcc ggcgaggagg agagcagcag ctgcggtggc 240

gctggcgccg gcgagggcga gcgcaagagg ggtgacgccg gcaggcaccc gtcgtaccgc 300

ggcgtgaggc ggcggagctg gggcaagtgg gtgtcggaga tccgcgagcc gcgcaagaag 360

tcgcgcatct ggctcggcac cttcccgacg gcggagatgg ccgcgcgcgc gcacgacgtg 420

gccgcgctcg ccatcaaggg ccgcgccgcg cacctcaact tcccgagcct cgcccacacg 480

ctcccgcgcc cggcctccac ctcaccctcc gacatccagg ccgccgccgc cctcgccgca 540

gctgcagccg ccaccgacca atgcgagtcc tcctcctctg ccgtcgccgc cgccaccgcc 600

accgacgccg aggcggcgga gtccacctcg tcggccgcgg ccagcccgtg cgccgccacc 660

agcagcgtcg aggagaacgc gctgttcgac ctgcccgacc ttctcctcga cctgagcgac 720

gggctctggt gctcacccgt ctggacgaca gcgccggccg atcagtacga cgccggcgac 780

gacggcgacg acgccgcggc gccgctcctg tgggccgagc agtgctggat ggacgcccca 840

gcggcgcccg tgcagcctga ctaa 864

<210> 3

<211> 284

<212> PRT

<213> Rice (Oryza sativa)

<400> 3

Met Glu Ala Asp Ala Ser His Thr Pro Thr Thr Ser Ser Ser Val Ser

1 5 10 15

Val Ser Phe Ser Ser Ser Ser Leu Ser Thr Ser Ser Ser Thr Ser Ser

20 25 30

Leu Val Asp Asn Gly Ala Gln Asp Arg Pro Lys Ser Ser Lys Pro Lys

35 40 45

His Ala Ala Lys Lys Arg Lys Arg Ala Ala Ala Glu Glu Pro Ala Asn

50 55 60

Ala Ala His Gly Ala Gly Glu Asp Thr Ser Ser Cys Ser Thr Asp Asp

65 70 75 80

Asn Ala Ala Ala Ser Gly Lys Ala Gln Ala Gly Gly Gly Gly Gly Gly

85 90 95

Val Asp Ser Ser Ser Thr Cys Thr Ala Ala Ser Ala Pro Arg Ser Gly

100 105 110

Phe Lys His Pro Ser Tyr Arg Gly Val Arg Arg Arg Ser Trp Gly Lys

115 120 125

Trp Val Ser Glu Ile Arg Glu Pro Arg Lys Lys Ser Arg Ile Trp Leu

130 135 140

Gly Thr Phe Pro Thr Ala Glu Met Ala Ala Arg Ala His Asp Val Ala

145 150 155 160

Ala Leu Ala Ile Lys Gly Arg Asn Ala His Leu Asn Phe Pro Asp Ser

165 170 175

Ala His Glu Leu Pro Arg Pro Glu Ser Thr Ser Pro Ala Asp Ile Gln

180 185 190

Ala Ala Ala Ala Lys Ala Ala Ala Glu Val Arg Cys Glu Glu Glu Ser

195 200 205

Ser Pro Ser Ser Ser Pro Thr Ala Glu Gln Pro Glu Glu Glu Ala Ala

210 215 220

Cys Pro Asp Thr Val His Ala Asp Gly Gly Gln Asp Asn Ala Leu Phe

225 230 235 240

Asp Leu Pro Asp Leu Leu Leu Asp Leu Arg Asp Gly Leu Trp Trp Ser

245 250 255

Pro Val Trp Pro Ala Ala Leu Ala Ala Glu Glu Tyr Asp Gly Gly Asp

260 265 270

Ala Val Val Leu Asn Glu Pro Leu Leu Trp Ala Glu

275 280

<210> 4

<211> 287

<212> PRT

<213> Rice (Oryza sativa)

<400> 4

Met Glu Ala Ala Ala Ile His Ala Pro Thr Thr Thr Thr Ser Ser Asp

1 5 10 15

Ser Gly Ser Cys Val Thr Asn Gly Thr Arg Glu Lys Arg Glu Ile Ser

20 25 30

Lys His Lys Gln Leu Lys Arg Lys Arg Ser Thr Ser Pro Ala Pro Pro

35 40 45

Pro Gly Cys Gly Gly Gly Gln Gly Gln Glu Ala Ala Val Glu Thr Asp

50 55 60

Ala Asp Ala Gly Ala Ala Gly Glu Glu Glu Ser Ser Ser Cys Gly Gly

65 70 75 80

Ala Gly Ala Gly Glu Gly Glu Arg Lys Arg Gly Asp Ala Gly Arg His

85 90 95

Pro Ser Tyr Arg Gly Val Arg Arg Arg Ser Trp Gly Lys Trp Val Ser

100 105 110

Glu Ile Arg Glu Pro Arg Lys Lys Ser Arg Ile Trp Leu Gly Thr Phe

115 120 125

Pro Thr Ala Glu Met Ala Ala Arg Ala His Asp Val Ala Ala Leu Ala

130 135 140

Ile Lys Gly Arg Ala Ala His Leu Asn Phe Pro Ser Leu Ala His Thr

145 150 155 160

Leu Pro Arg Pro Ala Ser Thr Ser Pro Ser Asp Ile Gln Ala Ala Ala

165 170 175

Ala Leu Ala Ala Ala Ala Ala Ala Thr Asp Gln Cys Glu Ser Ser Ser

180 185 190

Ser Ala Val Ala Ala Ala Thr Ala Thr Asp Ala Glu Ala Ala Glu Ser

195 200 205

Thr Ser Ser Ala Ala Ala Ser Pro Cys Ala Ala Thr Ser Ser Val Glu

210 215 220

Glu Asn Ala Leu Phe Asp Leu Pro Asp Leu Leu Leu Asp Leu Ser Asp

225 230 235 240

Gly Leu Trp Cys Ser Pro Val Trp Thr Thr Ala Pro Ala Asp Gln Tyr

245 250 255

Asp Ala Gly Asp Asp Gly Asp Asp Ala Ala Ala Pro Leu Leu Trp Ala

260 265 270

Glu Gln Cys Trp Met Asp Ala Pro Ala Ala Pro Val Gln Pro Asp

275 280 285

Claims (3)

1. Knock-out rice geneLJS3-1And homologous genes thereofLJS3-1LThe application of the rice gene in regulating and controlling the development of leaf pillows and the size of leaf included angle is characterized in thatLJS3-1The amino acid sequence of the coded protein is shown as SEQ ID NO.3, and the rice geneLJS3-1LThe amino acid sequence of the encoded protein is shown as SEQ ID NO.4, and when in application, the encoded protein is constructed to containLJS3-1Gene and homologous gene thereofLJS3-1LCRISPR/CAS9 vector of (1), and transferred into Nipponbare, knock-outLJS3-1Gene and homologous gene thereofLJS3-1LThe method can reduce the leaf angle by regulating and controlling the lignin accumulation and the mechanical strength of the thick-walled tissue of the leaf pillow, promote the plant type to be upright, and increase the rice yield by improving the fertile ear number per unit area under high density.

2. The use of claim 1, wherein the rice gene is a rice geneLJS3-1The nucleotide sequence of (A) is shown in SEQ ID NO. 1.

3. The use of claim 1, wherein the rice gene is a rice geneLJS3-1LThe nucleotide sequence of (A) is shown in SEQ ID NO. 2.

Images