CN105524155A - Wheat protein TaMYB7A and encoding gene and application thereof - Google Patents
Wheat protein TaMYB7A and encoding gene and application thereof Download PDFInfo
- Publication number
- CN105524155A CN105524155A CN201610033104.1A CN201610033104A CN105524155A CN 105524155 A CN105524155 A CN 105524155A CN 201610033104 A CN201610033104 A CN 201610033104A CN 105524155 A CN105524155 A CN 105524155A
- Authority
- CN
- China
- Prior art keywords
- tamyb7a
- gene
- recombinant
- plant
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention relates of the field of bio-genetic engineering, in particular relates to wheat protein TaMYB7A and an encoding gene and application thereof. The wheat protein TaMYB7A and an encoding gene shell, provided by the invention, are used for improving the yield of crops, have important practical significance and wide application prospect on cultivation and seed breeding of related crops, and play an important role in genetically modified crop yield study.
Description
Technical field
The present invention relates to biological gene engineering field, specifically a kind of wheat protein TaMYB7A and encoding gene thereof and application.
Background technology
Wheat is one of main in the world food crop, finds the functional gene relevant to high yield and molecule marker has important theory significance and using value to following improving yield of wheat molecular breeding.Yield traits mostly belongs to the quantitative character of controlled by multiple genes, shows as voriability, studies more difficult.Comparatively speaking, comparatively Inheritance of Yield Traits power is high for Yield And Yield Components, and different ecological region requires also to be not quite similar to the breeding of Components, thus yield traits is divided into independent factor research more practical.Spike number, grain number per spike and thousand seed weight are the Three factors forming and determine crop yield, and yield per unit improves the coordinated development depending on constituent element, and improving arbitrary factor all can increase yield.Grain number per spike heritability is comparatively tillered height, and increasing arbitrary yield factors is the important channel of improving output.Utilize output gene can accelerate crop genetic improvement process.Between more than ten years in the past, to be correlated with QTLs although located many grain number per spikes on the coloured differently body of wheat, due to Wheat volatiles huge (17.9 × 10
9bp), tumor-necrosis factor glycoproteins many (>80%), rarely have the report of Yield Traits of Wheat Cloning of Genes Related at present.
At present, myb gene research mainly concentrates on the aspects such as Salt And Alkali Tolerance, cold-resistant and drought resisting, the research of relevant crop yield aspect seldom, and for also not the studying of regulation and control of myb gene for yield traits.
Summary of the invention
The present invention spreads over the research of myb gene about crop yield aspect, provides a kind of wheat protein TaMYB7A and encoding gene thereof and application.
The present invention is achieved by the following technical solutions: a kind of wheat protein TaMYB7A, is the albumen as shown in (a) or (b):
A () is by the protein shown in SEQIDNO.1;
(b) by the protein shown in SEQIDNO.1 by one or more amino acid whose replacement, disappearance or/and insert and the derivative protein variant still with TaMYB7A function or activity obtained.
One of them object of the present invention is to provide the gene of the described wheat protein TaMYB7A of described coding.
Wheat protein TaMYB7A provided by the present invention derives from Chinese spring (TriticumaestivumL.), and its encoding gene is as the gene shown in (1) to (3) any one:
(1) its encoding sequence is the DNA molecular shown in SEQIDNO.2 or cDNA molecule;
(2) at least have 75% with the nucleotide sequence shown in SEQIDNO.2, at least have 85%, at least have 90%, at least there is 95% identity and the DNA molecular of above-mentioned albumen of encoding or cDNA molecule;
(3) under strict conditions with arbitrary described nucleotide sequence hybridization in (1) or (2), and above-mentioned DNA molecular or the cDNA molecule stating albumen.
The encoding gene of described wheat protein TaMYB7A comprises the open reading frame (nucleotide sequence is as shown in SEQIDNO.2) of 1365bp, and TaMYB7A albumen contains 454 amino acid.Should be understood that the preferences of degeneracy and the different plant species codon considering codon, the codon that those skilled in the art can use applicable specific species to express as required.
The above-mentioned nucleic acid molecule for described TaMYB7A albumen of encoding, those of ordinary skill in the art can adopt known method easily, the method of such as orthogenesis and point mutation, suddenlys change to the nucleotide sequence of the nucleic acid molecule of the described TaMYB7A albumen of coding of the present invention.Those are through manually modified, the nucleotide sequence being separated the nucleic acid molecule of the coding obtained described TaMYB7A albumen with the present invention has 75% or higher identity and described TaMYB7A albumen of encoding, and is all be derived from nucleotide sequence of the present invention and be equal to nucleotide sequence of the present invention.Term used herein " identity " refers to the sequence similarity between nucleotide sequence." identity " comprises and has 75% or higher with the DNA molecular shown in SEQIDNo.2 of the present invention or cDNA molecule, or 85% or higher, or 90% or higher, or the nucleotide sequence of 95% or higher identity; Identity can with the naked eye or computer software evaluate.Use computer software, the identity between two or more sequence can represent with per-cent (%), and it can be used for evaluating the identity between correlated series.
Another object of the present invention is the recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that provide containing wheat protein TaMYB7A encoding gene.
Present invention also offers the host cell containing described recombinant expression vector, described host cell comprises recombinant bacterium, as intestinal bacteria, Agrobacterium etc., also comprises vegetable cell.Described recombinant vectors can be recombinant expression vector, also can be recombinant cloning vector.
Described recombinant expression vector can use existing plant expression vector construction.Described plant expression vector comprises double base agrobacterium vector and can be used for the carrier etc. of plant micropellet bombardment, as pGreen0029, pCAMBIA3301, pCAMBIA1300, pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other derivative plant expression vector.Described plant expression vector also can comprise 3 ' end untranslated region of foreign gene, namely comprises the DNA fragmentation of polyadenylation signals and any other participation mRNA processing or genetic expression.The bootable polyadenylic acid of described polyadenylation signals joins 3 ' end of mRNA precursor.When using described gene constructed recombinant expression vector, any one enhancement type, composing type, organizing specific type or inducible promoter can be added before its transcription initiation Nucleotide, such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin gene Ubiquitin promotor (pUbi), stress induced promoter rd29A etc., they can be used alone or are combined with other plant promoter; In addition, when using gene constructed recombinant expression vector of the present invention, also enhanser can be used, comprise translational enhancer or transcriptional enhancer, these enhanser regions can be ATG initiator codon or neighboring region initiator codon etc., but must be identical with the reading frame of encoding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and initiator codon is widely, can be natural, also can be synthesis.Translation initiation region can from transcription initiation region or structure gene.For the ease of identifying transgenic plant cells or plant and screening, can process recombinant expression vector used, the coding can expressed in plant as added can produce enzyme or the gene of luminophor, the antibiotic marker thing with resistance or the chemical resistance reagent marker gene etc. of colour-change.Also any selected marker can not be added.In the present invention, the promotor starting described genetic transcription in described recombinant expression vector is specially 35S promoter.
More specifically, be pBI121 containing described transgenic arabidopsis carrier, containing described transgenic paddy rice recombinant expression vector pCAMBIA1305.Described recombinant expression vector is the recombinant plasmid obtained after the multiple clone site place of carrier inserts described gene.Described multiple clone site is specially KpnI and SmalI.
Wherein, the recombinant plasmid that obtains after being specially and inserting DNA fragmentation shown in SEQIDNO.2 between restriction enzyme site KpnI and SmalI of pBI121 carrier of described intermediate carrier.The recombinant plasmid that described pCAMBIA1305 carrier obtains after being specially and inserting DNA fragmentation shown in SEQIDNO.2 between KpnI and SmalI of described intermediate carrier.
In addition, the encoding gene of described wheat protein TaMYB7A can first be modified as follows, then imports in recipient plant, to reach better expression effect:
1) carry out according to actual needs modifying and optimizing, to make gene efficient expression; Such as, the codon can had a preference for according to recipient plant, changes its codon to meet plant-preference while the aminoacid sequence keeping wheat protein TaMYB18 encoding gene of the present invention; In optimizing process, keep certain GC content in the encoding sequence after preferably making optimization, to realize the high level expression of quiding gene in plant best, wherein GC content can be 35%, more than 45%, more than 50% or more than about 60%;
2) gene order of contiguous initial methionine is modified, to make translation effectively initial; Such as, effective sequence known in plant is utilized to modify;
3) be connected with the promotor of various expression of plants, be beneficial to its expression in plant; Described promotor can comprise composing type, induction type, sequential adjustment, Growth adjustment, Chemical Regulation, tissue preferably and tissue-specific promoter; The selection of promotor will change along with expression time and space requirement, and depend on target species; The such as specific expressing promoter of tissue or organ, acceptor in what period of growing is determined as required;
5) enhancer sequence is introduced, as intron sequences (such as deriving from Adhl and bronzel) and viral leader sequence (such as deriving from TMV, MCMV and AMV).
Described expression cassette forms by starting the promotor of described genetic expression, described gene and transcription termination sequence.
Above-mentioned modification also comprises screening from the plant of the encoding gene importing the TaMYB7A albumen shown in SEQIDNo.2 and expresses the plant of described encoding gene, obtains the step of described transgenic plant.
In addition, described transgenic plant are interpreted as the first-generation transgenic plant not only comprising and obtained by described gene transformation recipient plant, also comprise its filial generation.For transgenic plant, this gene can be bred in these species, also with traditional breeding method, this transgenosis can be entered other kind of same species, particularly including in commercial variety.Described transgenic plant comprise seed, callus, whole plant and cell.
The invention provides described albumen, described gene, described recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium and improve the application in crop yield.
Preferably, described in be applied as by expressing wheat protein TaMYB7A encoding gene, thus plant growth gesture is improved, Correlated Yield Characters also improves.The yield traits of above-mentioned regulation and control crop is embodied in: do in object described, if the expression amount of described gene is higher, then the yield traits of described plant is better.
Described gene specifically imports in described recipient plant by above-mentioned arbitrary described recombinant expression vector, obtains described transgenic plant.Specifically by using the conventional biology methods such as Ti-plasmids, Ri plasmid, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated, particle gun by described recombinant expression vector transformed plant cells or tissue, and the plant tissue of conversion is cultivated into plant.
In above-mentioned application or method, wheat protein TaMYB7A encoding gene can be used for improving crop yield proterties, described proterties be following at least one: plant-growth gesture, grain number per spike, spike length, fruit pod length and fruit pod quantity equal yield line proterties.
In above-mentioned application or method, described crop can be monocotyledons, also can be dicotyledons.As: paddy rice, wheat, tobacco or Arabidopis thaliana etc.During concrete enforcement, described plant is Arabidopis thaliana and paddy rice, be specifically respectively Arabidopis thaliana Colombia 0 type (Clo-0) and Japan fine.
Wheat protein TaMYB7A provided by the present invention and encoding gene shell thereof are for improving the output of crop, for the cultivation of respective crop and breeding, there is larger practical significance and wide application prospect, play an important role in the research of genetically modified crops output.
Accompanying drawing explanation
Fig. 1 is that in the embodiment of the present invention 3, process LAN Arabidopsis plant is cultivated with wildtype Arabidopsis thaliana and grown phenotype character pair than scheming.
Fig. 2 is process LAN Arabidopsis plant and wild-type Arabidopsis plants phenotypic character comparison diagram in the embodiment of the present invention 3.
Fig. 3 is that in the embodiment of the present invention 3, process LAN Arabidopsis plant and wild-type Arabidopsis plants fruit pod length vs scheme.
Fig. 4 is the RT-PCR positive identification of process LAN Arabidopsis plant in the embodiment of the present invention 4.
Fig. 5 is for being process LAN rice plant and WT lines phenotypic character in the embodiment of the present invention 5.
Fig. 6 is the RT-PCR positive identification of process LAN rice plant in the embodiment of the present invention 6.
Embodiment
Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.Without departing from the spirit and substance of the case in the present invention, the amendment do the inventive method, step or condition or replacement, all belong to protection scope of the present invention.
If do not specialize, each reagent that the present invention is used and experiment material are all commercially available, the conventional means that technique means used in embodiment is well known to those skilled in the art.The method of transgenic arabidopsis of the present invention and paddy rice can reference (ZhengJ; LiuH; WangYQ; etal.TaTEF-7A; atranscriptelongationfactorinfluencesyield-relatedtraits inbreadwheat (Triticumaestivum.L) .JournalofExperimentalBotany.2014,18 (65): 5351-5365); GaoH, ZhengXM, FeiGL, et.al.Ehd4, aCCCH-typepositiveregulatorofphotoperiodicfloweringinric e.PlosGenetics, 2013,9 (2): e1003281) carry out.
The biomaterial Chinese spring (TriticumaestivumL.) related in the present invention, Arabidopis thaliana (Arabidopsisthaliana) and paddy rice Japan fine (OryzasativaL.) are public kind.Arabidopis thaliana (Clo-0): be recorded in " ringgit beautiful woman. exogenous NO gas is on the impact of Arabidopsis callus respiratory intensity and mitochondrial complex Ⅰ albumen. Lanzhou University; Master's thesis in 2007 " literary composition, the public can obtain from applicant, is only limitted to for repeating the present invention.Paddy rice Japan fine (OryzasativaL.) is recorded in GaoH, ZhengXM, FeiGL, et.al.Ehd4, aCCCH-typepositiveregulatorofphotoperiodicfloweringinric e.PlosGenetics, 2013,9 (2): e1003281, the public can obtain from applicant, is only limitted to for repeating the present invention.2 × EasyTaqPCRSuperMix, pEASY-T1SimpleCloningKit are all purchased from Beijing Quanshijin Biotechnology Co., Ltd.
The clone of embodiment 1 wheat protein TaMYB7A full length gene and the structural analysis of proteins encoded
With Chinese spring (TriticumaestivumL.) wheat leaf blade for material, extracting RNA and reverse transcription acquisition cDNA, take cDNA as template, with TaMYB7A-F and TaMYB7A-R for primer, utilizes PCR method to obtain wheat TaMYB7A gene order total length.
The encode primers sequence of TaMYB7A full length gene:
TaMYB7A-F：5’-GGTACCATGAGCTCCCATGGTGTTG-3’；
TaMYB7A-R：5’-CCCGGGTTATGAACAAGGGGACCCTG-3’。
PCR program: 95 DEG C of denaturations 5 minutes; 95 DEG C of sex change 30 seconds, 56 DEG C of annealing 30 seconds, 72 DEG C extend 2 minutes, repeat 35 times; 72 DEG C extend 10 minutes.
PCR system:
2×EasyTaqPCRSuperMix12.5μl；
TaMYB7A-F（10μM）1μl；
TaMYB7A-R（10μM）1μl；
CDNA template 2 μ l;
Distilled water supplies 25 μ l.
PCR primer is cut after glue reclaims purifying and is connected on pEASY-T1Simple carrier according to pEASY-T1SimpleCloningKit cloning process clone, connect product conversion bacillus coli DH 5 alpha, and expand numerous wherein, positive colony obtains pEASY-T1Simple-TaMYB7A through order-checking screening, wherein, TaMYB7A total length is 1365bp, and its nucleotide sequence is as shown in SEQIDNO.2; The aminoacid sequence of the protein of being encoded by it is as shown in SEQIDNO.1.TaMYB7A comprises the open reading frame (SEQIDNO.2) of 1365bp, infers that TaMYB7A albumen contains 454 amino-acid residues thus.According to software prediction, the molecular weight of this albumen is 49569.1 dalton, and iso-electric point is 5.898.
Cut pEASY-T1Simple-TaMYB7A with KpnI and SmalI enzyme, obtain TaMYB7A fragment; Cut expression vector with KpnI and SpeI enzyme and obtain carrier segments, enzyme is cut two fragments obtained and is connected, and obtains transgenic paddy rice recombinant expression vector pCAMBIA1305-TaMYB7A.
Cut pEASY-T1Simple-TaMYB7A with KpnI and SmalI enzyme, obtain TaMYB7A fragment; Cut expression vector with KpnI and SpeI enzyme and obtain carrier segments, enzyme is cut two fragments obtained and is connected, and obtains transgenic arabidopsis recombinant expression vector pBI121-TaMYB7A.
Embodiment 2TaMYB7A Arabidopis thaliana expression vector
The pEASY-T1Simple-TaMYB7A that the order-checking obtained from embodiment 1 is correct, utilize KpnI and SmalI two restriction enzyme sites, obtain being structured in pEASY-T1Simple(Beijing Quanshijin Biotechnology Co., Ltd) full length sequence TaMYB7A on carrier, by plant expression vector pBI121(see Xiang-YanMeng, Arsenicbiotransformationandvolatilizationintransgenicric e, 2011, NewPhytol, 191, 49-56) carry out after same enzyme cuts, according to the using method of the T4DNA ligase enzyme of NEB company, enzyme is cut two fragments obtained to connect, product conversion bacillus coli DH 5 alpha will be connected, expand numerous wherein, positive colony obtains over-express vector pBI121-TaMYB7A through order-checking.Arabidopis thaliana transgenic method reference (ZhengJ, LiuH, WangYQ, etal.TaTEF-7A, atranscriptelongationfactorinfluencesyield-relatedtraits inbreadwheat (Triticumaestivum.L) .JournalofExperimentalBotany.2014,18 (65): 5351-5365) carry out.Adopt agrobacterium-mediated transformation to be transformed in Arabidopis thaliana by the over-express vector pBI121-TaMYB7A obtained, obtain transformed plant.
Concrete operations are: 1, configure Agrobacterium infection damping fluid, Agrobacterium infection damping fluid: 5% (5g/100ml) sucrose, 1/2MS, ddH
2o constant volume, to 100mL, adds 80 μ LSilwet-77.2, collected by centrifugation thalline, with the resuspended thalline of Agrobacterium infection damping fluid.3, collected by centrifugation thalline, with the resuspended thalline of Agrobacterium infection damping fluid.4, choose Arabidopis thaliana Colombia 0 type (Clo-0) plant just bloomed, inflorescence to be immersed in Agrobacterium infection damping fluid about 30 seconds, to put freshness protection package moisturizing, cultivate 24h in the dark, then the Arabidopis thaliana after transfection is removed freshness protection package, normally cultivate, results seed is T
0generation.T
0t is obtained for selfing
1generation.5, by T
1after seed disinfection, be laid in (containing 50mg/L Totomycin) on MS substratum, after 4 DEG C of vernalization 2 days, 22 DEG C, 16h illumination/8h dark culturing 14d, select the transgenic Arabidopsis plants of hygromycin, by transgenic line breeding, add generation, obtain T
3for the strain (parental generation that all offsprings all have hygromycin resistance is homozygous line) of homozygous transgenic.
According to the method for above-mentioned steps 1-4, also proceeded to by pBI121 empty carrier in Arabidopis thaliana Clo-0 type, obtaining isozygotys turns empty vector control strain.
Embodiment 3TaMYB7A gene increases fruit pod length and the growth potential of Arabidopis thaliana
The process LAN Arabidopsis plant obtained from embodiment 2 and wild-type Arabidopsis plants (containing empty carrier) greenhouse simultaneously together with cultivate, until Adult plant.Obtain 2 different TaMYB7A process LAN Arabidopis thaliana strain (Line-1, Line-2).Process LAN Arabidopsis plant and wild-type Arabidopsis plants phenotype be as shown in Figure 1, Figure 2 and shown in Fig. 3, after wheat cdna TaMYB7A arabidopsis thaliana transformation, and the increase of nourishing and growing of Arabidopis thaliana.2 process LAN Arabidopsis plant increase with flower a kind of sedge than the blade of Arabidopsis plant (WT), and fruit pod length and seed quantity obviously increase.
Table 1 transgenic arabidopsis phenotype is added up
| Proterties | CK | Line 1 | Line 2 |
| Fruit pod length (cm) | 1.07±0.06a(A) | 1.25±0.05b(B) | 1.14±0.059c(B) |
| Fruit pod quantity | 21.0±3.21a(A) | 33.2±2.67b(B) | 28.1±2.91c(C) |
Remarks: in CK, line, Upper Lower Case mother stock does not represent significance P=0.01andP=0.05.
Embodiment 4 measures the expression amount of TaMYB7A in TaMYB7A process LAN Arabidopsis plant
Semiquantitive PCR detects the expression of transfer-gen plant TaMYB7A gene.Concrete operations are as follows: from transfer-gen plant (the above T obtained to be detected
3generation isozygoty the strain that turns TaMYB7A and isozygoty turn empty vector control strain) extract total serum IgE in blade, reverse transcription obtains cDNA.Using gained cDNA as template, carry out pcr amplification, detect the expression of transfer-gen plant TaMYB7A gene.Arabidopis thaliana Colombia 0 type (Clo-0) plant is set simultaneously as wild type control.
Arabidopis thaliana internal reference primer:
Atactin-F：5’-CCAACAGAGAGAAGATGACT-3’；
Atactin-R：5’-ATGTCTCTTACAATTTCCCG-3’；
Arabidopis thaliana homology AT1G14600 gene primer:
AT1G14600-F：5’-ACGACGGAGTAATTGGTGG-3’；
AT1G14600-R：5’-TGGAGATGGCTCTTGACG-3’；
TaMYB7A genetic expression primer:
MRT-F：5’-GCATTCTTATGCTTGTGGAT-3’；
MRT-R：5’-AGAACCTGCTGCTCATACTTG-3’；
Utilize RT-PCR to measure the expression amount of TaMYB7A in 2 different TaMYB7A process LAN Arabidopis thaliana strain (Line-1, Line-2), result as shown in Figure 4.The process LAN Arabidopis thaliana obtained from embodiment 2 carries out RT-PCR qualification, under Arabidopis thaliana Actin detects the quality of cDNA and the basically identical condition of concentration, the expression of TaMYB7A detected, without expressing in wild-type (WT) in TaMYB7A process LAN Arabidopsis plant.So the character mutation of embodiment 2 process LAN Arabidopsis plant is produced by the wheat TaMYB7A gene of process LAN.
Embodiment 5TaMYB7A transgenic paddy rice expression vector
The building process of described carrier pCAMBIA1305-TaMYB7A is as follows:
(1) with Chinese spring (TriticumaestivumL.) wheat leaf blade for material, extract RNA reverse transcription and obtain cDNA, take cDNA as template, with TaMYB7A-F and TaMYB7A-R for primer, carry out PCR;
The encode primers sequence of TaMYB7A full length gene:
TaMYB7A-F：5’-GGTACCATGAGCTCCCATGGTGTTG-3’；
TaMYB7A-R：5’-CCCGGGTTATGAACAAGGGGACCCTG-3’；
PCR primer clone is connected on pEASY-T1Simple carrier, obtains pEASY-T1Simple-TaMYB7A;
(2) cut pEASY-T1Simple-TaMYB7A with KpnI and SmalI enzyme, obtain TaMYB7A fragment; Cut expression vector with KpnI and SpeI enzyme, obtain carrier segments, enzyme is cut two fragments obtained and connect, obtain transgenic paddy rice recombinant expression vector pCAMBIA1305-TaMYB7A.Agrobacterium-mediated transformation is adopted to be transformed in paddy rice by the over-express vector pCAMBIA1305-TaMYB7A obtained.
By pCAMBIA1305-TaMYB7A transform Agrobacterium tumefaciens EHA105 competent cell, obtain agrobacterium tumefaciens of recombinating; Simultaneously by destination carrier pGW-CUbi1390 transform Agrobacterium tumefaciens EHA105 competent cell, obtain contrasting recombinant bacterium.Agrobacterium tumefaciens of recombinating extracts plasmid, and check order, sequencing result shows that recombinant vectors pCAMBIA1305-TaMYB7A successfully proceeds in agrobacterium tumefaciens EHA105 competent cell, and restructuring agrobacterium tumefaciens builds correct.
Rice transgenic method reference (GaoH, ZhengXM, FeiGL, et.al.Ehd4, aCCCH-typepositiveregulatorofphotoperiodicfloweringinric e.PlosGenetics, 2013,9 (2): e1003281) carry out.The acquisition of transgenic plant adopts following methods: the fine seed of rice Japan of 1, fetching water shells sterilizing, and tiling, to calli induction media induction two weeks, chooses the thoughtful callus particle growing diameter about 2mm of callus succeeding transfer culture two.2, by agrobacterium tumefaciens LB liquid nutrient medium of recombinating (be the Rifampin of 50mg/L and concentration containing concentration be the Totomycin of 50mg/L) overnight incubation, OD is made
600value is about 0.6-0.8, obtains restructuring agrobacterium tumefaciens bacterium liquid.3, the centrifugal 3min of restructuring agrobacterium tumefaciens bacterium liquid 4000rmp of about 3mL is got, remove supernatant, collect restructuring agrobacterium tumefaciens thalline, restructuring agrobacterium tumefaciens thalline is resuspended in AMM (being the Syringylethanone of 100 μm of ol/L containing the concentration) liquid nutrient medium of about 20mL, at 28 DEG C, shake 2 hours under 150rpm condition, obtain object bacterium liquid.4, contaminate: soak 20min in the object bacterium liquid that callus particle step 1 obtained obtains in step 3, then be put on the Dual culture base of one deck filter paper, obtain the callus particle after Dual culture.After three days, the callus particle aseptic distillation after Dual culture is washed three times, each about 20min, then with containing concentration being the sterilizing washing twice, each 30min of the carboxylic benzyl of 500mg/L, repeatedly until washing lotion is very limpid, the callus particle after cleaning can be obtained.Callus particle after cleaning is placed on aseptic filter paper and dries, then puts it on a sieve substratum and cultivate two weeks, obtain the callus particle after a sieve cultivation.Callus particle after being cultivated by one sieve forwards on two sieve substratum to be cultivated two weeks, obtains the callus particle after two sieves cultivations.Callus particle after being cultivated by two sieves forwards on three sieve substratum more afterwards to be cultivated two weeks, obtains kanamycin-resistant callus tissue particle.5, kanamycin-resistant callus tissue particle is forwarded on division culture medium cultivate, obtain breaking up seedling.6, differentiation seedling step 5 obtained is planted cultivation on 1/2MS substratum and is taken root, and obtains the seedling of taking root.Then forward the seedling of taking root to chamber planting, obtain T
0for plant, results T
0for seed, by T
0plant to large Tanaka for planting seed, obtain the T of experimental group
1for plant.By the T of experimental group
1for plant selfing, obtain the T of experimental group
1for seed, in this approach until obtain the T of experimental group
2for plant.
According to the method for above-mentioned steps, also proceeded in paddy rice by pCAMBIA1305 empty carrier, obtaining isozygotys turns empty vector control strain.
Embodiment 6TaMYB7A increases growth potential and the grain number per spike of paddy rice
The process LAN rice plant obtained from embodiment 5 and wild-type (containing empty carrier) greenhouse simultaneously together with cultivate, until Adult plant.Obtain TaMYB7A process LAN rice strain (Line-1).Process LAN rice plant and WT lines phenotype as shown in Figure 5, TaMYB7A transform after, the transfer-gen plant florescence is constant, increase of nourishing and growing, grain number per spike also obviously increase.
Embodiment 7 measures the expression amount of TaMYB7A in TaMYB7A process LAN rice plant
Semiquantitive PCR detects the expression of transfer-gen plant TaMYB7A gene.Concrete operations are as follows: from transfer-gen plant (the above T obtained to be detected
3generation isozygoty the strain that turns TaMYB7A and isozygoty turn empty vector control strain) extract total serum IgE in blade, reverse transcription obtains cDNA.Using gained cDNA as template, carry out pcr amplification, detect the expression of transfer-gen plant TaMYB7A gene.Japanese fine plant is set simultaneously as wild type control.
Paddy rice ACTIN primer
Actin-F：5’-TCCATCTTGGCATCTCTCAG-3’；
Actin-R：5’-GTACCCGCATCAGGCATCTG-3’；
Paddy rice homology OS02G04640 gene primer
OS02G04640-F：5’-GCTTGTTCACGGCATCTACG-3’；
OS02G04641-R：5’-ATACGACAGACCACCGCAAC-3’；
TaMYB7A genetic expression primer
MRT-F：5’-GCATTCTTATGCTTGTGGAT-3’；
MRT-R：5’-AGAACCTGCTGCTCATACTTG-3’；
Utilize RT-PCR to measure the expression amount of TaMYB7A in three different TaMYB7A process LAN rice strains (Line-1), result as shown in Figure 6.The process LAN paddy rice obtained from embodiment 4 carries out RT-PCR qualification, under paddy rice Actin detects the quality of cDNA and the basically identical condition of concentration, the homologous gene OS02G04640 expression amount no significant difference of TaMYB7A in transgenosis and wild-type, the expression of TaMYB7A is detected, without expressing in wild-type (WT) in TaMYB7A transfer-gen plant.So embodiment 4 transgenic rice plant character mutation is because the wheat TaMYB7A gene of process LAN produces.
<110> Shanxi Wheat Research Institute Of Agriculture Scinces
<120> wheat protein TaMYB7A and encoding gene thereof and application
<160>2
<170>PatentInversion3.5
<210>1
<211>454
<212>PRT
<213> Chinese spring (TriticumaestivumL.)
<400>1
MetSerSerHisGlyValValAlaValLysProIleAlaThrPro15
AspLysThrThrHisSerTyrAlaCysGlySerThrGlnSerSer30
ValHisLysLeuLeuAspSerLysLeuAspHisLeuGlyLeuLeu45
AspAspAsnLeuSerSerThrSerGlnSerSerAspIleLysThr60
GluLeuIleArgThrSerSerLeuGlyArgSerSerLeuProPhe75
AsnLeuGlnArgArgSerProGluProAspProGluSerProLeu90
SerHisValSerHisProAsnPheSerGluProMetAlaSerAsn105
SerSerThrPheCysThrSerLeuPheSerSerSerLeuThrAsn120
SerAlaProCysArgArgMetGlyAlaLeuProPheLeuProHis135
ProProLysTyrGluGlnGlnValLeuProGlyGlnSerSerThr150
SerSerLeuGlnLeuSerGlyAspThrGlyAsnValHisAspGlu165
AlaGluGlnAlaAspAspIleLysAspPheLeuAsnLeuSerAla180
GlyAspAlaSerAspGlySerPheHisGlyGluAsnGlnAlaPhe195
AlaPheAlaGluAlaGluGlnMetGluPheGlnPheLeuSerGlu210
GlnLeuGlyIleAlaIleThrAspAsnGluGluSerProGlnLeu225
AspAspIleTyrAspThrProProProGlnMetSerSerLeuPro240
ValSerSerCysSerAsnGlnIleLeuGlnAsnProGlySerPro255
AlaLysLeuProLeuSerSerSerArgSerSerSerGlySerAla270
AlaAlaAsnLysSerArgLeuArgTrpThrLeuGluLeuHisGlu285
ArgPheValGluAlaValAsnLysLeuGluGlyProAspLysAla300
ThrProLysGlyValLeuLysLeuMetLysValGluGlyLeuThr315
IleTyrHisValLysSerHisLeuGlnLysTyrArgHisAlaLys330
TyrIleProGluIleLysGluGluLysLysAlaSerSerAspLeu345
LysLysValGlnProGlySerSerGlySerAspProPheLysAsn360
LysAsnLeuAlaGluAlaLeuArgMetGlnMetGluValGlnLys375
GlnLeuHisGluGlnLeuGluValGlnArgGlnLeuGlnLeuArg390
IleGluGluHisAlaLysTyrLeuGlnArgIleLeuGluGluGln405
GlnLysValGlySerGlySerSerLeuSerLeuLysThrProThr420
GluProSerGluSerThrSerLysAspArgThrGluProGluGlu435
AlaThrThrSerSerProGlnThrSerLysAsnSerGluAlaGly450
SerProCysSer454
<210>2
<211>1365
<212>DNA
<213> Chinese spring (TriticumaestivumL.)
<400>2
atgagctcccatggtgttgttgccgtgaagccaatcgccacgccggacaaaaccacgcat60
tcttatgcttgtggatccacacagtcttcagttcataagctgctggactctaaactggac120
caccttgggctgttggatgataatctgtcatccaccagtcagtcatcagacatcaagacc180
gagctgatccgaacgtcgagcctgggaagaagcagcctgccatttaaccttcagagaaga240
agccctgagcctgatcctgaaagtccattgtctcatgtctcgcaccccaatttttcagag300
cccatggcctcaaactcttcaacgttctgcacaagtttattctcatcatctttgacaaac360
tcggcgccttgccggcgaatgggtgctctgcctttcctgcctcaccctcccaagtatgag420
cagcaggttctcccagggcagtcatcaacctcctccctgcagctcagtggtgacacaggc480
aatgttcatgacgaggctgaacaggcagatgacataaaagacttcctcaatctttctgct540
ggagatgcttctgatggcagcttccatggtgaaaaccaagcgtttgctttcgccgaggcc600
gagcagatggagttccagttcttgtctgagcagctagggatcgccatcaccgataatgag660
gagagcccccaattagatgacatatacgacacgccgccgcctcaaatgtcgtcgcttccg720
gtctcatcctgctccaaccagatcctgcagaatccaggatctccggctaaactgccgctt780
agctcgtcgcggtcatcttctggatctgcagcagctaacaagtcaagattgaggtggaca840
ctggagctccacgagcgtttcgtagaggcagtgaacaagctcgaagggcctgacaaagca900
actcccaagggcgttctgaagcttatgaaagtggaaggcctgaccatctaccatgtaaag960
agtcatttgcagaagtaccgacacgcaaagtatattccagagatcaaagaagaaaagaag1020
gcttcctcggaccttaagaaagtacaaccgggtagcagtggaagcgatccgttcaaaaac1080
aagaacttggcagaagctctacggatgcaaatggaggttcagaagcagctccatgaacag1140
ctagaggtgcaaaggcagctgcagctacgcatagaagaacacgcgaaatacttgcagagg1200
atactggaagagcagcagaaggtcggcagtggcagctcgctctcactgaaaaccccgacg1260
gagccgtccgagtcgacgtcgaaagacagaactgaacctgaagaggccaccacctcttca1320
cctcagacgtccaagaacagcgaggcagggtccccttgttcataa1365
Claims (10)
1. a wheat protein TaMYB7A, is characterized in that, is the albumen as shown in (a) or (b):
A () is by the protein shown in SEQIDNO.1;
(b) by the protein shown in SEQIDNO.1 by one or more amino acid whose replacement, disappearance or/and insert and the derivative protein variant still with TaMYB7A function or activity obtained.
2. the gene of wheat protein TaMYB7A described in coding claim 1.
3. the encoding gene of wheat protein TaMYB7A, is characterized in that, described encoding gene is as the gene shown in (1) to (3) any one:
(1) its encoding sequence is the DNA molecular shown in SEQIDNO.2 or cDNA molecule;
(2) at least have 75% with the nucleotide sequence shown in SEQIDNO.2, at least have 85%, at least have 90%, at least there is 95% identity and the DNA molecular of albumen described in claim 1 of encoding or cDNA molecule;
(3) under strict conditions with arbitrary described nucleotide sequence hybridization in (1) or (2), and the DNA molecular of albumen or cDNA molecule described in coding claim 1.
4. the recombinant vectors containing gene described in Claims 2 or 3, expression cassette, transgenic cell line or recombinant bacterium.
5. recombinant vectors according to claim 4, is characterized in that, described recombinant vectors is recombinant expression vector or recombinant cloning vector.
6. recombinant expression vector according to claim 5, is characterized in that, the promotor starting described gene in recombinant expression vector is 35S promoter.
7. recombinant expression vector according to claim 6, is characterized in that, recombinant expression vector is pBI121 or pCAMBIA1305.
8. described in claim 1, described in albumen, Claims 2 or 3, recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium described in gene, claim 4 improve the application in crop yield.
9. application according to claim 8, is characterized in that, described crop is monocotyledons or dicotyledons.
10. application according to claim 9, is characterized in that, described plant is Arabidopis thaliana or paddy rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610033104.1A CN105524155B (en) | 2016-01-19 | 2016-01-19 | Wheat gluten TaMYB7A and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610033104.1A CN105524155B (en) | 2016-01-19 | 2016-01-19 | Wheat gluten TaMYB7A and its encoding gene and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105524155A true CN105524155A (en) | 2016-04-27 |
| CN105524155B CN105524155B (en) | 2019-01-04 |
Family
ID=55766714
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610033104.1A Active CN105524155B (en) | 2016-01-19 | 2016-01-19 | Wheat gluten TaMYB7A and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105524155B (en) |
-
2016
- 2016-01-19 CN CN201610033104.1A patent/CN105524155B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| JUN ZHENG ET AL.: "TEF-7A, a transcript elongation factor gene, influences yield-related traits in bread wheat (Triticum aestivum L.).", 《JOURNAL OF EXPERIMENTAL BOTANY》 * |
| LICHAO ZHANG ET AL.: "Molecular characterization of 60 isolated wheat MYB genes and analysis of their expression during abiotic stress.", 《JOURNAL OF EXPERIMENTAL BOTANY》 * |
| ZHANG,L.ET AL.: "Genbank登录号：AEV91186.1", 《NCBI》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105524155B (en) | 2019-01-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA3049172A1 (en) | Plant grain trait-related protein, gene, promoter and snps and haplotypes | |
| CN105753953B (en) | Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant | |
| WO2009075860A2 (en) | Transgenic plants with enhanced agronomic traits | |
| US20150135372A1 (en) | Transgenic Plants With Enhanced Agronomic Traits | |
| CN108368515A (en) | Drought tolerant corn | |
| WO2020221029A1 (en) | Zea mays receptor-like kinase gene zmrlk7 and use thereof | |
| WO2023065966A1 (en) | Application of bfne gene in tomato plant type improvement and biological yield increase | |
| CN109111514A (en) | And the breeding method and its relevant biological material of the transgenic wheat of anti-banded sclerotial blight and root rot | |
| US20140090101A1 (en) | Transgenic plants with enhanced agronomic traits | |
| WO2019129145A1 (en) | Flowering time-regulating gene cmp1 and related constructs and applications thereof | |
| CN103102401B (en) | Application of GmMYB73 in cultivating stress tolerance transgenic plants | |
| CN103172716B (en) | Heat-resistant plant gene and application thereof | |
| CN105585623B (en) | The disease-resistant breeding method for turning TaMYB-KW DNA triticum and relevant biological material and application | |
| CN109628475B (en) | Application of brassinolide synthetic gene PaCYP724B1 in regulation and control of plant branches | |
| CN114250233B (en) | Application of arabidopsis calcium ion channel gene AtCNGC3 in sclerotinia sclerotiorum prevention and control | |
| CN103588867B (en) | Soybean transcription factor GmMYB174a, and coding gene and applications thereof | |
| CN102660556B (en) | Sequence of wheat auxin synthesis gene TaYUCCA1 and application and plant expression vector of wheat auxin synthesis gene TaYUCCA1 | |
| CN105524155A (en) | Wheat protein TaMYB7A and encoding gene and application thereof | |
| CN104561040A (en) | Plant heat-resistant gene HTT3 and application thereof | |
| CN114644702B (en) | Tango protein, related biological material and plant breeding method | |
| CN114644701B (en) | Use of proteins derived from corn and related biomaterials | |
| CN114317554B (en) | Application of rape gene BnPEP5 in sclerotinia sclerotiorum prevention and control | |
| CN116789785B (en) | High-yield and high-light-efficiency gene FarL a of long stamen wild rice and application thereof | |
| CN114591958B (en) | Application of corn miRNA in changing plant rough dwarf disease resistance | |
| CN113136388B (en) | Application of rice OsMAPKKK5 gene in aspect of improving plant height and grain type of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |