CN114591958B

CN114591958B - Application of corn miRNA in changing plant rough dwarf disease resistance

Info

Publication number: CN114591958B
Application number: CN202210307562.5A
Authority: CN
Inventors: 周羽; 张嘉月; 王振华; 邸宏; 张�林; 高岩松; 董玲; 刘显君; 曾兴
Original assignee: Northeast Agricultural University
Current assignee: Northeast Agricultural University
Priority date: 2022-03-25
Filing date: 2022-03-25
Publication date: 2022-09-16
Anticipated expiration: 2042-03-25
Also published as: CN114591958A

Abstract

The invention relates to the technical field of plant genetic engineering, and particularly discloses application of corn miRNA in changing plant rough dwarf disease resistance. The invention discovers that the expression level of the corn miRNA is positively correlated with the resistance of the corn to the rough dwarf disease for the first time, and the precursor sequence of the corn miRNA is shown as SEQ ID NO. 1. Provides a new way for exploring and creating a new material for changing the maize rough dwarf disease, lays a genetic material foundation for subsequent research, and provides a good information platform for the maize rough dwarf disease resistant gene resource storage. Promotes the research on the rough dwarf disease resistance genetic mechanism and disease-resistant molecular breeding of plants and provides reliable materials and data support for the research on the molecular biological mechanism for enhancing the rough dwarf disease resistance of plants such as corn and the like.

Description

Application of corn miRNA in changing plant rough dwarf disease resistance

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to application of corn miRNA in changing plant rough dwarf disease resistance.

Background

Maize rough dwarf disease, a worldwide maize disease, occurs in many parts. Maize rough dwarf disease causes the quality and yield of maize to be reduced, the damage to maize is large, and the disease is difficult to be effectively controlled once outbreak occurs. The Maize rough dwarf disease has been reported to have 4 pathogens, which are rice black-streaked dwarf virus (RBSDV), Southern rice black-streaked dwarf virus (SRBSDV), Maize Rough Dwarf Virus (MRDV) and Rio quart virus (MRCV).

The maize rough dwarf disease cannot be spread by the friction of aphids, thrips, seeds, soil and sap, the disease is mainly spread by the laodelphax striatellus, the laodelphax striatellus eats wheat or other gramineous plants with the rough dwarf virus, the laodelphax striatellus can carry and transmit the virus for the whole life after obtaining the virus, the laodelphax striatellus has the characteristic of greenness tendency, the wheat migrates to the maize after harvesting, and the obtained laodelphax striatellus eats the maize, so that the maize plants are infected with the rough dwarf virus. The whole growth period of the corn can be infected with the rough dwarf disease, the seedling period is particularly the sensitive period before the 5-leaf period, the corn is most susceptible to the disease when the 2-leaf period and the 1-heart period are adopted, and the sensitive period of the summer corn which is sown early is more susceptible to the disease because the sensitive period is exactly matched with the retransmission period of the small brown planthopper. Laodelphax striatellus nymphs or adults overwinter under weeds on the ground, wheat seedlings in the field and the like, and are the initial source of infection in the next year. The virus is spread to the wheat with green turning in spring by the gray planthopper with the virus, and then is spread to the corn from the wheat, the weeds on the ground and the like. The occurrence of the disease depends on the field quantity of the Laodelphax striatellus and the number of the toxic individuals to a great extent, and the incidence degree of different varieties has certain difference.

miRNA is about 21-24nt non-coding RNAs widely existing in eukaryote, and most plant miRNAs are regulation proteins such as targeted transcription factors and the like, so that the plant miRNAs are in the central position of plant gene expression regulation. Plant miRNAs are the hot spots of international research at present and play an important role in plant growth and development regulation and disease defense. The virus can induce a large amount of miRNA to generate in the process of infecting host plants, the miRNA is up-regulated or down-regulated to express when the virus is infected, and the miRNA plays a role by inhibiting negative regulation factors in defense reaction and promoting positive regulation factors in defense reaction.

The occurrence of maize rough dwarf disease is influenced by various factors such as disease resistance of varieties, the number of medium Laodelphax striatellus, the number of field weeds, a farming system, weather conditions and the like, so that the difficulty in preventing and controlling the disease is high. At present, the production mainly adopts the comprehensive control measures of mainly taking agricultural measures such as adjusting the sowing time, strengthening the field management and the like and taking chemical control as the assistance. However, the prevention and treatment measures have the defects of labor and time waste, easy environmental pollution, poor prevention and treatment effect and the like, and the cultivation and planting of disease-resistant varieties are effective ways for preventing and treating the maize rough dwarf disease.

Therefore, the disease-resistant molecular mechanism needs to be deeply analyzed, and a foundation is laid for the cultivation of disease-resistant varieties and the analysis of genetic mechanisms.

Disclosure of Invention

The invention aims to provide application of miRNA in regulation of maize rough dwarf disease resistance, so as to solve the technical problem that maize germplasm resources in the prior art cannot meet the current maize production needs.

The invention performs miRNA, degradation group and transcriptome joint analysis on RBSDV infected corns, and finds that a corn miRNA is an important factor participating in regulation and control of maize rough dwarf disease. The miRNA is related to maize rough dwarf disease resistance.

Specifically, the technical scheme of the invention is as follows:

in a first aspect, the invention provides the use of a maize miRNA, or a biological material comprising a precursor sequence of said maize miRNA, for modifying resistance to rough dwarf in plants, said precursor sequence of said maize miRNA being represented by SEQ ID No. 1.

In a second aspect, the invention provides an application of a corn miRNA or a biological material containing a precursor sequence of the corn miRNA in breeding transgenic plants with changed rough dwarf resistance, wherein the precursor sequence of the corn miRNA is shown in SEQ ID NO. 1.

In a third aspect, the invention provides an application of a corn miRNA or a biological material containing a precursor sequence of the corn miRNA in improvement of rough dwarf resistant germplasm resources of plants, wherein the precursor sequence of the corn miRNA is shown as SEQ ID NO. 1.

In the invention, the mature sequence of the corn miRNA has a sequence shown as SEQ ID NO. 2.

The biological material is an expression cassette, a vector or a host cell.

The plant is corn.

In a fourth aspect, the invention provides a method for changing rough dwarf resistance of a plant, which controls the expression of the plant to a corn miRNA through a transgenic, hybridization, backcross, selfing or asexual propagation method, wherein the mature sequence of the corn miRNA is shown as SEQ ID NO. 2.

The controlling of expression of a maize miRNA by a plant refers to overexpressing or suppressing expression of the maize miRNA in a plant; the plant is preferably maize.

The transgene comprises the step of introducing a recombinant expression vector containing a precursor sequence of the corn miRNA into a plant by using a Ti plasmid, a plant virus vector, direct DNA (deoxyribonucleic acid) transformation, microinjection, a gene gun, conductance or an agrobacterium-mediated method to obtain a transgenic plant strain, wherein the precursor sequence of the corn miRNA is shown as SEQ ID No. 1.

The transgene comprises the step of introducing a recombinant expression vector containing a sequence for inhibiting the expression of the corn miRNA into a plant by using a Ti plasmid, a plant virus vector, direct DNA (deoxyribonucleic acid) conversion, microinjection, a gene gun, conductance or agrobacterium-mediated method to obtain a transgenic plant strain, wherein the mature sequence of the corn miRNA is shown as SEQ ID NO.2, and the sequence for inhibiting the expression of the corn miRNA is obtained by a simulated target technology.

The invention has the beneficial effects that:

1. the invention discovers that the expression level of the corn miRNA is positively correlated with the resistance of the corn to the rough dwarf disease for the first time, namely that the expression level of the miRNA is negatively correlated with the disease degree.

2. The invention provides a new way for exploring and creating a new maize rough dwarf resistant material, lays a genetic material foundation for subsequent research, and provides a good information platform for maize rough dwarf resistant gene resource storage.

3. The invention promotes the research on the maize rough dwarf resistance genetic mechanism and disease-resistant molecular breeding, and provides reliable materials and data support for the research on the molecular biological mechanism for enhancing the rough dwarf resistance of the maize.

Drawings

FIG. 1 is a GUS staining map of Arabidopsis thaliana tissue specificity provided in example 2 of the present invention, in which an oval-shaped marked region shows a stained portion.

FIG. 2 shows the electrophoresis results of the detection of the overexpression vector pCUB-OE provided in example 3 of the present invention, where M is 2000 marker, W is water, P is positive control, N is negative control, and 1-4 are recombinant Agrobacterium positive plasmids.

FIG. 3 is the overexpression of transgenic T progeny provided in example 4 of the present invention ₂ And (3) a generation plant detection result graph, wherein M is 2000 marker, W is water, P is positive control, N is negative control, and 1-21 is a transgenic positive strain.

FIG. 4 is a detection electrophoretogram of the suppression expression vector pCUB-MIM provided in example 5 of the present invention, wherein M is 2000 marker, W is water, P is positive control, N is negative control, and 1-4 are recombinant Agrobacterium tumefaciens positive plasmids.

FIG. 5 shows the suppression of expression T provided in example 6 of the present invention ₂ The detection result graph of the generation transgenic line is that M is 2000 marker, W is water, P is positive control, N is negative control, and 1-21 is transgenic positive line.

FIG. 6 shows a transgenic positive line T provided in example 7 of the present invention ₂ And (3) replacing artificial inoculation identification picture.

FIG. 7 shows a transgenic positive line T provided in example 7 of the present invention ₂ And (3) identifying the plant height analysis chart by artificial inoculation. Wherein B104 represents the recipient inbred line inoculated with rough dwarf disease.

FIG. 8 is a graph showing the expression amount of maize rough dwarf virus in leaves after inoculation of overexpression miRNA precursor sequences and suppression expression of miRNA progeny strains provided in example 7 of the present invention.

FIG. 9 is a graph showing the expression amounts of miRNA in leaves after the treatment of inoculating the progeny strains of over-expressed miRNA and inhibitory-expressed miRNA provided in example 7 of the present invention.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The instruments and devices mentioned in the following examples are conventional instruments and devices unless otherwise specified. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 analysis of the miRNA flanking sequences of the invention

The miRNA upstream sequence of the invention is searched at NCBI website, in order to ensure the complete promoter region sequence, the sequence about 2000bp upstream thereof (shown as SEQ ID NO. 4) is selected to carry out promoter prediction and analysis at PLANTCARE website, and the result shows that the miRNA upstream contains typical eukaryotic promoter core elements TATA-box (238-241bp), CAAT-box (510-513bp) and the like, cis-acting regulatory element A-box (705-708bp) and the like. Meanwhile, a plurality of light response elements ATCT-motif (1495-1504bp), Sp1(1820-1825bp) and the like exist in the promoter region.

EXAMPLE 2 recombinant plasmid pCAMBIA1301-Pro transformation

The pCAMBIA1301 vector was cleaved with EcoR I enzyme and Nco I enzyme (NEB), and the miRNA promoter (shown in SEQ ID NO. 4) was inserted into the pCAMBIA1301 vector (available from Prohibidae biol., Ltd.) and the 35S promoter was completely replaced by the promoter of the target gene. The recombinant plasmid pCAMBIA1301-Pro was transferred into Arabidopsis thaliana by the flower dipping method. Harvested T ₀ And (3) generating Arabidopsis seeds, dibbling and planting the Arabidopsis seeds in an MS solid culture medium containing 1% of hygromycin concentration for screening, wherein the transgenic Arabidopsis has hygromycin resistance and normal growth, and the Arabidopsis without transformation success is withered, yellow and wilted. Arabidopsis seedlings which still normally grow after two weeks were stained with GUS staining solution, and the stained parts were observed microscopically, and as a result, the GUS protein was found to be expressed in Arabidopsis leaves after repeated cycles as shown in FIG. 1. The result shows that the miRNA drives the target gene to express in the plant leaves.

EXAMPLE 3 construction and detection of overexpression vectors

The total DNA of an inbred line B73 is used as a template, TTCTTTCTCTTCTT (SEQ ID NO.5) and CCGCTTGGCCATGC (SEQ ID NO.6) are used as primers, a precursor sequence of miRNA is amplified (shown as SEQ ID NO.1, and a mature sequence is shown as SEQ ID NO. 2), the precursor sequence of the miRNA is connected to a pCUB vector (Mojo program, 2012, maize laccase Zmlac5 gene Arabidopsis thaliana genetic transformation, page 2, paragraph 3), and the precursor sequence of the miRNA is inserted between a promoter and a terminator on the pCUB vector by utilizing a BamHI enzyme cutting site. Specifically, carrying out single enzyme digestion on pCUB empty carrier by using BamHI, recovering pCUB carrier fragment by using glue, carrying out homologous recombination to connect a target fragment to a carrier, carrying out transformation, selecting single spots, sequencing, transforming overexpression carrier plasmid pCUB-OE into agrobacterium EHA105 competent cells by adopting a heat shock method, selecting single colony of recombinant agrobacterium for propagation, extracting plasmid DNA and carrying out PCR identification. The results are shown in FIG. 2, which shows that the recombinant Agrobacterium plasmid can amplify a target fragment of about 250bp, while the negative control and water have no specific band, thus proving that the target gene overexpression vector plasmid has been successfully transferred into Agrobacterium and can be used for the next step of genetic transformation of maize.

Example 4 overexpression of transgenic T2 Generation lines assay

Transforming the maize inbred line B104 by adopting an agrobacterium infection immature embryo method, and breeding to obtain a T2 generation strain. And extracting total DNA of leaves of the T2 generation two-leaf stage of the obtained maize transgenic plant by a CTAB method. Specific primers (GCGCTATATTTTGTTTT, SEQ ID NO. 7; ACATATTCATAGTT, SEQ ID NO.8) are designed according to the sequences of a promoter, a target gene and a terminator, and PCR detection is carried out by taking wild corn B104 leaf blade DNA as negative control and plasmid DNA as positive control. Referring to fig. 3, the positive transgenic plant and plasmid can amplify 842bp promoter plus target gene plus terminator fragment, and amplification bands are not seen in the negative control and the water control.

Example 5 construction and detection of expression-suppressing vectors

A simulation target technology is adopted, overlapping PCR amplification is carried out on a region combined with miRNA on a target gene through designing a specific primer to obtain an MIM target fragment, an MIM sequence (shown as SEQ ID NO. 3) is connected to a pCUB (MoGeorge, 2012, maize laccase Zmlac5 gene Arabidopsis thaliana genetic transformation,

page

2, 3 rd paragraph) vector, and the MIM sequence is inserted between a promoter and a terminator on the pCUB vector by utilizing a BamHI enzyme cutting site. Specifically, carrying out single enzyme digestion on pCUB empty carrier by using BamHI, recovering pCUB carrier fragment by using glue, carrying out homologous recombination to connect a target fragment to a carrier, carrying out transformation, selecting single spots, sequencing, transforming agrobacterium EHA105 competent cells of the suppression expression carrier plasmid pCUB-MIM by adopting a heat shock method, selecting a single colony of the recombinant agrobacterium for propagation, extracting plasmid DNA and carrying out PCR identification. The results are shown in FIG. 4, which indicates that the recombinant Agrobacterium plasmid can amplify a target fragment of about 700bp, while the negative control and water do not have the specific band, thus proving that the suppression expression vector plasmid has been successfully transferred into Agrobacterium and can be used for the next genetic transformation of maize.

Example 6 inhibition of expression of transgenic T2 generation Strain assay

Transforming the maize inbred line B104 by adopting an agrobacterium infection immature embryo method, and breeding to obtain a T2 generation strain. And extracting total DNA of leaves of the T2 generation two-leaf stage of the obtained maize transgenic plant by a CTAB method. Specific primers (SEQ ID NO.7-8) are designed according to the sequences of a promoter, a target gene and a terminator, and PCR detection is carried out by taking wild corn B104 leaf blade DNA as negative control and plasmid DNA as positive control. The results are shown in FIG. 5, 194bp promoter, target gene and terminator gene fragments can be amplified from both positive transgenic plants and plasmids, and no amplified band is seen in negative control and water control.

Example 7 spatiotemporal expression Pattern analysis of miRNA in transgenic lines

(1) Artificial inoculation identification of transgenic positive strain

The artificial inoculation of rough dwarf virus is carried out by adopting a net cage inoculation method. Firstly, sowing the seeds of the corn B104 and the transgenic line into seedling raising hole trays, wherein each hole tray has 72 holes (12 holes multiplied by 6 holes), performing single-seed sowing, culturing the seedlings in a place without the ash plant hopper, and inoculating the seedlings after the seedlings grow to the two leaves and the heart stage. During inoculation, the hole trays are cut and placed in containers (70cm multiplied by 50cm), earth is hilled until no gap exists between the hole trays, and each container is covered with an 80-mesh insect-proof net. According to the toxicity carrying rate of artificially cultured laodelphax striatellus (30% in the embodiment) and the proportion of 1 head of the laodelphax striatellus in each plant, calculating the number of the laodelphax striatellus (the number of the laodelphax striatellus is equal to the number of seedlings multiplied by 1/the toxicity carrying rate of the laodelphax striatellus) required to be added into each inoculation box, uniformly transferring the laodelphax striatellus to the corn seedlings according to the calculated number by using an inoculation transfer device, and not inoculating the corresponding control group of each group. After inoculation, the mouth of the inoculation box is sealed and placed indoors. Inoculating for 2d at room temperature. During inoculation, the small brown planthoppers in the seed box are periodically disturbed to promote the small brown planthoppers to migrate and increase the inoculation efficiency. And after inoculation is finished, opening the insect-proof net, taking out the hole tray, and spraying the insecticide to stop the virus transmission of the laodelphax striatellus. And (3) placing the corn seedlings outside the ashless plant hoppers, hardening the seedlings for 2d, and transplanting the seedlings to a field for growth. After the plants grow for 60 days, performing disease resistance identification on each individual plant, detecting 40 plants in each material, wherein the result shows that the heights of an overexpression strain (overexpression T2 generation) and an inhibition expression strain (inhibition expression T2 generation) are lower than those of an uninoculated plant (CK), the height of the overexpression strain is higher than that of the inhibition expression strain, the disease grade index of the overexpression strain is 3 grade (the height of the overexpression strain is about healthy plant 1/2), the disease grade index of the inhibition strain is 4 grade (the height of the inhibition strain is about healthy plant 1/3), the disease grade index of a receptor inbred line B104 is 4 grade (the height of the receptor inbred line B104 is about healthy plant 1/3), the height of the inhibition strain is lower than that of the receptor inbred line B104, the height of the overexpression strain is higher than that of the receptor inbred line B104 (see figures 6 and 7, wherein the first CK on the horizontal coordinates represents a control group of the receptor inbred line B104 inoculated with rough dwarf disease, the second CK represents a control group of the inoculation overexpressed strain inoculated with rough dwarf disease, the third CK represents the control group inoculated with the suppression expression strain of rough dwarf).

(2) Analysis of viral expression in overexpression and suppression of expression transgene Positive lines

From the beginning of putting the bemisia tabaci with the virus, after the 5d, 14d and 28d of inoculation, B104, leaves of 20 transgenic lines which are over-expressed and inhibited are respectively collected, primers (TGTGCGTTGCGACTCAGAAA, SEQ ID NO. 9; GCTGTCTCTTGATGTCCCAGT, SEQ ID NO.10) are designed according to the sequence of the RBSDV, and qRT-PCR is carried out to detect the virus expression condition. The results are shown in fig. 8, after rough dwarf inoculation, the expression of the virus in the receptor inbred line B104, the overexpression transgenic line and the suppression expression transgenic line shows a continuous rising trend, and the time points of peak appearance are the same and are all 28 days after inoculation; the virus expression amounts of B104 strains are 20.256, 45.456 and 59.552 respectively at 5, 14 and 28 days after inoculation, the virus expression amounts of the transgenic strains for inhibiting expression are 31.595, 71.156 and 79.497 respectively at 5, 14 and 28 days after inoculation, and the virus expression amounts of the transgenic strains for over-expressing are 7.034, 25.057 and 33.395 respectively at 5, 14 and 28 days after inoculation. The expression level of the virus of the overexpression transgenic line is lower than that of the suppression expression transgenic line and the receptor inbred line B104, and the expression level of the virus of the suppression expression transgenic line is higher than that of the receptor inbred line B104.

(3) Analysis of miRNA expression in overexpression and suppression expression transgenic positive lines

From the beginning of putting the bemisia tabaci with the poison, after the inoculated 5d, 14d and 28d, respectively collecting B104, over-expression and suppression expression 20 transgenic strain leaves, designing a specific primer (CAGCGTGTCTTTCTCTTCTTTC, SEQ ID NO. 11; AGCAGGGTCCGAGGTATTC, SEQ ID NO.12), and carrying out qRT-PCR to detect the miRNA expression condition. Referring to fig. 9, the expression levels of miRNA in B104 plant lines at 5, 14 and 28 days after sampling were 1.356, 1.468 and 1.298, respectively; the over-expression-1 in the over-expression strain is 2.055, 2.560 and 1.630 respectively; overexpression-2 was 2.560, 2.894, 2.14, respectively; overexpression-3 is 1.982, 2.354, 1.489 respectively; the expression levels of miRNA in the inhibition expression-1 in the inhibition expression strain are 0.801, 1.094 and 0.550 respectively at 5, 14 and 28 days after sampling; the expression-2 inhibition values are 0.562, 0.896 and 0.354 respectively; the expression-3 inhibition values were 0.789, 0.912 and 0.364, respectively. The strains have the tendency of ascending first and then descending, and the peak value appears 14d after the treatment; the expression quantity of the over-expression transgenic line is obviously higher than that of the receptor inbred line B104 and the suppression expression transgenic line (P is less than 0.05) at 3 time points.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> northeast university of agriculture

Application of <120> corn miRNA in changing plant rough dwarf disease resistance

<130> KHP221111285.3

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttctttctct tctttctttt ggcggcatgg ccaagcgg 38

<210> 2

<211> 19

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ucuuucucuu cuuucuuuu 19

<210> 3

<211> 102

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gatccaaaag aaagatcaag agaaagagtt gttgttgtta tggtctaatt taaatatggt 60

ctaaagaaga agaataaaag aaagatcaag agaaagaggt ac 102

<210> 4

<211> 2065

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agaacacttg gctaggttgc atcaaatgct tgacgaccta cagagcggga attttccatc 60

tgcaaccttc tgtcgaaaga gtccgcttac gggcgggtga ggatcaacac tctgccacct 120

agacatggct caaaacgaag gggtaaggcc aagtgttctt aaaacaaaac tctcagtgca 180

cttcggagca cggtcttccg ttaggtcctt tacggacgac gaaagccagc cccttggcta 240

tactctactc ttcgcctccg gctgttcttt ccttttggct cggcggagct gagctgggtt 300

ccattacact ctgtaggaaa tgcatagaca gtccacgcag caaaccgagg ccctgcgtgc 360

gccgtacgta ccgcctacga ataataggta gccccacccc aggcagagtt tgtgagccgt 420

gtaataggcg accatttcgc gcggttcggg gggcacttga ataagccgcc ggcacccggc 480

tgcgtcttta cccctatcca atttttgggc caattccccc ttcgtactac caaaaaatga 540

gattcttgcc gaatccgagt ttgctgctcc aaccattaca aaactaatac ctattctgtt 600

tagtacttca ggtgcttctc tagcgtataa tgtaaatctc gtagcggatc aattccaacg 660

agcctttcaa actagtactt tttgtaatcg actctatagc ttcttcaata aacgctggtt 720

cttcgatcaa gttttgaatg actttctagt cagatcgttc ctgcgtttcg gatattcagt 780

ctcattcgaa gctttagaca agggtgctat tgagatattg ggcccttatg gtatctcgta 840

cacattccga cgattggccg agcgaataag tcaacttcaa agtggatctg ttgtgcgaag 900

agtgcgttat gaaccgtggc cgcctacctg ctttggttgg tgggggcggc tcctccgttg 960

tgggtaaacg ggaaacccga ctctacgaac ccgaggaaag gctgcacagc ttccgtaggg 1020

tcgttaagac cggagctttt tgtagtgcta gcaggaatgc aagtgaatga atccaatccc 1080

ctttcaaatc ggcgaggtaa taccttattg aagtagggca cgctacggca acacaggact 1140

gacggggtgg gggcttgctg tctacttggc gagccttcac tgcccccttc tgtaacttcc 1200

cttctttcgt ccgtccacga ggcagtcaaa agaaagagag aaaggggcgg ctataacgca 1260

ggagtcgtgg cggttgtatg ccacaaggtc cctatagaca aggggacaag tgaatcatcg 1320

cttttgggcg caggcagccc tctaccatcc atcccattgc attcctctca tagagtactg 1380

taccgtctca gaccagatac atctatggaa agaaaggatt tcatagaaaa tattcatttt 1440

tctctttttt tggatcccca tgcattccgt tattcccgta actatggatt ggattggatt 1500

ggattgattg attgtcccta cctaactaaa tggtagtggt ctagggagcg caattgctag 1560

agcacgggag aatgaagagt aatgatttaa gcaagagcag ccggacggac tactatagtc 1620

agtctagtga ctactatagt cttttctttc tttgtagtta agtaataatg tttggtatag 1680

cagcctttcc gagcgagtct ctgggatctc ctgtaaaccc ccatgatgtg gtaaagggag 1740

ggaggatatt aggggaagca gtgagtggag attcccctgc ggagagccgg atgaggggag 1800

accctcacgt ccggttcgga gggcggggat atcccgaccc tactatcatt atgcctttgc 1860

aatgttactt ggttcaactc catttgtgac cttttctcgt atgtgggact ctctatcttc 1920

ttgggtagat tctagatcgt ctttcatttt gttagtgagt agttttatta ttaataagtc 1980

aagtcaagaa taataagaga actgtaggag cttgccagga cggcttggta agcaagctac 2040

ctgttatgta ggcgccaact cccag 2065

<210> 5

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ttctttctct tctt 14

<210> 6

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ccgcttggcc atgc 14

<210> 7

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

gcgctatatt ttgtttt 17

<210> 8

<211> 14

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

acatattcat agtt 14

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgtgcgttgc gactcagaaa 20

<210> 10

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gctgtctctt gatgtcccag t 21

<210> 11

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagcgtgtct ttctcttctt tc 22

<210> 12

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

agcagggtcc gaggtattc 19

Claims

1. The application of the method for over-expressing or inhibiting expression of the maize miRNA in changing the resistance of the plant rough dwarf virus is disclosed, wherein the precursor sequence of the maize miRNA is shown in SEQ ID NO. 1; the plant is corn; the method for over-expressing the maize miRNA can enhance the resistance of the plant rough dwarf disease, and the method for inhibiting the expression of the maize miRNA can weaken the resistance of the plant rough dwarf disease.

2. The application of the method for over-expressing or inhibiting expression of the corn miRNA in breeding transgenic plants with changed rough dwarf resistance performance is disclosed, wherein the precursor sequence of the corn miRNA is shown as SEQ ID NO. 1; the plant is corn; the method for over-expressing the corn miRNA can be used for breeding transgenic plants with enhanced rough dwarf resistance, and the method for inhibiting expression of the corn miRNA can be used for breeding transgenic plants with reduced rough dwarf resistance.

3. The application of the corn miRNA or the biological material containing the precursor sequence of the corn miRNA in improvement of rough dwarf resistant germplasm resources of plants is disclosed, wherein the precursor sequence of the corn miRNA is shown as SEQ ID NO. 1; the plant is corn.

4. The use of any one of claims 1-3, wherein the mature sequence of the maize miRNA is as set forth in SEQ ID No. 2.

5. Use according to claim 3, wherein the biological material is an expression cassette, a vector or a host cell.

6. A method for changing the rough dwarf resistance of a plant is characterized in that the expression of a corn miRNA by the plant is controlled by a method of transgenosis or the combination of the transgenosis and hybridization, backcross, self-crossing or asexual propagation, and the mature sequence of the corn miRNA is shown in SEQ ID NO. 2; the plant is corn;

the controlling of expression of a maize miRNA by a plant refers to overexpressing or inhibiting expression of the maize miRNA in the plant; the overexpression may enhance plant rough dwarf resistance and the suppression of expression may attenuate plant rough dwarf resistance.

7. The method of claim 6, wherein said transgening comprises introducing a recombinant expression vector comprising a precursor sequence of said maize miRNA into the plant using a Ti plasmid, a plant viral vector, direct DNA transformation, microinjection, gene gun, conductance, or Agrobacterium-mediated method to obtain a transgenic plant line, said precursor sequence of said maize miRNA being represented by SEQ ID No. 1.

8. The method of claim 6, wherein the transgene comprises introducing a recombinant expression vector comprising a sequence that inhibits the expression of the maize miRNA into the plant using a Ti plasmid, a plant viral vector, direct DNA transformation, microinjection, a gene gun, conductance, or Agrobacterium-mediated method to obtain a transgenic plant line, wherein the mature sequence of the maize miRNA is shown in SEQ ID No.2, and the sequence that inhibits the expression of the maize miRNA is obtained by a simulated target technique.