CN109609516B - Application of disease-resistant gene in rice false smut resistance improvement - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a disease-resistant gene in rice false smut resistance improvement. The OsRFS1 gene is cloned from rice, the nucleotide sequence of the OsRFS1 gene is shown as SEQ ID NO. 1, and the resistance of the rice to false smut can be improved by changing the expression abundance of the OsRFS1 gene through a gene engineering technology. Research on the biological function of the OsRFS1 gene proves that the overexpression of the OsRFS1 gene in different rice varieties can enable rice to show the capability of enhancing the resistance of the rice to ustilaginoidea virens, and the disease resistance of the rice to the ustilaginoidea virens is influenced by regulating the expression level of the OsRFS1 gene. The OsRFS1 gene can be used for cultivating false smut resistant rice varieties.

Description

Application of disease-resistant gene in rice false smut resistance improvement

Technical Field

The present invention belongs to the field of plant gene engineering technology. In particular to the functional identification of OsRFS1 gene and the application in the improvement of rice false smut resistance. The invention changes the expression abundance of the OsRFS1 gene through a gene engineering technology, and can improve the resistance of rice to false smut. The OsRFS1 gene can be applied to the cultivation of rice varieties resisting false smut.

Background

With the increasing population, the continuous decrease of the cultivated land area and the change of the environment all over the world, the grain safety is seriously challenged. The rice diseases are one of the important factors for limiting the safe production of rice. Especially, in recent ten years, the rice false smut which is getting worse, not only causes the yield reduction of rice, but also generates toxin which is harmful to human and livestock, and seriously threatens the grain safety. False smut is a disease of rice panicle caused by false smut (pathogenic asexual Ustilaginoidea virens, sexual Villospora virens). In recent decades, along with climate change, large-area popularization of high-yield and high-quality hybrid rice in China and improvement of water and fertilizer levels of rice, false smut occurs in large areas in each rice production area in China. Especially, the annual incidence area of the national false smut in recent years exceeds 1.5 hundred million mu, and the false smut becomes one of the main diseases which endanger the safe production of rice. Ustilaginoidea virens affects the nutrition transportation and normal development of grains in rice, causes the increase of blight rate and the reduction of thousand grain weight, and seriously affects the rice yield. The ustilaginoidea virens wraps grains, produced ustilaginoidea virens pollutes rice, and after people and livestock eat the rice polluted by the ustilaginoidea virens, the ustilaginoidea virens can strongly inhibit human and livestock tubulin assembly and cell skeleton formation, seriously inhibit normal growth of human and livestock cells and greatly threaten human and livestock health. For example, hens eating rice contaminated with ustilaginoidin do not lay eggs, sows eating rice contaminated with ustilaginoidin abortion, and aquatic animals with water body contaminated with ustilaginoidin develop malformation. At present, the prevention and treatment of the rice false smut in agricultural production depends on the spraying of a large amount of pesticides to a great extent, and the spraying of the pesticides not only increases the investment of manpower and material resources, but also causes the irreparable pollution to the environment due to pesticide residues. Therefore, the development of the false smut resistant gene of the rice improves the disease resistance of the rice to the false smut, and has important practical production significance for cultivating new high-quality disease-resistant rice varieties.

At present, researches on rice infection caused by ustilaginoidea virens are relatively few. Aiming at the study of Ustilaginoidea virens, a few genes are cloned by constructing Ustilaginoidea virens mutant libraries and combining methods such as transcriptome analysis and the like in several laboratories at home and abroad, and the fact that the genes have partial effect on the pathogenicity of Ustilaginoidea virens is found, and the pathogenicity of the Ustilaginoidea virens can be reduced to a certain extent by knocking out the genes. Aiming at the research of rice, through transcriptome analysis of rice young ear infected by ustilaginoidea virens, the expression quantity of related genes which are partially involved in cellular phosphorylation, programmed cell death, cell wall synthesis, abscisic acid signal, calcium ion regulation, seed starch storage, embryo formation and the like of rice is found to be changed before and after the ustilaginoidea virens is infected in the rice young ear, but whether the genes are really involved in the resistance of the rice to the ustilaginoidea virens or not is still not directly proved at present.

Research on different rice germplasm resources discovers that different rice varieties have difference in disease resistance to false smut, and implies that unexplored false smut resistant genes exist in part of rice germplasm resources. Several research units in China identify the rice false smut resistant quantitative trait loci on a plurality of chromosomes of rice by constructing a recombinant inbred line population or a introgression line population consisting of rice false smut resistant and rice false smut susceptible genetic materials. However, until now, it has been unknown whether these anti-false smut quantitative trait loci contain anti-false smut genes and whether these anti-false smut genes can improve the disease resistance of rice against false smut by genetic means.

The research of the invention finds that the OsRFS1 gene in rice positively regulates the resistance to ustilaginoidea virens. The overexpression OsRFS1 gene can enhance the disease resistance of different rice varieties to ustilaginoidea virens, and the knockout of OsRFS1 gene expression can obviously reduce the resistance of rice to ustilaginoidea virens. The invention has important significance for improving the resistance of the important grain crop rice to false smut.

Disclosure of Invention

The invention aims to separate and clone an OsRFS1 gene from rice, aims to improve the resistance of the rice on the rice false smut resistance target character through the research and application of the OsRFS1 gene of the rice and provides a new gene resource for rice genetic breeding. The invention provides an OsRFS1 gene and a protein coded by the same, and biological function verification is carried out on the function of the gene and the application of the gene in rice false smut improvement. The isolated gene of the invention encodes a protein of a special GRAS family, and the biological function of the protein is to regulate and control the resistance of rice to false smut.

The invention separates and uses a cDNA segment of OsRFS1 gene coding GRAS family protein, and explains the action mechanism of the segment. The OsRFS1 gene has the sequence shown in SEQ ID NO:1, and the coding protein sequence is shown as SEQ ID NO:2, respectively.

The gene of the present invention can be obtained by screening a BAC library using a DNA fragment of the predicted gene sequence of the present invention as a probe. Similarly, the gene of the present invention can be amplified from the genome or cDNA of cultivated rice or gramineous crops by PCR technique. The gene of the present invention can also be obtained by chemical synthesis.

By adopting the technical scheme, the gene expression vector containing the OsRFS1 regulatory element, such as a constitutive promoter, an inducible promoter and an organ-specific promoter, can be obtained by separation and fusion construction. When the gene of the present invention is constructed into a plant expression vector, an enhancer may be used, and these enhancer regions may be an ATG initiation codon, a initiation codon of a neighboring region, and the like, but must be in the same reading frame as the coding sequence in order to ensure translation of the entire sequence.

The OsRFS1 gene sequence can be applied to crops, in particular to rice breeding for disease resistance, transgenic lines and new gene varieties.

The specific technical scheme for realizing the invention is as follows:

1. according to the result of RT-PCR, a cDNA fragment containing the complete gene of OsRFS1 is separated from flower 11 of the rice variety, and the nucleotide sequence is shown as SEQ ID NO:1 is shown. The specific separation method is described in detail in example 1.

2. The cDNA fragment containing the entire gene of OsRFS1 was ligated to pU1301 vector to construct an overexpression vector of OsRFS1, which was named Ubi: OsRFS1OE by the applicant. The specific method is described in detail in example 2.

3. Designing a CRISPR gene knockout target of OsRFS1, and constructing a CRISPR gene knockout vector of OsRFS 1. Applicants named this expression vector pYL-Cas9-gRNA-OsRFS 1. The specific method is described in detail in example 3.

4. The expression vector Ubi: OsRFS1OE and the CRISPR knockout expression vector pYL-Cas9-gRNA-OsRFS1 are transferred into the rice recipient medium flower 11 by using a mature Agrobacterium-mediated transgenic method (Lin and Zhang, optimizing the tissue culture conditions for high efficiency transformation of expression of indication. plant Cell Rep,2005,23:540-548) to obtain a genetically transformed plant. Meanwhile, the expression vector Ubi, OsRFS1OE is transferred into the rice recipient Huai rice No. 5 to obtain a genetic transformation plant. The specific method is described in detail in example 4.

5. At T₂And identifying the expression quantity of the Ubi OsRFS1OE transgenic plant and the resistance of ustilaginoidea virens, and carrying out statistical analysis on related phenotypes. The specific methods are described in detail in example 5 and example 6. At T₂Gene mutation conditions of pYL-Cas9-gRNA-OsRFS1 transgenic plants are identified, and relevant phenotypes are analyzed statistically. The specific method is described in detail in example 5.

6. The infection rate of ustilaginoidea virens in young panicles of rice after the ustilaginoidea virens with GFP fluorescent markers infect the young panicles of rice is counted by a fluorescence microscope method. The specific method is described in detail in example 7.

7. The biomass of the ustilaginoidea virens in the young panicles of the rice is counted after the ustilaginoidea virens infects the young panicles of the rice by means of molecular biology. The specific method is described in detail in example 8.

Compared with the prior art, the invention has the following advantages:

the invention describes a method for separating and cloning a DNA fragment containing a complete coding segment of an OsRFS1 gene and verifying the function of the OsRFS1 gene. The invention discovers that the OsRFS1 gene can control the resistance of rice to false smut, the overexpression of the OsRFS1 gene can enhance the resistance of rice to false smut, and the knockout of the OsRFS1 gene can reduce the resistance of rice to false smut. The invention can provide a new method for genetic improvement of rice resistance to false smut.

Drawings

FIG. 1: the invention relates to a flow chart for identifying and separating and cloning rice false smut resistant OsRFS1 gene and verifying OsRFS1 gene function.

FIG. 2: the invention discloses a schematic construction process of an expression vector Ubi: OsRFS1 OE. Description of reference numerals: panel A in FIG. 2: a schematic of the structure of the empty vector pU1301 for the construction of the expression vector Ubi: OsRFS1 OE. Panel B in fig. 2: OsRFS1OE, a DNA fragment containing the coding region of OsRFS1 gene. RB and LB represent the right and left borders of T-DNA, respectively, GUS represents the beta-glucuronidase gene, Hpt represents the hygromycin phosphotransferase gene, Ubi represents the promoter of the maize ubiquitin gene, 35S represents the promoter of cauliflower mosaic virus, NOS represents the polyadenylation signal sequence terminator, KpnI and BamHI are restriction endonucleases. Panel C in fig. 2: expression vector Ubi, OsRFS1OE in rice middle flower 11 background is obtained to detect OsRFS1 gene expression level in transgenic rice. Panel D in fig. 2: the expression vector Ubi, OsRFS1OE is expressed in the background of No. 5 rice of rice variety, and OsRFS1 gene expression level in transgenic rice is detected.

FIG. 3: the construction process of the CRISPR vector pYL-Cas9-gRNA-OsRFS1 is shown in the drawing. Description of reference numerals: panel A in FIG. 3: pYL-Cas 9-gRNA. P₃₅: HPT denotes 35S promoter Table of cauliflower mosaic virusThe hygromycin phosphotransferase gene, P_UbiRepresents a maize ubiquitin gene promoter, NLS represents a nuclear localization signal sequence, T_nosRepresents the Agrobacterium tumefaciens terminator sequence. Panel B in fig. 3: the design site of gRNA of CRISPR target T1 and T2 of OsRFS1 gene. Panel C in fig. 3: the OsRFS1 gene knockout rice line has the number and the position of deleted deoxyribonucleotides compared with a wild type. Graph D in fig. 3: agarose gel electrophoresis detection shows that the PCR product of the OsRFS1 gene knockout rice strain is obviously smaller than that of the wild type.

FIG. 4: disease resistance analysis of T3 generation transgenic plants of Ubi, OsRFS1OE and pYL-Cas9-gRNA-OsRFS1 to false smut. Description of reference numerals: panel A in FIG. 4: the number of rice false smuts per ear after inoculating ustilaginoidea virens in rice middle flower 11 background OsRFS1 gene overexpression families 6 and 10. Compared with the wild type (namely non-transgenic, the same below), the number of false smut per ear of rice is obviously reduced after the false smut is inoculated on the transgenic rice constructed by carrying the Ubi: OsRFS1OE vector. Panel B in fig. 4: rice head rice false twist rate after inoculation of Ustilaginoidea virens on rice medium flower 11 background OsRFS1 gene overexpression families 6 and 10. Compared with a wild type, the rice false twist rate of each ear of rice is obviously reduced after the rice is inoculated with ustilaginoidea virens by the transgenic rice constructed by carrying the Ubi: OsRFS1OE vector. Panel C in fig. 4: rice false smut number per ear after inoculation of Ustilaginoidea virens in No. 5 background OsRFS1 gene overexpression families 3 and 5 of rice. Compared with the wild type, the number of rice false smut per ear is obviously reduced after the rice false smut is inoculated on the transgenic rice constructed by carrying the Ubi: OsRFS1OE vector. Graph D in fig. 4: rice head rice false twist rate after inoculation of Ustilaginoidea virens in No. 5 background OsRFS1 gene overexpression families 3 and 5 of rice. Compared with a wild type, the rice false twist rate of each ear of rice is obviously reduced after the rice is inoculated with ustilaginoidea virens by the transgenic rice constructed by carrying the Ubi: OsRFS1OE vector. E diagram in fig. 4: the number of false smut per ear after inoculating ustilaginoidea virens in the rice middle flower 11 background osrfs1 gene knockout families 1 and 2. Compared with a wild type, the number of rice false smut per ear is obviously increased after the rice false smut is inoculated on the transgenic rice constructed by carrying pYL-Cas9-gRNA-OsRFS1 vector. Graph F in fig. 4: the rice medium flower 11 background osrfs1 gene knockout families 1 and 2 have rice koji ball rate per spike after inoculation of ustilaginoidea virens. Compared with a wild type, the rice bulb bending rate of each ear of rice constructed by carrying pYL-Cas9-gRNA-OsRFS1 vector is obviously increased after the rice is inoculated with Ustilaginoidea virens.

FIG. 5: after ustilaginoidea virens carrying GFP fluorescent markers infect wild rice middle flower 11 and transgenic rice young ear knocked out by OsRFS1 gene constructed by carrying pYL-Cas9-gRNA-OsRFS1 vector, the infection proportion of ustilaginoidea virens in rice young ear flowers is counted. Description of reference numerals: compared with a wild type middle flower 11 of a rice variety, the OsRFS1 gene knockout family constructed by carrying pYL-Cas9-gRNA-OsRFS1 vector has the advantage that the proportion of GFP fluorescence labeled ustilaginoidea virens in rice flowers can be obviously increased in different days infected by ustilaginoidea virens carrying GFP fluorescence labeling.

FIG. 6: and (3) counting the biomass of the ustilaginoidea virens after the ustilaginoidea virens infects the florescence 11 of wild rice and the young ear of the transgenic rice constructed by carrying pYL-Cas9-gRNA-OsRFS1 vector. Description of reference numerals: beta-actin is a housekeeping gene of ustilaginoidea virens; WT means wild type middle flower 11; osrfs1 shows a transgenic rice plant constructed with pYL-Cas9-gRNA-OsRFS1 vector. Compared with a wild type middle flower 11, the OsRFS1 gene knockout family constructed by carrying pYL-Cas9-gRNA-OsRFS1 vector has the advantage that the expression quantity of housekeeping genes of ustilaginoidea virens in rice flowers is obviously increased in different days infected by ustilaginoidea virens.

Detailed Description

Description of sequence listing:

the sequence table SEQ ID NO 1 is a nucleotide sequence (the sequence length is 1-3102bp, wherein 1-770 bp is 5'UTR, 771-2624 bp is exon (exton), and 2625-3084 bp is 3' UTR) containing OsRFS1 gene separated and cloned by the invention and a corresponding amino acid sequence. Encodes 611 amino acid residues.

From the following description and these examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions.

The methods used in the following examples are conventional methods or reagents in the art unless otherwise specified, and reference may be made to the specific procedures: for example: molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor) or related products (practice of the invention is not limited thereto).

Example 1: separating and cloning DNA fragment containing OsRFS1 gene complete coding segment

In order to obtain a complete DNA fragment encoded by the OsRFS1 gene, the invention adopts a Trizol extraction kit (the specific operation steps are operated according to the instruction provided by the kit) produced by Invitrogen company to extract the total RNA of young ears with the length of 0.5mm of flowers 11 (or ZH11) (from the institute of crop science of Chinese academy of agricultural sciences) in rice varieties. The reverse transcription was carried out using DNaseI and reverse transcriptase manufactured by Invitrogen. The cDNA obtained by reverse transcription was used as a template, and a specific primer of OsRFS1 gene (the nucleotide sequence of the gene is shown in SEQ ID NO: 1), RFS1OEF (forward primer): 5' -GAATTCATGTTGGCGGGTTGCTCGT-3' (the underlined sequence is the KpnI recognition site); RFS1OER (reverse primer): 5' -GGATCCGCTTTGCTGAGAATGCTGTTG-3' (the underlined sequence is the BamHI recognition site); the coding region of the OsRFS1 gene, namely CDS sequence (the sequence is shown in SEQ ID NO: 1) is separated and cloned by a PCR method, and the protein sequence is shown in SEQ ID NO: 2.

Example 2: construction of overexpression vector of protein coding region of OsRFS1 Gene

The PCR product obtained in example 1 was digested with KpnI and BamHI, and then ligated with KpnI and BamHI digested vector pU1301 (a publicly reported commercial plasmid: Zhou et al, Over-expression of plasmid amino transfer genes in rice regulated in alkaline nitrosynthesis and amplified amino acid content in seeds. Theor Appl Gene, 2009,118: 1381-1390; the basic backbone of which is pCAMBIA1301 from CAMBIA laboratory, Australia, whose structure is shown in FIG. 2A, expression regulation of the target gene was achieved by addition of a maize Ubiquitin promoter), using T4DNA ligase (purchased from Promega, used specifically and used in the specifications referred to the products of the same company). The ligation product was transferred to E.coli Tran-T1 (purchased from Beijing Quanjin Biotechnology Co., Ltd.) by thermal activation, recovered for 45min with 400. mu. lLB medium, spread on LA medium plate containing 50mg/L kanamycin, and incubated at 37 ℃ in incubator for 14-16h (reference is made to LA and LB formulations: SammBruke, molecular cloning instructions, third edition, scientific Press, Beijing, 2002). The single clone was picked, expanded and extracted, and positive clones were screened by KpnI and BamHI double digestion, and the resulting expression vector was named Ubi: OsRFS1 OE.

Example 3: construction of OsRFS1 Gene knockout vector pYL-Cas9-gRNA-OsRFS1

Designing a sgRNA sequence based on CRISPR/Cas9 aiming at the OsRFS1 gene of rice, wherein the sgRNA sequence is positioned at an exon close to the 5' end of the OsRFS1 gene, and the nucleotide sequence is T1: 5 '> ACGTGTCTCCGGGATGTTGG < 3'; t2: 5 '> GCCCCATTGTTCGCGCCAAG < 3' (see diagram B in fig. 3). The sgRNA T1 and T2 are respectively inserted into vectors pYL-sgRNA-OsU3 and pYL-sgRNA-OsU6a by an overlap extension PCR method to obtain PCR fragments OsU3-T1-gRNA-polyT and OsU6 a-T2-gRNA-polyT. The above PCR fragment was ligated into pYL-Cas9-gRNA vector by BsaI cleavage (see panel a in fig. 3). Vectors pYL-Cas9-gRNA, pYL-sgRNA-OsU3 and pYL-sgRNA-OsU6a were gifted by the professor Liu flare light of the university of south China agriculture (see published articles for vector information, Ma et al, A robust CRISPR/Cas9system for conservation, high-efficiency multiplex genome editing in monocot and dicotplants. mol plant.2015,8: 1274-. The specific operation steps are as follows:

(1) construction of OsU3-T1-gRNA-polyT and OsU6a-T2-gRNA-polyT fragments

The first round of PCR takes pYL-sgRNA-OsU3 plasmid as a template, and uses primers B1' and T1R to amplify a T1 target sequence of 20bp between a OsU3 promoter and an OsRFS1 gene; pYL-sgRNA-OsU3 is also taken as a template, and primers T1F and B2 are used for amplifying a T1 target sequence and gRNA-polyT of the OsRFS1 gene; in the second round of PCR, the product of the first round of PCR is used as a template, and primers B1' and B2 are used for amplification to obtain a OsU3-T1-gRNA-polyT fragment.

A fragment OsU6a-T2-gRNA-polyT was obtained in the same manner. A first round of PCR uses pYL-sgRNA-OsU6a as a template, and primers B2' and T2R are used for amplifying OsU6a promoter and a T2 target sequence of 20bp of an OsRFS1 gene; pYL-sgRNA-OsU6a is also used as a template, and a T2 target sequence and gRNA-polyT of the OsRFS1 gene are amplified by using primers T2F and BL; in the second round of PCR, the product of the first round of PCR is used as a template, and primers B2' and BL are used for amplification to obtain a OsU6a-T2-gRNA-polyT fragment. The sequence information of the primers used in this step is:

B1’:5'-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3' (the underlined sequence is the BsaI cleavage site);

B2:5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3' (the underlined sequence is the BsaI cleavage site);

B2’:5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3' (the underlined sequence is the BsaI cleavage site);

BL:5'-AGCGTGGGTCTCGACCGGGTCCATCCACTCCAAGCTC-3' (the underlined sequence is the BsaI cleavage site);

T1F:5'-ACGTGTCTCCGGGATGTTGGGTTTTAGAGCTAGAAATAGC-3' (underlined sequence as target T1);

T1R:5'-CCAACATCCCGGAGACACGTTGCCACGGATCATCTGCACA-3' (underlined sequence as target T1);

T2F:5'-GCCCCATTGTTCGCGCCAAGGTTTTAGAGCTAGAAATAGC-3' (underlined sequence as target T2);

T2R:5'-CTTGGCGCGAACAATGGGGCCGGCAGCCAAGCCAGCACC-3' (underlined sequence is target T2).

(2) Construction of CRISPR mutation vector pYL-Cas9-gRNA-OsRFS1 of OsRFS1

PCR fragments of OsU3-T1-gRNA-polyT and OsU6-T2-gRNA-polyT were ligated into the BsaI site of pYL-Cas9-gRNA vector by a one-side ligation method using the restriction enzyme BsaI (see Panel A in FIG. 3).

Example 4: obtaining of transgenic Rice

The expression vector Ubi: OsRFS1OE (from example 2) and knock-out vector pYL-Cas9-gRNA-OsRFS1 (from example 3) were transformed into calli of flower 11(ZH11) in rice cultivars by Agrobacterium EHA 105-mediated genetic transformation, simultaneously, an expression vector Ubi: OsRFS1OE (from example 2) is transferred into a rice variety Huai-rice No. 5 (from agricultural science institute of Yangzhou city, Jiangsu province, the cultivar rice with the largest popularization area in Jiangsu province) through an agrobacterium EHA 105-mediated genetic transformation method, and the callus with resistance to hygromycin (an antibiotic for screening positive transgenic callus, purchased from Roche pharmaceutical Co., Ltd. of Denmark) is obtained through conventional pre-culture, infection culture, co-culture and screening culture, and then is subjected to differentiation culture, rooting culture, seedling hardening and transplanting to the field to obtain a transgenic plant. The method for Agrobacterium genetic transformation and the reagents and formulations used in the method of the present invention are optimized according to the reports of Hiei et al (Hiei et al, efficient transformation of rice (Oryza sativa L.), formulated by Agrobacterium and sequence analysis of the bases of the T-DNA. plant J.1994,6: 271-282; Lin and Zhang, optimization of the tissue culture transformation of the index plant Cell Rep.2005,23:540-548) (the above-mentioned optimization method is a well-known method described in the patent application documents published in the national laboratory of agricultural university for genetic improvement of agricultural crops for about 20 years).

Example 5: identification of OsRFS1 gene transgenic rice

(1) Expression quantity detection of OsRFS1 gene overexpression transgenic plant

1) RNA of transgenic rice leaf blade at tillering stage from Ubi: OsRFS1OE was extracted and synthesized into cDNA by reverse transcription. The specific operation method and procedure are the same as in example 1.

2) The obtained reverse transcription product was subjected to qRT-PCR detection using primers (primer combination RFS1RT-F1 and RDS1RT-R1), and the amplification result of rice housekeeping actin gene (accession number LOC _ Os03g13170) was used as an internal reference (primer combination actin RT-F and actin RT-R), and the sequences were as follows:

RFS1RT-F1:5'-TGCGGATACTCAACGCCATCA-3'

RFS1RT-R1:5'-ACTCGCCGACTCCGGTGATC-3'

actinRT-F:5'-AACCAGCTGAGGCCCAAGA-3'

actinRT-R:5'-ACGATTGATTTAACCAGTCCATGA-3'

the PCR reaction was performed in a total volume of 20. mu.l, containing 1. mu.l of cDNA template, 10. mu.l of 2 XGC I buffer, 2. mu.l of 10mM dNTP, 0.2. mu.l of each 10mM primer, 0.2. mu.l of rTaq enzyme, and 20. mu.l of deionized water (2 XGC I buffer, dNTP, rTaq enzyme, etc., used therein, were purchased from Boehringer Bio Inc.). The PCR reaction conditions were as follows: 4min at 94 ℃; ② 94 ℃ for 40 s; ③ 58 ℃ for 30 s; fourthly, 30s at 72 ℃; fifthly, circulating 28 times from the step II to the step IV; sixthly, the temperature is 72 ℃ for 7 min; keeping at 4 deg.C. PCR products were detected electrophoretically on 2% (mass/volume) TBE agarose gels.

RT-PCR detection results show that the expression quantity of the positive transgenic plant of the expression vector Ubi: OsRFS1OE is obviously increased compared with the wild type. The results are shown in FIGS. 2C and 2D.

(2) OsRFS1 gene knockout transgenic plant detection

Selecting upstream and downstream sequences of target points T1 and T2 to design primers, carrying out PCR amplification, sequencing amplified fragments, and judging whether a DNA region between the target points T1 and T2 has base deletion or not through a sequencing peak diagram. The primer sequences for identifying the deletion effect of the OsRFS1 gene are as follows:

RFS1E2F:5'-ATTCTTTGGAAGAACAACAA-3'

RFS1E2R:5'-AACTCGGGCGGCTGCGGC-3'

sequencing the PCR product of the OsRFS1 gene knockout transgenic single plant by using a primer RFS1E2F, and identifying the OsRFS1 gene sequence deletion condition. The invention successfully obtains transgenic plants OsRFS1-1 and OsRFS1-2 with OsRFS1 gene deletion, wherein 317 deoxyribonucleotides are deleted in the transgenic plant OsRFS1-1, 309 deoxyribonucleotides are deleted in the transgenic plant OsRFS1-2, and the result is shown in a figure 3C and a figure 3D.

Example 6: identification and verification of resistance of transgenic rice to false smut

(1) Identification of resistance of Zhonghua 11 background transgenic rice to false smut

To analyze transgenic rice plants for resistance to false smut, applicants examined Ubi: OsRFS1OE and a knock-out independent T against a mid-flower 11 background₂The seeds of the family osrfs1-1 and osrfs1-2 are sown in a seedling bed after conventional seed soaking and pregermination, and are transplanted to a field after 20 days, the planting density is 15 x 24 cm, the planting place is a test field of Huazhong agriculture university in flood mountainous areas of Wuhan city, Hubei province, China, and field management is carried out according to a conventional rice planting method under the condition of safety protection facilities. At the tillering stage of rice, we transplanted rice in bread boxes and transferred it to growth chambers. In waterOne week before rice heading, Ustilago virens inoculation tests are carried out on OsRFS1 gene overexpression rice families 6 and 10, knockout expression rice families OsRFS1-1 and OsRFS1-2 and wild type medium flower 11. The results show that after the OsRFS1 gene overexpression rice family 6 and the OsRFS1 gene overexpression rice family 10 are inoculated with ustilaginoidea virens at the booting stage, compared with wild type medium flower 11 (non-transgenic, the same below), the number of rice false smuts per ear and the rice false smut rate of transgenic positive single plants of the OsRFS1 gene overexpression rice family 6 and the OsRFS1 gene overexpression rice family 10 are both significantly lower than those of the wild type control (p is compared with the wild type medium flower 11 (non-transgenic, the same below)<0.01), the results are shown in fig. 4A and 4B. The results show that the OsRFS1 gene overexpression rice strain can enhance the resistance of rice to ustilaginoidea virens. The number of rice false-twist balls per ear and the rice false-twist rate of single plants of OsRFS1 gene knockout expression rice families OsRFS1-1 and OsRFS1-2 are obviously higher than those of wild type (non-transgenic) control (p)<0.01), see E-diagram in fig. 4 and F-diagram in fig. 4. The results show that the transgenic rice line with the OsRFS1 gene knocked out and expressed can reduce the resistance of rice to ustilaginoidea virens.

(2) Identification and verification of resistance of Huai rice No. 5 background transgenic rice to false smut

To analyze the resistance of transgenic plants to false smut, applicants examined two independent T's of OsRFS1OE in the context of "Huai Rice No. 5₂The seeds are sown in a seedling bed after conventional seed soaking and pregermination, and are transplanted to a field after 20 days, the planting density, namely the plant row spacing, is 15 x 24 cm, the planting site is a test field of Huazhong agriculture university in flood mountain areas of Wuhan city, Hubei province, China, and the field management is carried out according to a conventional rice planting method under the condition of safety protection facilities. During the rice tillering stage, the applicant transplanted the rice in bread boxes and transferred it into growth chambers. One week before rice heading, Ustilago virens inoculation tests are carried out on OsRFS1 gene overexpression rice families 3 and 5 and wild type Huai rice No. 5. The results show that after the OsRFS1 gene overexpression rice families 3 and 5 are inoculated with ustilaginoidea virens at the booting stage, compared with wild type Huai rice No. 5 (non-transgenic, the same below), the number of rice false grains per ear and the rice false grain rate of positive single plants of the OsRFS1 gene overexpression rice families 3 and 5 are obviously lower than those of wild type control (p is the same as the wild type Huai rice No. 5) (the number of rice false grains per ear and the rice false grain rate per ear are both obviously lower than those of the wild type control (p is the same as the wild<0.01), see fig. 4C and 4D. To be provided withThe results show that the OsRFS1 gene overexpression rice strain can enhance the resistance of rice to ustilaginoidea virens.

Example 7: statistics of GFP fluorescence labeling Ustilaginoidea virens infection of rice young panicle

Inoculating ustilaginoidea virens G2 carrying GFP fluorescence labeling to rice materials 'Zhonghua 11' and pYL-Cas9-gRNA-OsRFS1 at the booting stage, taking spikelets after inoculating for 1, 3, 5, 7, 9 and 11 days, observing and counting the presence or absence of GFP fluorescence in the spikelets by an OLYMPUS SZX16 vertical fluorescence microscope ((Olympus Corporation, Tokyo, Japan)), observing 100 florets at the same position of each spikelet, recording the number of flowers with GFP fluorescence on the surface of a floral organ, and displaying that the OsRFS1 gene knockout expression paddy rice family OsRFS1-1 is inoculated with ustilaginoidea virens carrying GFP fluorescence labeling at the booting stage, compared with a wild type middle flower 11, the number of florets with GFP fluorescence in the spikelets of the OsRFS1 gene knockout expression rice family OsRFS1-1 is obviously higher than that of wild type control (p < 0.01). As shown in figure 5, the results show that the OsRFS1 gene knockout expression rice strain can obviously enhance the infection of ustilaginoidea virens on the florets in the young spikes of the rice.

Example 8: biomass analysis of Ustilaginoidea virens infected rice young panicle

Inoculating ustilaginoidea virens to rice materials 'Zhonghua 11' and pYL-Cas9-gRNA-OsRFS1 in the booting stage, taking young ears after 2, 3, 4, 5 and 6 days of inoculation, stripping stamens and pistils of florets, and comparatively analyzing the expression of ustilaginoidea virens housekeeping gene beta-actin (gene accession number KDB13104) by using a quantitative PCR method. The result shows that after the OsRFS1 gene knockout expression rice family OsRFS1-1 is inoculated with ustilaginoidea virens at the booting stage, compared with the wild type 'middle flower 11', the OsRFS1 gene knockout expression rice family OsRFS1-1 has the advantages that the expression quantity of the housekeeping gene beta-actin in stamens of the florets and pistils of the ustilaginoidea virens in the scilla sciaenae is obviously higher than that of the wild type control (p <0.01), and the figure is shown in figure 6. The results show that the OsRFS1 gene knockout expression rice line can enhance the infection of ustilaginoidea virens in stamens and pistils of florets in rice young ears.

Sequence listing

<110> university of agriculture in Huazhong

<120> application of a disease-resistant gene in rice false smut resistance improvement

<141>2019-01-26

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>3102

<212>DNA

<213> Rice (Oryza sativa)

<220>

<221>gene

<222>(1)..(3102)

<220>

<221>3'UTR

<222>(2625)..(3084)

<220>

<221>exon

<222>(771)..(2624)

<220>

<221>5'UTR

<222>(1)..(770)

<400>1

caccacaccg gagaggtgag tgagagtgag agagtgagag cagagaccac caccaccgga 60

gaggttagtg agagaggagt ggtaatggtg aggcaacaag agtaggttcc atttcatatc 120

atcactagga tagcgtagtt tgtaggctgc atctccatct ccatcgccat tgattcgcat 180

tgcatccatc attttaggat gttctactag ggttcttgat ttttcttttg gtttgttgtt 240

ttgacgaatg gaggtattgt tgggattcgc cgcctgctgc tcgtcgtcgt cgtcgccgat 300

gaggaggccg tgcgggctct gccccggcat gtccgatcgt tcgtgatttg ttttttctac 360

atgttttagg gcccatttgt tcttgatcct attctttgat tcttttgtac taagcattct 420

aaggcgaagc cacccattct ttcctgcata tatacttaca aacacatagc ccccatctga 480

tctcacaaac attatttctc tctctttttt tctcagtttt ttctttgttg atttactgac 540

caaattcttt ggaagaacaa caagatcatc tggtttttat ctgctcattc ttttgtacat 600

cgaatcatat acatttccat tccaccaaag ccttagccag ataccacaga gagagtgtga 660

gagaaatcag agtgagaaac agaggaggaa gaagaagaag aagacgagga ggaggaggag 720

gaggagcagg aggaggagga ggtctcttct tggcacgtcg cgttccggcg agtgacgtgt 780

ctccgggatg ttggcgggtt gctcgttctc gtcgtcgagg catcagatga gcaccgcgca 840

gcgtttcgac atcctcccct gcggcttctc caagcgcggc agccgcggcg acggcgccgc 900

cccgcgggtc gccggcgacg ccaggagcgg cgccaccacc tgctccttcc ggacgcaccc 960

cgcgccgccg gtcacccagt ccgtgtcctg gggcgccaag ccggagcccg gcggcaatgg 1020

caatggcgcc caccgcgccg ttaagcgggc gcatgacgag gacgcggtcg aggagtatgg 1080

ccccattgtt cgcgccaagc ggacgcggat gggcggcgac ggcgatgagg tatggttcca 1140

tcaatccatt gcagggacga tgcaagcgac ggcggcggga gaaggagagg aggcggagga 1200

ggagaaggtc ttcttggtgc cgagcgcggc ggcgttcccg cacggcatgg ccgccgcggg 1260

gccatcgctg gccgcggcca agaaggagga gtacagcaag tcgccgtccg actcgtcgtc 1320

ctcgtcgggc acggacggcg gctcgtcggc gatgatgccg ccgccgcagc cgcccgagtt 1380

cgacgcgagg aacggcgtgc cggcgccggg gcaggcggag cgggaggcgc tggagctggt 1440

gcgcgcgctc accgcgtgcg ccgactccct ctccgccggc aaccacgagg ccgccaacta 1500

ctacctggcc cggctcggcg agatggcctc gccggcgggg cccacgccga tgcaccgcgt 1560

ggccgcctac ttcaccgagg cgctcgcgct ccgcgtcgtg cgcatgtggc cgcacatgtt 1620

cgacatcggc ccgccgcggg agctcaccga cgacgccttc ggcggcggcg acgacgacgc 1680

catggcgctg cggatactca acgccatcac gcccatcccg aggttcctgc acttcacgct 1740

caacgagcgc ctcctccgcg agttcgaggg gcacgagcgc gtccacgtca tcgacttcga 1800

catcaagcag gggctccaat ggccgggctt gctccagagc ctggccgcgc gggcggtgcc 1860

tccggcgcac gtgcggatca ccggagtcgg cgagtcgagg caggagctgc aggagacggg 1920

agcgcggctg gcgcgcgtcg ccgccgcgct cggcctggcg ttcgagttcc acgccgtggt 1980

cgaccggctc gaggacgtcc gcctgtggat gctccacgtc aagcgcggcg agtgcgtggc 2040

cgtgaactgc gtcctcgcca tgcaccgcct gctccgcgac gacgccgcgc tgaccgactt 2100

cctggggcta gcgcgcagca cgggcgccac catcctcctc ctcggcgagc acgagggcgg 2160

cggcctcaac tcggggaggt gggaggcgcg gttcgcgcgc gcgctgcggt actacgccgc 2220

ggcgttcgac gcggtggacg cggcggggct gccggaggcg agccccgcga gggccaaggc 2280

ggaggagatg ttcgcgcggg agatccgcaa cgcggtggcg ttcgagggcc ccgagcggtt 2340

cgagcgccac gagagcttcg ccgggtggcg gcggcgcatg gaggacggcg gcgggttcaa 2400

gaacgccggc atcggcgagc gcgaggcgat gcaggggcgc atgatcgcga ggatgttcgg 2460

gccggacaag tacaccgtgc aggcgcacgg cggcggcggc agcggcggcg gcgaggcgct 2520

cacgctccgg tggctggacc agccgctgta caccgtgacg gcgtggacgc cggcgggcga 2580

cggcgcggga ggcagcaccg tgtcggcgtc cacaacagca tcacattctc agcaaagcta 2640

agctgacgat gaatggtgat taggtgaaga gaaagaaaga acaaagcctt tttttacagt 2700

gcttcttttg ttaatgatga ttagttcata cagtatgaca attcttttat acattcagag 2760

aaaagaaaga agaaagaaag gtgtagtttt ttgttttata gattgatagg tggaaagatt 2820

caattaaatc aaattcaatt caatttttag attgtaattc tttataaata ttcttttggc 2880

tgttgagaga gagtcccctg caaaatgtag ctgcatgtag aagaaagaaa gcaaagaagc 2940

agtagataga ttagcagggg cagcatctct cacagtcact attagtgtct ccggctgtta 3000

ttatacaaca ttattattac aatcaaattc tttcatcatt cattctacat gtaatctctg 3060

ttcagaatca gaatgaaatg aaacatgtgt tatatttctc ca 3102

Claims (1)

1. The application of OsRFS1 gene derived from rice in enhancing resistance of rice to false smut is characterized in that the nucleotide sequence of the OsRFS1 gene is shown as sequence table SEQ ID NO:1 is shown.

Images