CN109609516A - Application of one disease-resistant gene in the improvement of Rice Resistance false smut - Google Patents

Abstract

The invention belongs to field of plant genetic project technology, and in particular to application of the disease-resistant gene in the improvement of Rice Resistance false smut.Clone obtains OsRFS1 gene from rice, and for nucleotide sequence as shown in SEQ ID NO:1, the present invention changes the gene expression abundance of OsRFS1 gene by technique for gene engineering, can improve rice to the resistance of false smut.It is had shown that by the research of the biological function to OsRFS1 gene, the ability that overexpression OsRFS1 gene can make rice show resistance enhancing to ustilaginoidea virens in different rice varieties influences rice to the disease resistance of false smut by adjusting OsRFS1 gene expression dose.OsRFS1 gene can be used for cultivating in anti-false smut rice varieties.

Description

Application of one disease-resistant gene in the improvement of Rice Resistance false smut

Technical field

The invention belongs to field of plant genetic project technology.Function Identification more particularly to OsRFS1 gene and in Rice Resistance Application in false smut improvement.The present invention changes the gene expression abundance of OsRFS1 gene by technique for gene engineering, can improve water Resistance of the rice to false smut.OsRFS1 gene can be used for the application in the rice varieties for cultivating anti-false smut.

Background technique

As world population increasingly increases, the change of the continuous reduction and environment of cultivated area, grain security is by tight High challenge.And rice disease is one of an important factor for limitation rice safety produces.Especially in recent ten years, it is on the rise False smut not only causes the rice underproduction, more generates to the harmful toxin of people and animals, seriously threaten grain security.False smut is by rice Rice Panicle caused by bent germ (cause of disease Invisible element Ustilaginoidea virens, Perfect stage Villosiclava virens) Portion's disease.In recent ten years, with climate change and China's high yield and high quality hybrid paddy rice be widely applied and rice liquid manure water Flat raising, false smut occur in each Rice Production area large area in China.Especially national false smut is fallen ill face every year in recent years For product more than 1.5 hundred million mu, false smut has become one of the Major Diseases of hazard rice safety in production.Ustilaginoidea virens shadow in paddy Grain nutrition transport and normal development are rung, causes sterile grain rate raising and mass of 1000 kernel decline, seriously affects rice yield.Ustilaginoidea virens Grain is wrapped up, the rice song endotoxin contamination rice generated, after people and animals eat the rice by rice song endotoxin contamination, rice song toxin can be strong Strong inhibition people and animals' tubulin assembling and cytoskeleton are formed, serious to inhibit the normal development of people and animals' cell, are caused to human and livestock health Great threat.For example the hen of edible rice song endotoxin contamination rice is not laid eggs, and the Sow abortion of rice song endotoxin contamination rice is eaten, The aquatic livestock developmental deformity etc. of rice song endotoxin contamination water body.At present in agricultural production to the prevention and treatment of rice green smut largely Upper spraying dependent on a large amount of pesticides, and the investment for spraying not only increase human and material resources of pesticide, the remnants of pesticide but will be caused Unrepairable pollution to environment.Therefore excavate the anti-false smut gene of rice itself, improvement rice to the disease resistance of false smut, There is important actual production meaning to High quality and diseases resistance new rice variety is cultivated.

The research for infecting rice to ustilaginoidea virens at present compares less.It is several both at home and abroad for the research of ustilaginoidea virens A few gene is cloned in conjunction with the methods of transcriptome analysis, has found it by building ustilaginoidea virens mutant library in laboratory Partial action is risen to the pathogenicity of ustilaginoidea virens, the cause of ustilaginoidea virens can be reduced to a certain extent by knocking out these genes Sick power.For the research of rice, by infecting the transcriptome analysis of rice young panicle to ustilaginoidea virens, discovery subparticipation rice Cells phosphorylation, apoptosis, Cell wall synthesis, the acid signal that falls off, calcium ion regulatory, seed starches storage, embryo shape Expression quantity at equal related genes is changed before and after ustilaginoidea virens infects rice young panicle, but whether these genes really join With rice to the resistance of ustilaginoidea virens, at present still without direct genetic evidence.

Finding different Rice Varieties song diseases to the research of rice difference germ plasm resource, there are the differences of disease resistance, imply There is the anti-false smut gene not yet excavated in the Rice Germplasm Resources of part.Domestic Ji Jia research unit passes through building Rice Resistance The recombinant inbred lines or introgressive line group of false smut and sense false smut genetic stocks composition, on a plurality of chromosome of rice Identify anti-false smut quantitative trait locus.But by currently, whether comprising anti-in these anti-false smut quantitative trait locus Can false smut gene and these anti-false smut genes improve rice by science of heredity means must not to the disease resistance of false smut And know.

The research of the invention finds that the OsRFS1 gene in rice is just regulating and controlling the resistance to ustilaginoidea virens.Overexpression The disease resistance of different Rice Varieties song germs can be enhanced in OsRFS1 gene, and knocking out OsRFS1 gene expression can be significant Rice is reduced to the resistance of ustilaginoidea virens.The present invention has important cereal crops rice important in the improvement of anti-false smut Meaning.

Summary of the invention

The purpose of the present invention is one OsRFS1 genes of separation clone from rice, it is intended to by rice Os RFS1 gene Research and application, on the objective trait of Rice Resistance false smut improve rice resistance, provided for Genetic and breeding in rice new Genetic resources.The present invention provides OsRFS1 gene and its protein of coding, carry out function and in rice to rice to the gene Application in bent disease improvement has carried out biological function verifying.The gene that the present invention separates encodes the egg of a special GRAS family White, biological function is resistance of the adjusting and controlling rice to false smut.

The cDNA segment of the OsRFS1 gene of one coding GRAS family protein of present invention separation and application, and to the segment The mechanism of action be illustrated.OsRFS1 gene has the nucleotide sequence as shown in SEQ ID NO:1, coding protein sequence Column are as shown in SEQ ID NO:2.

Probe can be made using the DNA fragmentation of the predicted gene sequence in the present invention, screening obtains this hair from the library BAC Bright gene.Equally, round pcr can also be used, from expanding in the genome or cDNA of cultivated rice or gramineous crop Obtain gene of the invention.Equally chemically synthesized method can also be taken to obtain gene of the invention.

, can be isolated comprising OsRFS1 controlling element using above technical scheme, such as constitutive promoter, induction type Promoter and organ specific promoters construct expression vector.Gene of the invention is being building up to plant expression vector When middle, it is possible to use enhancer, these enhancer regions can be ATG initiation codon and neighboring region initiation codon etc., But must be identical as the reading frame of coded sequence, to guarantee the translation of entire sequence.

OsRFS1 gene order of the present invention can be used for crop, especially paddy disease-resistant breeding, transgenic line, Application in gene new varieties.

Realize that the specific technical solution of the present invention is as follows:

1, according to RT-PCR's as a result, isolating the cDNA piece comprising OsRFS1 complete genome in 11 from spending in rice varieties Section, nucleotide sequence is as shown in SEQ ID NO:1.Specific separation method has a detailed description in embodiment 1.

2, by it is above-mentioned include that the cDNA segment of OsRFS1 complete genome is connected on pU1301 carrier, building obtains The expression vector is named as Ubi:OsRFS1 OE by the overexpression carrier of OsRFS1, applicant.Specific method is in embodiment 2 In have a detailed description.

3, the CRISPR gene knockout target spot for designing OsRFS1, constructs the CRISPR gene knockout carrier of OsRFS1.Application The expression vector is named as pYL-Cas9-gRNA-OsRFS1 by people.Specific method has a detailed description in embodiment 3.

4, transgenic method (Lin and Zhang, the Optimising the of mature mediated by agriculture bacillus is utilized tissue culture conditions for high efficiency transformation of indica Rice.Plant Cell Rep, 2005,23:540-548) expression vector Ubi:OsRFS1 OE and CRISPR are knocked out and expressed Carrier pYL-Cas9-gRNA-OsRFS1 is transferred in rice receptor and spends in 11, obtains genetic transformation plant.Simultaneously by expression vector Ubi:OsRFS1 OE is transferred in rice No. 5, rice receptor Huaihe River, obtains genetic transformation plant.Specific method has in detail in example 4 Description.

5, in T₂In generation, identifies the expression quantity of Ubi:OsRFS1 OE transgenic plant and the resistance to ustilaginoidea virens, and right Relevant phenotype is for statistical analysis.Specific method has a detailed description in embodiment 5 and embodiment 6.In T₂Generation identification pYL- The gene mutation situation of Cas9-gRNA-OsRFS1 transgenic plant, and it is for statistical analysis to Relevant phenotype.Specific method exists It is had a detailed description in embodiment 5.

6, ustilaginoidea virens after rice young panicle is infected by the ustilaginoidea virens of the method statistic GFP fluorescent marker of fluorescence microscope Infection rate in rice young panicle is spent.Specific method has a detailed description in embodiment 7.

7, ustilaginoidea virens is in rice young panicle flower after infecting rice young panicle by the means statistics ustilaginoidea virens of molecular biology In biomass.Specific method has a detailed description in embodiment 8.

Compared with prior art, advantages of the present invention is as follows:

The present invention describes the DNA fragmentation and verifying that separation clone includes OsRFS1 gene complete coding region section The method of OsRFS1 gene function.Present invention discover that OsRFS1 gene can control rice to the resistance of false smut, by its excess Rice can be enhanced to the resistance of false smut in expression, and OsRFS1 gene knockout can be reduced rice to the resistance of false smut.This Invention can provide a kind of new method to the genetics of resistance improvement of false smut for rice.

Detailed description of the invention

Fig. 1: the present invention is identified and isolated from the anti-false smut OsRFS1 gene of cloning rice and verifying OsRFS1 gene function Flow chart.

Fig. 2: the building process schematic diagram for the expression vector Ubi:OsRFS1 OE that the present invention constructs.Description of symbols: figure A figure in 2: the structural schematic diagram of the empty carrier pU1301 for construction of expression vector Ubi:OsRFS1 OE.B figure in Fig. 2: Be inserted into expression vector Ubi:OsRFS1 OE includes the DNA fragmentation schematic diagram of the gene coding region OsRFS1.RB and LB distinguishes table Show that the right margin and left margin of T-DNA, GUS indicate that beta-glucuronidase gene, Hpt indicate hygromycin phosphotransferase gene, Ubi indicates the promoter of maize ubiquitin ubiquitin gene, and 35S indicates the promoter of cauliflower mosaic virus, and NOS indicates more Polyadenylation signal sequence ends, KpnI and BamHI are restriction enzyme.C figure in Fig. 2: 11 back are spent in rice Expression vector Ubi:OsRFS1 OE obtains OsRFS1 gene expression amount detection in transgenic paddy rice in scape.D figure in Fig. 2: in water Expression vector Ubi:OsRFS1 OE obtains OsRFS1 gene expression amount detection in transgenic paddy rice in No. 5 backgrounds of rice varieties Huaihe River rice.

Fig. 3: CRISPR carrier pYL-Cas9-gRNA-OsRFS1 building process schematic diagram.Description of symbols: in Fig. 3 A figure: the Vector map of pYL-Cas9-gRNA.P₃₅: HPT indicates that the tide of the 35S promoter starting expression of cauliflower mosaic virus is mould Plain phosphoric acid transferase gene, P_UbiIndicate Maize Ubiquitin gene promoter, NLS indicates nuclear localization signal sequence, T_nosIndicate crown gall Agrobacterium terminator sequence.B figure in Fig. 3: the design site of the gRNA of OsRFS1 gene C RISPR target spot T1 and T2.In Fig. 3 C figure: the deoxyribonucleotide number and position that OsRFS1 gene knockout rice strain lacks compared with wild type.In Fig. 3 D figure: agarose gel electrophoresis detection OsRFS1 gene knockout rice strain PCR product obviously become smaller compared with wild type.

The T3 of Fig. 4: Ubi:OsRFS1 OE and pYL-Cas9-gRNA-OsRFS1 is for transgenic plant to the disease-resistant of false smut Property analysis.Description of symbols: the A figure in Fig. 4: 11 background OsRFS1 gene overexpression familys 6 and 10 is spent to be inoculated in rice Every fringe rice curve number after ustilaginoidea virens.Compared to wild type (i.e. non-transgenic, similarly hereinafter), Ubi:OsRFS1 OE vector construction is carried Transgenic paddy rice inoculation ustilaginoidea virens after every fringe rice curve number significantly reduce.B figure in Fig. 4: 11 backgrounds are spent in rice OsRFS1 gene overexpression family 6 and 10 is inoculated with every fringe rice curve rate after ustilaginoidea virens.Compared to wild type, Ubi is carried: Every fringe rice curve rate significantly reduces after the transgenic paddy rice inoculation ustilaginoidea virens of OsRFS1 OE vector construction.C figure in Fig. 4: water No. 5 background OsRFS1 gene overexpression familys 3 and 5 of rice Huaihe River rice are inoculated with every fringe rice curve number after ustilaginoidea virens.Compared to wild type, Every fringe rice curve number significantly reduces after carrying the transgenic paddy rice inoculation ustilaginoidea virens of Ubi:OsRFS1 OE vector construction.In Fig. 4 D figure: No. 5 background OsRFS1 gene overexpression familys 3 and 5 of rice Huaihe River rice are inoculated with every fringe rice curve rate after ustilaginoidea virens.Phase Than wild type, every fringe rice curve rate is significant after carrying the transgenic paddy rice inoculation ustilaginoidea virens of Ubi:OsRFS1 OE vector construction It reduces.E figure in Fig. 4: 11 background osrfs1 gene knockout familys 1 and 2 are spent to be inoculated with every fringe rice curve after ustilaginoidea virens in rice Number.Compared to wild type, every fringe after the transgenic paddy rice inoculation ustilaginoidea virens of pYL-Cas9-gRNA-OsRFS1 vector construction is carried Rice curve number dramatically increases.F figure in Fig. 4: 11 background osrfs1 gene knockout familys 1 and 2 are spent to be inoculated with ustilaginoidea virens in rice Every fringe rice curve rate afterwards.Compared to wild type, the transgenic paddy rice for carrying pYL-Cas9-gRNA-OsRFS1 vector construction is inoculated with rice Every fringe rice curve rate dramatically increases after bent germ.

Fig. 5: the ustilaginoidea virens for carrying GFP fluorescent marker, which infects, spends 11 and carrying pYL-Cas9-gRNA- in wild rice After transgenic paddy rice children's fringe of the osrfs1 gene knockout of OsRFS1 vector construction, ustilaginoidea virens infects ratio in rice young panicle is spent Example statistics.Description of symbols: compared to spending 11 in rice varieties wild type, pYL-Cas9-gRNA-OsRFS1 vector construction is carried Osrfs1 gene knockout family in the different number of days that the ustilaginoidea virens for being carried GFP fluorescent marker infects, rice Hua Zhongneng Observe that the ratio of GFP fluorescent marker ustilaginoidea virens dramatically increases.

Fig. 6: ustilaginoidea virens, which infects, spends 11 and carrying pYL-Cas9-gRNA-OsRFS1 vector construction in wild rice After transgenic paddy rice children's fringe, the biomass statistics of ustilaginoidea virens.Description of symbols: β-actin is the housekeeping gene of rice aspergillus； WT indicates to spend 11 in wild type；Osrfs1 indicates to carry the transgenic paddy rice of pYL-Cas9-gRNA-OsRFS1 vector construction.Phase Than spending 11 in wild type, the osrfs1 gene knockout family of pYL-Cas9-gRNA-OsRFS1 vector construction is carried by false smut In the different number of days that bacterium is infected, rice spends the housekeeping gene expression quantity of middle ustilaginoidea virens to dramatically increase.

Specific embodiment

To the explanation of sequence table:

Sequence table SEQ ID NO:1 be the present invention separation clone include OsRFS1 gene nucleotide sequence (sequence Length is 1-3102bp, in which: 1--770bp is 5'UTR；771--2624bp is exon (exton)；2625--3084bp is 3'UTR) and corresponding amino acid sequence.Encode 611 amino acid residues.

According to description below and these embodiments, those skilled in the art can determine essential characteristic of the invention, and And without departing from the spirit and scope of the invention, various changes and modifications are made to the present invention so that its be applicable in it is various Purposes and condition.

Method therefor is conventional method in that art or reagent unless otherwise instructed in following embodiments, and specific steps can join It examines: for example: " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor) Or Related product (the invention is not limited thereto for implementation).

Embodiment 1: separation clone includes the DNA fragmentation of OsRFS1 gene complete coding region section

The intact DNA fragments of OsRFS1 gene coding in order to obtain, the present invention is using the production of Invitrogen company Trizol extraction agent box (concrete operation step is operated according to the specification that kit provides), extracts in rice varieties and spends 11 The total serum IgE of the young fringe of (or ZH11) (coming from Institute of Crop Science, Chinese Academy of Agricultural Science) 0.5mm long.Using The DNaseI and reverse transcriptase of Invitrogen company production, carry out reverse transcription to it.It is mould by the cDNA that reverse transcription obtains Plate, using the special primer of OsRFS1 gene (nucleotide sequence of the gene is as shown in SEQ ID NO:1), RFS1OEF is (positive Primer): 5'-GAATTCThe sequence of ATGTTGGCGGGTTGCTCGT-3'(underscore is KpnI recognition site)；RFS1OER is (anti- To primer): 5'-GGATCCThe sequence of GCTTTGCTGAGAATGCTGTTG-3'(underscore is BamHI recognition site)；Pass through Code area, that is, CDS sequence (sequence is shown in SEQ ID NO:1) of method separation clone's OsRFS1 gene of PCR, protein sequence As shown in SEQ ID NO:2.

Embodiment 2: the overexpression carrier of the protein coding region of building OsRFS1 gene

The PCR product obtained with KpnI and BamHI double digestion embodiment 1, then and by KpnI and BamHI double digestion (carrier is a kind of business plasmid of open report: Zhou et al., Over-expression of to carrier pU1301 aspartate aminotransferase genes in rice resulted in altered nitrogen metabolism and increased amino acid content in seeds.Theor Appl Genet,2009, 118:1381-1390；Its basic framework is the pCAMBIA1301 in the Australian laboratory CAMBIA, by the way that corn is added Ubiquitin promoter realizes that structure is as shown in the A figure in Fig. 2 to the expression regulation of target gene), it is connected using T4DNA Enzyme (being purchased from Promega company, detailed directions refer to the specification of the said firm's product with dosage) is attached.Connection product passes through The method that heat shockization turns is transferred in Escherichia coli Tran-T1 (purchased from Beijing Quanshijin Biotechnology Co., Ltd), adds 400 μ l LB culture medium recovery 45min, is applied on the LA culture medium flat plate of the kanamycins containing 50mg/L, 37 DEG C of incubator culture 14-16h (LA and LB formula refer to: Pehanorm Brooker, " Molecular Cloning:A Laboratory guide " third edition, Science Press, Beijing, 2002). Picking monoclonal, expands to cultivate and simultaneously extracts plasmid, by KpnI and BamHI double digestion screening positive clone, and by resulting table Ubi:OsRFS1 OE is named as up to carrier.

Embodiment 3: building OsRFS1 gene knockout carrier pYL-Cas9-gRNA-OsRFS1

The sgRNA sequence based on CRISPR/Cas9 is designed for rice Os RFS1 gene, positioned at the close of OsRFS1 gene At the exon at 5 ' ends, nucleotides sequence is classified as T1:5 '>ACGTGTCTCCGGGATGTTGG<3 '；T2:5 ' > GCCCCATTGTTCGCGCCAAG < 3 ' (see the B figure in Fig. 3).SgRNA T1 and T2 are distinguished by the method for Overlap extension PCR Be inserted into carrier pYL-sgRNA-OsU3 and pYL-sgRNA-OsU6a, obtain PCR fragment OsU3-T1-gRNA-polyT and OsU6a-T2-gRNA-polyT.The above PCR fragment is connected in pYL-Cas9-gRNA carrier by BsaI digestion (see Fig. 3 In A figure).Carrier pYL-Cas9-gRNA, pYL-sgRNA-OsU3 and pYL-sgRNA-OsU6a are by Agricultural University Of South China Liu Yao Light professor give that (carrier information, which is shown in, has published an article, Ma et al., A robust CRISPR/Cas9system for convenient,high-efficiency multiplex genome editing in monocot and dicot plants.Mol Plant.2015,8:1274–1284).Concrete operation step is as described below:

(1) building of OsU3-T1-gRNA-polyT and OsU6a-T2-gRNA-polyT segment

First round PCR using pYL-sgRNA-OsU3 plasmid as template, with primer B1 ' and T1R amplification OsU3 promoter with The T1 target sequence of OsRFS1 gene 20bp；Equally using pYL-sgRNA-OsU3 as template, OsRFS1 base is expanded with primer T1F and B2 Because of T1 target sequence and gRNA-polyT；Second wheel PCR is to expand to obtain with primer B1 ' and B2 using first round PCR product as template OsU3-T1-gRNA-polyT segment.

The segment of OsU6a-T2-gRNA-polyT is obtained using same method.The first round, PCR was with pYL-sgRNA- OsU6a is template, with the T2 target sequence of primer B2 ' and T2R amplification OsU6a promoter and OsRFS1 gene 20bp；Equally with PYL-sgRNA-OsU6a is template, expands OsRFS1 gene T2 target sequence and gRNA-polyT with primer T2F and BL；Second wheel PCR is to expand to obtain OsU6a-T2-gRNA-polyT segment with primer B2 ' and BL using first round PCR product as template.The step Suddenly the primer sequence information used are as follows:

B1’:5'-TTCAGAGGTCTCTCTCGCACTGGAATCGGCAGCAAAGG-3'(underlined sequences are BsaI digestion Site)；

B2:5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3'(underlined sequences are BsaI digestion position Point)；

B2’:5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3'(underlined sequences are BsaI digestion Site)；

BL:5'-AGCGTGGGTCTCGACCGThe sequence of GGTCCATCCACTCCAAGCTC-3'(underscore is BsaI digestion Site)；

T1F:5'-ACGTGTCTCCGGGATGTTGGGTTTTAGAGCTAGAAATAGC-3'(underlined sequences are target spot T1)；

T1R:5'-CCAACATCCCGGAGACACGTTGCCACGGATCATCTGCACA-3'(underlined sequences are target spot T1)；

T2F:5'-GCCCCATTGTTCGCGCCAAGGTTTTAGAGCTAGAAATAGC-3'(underlined sequences are target spot T2)；

T2R:5'-CTTGGCGCGAACAATGGGGCCGGCAGCCAAGCCAGCACC-3'(underlined sequences are target spot T2)。

(2) building of the CRISPR mutational vector pYL-Cas9-gRNA-OsRFS1 of OsRFS1

Using restriction enzyme BsaI, method by being connected while digestion, by OsU3-T1-gRNA-polyT With the PCR fragment of OsU6-T2-gRNA-polyT be connected at the site BsaI of pYL-Cas9-gRNA carrier in (referring in Fig. 3 A figure).

Embodiment 4: the acquisition of transgenic paddy rice

By expression vector Ubi:OsRFS1 OE (coming from embodiment 2) and knockout carrier pYL-Cas9-gRNA-OsRFS1 (coming from embodiment 3) is transferred to the callus that 11 (ZH11) are spent in rice varieties by the genetic transforming method that Agrobacterium EHA105 is mediated Tissue, while the genetic transformation side that expression vector Ubi:OsRFS1 OE (coming from embodiment 2) is mediated by Agrobacterium EHA105 It (is the maximum cultivated rice of Jiangsu Province's popularizing area from Jiangsu Province's Yangzhou Academy of Agricultural Sciences that method, which is transferred to rice varieties Huaihe River rice No. 5, Kind), by conventional preculture, infects culture, co-cultivation and screening and culturing and obtain having to hygromycin (for screening the positive Transgenosis callus a kind of antibiotic, buy from the Co., Ltd, Roche Group of Denmark) callus of resistance, using point Change culture, culture of rootage, hardening is simultaneously transplanted to crop field, and transgenic plant is obtained.The method of Agrobacterium genetic transformation of the invention It is that (Hiei et al., Efficient are optimized according to the report of Hiei et al. with reagent and formula used transformation of rice(Oryza sativa L.)mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA.Plant J.1994,6:271-282；Lin and Zhang, Optimising the tissue culture conditions for high efficiency transformation Of indica rice.Plant Cell Rep.2005,23:540-548) (above-mentioned optimization method is that Hua Zhong Agriculture University makees Method documented by the Patent Application Publication that object genetic improvement National Key Laboratory has disclosed in the past 20 years is known side Method).

The identification of embodiment 5:OsRFS1 gene transgenic rice

(1) the expression quantity detection of OsRFS1 gene overexpression transgenic plant

1) RNA of the transgenic paddy rice tillering stage blade from Ubi:OsRFS1 OE is extracted, reverse transcription synthesizes cDNA.Tool Gymnastics makees method and process with embodiment 1.

2) to obtained reverse transcription product with primer carry out qRT-PCR detection (primer sets be combined into RFS1RT-F1 and RDS1RT-R1), and use rice actin gene of running one's home (number of logging in LOC_Os03g13170) amplification as internal reference (primer sets are combined into actinRT-F and actinRT-R), sequence is as follows:

RFS1RT-F1:5'-TGCGGATACTCAACGCCATCA-3'

RFS1RT-R1:5'-ACTCGCCGACTCCGGTGATC-3'

actinRT-F:5'-AACCAGCTGAGGCCCAAGA-3'

actinRT-R:5'-ACGATTGATTTAACCAGTCCATGA-3'

It is 20 μ l that PCR, which reacts total volume, includes 10 μ l, 10mM dNTP of cDNA template 1ul, 2 × GC I buffer, 2 μ Each 0.2 μ l of 0.2 μ l, rTaq enzyme of l, 10mM primer, add deionized water to 20 μ l (used 2 × GC I buffer, dNTP, RTaq enzyme etc. is purchased from precious bioengineering Dalian Co., Ltd).PCR reaction condition is as follows: 1. 94 DEG C of 4min；②94℃ 40s； ③58℃ 30s；④72℃ 30s；5. 2. 4. being recycled to step 28 times from step；⑥72℃ 7min；7. 4 DEG C of preservations.PCR is produced Object electrophoresis detection on the TBE Ago-Gel of 2% (mass/volume).

RT-PCR testing result show expression vector Ubi:OsRFS1 OE transgenic positive plant relative to wild type and Speech, expression quantity obviously rise.As a result as shown in Figure 2 C and 2 D shown in FIG..

(2) the transgenic plant detection of OsRFS1 gene knockout

The upstream and downstream primers of target spot T1 and T2 are chosen, PCR amplification is carried out, amplified fragments is sequenced, are led to It crosses sequencing peak figure and judges whether the region of DNA domain between target site T1 and T2 occurs base deletion.Identify OsRFS1 gene delection effect The primer sequence of fruit is as follows:

RFS1E2F:5'-ATTCTTTGGAAGAACAACAA-3'

RFS1E2R:5'-AACTCGGGCGGCTGCGGC-3'

It is sequenced with PCR product of the primer RFS1E2F to the transgenosis single plant of OsRFS1 gene knockout, identifies OsRFS1 Gene order deletion condition.The present invention successfully obtains the transgenic plant osrfs1-1 and osrfs1-2 of OsRFS1 gene delection, Wherein transgenic plant osrfs1-1 lacks 317 deoxyribonucleotides, and transgenic plant osrfs1-2 lacks 309 deoxidations As a result ribonucleotide is shown in Fig. 3 C and Fig. 3 D.

Embodiment 6: transgenic paddy rice fights false smut identification verifying

(1) spend 11 background transgenic paddy rices to false smut Resistance Identification in

In order to analyze transgenic rice plant to the resistance of false smut, applicant is by the middle Ubi:OsRFS1 for spending 11 backgrounds The independent T of OE and knockout₂Family osrfs1-1 and osrfs1-2 seed by conventional seed soaking, be seeded in rice seedling bed after vernalization, 20 days After transplant to crop field, planting density, that is, seeding row spacing is 15*24 centimetres, and planting site is Wuhan City, Hubei China province Hongshan District Central China Agriculture university experimental plot, paddy rice planting method under the conditions of having safety protection facility for one routinely carry out field management.? Rice plant of tillering stage, we in bread box, move to rice transplanting in growth case.In Rice Heading the last week, to OsRFS1 base Because of overexpression rice family 6 and family 10, knock out flower in expression rice family osrfs1-1 and osrfs1-2 and wild type 11 carry out ustilaginoidea virens inoculation test.The results show that OsRFS1 gene overexpression rice family 6 of the invention and family 10 exist After boot stage is inoculated with ustilaginoidea virens, compared to 11 (non-transgenics, similarly hereinafter) are spent in wild type, OsRFS1 gene overexpression rice Family 6 and the every fringe rice curve number of 10 transgenic positive single plant of family and the equal conspicuousness of every fringe rice curve rate are less than wild type control (p < 0.01), as a result see Fig. 4 A, Fig. 4 B.The above result shows that OsRFS1 gene overexpression rice strain can enhance rice to rice The resistance of bent germ.And OsRFS1 gene knockout expression rice family osrfs1-1 and the every fringe rice curve number of osrfs1-2 single plant and The equal conspicuousness of every fringe rice curve rate is higher than wild type (non-transgenic) control (p < 0.01), sees the E figure in Fig. 4 and the F in Fig. 4 Figure.The above result shows that the transgenic paddy rice strain that OsRFS1 gene is knocked after expression can reduce rice to ustilaginoidea virens Resistance.

(2) " Huaihe River rice No. 5 " background transgenic paddy rice verifies false smut Resistance Identification

In order to analyze transgenic plant to the resistance of false smut, applicant is by the Ubi:OsRFS1 OE of " Huaihe River rice No. 5 " background Two independent T₂Seed is seeded in rice seedling bed after routinely seed soaking and vernalization, transplants after 20 days to crop field, planting density, that is, strain Line-spacing is 15*24 centimetres, and planting site is Hongshan District Hua Zhong Agriculture University, Wuhan City, Hubei China province experimental plot, has peace at one Paddy rice planting method under full protection facility condition routinely carries out field management.In rice plant of tillering stage, applicant moves rice It is planted in bread box, moves in growth case.In Rice Heading the last week, to OsRFS1 gene overexpression rice family 3 and family It is 5 and No. 5 progress ustilaginoidea virens inoculation tests of wild type Huaihe River rice.The results show that OsRFS1 gene overexpression of the invention Rice family 3 and family 5 are compared after boot stage is inoculated with ustilaginoidea virens with wild type Huaihe River rice No. 5 (non-transgenic, similarly hereinafter), OsRFS1 gene overexpression rice family 3 and the positive every fringe rice curve number of single plant of family 5 and the equal conspicuousness of every fringe rice curve rate Less than wild type control (p < 0.01), Fig. 4 C and Fig. 4 D are seen.The above result shows that OsRFS1 gene overexpression rice strain energy Enhance rice to the resistance of ustilaginoidea virens.

Embodiment 7:GFP fluorescent marker ustilaginoidea virens infects rice young panicle flower statistics

Rice material " in spend 11 " and pYL-Cas9-gRNA-OsRFS1 are inoculated in boot stage and carry GFP fluorescent marker Ustilaginoidea virens G2, the small ear after taking inoculation 1,3,5,7,9,11 day, with the vertical fluorescence microscope of OLYMPUS SZX16 (whether there is or not GFP fluorescence in (Olympus Corporation, Tokyo, Japan) observation statistics small ear.Each small ear same position 100 little Hua are observed, flower number of the floral organ surface with GFP fluorescence is recorded.The results show that OsRFS1 gene knockout of the invention Rice family osrfs1-1 is expressed after the ustilaginoidea virens of boot stage inoculation GFP fluorescent marker, compared with wild type " in spend 11 ", There is the little Hua quantity of GFP fluorescence to be significantly higher than wild type pair in the small ear of OsRFS1 gene knockout expression rice family osrfs1-1 According to (p < 0.01).See Fig. 5.The above results show that OsRFS1 gene knockout expression rice strain can significantly increase ustilaginoidea virens pair Little Hua's infects in rice young panicle.

Embodiment 8: ustilaginoidea virens infects the biomass analysis of rice young panicle flower

Ustilaginoidea virens is inoculated in boot stage to rice material " in spend 11 " and pYL-Cas9-gRNA-OsRFS1, take inoculation 2, 3, the young fringe after 4,5,6 days, strips the stamen and gynoecium of little Hua, is run one's home base using quantifying PCR method comparative analysis ustilaginoidea virens Because of the expression of β-actin (the gene number of logging in KDB13104).The results show that OsRFS1 gene knockout of the invention expresses rice man It is osrfs1-1 after boot stage is inoculated with ustilaginoidea virens, compared with wild type " in spend 11 ", OsRFS1 gene knockout expresses rice The expression quantity of the housekeeping gene β-actin of ustilaginoidea virens is significantly high in the stamen and gynoecium of little Hua in the young fringe of family osrfs1-1 In wild type control (p < 0.01), Fig. 6 is seen.The above result shows that OsRFS1 gene knockout expression rice strain can enhance rice song Germ infecting in the stamen and gynoecium of little Hua in rice young panicle.

Sequence table

<110>Hua Zhong Agriculture University

Application of<120>disease-resistant genes in the improvement of Rice Resistance false smut

<141> 2019-01-26

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3102

<212> DNA

<213>rice (Oryza sativa)

<220>

<221> gene

<222> (1)..(3102)

<220>

<221> 3'UTR

<222> (2625)..(3084)

<220>

<221> exon

<222> (771)..(2624)

<220>

<221> 5'UTR

<222> (1)..(770)

<400> 1

caccacaccg gagaggtgag tgagagtgag agagtgagag cagagaccac caccaccgga 60

gaggttagtg agagaggagt ggtaatggtg aggcaacaag agtaggttcc atttcatatc 120

atcactagga tagcgtagtt tgtaggctgc atctccatct ccatcgccat tgattcgcat 180

tgcatccatc attttaggat gttctactag ggttcttgat ttttcttttg gtttgttgtt 240

ttgacgaatg gaggtattgt tgggattcgc cgcctgctgc tcgtcgtcgt cgtcgccgat 300

gaggaggccg tgcgggctct gccccggcat gtccgatcgt tcgtgatttg ttttttctac 360

atgttttagg gcccatttgt tcttgatcct attctttgat tcttttgtac taagcattct 420

aaggcgaagc cacccattct ttcctgcata tatacttaca aacacatagc ccccatctga 480

tctcacaaac attatttctc tctctttttt tctcagtttt ttctttgttg atttactgac 540

caaattcttt ggaagaacaa caagatcatc tggtttttat ctgctcattc ttttgtacat 600

cgaatcatat acatttccat tccaccaaag ccttagccag ataccacaga gagagtgtga 660

gagaaatcag agtgagaaac agaggaggaa gaagaagaag aagacgagga ggaggaggag 720

gaggagcagg aggaggagga ggtctcttct tggcacgtcg cgttccggcg agtgacgtgt 780

ctccgggatg ttggcgggtt gctcgttctc gtcgtcgagg catcagatga gcaccgcgca 840

gcgtttcgac atcctcccct gcggcttctc caagcgcggc agccgcggcg acggcgccgc 900

cccgcgggtc gccggcgacg ccaggagcgg cgccaccacc tgctccttcc ggacgcaccc 960

cgcgccgccg gtcacccagt ccgtgtcctg gggcgccaag ccggagcccg gcggcaatgg 1020

caatggcgcc caccgcgccg ttaagcgggc gcatgacgag gacgcggtcg aggagtatgg 1080

ccccattgtt cgcgccaagc ggacgcggat gggcggcgac ggcgatgagg tatggttcca 1140

tcaatccatt gcagggacga tgcaagcgac ggcggcggga gaaggagagg aggcggagga 1200

ggagaaggtc ttcttggtgc cgagcgcggc ggcgttcccg cacggcatgg ccgccgcggg 1260

gccatcgctg gccgcggcca agaaggagga gtacagcaag tcgccgtccg actcgtcgtc 1320

ctcgtcgggc acggacggcg gctcgtcggc gatgatgccg ccgccgcagc cgcccgagtt 1380

cgacgcgagg aacggcgtgc cggcgccggg gcaggcggag cgggaggcgc tggagctggt 1440

gcgcgcgctc accgcgtgcg ccgactccct ctccgccggc aaccacgagg ccgccaacta 1500

ctacctggcc cggctcggcg agatggcctc gccggcgggg cccacgccga tgcaccgcgt 1560

ggccgcctac ttcaccgagg cgctcgcgct ccgcgtcgtg cgcatgtggc cgcacatgtt 1620

cgacatcggc ccgccgcggg agctcaccga cgacgccttc ggcggcggcg acgacgacgc 1680

catggcgctg cggatactca acgccatcac gcccatcccg aggttcctgc acttcacgct 1740

caacgagcgc ctcctccgcg agttcgaggg gcacgagcgc gtccacgtca tcgacttcga 1800

catcaagcag gggctccaat ggccgggctt gctccagagc ctggccgcgc gggcggtgcc 1860

tccggcgcac gtgcggatca ccggagtcgg cgagtcgagg caggagctgc aggagacggg 1920

agcgcggctg gcgcgcgtcg ccgccgcgct cggcctggcg ttcgagttcc acgccgtggt 1980

cgaccggctc gaggacgtcc gcctgtggat gctccacgtc aagcgcggcg agtgcgtggc 2040

cgtgaactgc gtcctcgcca tgcaccgcct gctccgcgac gacgccgcgc tgaccgactt 2100

cctggggcta gcgcgcagca cgggcgccac catcctcctc ctcggcgagc acgagggcgg 2160

cggcctcaac tcggggaggt gggaggcgcg gttcgcgcgc gcgctgcggt actacgccgc 2220

ggcgttcgac gcggtggacg cggcggggct gccggaggcg agccccgcga gggccaaggc 2280

ggaggagatg ttcgcgcggg agatccgcaa cgcggtggcg ttcgagggcc ccgagcggtt 2340

cgagcgccac gagagcttcg ccgggtggcg gcggcgcatg gaggacggcg gcgggttcaa 2400

gaacgccggc atcggcgagc gcgaggcgat gcaggggcgc atgatcgcga ggatgttcgg 2460

gccggacaag tacaccgtgc aggcgcacgg cggcggcggc agcggcggcg gcgaggcgct 2520

cacgctccgg tggctggacc agccgctgta caccgtgacg gcgtggacgc cggcgggcga 2580

cggcgcggga ggcagcaccg tgtcggcgtc cacaacagca tcacattctc agcaaagcta 2640

agctgacgat gaatggtgat taggtgaaga gaaagaaaga acaaagcctt tttttacagt 2700

gcttcttttg ttaatgatga ttagttcata cagtatgaca attcttttat acattcagag 2760

aaaagaaaga agaaagaaag gtgtagtttt ttgttttata gattgatagg tggaaagatt 2820

caattaaatc aaattcaatt caatttttag attgtaattc tttataaata ttcttttggc 2880

tgttgagaga gagtcccctg caaaatgtag ctgcatgtag aagaaagaaa gcaaagaagc 2940

agtagataga ttagcagggg cagcatctct cacagtcact attagtgtct ccggctgtta 3000

ttatacaaca ttattattac aatcaaattc tttcatcatt cattctacat gtaatctctg 3060

ttcagaatca gaatgaaatg aaacatgtgt tatatttctc ca 3102

Claims (2)

1. from rice Os RFS1 gene in enhancing rice to the application in false smut resistance, which is characterized in that described The nucleotide sequence of OsRFS1 gene is as shown in sequence table SEQ ID NO:1.

2. application as described in claim 1, which is characterized in that the application further include: striking OsRFS1 is gene constructed Except being transformed on expression vector in rice body, obtains and weaken rice to the transgenic line of false smut resistance.