CN114807174A

CN114807174A - Genetic locus for reversely regulating and controlling rice blast germ resistance and application thereof

Info

Publication number: CN114807174A
Application number: CN202210590549.5A
Authority: CN
Inventors: 刘立娜; 李成云; 李进斌; 杨宝明; 王一; 吴奇; 浦鑫; 余萍
Original assignee: Yunnan Agricultural University; Institute of Agricultural Environment and Resources of Yunnan Academy of Agricultural Sciences
Current assignee: Yunnan Agricultural University; Institute of Agricultural Environment and Resources of Yunnan Academy of Agricultural Sciences
Priority date: 2022-05-27
Filing date: 2022-05-27
Publication date: 2022-07-29
Anticipated expiration: 2042-05-27
Also published as: CN114807174B

Abstract

The invention provides a genetic locus for reversely regulating and controlling rice resistance to rice blast germs and application thereof, belonging to the technical field of plant genetic engineering. The genetic locus nucleotide sequence is shown as SEQID NO. 1. The invention constructs an overexpression vector and a strain containing the complete sequence of the genetic locus XLOC _047603, the overexpression vector and the strain are transformed into rice disease-resistant varieties to obtain overexpression mutant strains, the rice blast strains are inoculated, and disease investigation results show that the overexpression mutant strains reduce the resistance of rice to rice blast germs; construction of knockdown vector transformation seedlings to inoculate multiple strains of rice blast fungus, and disease investigation results prove that knockdown transformation seedlings inhibit expression of XLOC-047603 and can obviously improve resistance of rice to different strains of rice blast fungus. Experiments show that the genetic locus XLOC _047603 plays a reverse regulation role in the defense response of rice to rice blast fungi. The invention provides a new strategy and genetic resources for cultivating a new broad-spectrum rice blast resistance rice variety, and has very important theoretical significance and application value.

Description

Genetic locus for reversely regulating and controlling rice blast germ resistance and application thereof

Technical Field

The invention relates to the technical field of plant genetic engineering, in particular to a genetic locus for reversely regulating and controlling rice blast germ resistance and application thereof.

Background

China is a big agricultural country with a long-standing culture civilization, and nearly 22% of the world population is cultivated and alive by using land which accounts for 7% of the world. Grain crops in China mainly comprise rice, wheat and corn, but many pathogenic fungi seriously harm the yield and the quality of the grain crops, and rice blast, which is called rice cancer, brings huge threats to the rice safety of China and even the world every year. Rice blast causes significant economic losses worldwide. Pathogenic bacteria of the rice can infect different parts of the rice, wherein the yield loss of the rice caused by leaf blast and panicle blast is the most serious. Statistically, rice blast can reduce rice yield by 10-30% (Talbot, 2003). Rice is a food crop on which more than half of the population lives worldwide, and according to the analysis of the international food policy research institute, human beings need to produce 1.38 times of the current rice yield in a smaller planting area to meet the demand of population increase by 2030 (Wilson and Talbot, 2009). In the face of this severe situation, we need to understand the disease resistance of rice and reduce the loss of rice yield and quality caused by rice blast.

Crop immunity is one of the most economic, sustainable and ecologically relevant disease management strategies. Two layers of natural immune systems are evolved in the long-term interaction between plants and pathogenic bacteria, pathogen-associated molecular Pattern-Triggered Immunity (PTI) and effector-Triggered Immunity (ETI). The disease-resistant gene is discovered mainly based on ETI reaction, and accords with the gene-to-gene theory, namely, pathogenic genes of rice blast germs correspond to disease-resistant genes of rice one to one, however, the disease resistance triggered by a single gene usually loses the resistance effect of the pathogenic genes after crops are planted for 2 to 3 years due to rapid variation of the pathogenic genes. At present, broad-spectrum and durable disease-resistant crop varieties are lacked. PTI is the first line of defense for preventing pathogenic bacteria from infecting plants, a series of rapid response mechanisms are generated, including active oxygen, callose accumulation and the like, the strengthening of PTI composition can be used as a new strategy to widely improve the effectiveness of ETI on various diseases in crops (Yuan et al, 2021; Nagou et al, 2022), and broad-spectrum and durable disease-resistant varieties are expected to be developed. Therefore, the inventor researches the constitutive genetic locus in the rice material, and finds that the constitutive genetic locus has obvious difference with XLOC-047603 on the basis of resistant and susceptible rice heredity through gene network analysis of the differential expression genetic locus, so that the expression of chitinase synthesis related genes is inhibited, and the PTI reaction of rice infected by rice blast germs is inhibited. The genetic locus has not been reported in the literature at present. The invention identifies a genetic locus for reversely regulating and controlling the resistance of rice to rice blast germs and provides valuable information for regulating the interaction of rice and rice blast.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide a genetic locus for reversely regulating and controlling rice blast germ resistance and application thereof.

The above object of the present invention is achieved by the following technical solutions:

a genetic locus for reversely regulating and controlling rice resistance to rice blast germs is disclosed, and the nucleotide sequence of the genetic locus is shown in SEQ ID NO. 1. The gene is confirmed to be located on the 11 th chromosome of rice, and the total length is 815 bp. The invention has important application value for molecular genetic breeding of disease-resistant varieties of important grain crops such as rice and the like.

The invention also protects a knockdown expression vector containing the genetic locus for reversely regulating and controlling the rice blast resistance and a recombinant bacterium of the plant knockdown expression vector.

The invention also protects the application of the genetic locus for reversely regulating and controlling the rice blast resistance, the plant knockdown expression vector or the recombinant bacterium in improving the resistance of rice to the rice blast.

The application steps for improving the rice blast resistance of the rice comprise: and transforming the plant knockdown expression vector containing the genetic locus for reversely regulating the rice blast resistance into agrobacterium to prepare an agrobacterium suspension, transforming the agrobacterium suspension or the recombinant bacteria into susceptible rice to obtain a rice blast resistance rice plant, and enabling the genetic locus for reversely regulating the rice blast resistance not to be expressed or to be expressed in a low way, thereby improving the resistance of the rice plant to the rice blast.

The second purpose of the invention is to provide the application of the genetic locus for reversely regulating and controlling the rice blast resistance in the identification of the rice blast resistance.

The identification steps of the rice blast resistance in rice by utilizing the genetic locus for reversely regulating and controlling the rice blast resistance are as follows:

1) extracting total RNA of rice to be detected;

2) reverse transcription to prepare cDNA;

3) using cDNA as template, using the DNA sequence shown in SEQ ID NO:14 and SEQ ID NO: 15, performing qRT-PCR, wherein the rice variety with high expression of the genetic locus for reversely regulating and controlling the rice resistance to the rice blast germs is a susceptible variety, and the rice variety with low expression or no expression of the genetic locus for reversely regulating and controlling the rice resistance to the rice blast germs is a disease-resistant variety.

Compared with the prior art, the invention has the following beneficial effects:

1. the invention provides a genetic locus XLOC _047603 for reversely regulating rice blast resistance, application thereof in identifying rice blast resistance and application thereof in improving rice blast resistance. The nucleotide sequence of the genetic locus which is obtained by screening and has strong correlation with PTI is shown as SEQ ID NO:1 is shown.

2. The genetic locus can be used for identifying the resistance of rice to the rice blast, namely the genetic locus can be used as a molecular marker for identifying the resistance of rice varieties to the rice blast.

3. The invention constructs an expression vector and a strain containing the genetic locus. After the genetic locus obtained by the invention is over-expressed, the obtained over-expressed transformed seedling is inoculated with a rice blast strain, and disease investigation shows that the transcript is highly expressed in a disease-resistant variety and shows infection of rice blast germs as infection of the rice blast germs; knocking down the vector transformation seedling to inoculate the rice blast strain, and demonstrating that the expression of the transcript is inhibited in the susceptible variety through the disease investigation result, the disease resistance of the rice to the infection of the rice blast germs can be improved, and the genetic locus (XLOC _047603) is proved to reversely regulate the resistance of the rice to the rice blast germs.

4. Experiments prove that the genetic locus XLOC _047603 plays a negative control role in the defense response of different rice over-expression strains to rice blast germs. The invention provides a new strategy and genetic resources for cultivating new rice disease-resistant varieties, in particular new rice blast-resistant varieties, and has very important theoretical significance and application value.

Drawings

FIG. 1 is a map of the genetic locus XLOC _047603 sequence position;

FIG. 2 is an enzymatic cut and map of the over-expression vector for XLOC _047603, note: the EcorV enzyme digestion yielded 4 bands: 1134 bp; 1168 bp; 2691 bp; 5324 bp. Marker strip size is: 5000 bp; 3000 bp; 2000 bp; 1000 bp; 750 bp; 500 bp; 250 bp; 100 bp;

FIG. 3 shows the results of gene detection of rice transformed seedlings overexpressing XLOC _047603, note: from left to right the sample order is: marker; negative control; OE 86-1; OE 86-2; OE 86-3; OE 86-12; OE 86-13; OE 86-16; OE 86-19;

FIG. 4 is an index change of disease for an XLOC _047603 overexpression strain;

FIG. 5 is a diagram of the phenotypic symptoms of XLOC _047603 overexpression lines;

FIG. 6 is a excision and map of the knockdown vector of XLOC _ 047603;

FIG. 7 shows the results of gene testing of knockdown (XLOC-047603) rice transformed seedlings, note: from left to right the sample order is: a positive control; marker; negative control; d86-1; d86-2; d86-3; d86-4; d86-5; d86-6; d86-7; d86-8; d86-9; d86-10; d86-13;

FIG. 8 is a plot of the index change of disease for the XLOC _047603 knockdown mutant strain;

FIG. 9 is a plot of XLOC _047603 knockdown strain phenotype symptomatology;

FIG. 10 is a graph showing the expression levels of XLOC _047603 in different rice plants amplified using designed primers.

Detailed Description

The invention is further described with reference to the drawings and the following detailed description, which are not intended to limit the invention in any way. Reagents, methods and apparatus used in the present invention are conventional in the art unless otherwise indicated.

Unless otherwise indicated, reagents and materials used in the following examples are commercially available. The primer sequences used were all synthesized by Wuhanbo remote biotechnology, Inc.

Example 1: screening for genetic locus XLOC _047603

1.1 materials

Host materials: a rice susceptible variety LTH and a near isoline rice variety IRBLsh-S carrying a resistance gene Pish.

Rice blast fungus strain: y92-66 b.

1.2 Experimental methods

1.2.1 sample Collection

Three-leaf one-heart stage rice seedling spray inoculation (spore concentration: 1 × 10) ⁵ individual/mL) is kept more than 98 percent, is dark, is kept at 28 ℃, is subjected to sample collection after 24 hours, collects fully-expanded rice leaves (No. 2 and No. 3 leaves) of each sample, is put into liquid nitrogen for quick freezing, and is stored in an ultra-low temperature refrigerator. Each sample was subjected to 3 biological replicates. The remaining seedlings were transferred to the greenhouse for further cultivation, and disease investigation was performed at 7 d. Wherein LTH lesions are rated as disease-resistant (R) on a 0-2 scale, and are rated as susceptible (S) on a 3-5 scale (Li et al, 2014); disease index ∑ (number of diseased plants at each stage × corresponding stage value)/(total number of investigated plants × highest stage value) × 100, and differential significance analysis was performed by T-test.

1.2.2 transcriptome banking, sequencing

The total RNA of the extracted rice leaves is subjected to 1.0% agarose gel electrophoresis to detect the RNA quality, a spectrophotometer to detect the RNA purity, a Qubie to detect the RNA concentration and Agilent 2100 to detect the RNA integrity. Detecting qualified RNA to construct a library and sequencing. The method comprises the following basic steps: (1) rRNA was removed and then the rRNA residues were removed by ethanol precipitation. (2) Using a kit (

Ultra ^TM Directional RNA Library Prep Kit, NEB, usa). (3) And (5) purifying the product. (4) Agilent 2100 measures library quality. Sequencing the qualified library by using an IlluminaHiseq 2000 sequencing platform by committing Beijing Nuo Po biogenic bioinformatics technology Limited to obtain reads with the length of about 125 bp.

1.2.3 differential expression genetic locus analysis, screening XLOC _047603

The edgeR software package (Robinson et al, 2010) was used to identify differentially expressed genetic sites. After the disease-resistant rice variety IRBLsh-S or the susceptible variety LTH is treated by the inoculated strain, compared with the corresponding mock, the genetic locus p-value with obvious expression quantity difference is less than 0.05, and lg FC is more than or equal to 1 or less than or equal to-1, which is taken as a candidate genetic locus for research.

1.3 results of the experiment

(1) Genetic locus analysis of differential expression

The genetic background of different disease-resistant and disease-susceptible rice materials is analyzed, and the results show that the gene expression related to the activity of chitinase in the disease-resistant variety has obvious difference between the disease-resistant and disease-susceptible varieties in the chitinase catalysis process. Gene network analysis and R script analysis are utilized to find that PTI (protein transduction domain) composition chitinase related genes are remarkably and negatively related to a genetic locus XLOC-047603 (R ² >0.9And FDR<0.05), indicating that XLOC _047603 has significant negative regulatory effect with PTI-constituting chitinase-related genes.

(2) Screening to genetic locus XLOC _047603 with differential expression

The co-expression result shows that in strongly related genetic loci, the chitinase-related genes consisting of XLOC _047603 and PTI are closely related and can reversely regulate the resistance of rice to rice blast germs. XLOC-047603, 567bp in full length, is located on rice chromosome 11, and has a sequence position diagram shown in figure 1 and a sequence shown in SEQ ID NO. 1. The genetic locus is a newly discovered transcript.

Example 2 construction of overexpression vector and genetic transformation of genetic locus XLOC _047603

In order to verify the disease resistance of the genetic locus reverse regulation rice to rice blast germs, an overexpression vector containing an XLOC _047603 genetic locus complete sequence is constructed, agrobacterium is transformed into a rice disease-resistant variety, and the function of reverse regulation of the disease resistance is verified.

2.1 materials

Transformation of rice wild type: the disease-resistant variety IRBLsh-S.

Inoculating a strain: y92-66b and Guy 11.

2.2 Experimental methods

2.2.1 overexpression vector construction

(1) Rice leaf genome DNA extraction

Using a genomic DNA purification kit (Promega, A1120), rice seedling DNA was extracted and purified according to the protocol. And (3) detecting the integrity of the DNA by using 1.5% agarose gel electrophoresis, wherein the finally obtained genome DNA has a single band and no dragging, and represents that the genome DNA has good integrity and is used for subsequent experiments.

(2) Designing and synthesizing primers required by an overexpression vector:

XLOC_047603-O(+)：cagtCGTCTCacaactgtcatcttaaggcgtaact

XLOC_047603-O(-)：cagtCGTCTCatacaggtttttgccaattccattt

the product fragment has the sequence shown in SEQ ID NO 2-3 and the size is 567 bp.

(3) PCR reaction

A50 μ L PCR reaction was performed, including DNA template: 1 mu L of the solution; buffer: 5 mu L of the solution; mg (magnesium) ²⁺ ：4μL；dNTP：2μL；P+：2μL；P-：2μL；H ₂ O: 34 mu L of the solution; taq enzyme: 2U is adopted. The PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing and extending for 45s at 50 ℃; extension at 72 ℃ for 12 s; the cycle is 30 times, and the extension is carried out for 10min at 72 ℃.

(4) Agarose gel electrophoresis and product recovery

The sizes of PCR products detected by 1.5% agarose electrophoresis are 567bp respectively; the electrophoretic fragments were excised and subjected to sol recovery, the recovery procedure was performed as described in the kit, and the DNA (labeled iDNAX2) was recovered by dissolving in water in a total volume of 30. mu.L, and used for vector ligation after detection without errors.

(5) Digesting and purifying the vector and the iDNAX2

The vector and iDNAX2 were digested in 20. mu.L (Buffer: 13. mu.L; H) ₂ O: 13 mu L of the solution; BasI/Eco3 II: 1 mu L of the solution; pBWA (V) HS-ccdB or iDNAX 2: 4 μ L). The enzyme was cleaved at 37 ℃ for 1 h. The vector enzymatic cuts and the recovered fragment cleavage products were combined and purified using a PCR purification kit (labeled PBWA-iDNAX2) for ligation reactions.

(6) Ligation reaction, product transformation competence and bacterial plaque PCR identification

Ligation reaction System 10. mu.L (Buffer: 1. mu.L; H) ₂ O: 5.5 mu L; t4 ligase: 1 mu L of the solution; PBWA-iDNAX 2: 2.5. mu.L). Ligation was performed at 20 ℃ for 1h to obtain a ligation product. 5-10. mu.L of the ligation product was transformed into E.coli competent cells, plated on resistant plates (kanamycin), incubated at 37 ℃ for 12h, and plaque PCR was performed. 10 plaques were picked for 1.5mL of EP inoculants and PCR identification, with 25. mu.L of PCR reaction system (template: 1. mu.L; Buffer: 2.5. mu.L; Mg) ²⁺ ：4μL；dNTP：1μL；HS)35seq/35seq(G)：1μL；NOSseq-R/Noseq(G)：1μL；H ₂ O: 16.5 mu L; taq enzyme: 10U). The PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing and extending for 45s at 50 ℃; extension at 72 ℃ for 12 s; the cycle is 30 times, and the extension is carried out for 10min at 72 ℃.

The target band was detected to be a fragment of about 157bp by 2.0% agarose electrophoresis. Taking bacterial liquid corresponding to 1-3 positive bands, taking 100 mu L of bacterial liquid for sample sequencing, inoculating the rest 400 mu L of bacterial liquid into resistant LB containing 5-10mL (kanamycin), shaking the bacteria in a test tube, and correspondingly and correctly taking a tube of bacterial liquid to extract plasmids (named pBWA (V) HS-OE-LLN-47603) after a sequence test result is obtained.

2.2.2 transformation of Agrobacterium with vectors

The correctly identified over-expression vector plasmid pBWA (V) HS-OE-LLN-47603 is transformed into Agrobacterium EHA105, and single Agrobacterium colony is picked and placed in culture solution for shake culture. And (3) placing the cultured bacterial liquid in a centrifuge tube, centrifuging, taking the supernatant, and preparing an agrobacterium tumefaciens suspension for rice transformation.

2.2.3 transformation of rice disease-resistant variety IRBLsh-S

(1) Taking mature wild type disease-resistant rice variety IRBLsh-S seeds, selecting full and high-quality seeds without dental plaque, mechanically shelling, sterilizing and inoculating to callus induction culture medium, wherein the formula of the culture medium is as follows: MS +2, 4-D2.0 mg/L + sugar 20 g/L.

(2) Picking out callus with size of 0.2cm × 0.2cm, and placing in Agrobacterium tumefaciens suspension for infection for 5 min; then placing the callus on a co-culture medium for culturing, wherein the formula of the co-culture medium is as follows: MS + NAA 0.2mg/L +6-BA 1.0 mg/L.

(3) And (3) culturing resistant callus: taking out the callus, drying, and transferring to a screening culture medium for primary screening; the initial calli with resistant calli were transduced onto new medium for a second selection. The formula of the first-screening culture medium is as follows: MS +2, 4-D0.2-0.5 mg/L +50mg/L hygromycin; the second screening culture medium is: MS +2, 4-D0.2-0.5 mg/L +80mg/L hygromycin.

(4) Selecting resistant callus for bud culture: transferring the selected callus into a bud differentiation medium, and placing the callus into a constant-temperature culture chamber for differentiation into seedlings; growing to about 1cm, and transplanting to rooting culture medium for strengthening seedling. The formula of the differentiation medium is as follows: MS + NAA 0.2-0.5 mg/L +6-BA 1.0 mg/L; the rooting medium comprises the following components: MS + NAA 0.2-0.4 mg/L.

(5) The pre-primer for the hygromycin gene amplification of the rooted seedlings is hyg (280) +: 5'-ACGGTGTCGTCCATCACAGTT TGCC-3', rear primer hyg (280) -: 5'-TTCCGGAAGTGCTTGACATTGGGGA-3', and performing PCR amplification with the sequence shown in SEQ ID NO. 4-5, wherein the annealing temperature is 56 ℃. And detecting the PCR product obtained after amplification by using 1.5% agarose gel electrophoresis, detecting the banding pattern of the product by using a gel imaging system, analyzing and confirming the success of transformation. Hardening seedlings in a rooting seedling greenhouse, and culturing until T1 generation seeds are harvested.

2.2.4 characterization of disease resistance of XLOC _047603 overexpressing transformed shoots

(1) Culture of transformed plantlets

Seedling raising tray method is adopted. Before sowing, uniformly mixing the paddy soil, the humus soil and the plant ash according to the ratio of 1:1:1, and sterilizing by exposure to sunlight. The plump rice seeds were selected for sterilization (1.5% NaClO sterilized soaking for 5min, rinsing with clear water until there was no odor of sodium hypochlorite). And respectively putting the disinfected over-expression transformed seedling T1 generation seeds and wild LTH seeds into a sterilized culture dish, and continuously soaking in clear water. Accelerating germination in a constant temperature incubator at 28 ℃ until white is exposed, and then sowing the seeds in a seedling raising tray. The rice was grown to trilobe-hearts stage (about 21d) for inoculation of Magnaporthe grisea spores (1X 10) ⁵ counts/mL) assay.

(2) Disease investigation and sampling

And (3) transferring the rice seedlings cultured in the dark for 24h after spray inoculation to a greenhouse, investigating the disease degree at 7d, determining disease resistance (R) on a 0-2 level of a disease spot, determining disease susceptibility (S) on a 3-5 level, and calculating the disease index. The disease index ∑ (number of diseased leaves at each stage × representative value at each stage)/(total investigated leaves number × highest representative value) × 100, and IRBLsh-S of the disease-resistant rice variety was used as a control.

2.3 results of the experiment

(1) Successfully constructs rice genetic locus XLOC _047603 overexpression vector

The nucleotide sequence of candidate rice XLOC _047603 is utilized to successfully construct an overexpression vector of XLOC _047603, and a vector excision map and a vector map are shown in FIG. 2.

(2) Gene detection XLOC _047603 overexpression successful transformation seedling

An overexpression vector was constructed according to the sequence XLOC _047603 and transformed into IRBLsh-S to form an overexpression strain of XLOC _047603 (OE 86). IRBLsh-S is infected with Y92-66b and has disease resistance. Through gene detection, different over-expression strains (OE 86-1; OE 86-2; OE 86-3; OE 86-12; OE 86-13; OE 86-16; OE 86-19; OE86-24) are all positive strains (figure 3). All positive transformants were used for subsequent disease resistance identification.

(3) Response change of rice XLOC-047603 overexpression strain to strain infection

The experimental results show that: infection of an over-expression strain (OE 86-1; OE 86-2; OE 86-3; OE 86-12; OE 86-13; OE 86-16; OE 86-19; OE86-24) on Y92-66b shows different degrees of susceptibility (FIG. 4, FIG. 5), and the disease indexes respectively reach 24.4; 25.2; 45.0 of the total weight of the mixture; 16.7; 40.5; 36.3; 44.0; 28.0, which is obviously higher than the disease index of 7.03 of the disease-resistant control IRBLsh-S. The results further demonstrate that: XLOC _047603 negatively regulated rice resistance to rice blast fungus.

Example 3: construction and genetic transformation of knockdown expression vector of genetic locus XLOC-047603

In order to apply the genetic locus for reversely regulating and controlling the rice blast germ resistance of the rice, a knock-down vector is constructed, and a rice transformation seedling with disease resistance is obtained.

3.1 materials

Transformation of wild-type susceptible rice varieties: LTH.

Inoculating the rice blast fungus strain: y92-66b and Guy 11.

3.2 Experimental methods

3.2.1 vector construction

(1) Rice leaf genome DNA extraction

(2) The following three pairs of primers were synthesized

XLOC _047603-F primer:

XLOC_047603-F(+):cagtCGTCTCacaacgaacacatgcatcagttcattct

XLOC_047603-F(-):cgatCGTCTCacagggttctgaacctaaatagcgtgat

loop primer:

Loop(+):cgatGGTCTCacctgcaggtctagtttttctcct

Loop(-):cgatGGTCTCagcccgggctctgtaactatcatc

XLOC _047603-R primer:

XLOC_047603(+):cagtCGTCTCagggcgcttctgaacctaaatagcgtgat

XLOC_047603-R(-):cgatCGTCTCatacagaacacatgcatcagttcattct

the sequence is shown in SEQ ID NO. 6-11.

(3) PCR reaction

3, carrying out PCR reaction of a 50-mu-L system on the primers respectively, wherein the DNA template: 1 mu L of the solution; buffer: 5 mu L of the solution; mg (magnesium) ²⁺ ：4μL；dNTP：2μL；P+：2μL；P-：2μL；H ₂ O: 34 mu L of the solution; taq enzyme: 2U is adopted. The PCR procedure was: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing and extending for 45s at 50 ℃; extension at 72 ℃ for 12 s; the number of cycles was 30 and extension at 72 ℃ was 10 min.

(4) Agarose gel electrophoresis and product recovery

Detecting the sizes of the PCR products of the 3 pairs of primers by 1.5 percent agarose electrophoresis as 202bp, 200bp and 202bp respectively; cutting the electrophoretic fragment, putting the electrophoretic fragment into the same system for sol recovery, performing the recovery procedure according to the instruction of the kit, dissolving the recovered DNA (marked as LDNAX2) by water with the total volume of 30 mu L, and using the recovered DNA for vector connection after error-free detection.

(5) The carrier and LDNAX2 are cut and purified by enzyme

The vector and LDNAX2 were separately digested in 20. mu.L system D, Buffer: 13 mu L of the solution; h ₂ O: 13 mu L of the solution; BasI/Eco3 II: 1 mu L of the solution; pBWA (V) HS-ccdB or LDNAX 2: 4 μ L. The enzyme was cleaved at 37 ℃ for 1 h. The vector enzymatic cut and the recovered fragment cleavage products were combined and purified using a PCR purification kit (labeled PBWA-LDNAX2) for ligation reactions.

Ligation reaction System 10. mu.L (Buffer: 1. mu.L; H) ₂ O: 5.5 mu L; t4 ligase: 1 mu L of the solution; PBWA-LDNAX 2: 2.5. mu.L). Ligation was performed at 20 ℃ for 1h to obtain a ligation product. 5-10. mu.L of the ligation product was transformed into E.coli competent cells, plated (kanamycin) resistant plates, and incubated at 37 ℃ for 12h for plaque PCR identification. 10 plaques were picked and simultaneously identified by 1.5mL of EP pipet and PCR. PCR reaction system 25. mu.L (template: 1. mu.L; Buffer: 2.5. mu.L; Mg) ²⁺ ：4μL; dNTP: 1 mu L of the solution; HS)35seq/35seq (G): 1 mu L of the solution; NOSseq-R/Noseq (G): 1 mu L of the solution; H2O: 16.5 mu L; taq enzyme: 10U). The PCR reaction program is: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 s; annealing and extending for 45s at 50 ℃; extension at 72 ℃ for 12 s; the number of cycles was 30 and extension at 72 ℃ was 10 min.

The 1.5% agarose electrophoresis detected the target band to be about 194bp fragments. Taking bacterial liquid corresponding to 1-3 positive bands, taking 100 mu L of the bacterial liquid to send a sample for sequencing, inoculating the rest 400 mu L of the bacterial liquid into resistant LB containing 5-10mL (kanamycin), shaking the bacteria in a test tube, and correspondingly and correctly taking a tube of the bacterial liquid to extract plasmids (named pBWA (V) HS-RNAi-LLN-2018-3) after a sequencing result is obtained.

3.2.2 transformation of Agrobacterium with vector

And (3) transforming the correctly identified knockout carrier plasmid pBWA (V) HS-RNAi-LLN-2018-3 into agrobacterium EHA105, selecting an agrobacterium single colony, and placing the agrobacterium single colony in a culture solution for shake culture. And (3) placing the cultured bacterial liquid in a centrifuge tube, centrifuging, taking the supernatant, and preparing an agrobacterium tumefaciens suspension for rice transformation.

3.2.3 transformation of susceptible Rice variety LTH

(1) Taking mature wild rice LTH seeds, selecting full and high-quality seeds without bacterial plaques, mechanically shelling, and inoculating the seeds to a callus induction culture medium after disinfection, wherein the formula of the culture medium is as follows: MS +2, 4-D2.0 mg/L + sugar 20 g/L.

(5) The pre-primer for the hygromycin gene amplification of the rooted seedlings is hyg (280) +: 5'-ACGGTGTCGTCCATCACAGTT TGCC-3', rear primer hyg (280) -: 5'-TTCCGGAAGTGCTTGACATTGGGGA-3' is shown in SEQ ID NO 12-13, and the annealing temperature is 56 ℃. And detecting the PCR product obtained after amplification by using 1.5% agarose gel electrophoresis, detecting the banding pattern of the product by using a gel imaging system, analyzing and confirming the success of transformation. Hardening seedlings in a rooting seedling greenhouse, and culturing until T1 generation seeds are harvested.

3.2.4XLOC047603 identification of disease resistance of knockdown transformed seedlings

(1) Culture of transformed plantlets

Seedling raising tray method is adopted. Before sowing, uniformly mixing the paddy soil, the humus soil and the plant ash according to the ratio of 1:1:1, and sterilizing by exposure to sunlight. The plump rice seeds were selected for sterilization (1.5% NaClO sterilized soaking for 5min, rinsing with clear water until there was no odor of sodium hypochlorite). And respectively putting the disinfected knockdown transformed seedling T1 generation seeds and wild LTH seeds into a sterilized culture dish, and continuously soaking in clear water. Accelerating germination in a constant temperature incubator at 28 ℃ until white is exposed, and then sowing the seeds in a seedling raising tray. Rice was grown to the three-leaf one-heart stage (about 21d) for inoculation experiments.

(2) Disease investigation and sampling

After spray inoculation, the rice seedlings cultured in the dark for 24h are transferred to a greenhouse, the disease degree is investigated at 7d after inoculation, disease resistance (R) is determined as disease spots 0-2, disease susceptibility (S) is determined as 3-5, and the disease index is calculated as Σ (each stage of disease leaf number × each stage representative value)/(total investigated leaf number × highest representative value) × 100. LTH is taken as a susceptible control variety.

3.3 results of the experiment

(1) Successfully constructing rice XLOC _047603 knockdown vector

The nucleotide sequence of candidate rice XLOC _047603 was used to successfully construct a knock-down vector of XLOC _047603, and the vector excision map and vector map are shown in FIG. 6.

(2) Gene detection XLOC _047603 successfully knocked down transformed seedling

Knock-down vectors were constructed from the XLOC _047603 sequence and transformed into LTH wild-type to obtain XLOC _047603 knock-down transformed shoots (D86). Through gene detection, different knock-down strains (D86-1; D86-2; D86-3; D86-4; D86-5; D86-6; D86-7; D86-8; D86-9; D86-10; D86-13; D86-14; D86-15; D86-16) are positive strains (figure 7), and can be used for subsequent disease resistance identification.

(3) Response change of rice XLOC-047603 knockdown line to strain infection

The data show that: compared with wild type control, the knockdown strain (D86-1; D86-2; D86-3; D86-5; D86-6; D86-7; D86-9; D86-10; D86-14; D86-15; D86-16) shows different degrees of resistance to infection of Y92-66b (FIG. 8, FIG. 9), and the disease index reaches 37.0 respectively; 41.7; 36.4; 36.8 of the total weight of the mixture; 35.4; 23.6; 31.0; 34.8 of the total weight of the powder; 33.6, respectively; 47.9; 46.1, significantly lower than disease index 71.6 for the susceptible control LTH. The results prove that: the XLOC _047603 rice knockdown line improved its resistance response to Pyricularia oryzae.

Example 4: fluorescent quantitative PCR detection of expression quantity of XLOC-047603 in rice and identification of disease resistance of different rice varieties

4.1 materials

Rice variety: susceptible LTH and disease resistant IRBLsh-S.

The rice blast fungus strain: strain Y92-66 b; strain Guy 11.

4.2 Experimental methods

4.2.1 extraction of Rice leaf RNA

RNA extraction kit for total RNA extraction of rice leaf (

Super total RNA extraction kit LS1040), performed according to the instructions, with minor modifications.

4.2.2RNA reverse transcription

The RNA that was qualified for detection was subjected to Reverse Transcription using a Reverse Transcription kit (GoScript Reverse Transcription System, A5001) and performed according to the instructions.

4.2.3 fluorescent quantitation of expression levels of candidate genetic loci

In order to determine and develop a rapid method for detecting the expression quantity of an XLOC _047603 genetic locus, a fluorescent quantitative PCR specific primer is designed for detecting the expression of the genetic locus, total RNA of each sample is extracted, and qRT-PCR verification is performed after reverse transcription. qRT-PCR reaction system (performed under dark conditions and on ice): 2.0 μ L of cDNA; SYBR Premix Ex Taq II 10.0. mu.L; 0.4 mu L of the front primer; 0.4 mu L of rear primer; RNA-free water was added to a total volume of 20. mu.L. The primers used were XLOC — 047603 PF: TCCTCTGTCGGTCTGTCCTA, respectively; XLOC — 047603 PR: GCCTCCAACAAACAGACTTGT, the sequence is shown in SEQ ID NO: 14-15. The product size was 106 bp.

And (3) fully and uniformly mixing the reaction system after the preparation is finished, and loading the sample after a sealing film is added. Ct value detection was performed using a fluorescent quantitative PCR instrument (Bio-Rad Thermal Cycler, USA). The reaction procedure is as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 20 s; annealing and extending for 20s at 58 ℃; collecting fluorescence signals at 65 ℃; the number of cycles was 45. Dissolution curve parameters: the temperature is raised from 60 ℃, and the fluorescence signal is collected in one cycle when the temperature is raised by 0.5 ℃ every time, and the total number of cycles is 80. 3 biological replicates and 3 technical replicates were set for each sample, Ct values were recorded and relative expression levels were calculated.

4.3 results of the experiment

The expression level of XLOC _047603 in LTH, IRBLsh-S, inoculated strain Y92-66b or host rice after Guy11 is shown in figure 10, and the qRT-PCR detection result is consistent with the sequencing result. Experimental results show that the expression levels of the developed molecular marker XLOC _047603 in a rice susceptible variety LTH and a rice disease-resistant variety IRBLsh-S are obviously different, the size of a product is 106bp, and the sequence of the product is shown as SEQ ID NO: 16: the method comprises the following specific steps:

TCCTCTGTCGGTCTGTCCTACATCCTTCAGTTATCAGTGCCAGATCAATGATCACAAGAGTTGATATTTTGGAGACCACAAATGCACAAGTCTGTTTGTTGGAGGC。

the primers and the products can accurately reflect the change of the expression quantity of XLOC-047603. Therefore, the molecular markers (i.e., primers) and products used for the qRT-PCR assay can be used for the expression level detection of XLOC _ 047603; the method can be used for identifying the disease resistance of different rice varieties, namely the rice variety with high expression quantity is a rice blast-susceptible variety containing the reverse genetic locus, and the rice variety with low expression or no expression is a rice blast-resistant variety without the reverse genetic locus.

SEQUENCE LISTING

<110> research institute of agricultural environmental resources of agricultural academy of sciences of Yunnan province

Yunnan Agricultural University

<120> genetic locus for reversely regulating and controlling rice blast resistance and application thereof

<130> 1221

<160> 16

<170> PatentIn version 3.3

<210> 1

<211> 567

<212> RNA

<213> Rice (Oryza sativa L.)

<400> 1

ugucaucuua aggcguaacu aaaugacaua gccgguccca agcccggaaa aaggaggagg 60

ggauauaauc uuguauacuu cuauauugaa augaugcucu gcugcuaaau acaucauuug 120

auauuuucuu ggaaguuucu gcacuuuuau caagcuaauu ucaucuucag uaauggauca 180

gaauaguuau ggagagucau ccacucuguu uaauuguuca acaaaucuga uucuagacua 240

uuuuaguuug accucauuac aguccaguuu uccaguaaaa gcaauuugga ugaacacaug 300

caucaguuca uucuccucug ucggucuguc cuacauccuu caguuaucag ugccagauca 360

augaucacaa gaguugauau uuuggagacc acaaaugcac aagucuguuu guuggaggcu 420

uuaguauuuu ucaugaucaa aacuggugca gaaaacaucu guuaucacau aucacgcuau 480

uuagguucag aacauaauua ugaagcacau gaucaacaaa uaaaaaugau gaauuuaaau 540

ucaugaaaaa uggaauuggc aaaaacc 567

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence

<400> 2

cagtcgtctc acaactgtca tcttaaggcg taact 35

<210> 3

<211> 35

<212> DNA

<213> Artificial sequence

<400> 3

cagtcgtctc atacaggttt ttgccaattc cattt 35

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence

<400> 4

acggtgtcgt ccatcacagt ttgcc 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence

<400> 5

ttccggaagt gcttgacatt gggga 25

<210> 6

<211> 38

<212> DNA

<213> Artificial sequence

<400> 6

cagtcgtctc acaacgaaca catgcatcag ttcattct 38

<210> 7

<211> 38

<212> DNA

<213> Artificial sequence

<400> 7

cgatcgtctc acagggttct gaacctaaat agcgtgat 38

<210> 8

<211> 34

<212> DNA

<213> Artificial sequence

<400> 8

cgatggtctc acctgcaggt ctagtttttc tcct 34

<210> 9

<211> 34

<212> DNA

<213> Artificial sequence

<400> 9

cgatggtctc agcccgggct ctgtaactat catc 34

<210> 10

<211> 39

<212> DNA

<213> Artificial sequence

<400> 10

cagtcgtctc agggcgcttc tgaacctaaa tagcgtgat 39

<210> 11

<211> 38

<212> DNA

<213> Artificial sequence

<400> 11

cgatcgtctc atacagaaca catgcatcag ttcattct 38

<210> 12

<211> 25

<212> DNA

<213> Artificial sequence

<400> 12

acggtgtcgt ccatcacagt ttgcc 25

<210> 13

<211> 25

<212> DNA

<213> Artificial sequence

<400> 13

ttccggaagt gcttgacatt gggga 25

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

tcctctgtcg gtctgtccta 20

<210> 15

<211> 21

<212> DNA

<213> Artificial sequence

<400> 15

gcctccaaca aacagacttg t 21

<210> 16

<211> 106

<212> DNA

<213> Artificial sequence

<400> 16

tcctctgtcg gtctgtccta catccttcag ttatcagtgc cagatcaatg atcacaagag 60

ttgatatttt ggagaccaca aatgcacaag tctgtttgtt ggaggc 106

Claims

1. A genetic locus for reversely regulating and controlling rice blast resistance is characterized in that a nucleotide sequence of the genetic locus is shown as SEQ ID NO. 1.

2. The use of the genetic locus for retroregulating rice blast resistance of rice as claimed in claim 1 for improving disease resistance of rice.

3. A plant knockdown expression vector comprising the genetic locus for retroregulating rice blast resistance of claim 1.

4. A recombinant bacterium comprising the plant knockdown expression vector for controlling rice blast resistance in a reverse direction as defined in claim 3.

5. Use of the plant knockdown expression vector of claim 3 or the recombinant bacterium of claim 4 for increasing resistance of rice to Pyricularia oryzae.

6. The use of claim 5, wherein: transforming the plant knock-down vector of claim 5 into agrobacterium, preparing an agrobacterium suspension, transforming the suspension into susceptible rice to obtain a rice plant with rice blast resistance, and making the genetic locus for reversely regulating and controlling the resistance of the rice to rice blast bacteria in the rice as claimed in claim 1 not express or express at a low level, thereby improving the resistance of the rice plant to rice blast bacteria.

7. Use of the genetic locus for retroregulating rice blast resistance of rice as claimed in claim 1 for identifying resistance of rice to Pyricularia oryzae.

8. The use of claim 7, wherein: the identification steps are as follows:

1) extracting total RNA of rice to be detected;

2) reverse transcription to prepare cDNA;

3) using cDNA as template, using the DNA sequence shown in SEQ ID NO:14 and SEQ ID NO: 15, performing qRT-PCR, wherein the rice variety with high expression of the genetic locus for reversely regulating the resistance of the rice to the rice blast germs as claimed in claim 1 is a susceptible variety, and the rice variety with low expression or no expression of the genetic locus for reversely regulating the resistance of the rice to the rice blast germs is a disease-resistant variety.