CN106148353B - Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling - Google Patents
Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling Download PDFInfo
- Publication number
- CN106148353B CN106148353B CN201510172218.XA CN201510172218A CN106148353B CN 106148353 B CN106148353 B CN 106148353B CN 201510172218 A CN201510172218 A CN 201510172218A CN 106148353 B CN106148353 B CN 106148353B
- Authority
- CN
- China
- Prior art keywords
- rice
- bph6
- gene
- brown planthopper
- planthopper resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H1/00—Processes for modifying genotypes ; Plants characterised by associated natural traits
- A01H1/04—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
- A01H1/045—Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection using molecular markers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Botany (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Environmental Sciences (AREA)
- Developmental Biology & Embryology (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides brown planthopper resistant gene in rice Bph6 and its molecular labeling of close linkage.The nucleotide sequence of the brown planthopper resistant gene in rice Bph6 is as shown in SEQ ID No.1, and its cDNA sequence is as shown in SEQ ID No.2.The Bph6 assignments of genes gene mapping between molecular labeling H and Y37, and with the two close linkage.The rice containing brown planthopper resistant gene Bph6 can be screened using molecular labeling H and Y37.By genetic transformation and hybridization, Bph6 genes are transferred to common rice kind, it is possible to increase rice, so as to mitigate harm caused by brown paddy plant hopper, reaches the purpose of volume increase and stable yields to the resistance of brown paddy plant hopper.
Description
Technical field
The invention belongs to plant genetic engineering field, and in particular to a kind of brown planthopper resistant gene in rice Bph6 and its closely connect
The molecular labeling of lock.
Background technology
Rice is a kind of important cereal crops, has more than the people of half in the world using it as staple food.Simultaneously as rice
Genome deliberate genetic figure and physical map have been completed, and its transgenic technology is relatively easy, and with other gramineous crop bases
Because group has synteny, thus by depending on doing model plant.With including rice a variety of biological genomes be sequenced completion,
The mankind initially enter the genome times afterwards comprehensively.Carry out functional genome research comprehensively has turned into the Disciplinary Frontiers of life science.Therefore
The research of rice functional gene is significant to socio-economic development and biological study.
Food Security, it is the people of the world's facing challenges.50th, the hybridization of the breeding wheat for semidwarfness of the sixties and the seventies
Scientific and technological revolution increases substantially rice yield to rice cultivating twice.But rice is by the disease pest of large area in recent decades
Evil, makes Rice Production be on the hazard.Brown paddy plant hopper is that the primary pest in China's Rice Production, its adult and nymph pierce suction with lancet
Rice juice, cause yellow leaf or withered, cause the underproduction or total crop failure.According to Chinese agriculture yearbook record, 1966,1969,1973,
1977th, national big generation in 1983 and 2003, national especially big generation in 1987,1991,2005,2006 and 2007 are brown to fly
Lice hazard area reaches more than the 50% of the rice gross area, and serious loss is caused to China's Rice Production..China is every at present
Year, Brown Planthopper occurring area was more than 20,000,000 hectares, and direct production is lost up to 280 caused by brown paddy plant hopper endangers every year
More than ten thousand tons.Brown paddy plant hopper forms safely serious threat to China's Rice Production.
At present, brown paddy plant hopper has become the first big insect pest in China's Rice Production, to the current grain security in China shape
Into serious threat.For a long time, the preventing and treating of brown paddy plant hopper mainly relies on and applies chemical insecticide.Because brown paddy plant hopper outburst mostly occurs
In the rice maturation pustulation period, now rice strain growing way is vigorous, and the operation that insecticide is applied to rice strain base portion is extremely difficult.In fact by
Year after year a large amount of in chemical insecticide apply, and the brown paddy plant hopper resistance to the action of a drug is multiplied, and makes the effect of chemical control limited.Use simultaneously
Chemical insecticide prevents and treats brown paddy plant hopper, on the one hand adds the production cost of peasant, and another aspect chemical insecticide is also resulted in non-
The poisoning of target organism, to the environment such as environment and grain contamination and ecological problem.
It is method the most cost-effective in brown paddy plant hopper integrated control to cultivate insect-proof rice kind using brown planthopper resistant gene.
International Rice Research Institute (IRRI) even result of study and Southeast Asia Rice Production it was verified that only medium resistance water
Flat rice varieties, are also enough the collective control of brown paddy plant hopper is below horizontal what is damaged, are unlikely to cause reality to rice
The harm and production loss on border.Therefore, it is preventing and treating rice to excavate brown planthopper resistant gene in rice and applied in rice breeding project
The essential measure of brown paddy plant hopper.
The research of brown planthopper resistant gene in rice starts from the beginning of the seventies in last century.So far in common cultivated rice and wild rice
Identify and located in resource individual rice brown planthopper resistant more than 20 main effect anti insect gene (specific summary is shown in Jena etc.,
2010.Current status of Brown Planthopper(BPH)resistance and genetics.Rice
2010(3),161-171).As Bph1 (Athwal et al., 1971；Hirabayashi and Ogawa,1995；Sharma
et al.,2003；Cha et al.,2008),Bph2(Athwal et al.,1971；Murata et al.,1998；Murai
Et al., 2001), Bph3 (Lakshminarayana and Khush, 1977；Jairin et al., 2007), Bph4
(Kawaguchi et al., 2001), and bph5 (Khush et al., 1991), Bph6 (Kabir and Khush, 1988；Qiu
et al.,2010),Bph7(Kabir and Khush,1988),Bph8(Nemoto et al.,1989),Bph9((Nemoto
et al.,1989；Muruta and Fujiwara,2001),Bph10(Ishii et al.,1994),Bph11(Takita,
1996), Bph12 (Hirabayashi et al., 1998,1999), Bph13 (t) (Liu et al., 2001), Bph14
(Wang et al.,2001；Du et al., 2009), Bph15 (Huang et al., 2001；Yang et al 2004),
Bph17 (Renganayaki et al., 2002), Bph18 (t) (Jena et al., 2006), Bph19 (t) (Chen et
al.,2006),Bph20(t)、Bph21(t)、Bph22(t)、Bph23(t)、Bph24(t)(Li et al.,2006；Li Rongbai
Deng 2008), Bph20, Bph21 (Rahman et al 2009), Bph22 (t), Bph23 (t) (Ram et al2010), Bph
24(t)(Deen et al 2010),Bph22(t)、Bph23(t)(Hou et al 2011),Bph25(t)、Bph26(t)
(Myint et al.2005；Yara et al.2010；Myint et al.2012).Wherein, Bph14 genes have succeeded gram
Grand, this is to utilize the isolated first case rice anti insect gene (Du et al 2009) of map based cloning method first in the world.
Bph26 and Bph3 genes also respectively obtained clone (Tamura et al.2014 in 2014；Liu et al.2014).
Map based cloning (map-based cloning) is also known as positional cloning (positional cloning), be with
A kind of gene clone technology that the development of molecular markers linkage map spectrum gets up.Map based cloning method step is included to mesh
Mark gene and carry out Genes location, physical positioning, sequence analysis and genetic transformation authentication function.Theoretically, any one energy
The gene of positioning can all use map based cloning method to separate.Map based cloning method is generally suitable for the small species of genome comparison, such as list
Leaf model plant rice, there is the characteristics of the ratio between small genome, genomic physical distance and genetic distance are small and mark is abundant.
For rice as grass family model plant, its genome is the concentric circles of seven kinds of grass genome compositions such as wheat, jowar
The center of circle, it is one of crop for being best suitable for application drawing position PCR cloning PCR separation target gene.The multiple genes cloned in rice are all
Cloned by map based cloning method, such as Bacterial blight resistance gene Xa-21 (Song WY 1995, A Receptor Kinase-
Like Protein Encoded by the Rice Disease Resistance Gene,Xa21.Science,270:
1804-1806), Xa-1 (1998, Expression of Xa-1, a bacterial such as Yoshimura blight-
resistance gene in rice,is induced bybacterial inoculation.PNAS,95:1663-1668)
With Xa-26 (2004, the Xa26a gene conferring resistance to Xanthomonas such as Sun oryzae
pv.oryzae in rice,encodes an LRR receptor kinase-like protein.Plant Journal,
37:517-527), blast resistant gene Pi-b (1999, the The Pi-b gene for rice such as Wang blast
resistance belongs to the nucleotide binding andleucine-rich repeat class of
plant disease resistance genes.Plant Journal,1999,19:55-64) and Pi-ta (Bryan etc.
2000,A single amino acid difference distinguishes resistant and susceptible
alleles of the rice blast resistance gene Pi-ta.Plant Cell,12:2033~2046), I
Tillering gene (2003, the Control oftillering in such as Li rice.Nature 422 of state scientist clone:618-
621), resistant gene of salt (2005, the A rice quantitative trait locus for salt such as Ren tolerance
encodes a sodium transporter.Nature Genetics 37(10):1141-1146) and Yield Genes
(2008, the Natural variation in Ghd7is an important regulator such as Weiya Xue of
Heading date and yield potential in rice.Nature Genetics 40,761-767), and application
Isolated first case rice anti insect gene (2009, the Identification such as Du and of map based cloning method
characterization of Bph14,a gene conferring resistance to brown planthopper
in rice.PNAS,106:22163-22168)。
The content of the invention
It is an object of the invention to provide a kind of gene Bph6 of rice brown planthopper resistant and its application.
The method that the present invention uses science of heredity, the segregating population of rice brown planthopper resistant is built, using the method for map based cloning,
It is separated to brown planthopper resistant gene in rice Bph6.Show that the gene with brown planthopper resistant performance is to isolate by isolating mark detection
, by genetic transformation Bph6 genes, perceptual rice the phenotype of brown planthopper resistant is occurred, it was confirmed that the function of the gene.
The present invention provide brown planthopper resistant gene in rice Bph6, the nucleotide sequence of the gene as shown in SEQ ID NO.1,
Full length gene 7836bp, has 2 intrones and 3 extrons, and its CDS is respectively that section is 3841-6786, cDNA total lengths
4140bp。
Further, the cDNA sequence of the gene encodes 981 amino acid as shown in SEQ ID NO.2.
Present invention also offers the albumen of the gene code, the amino acid sequence such as SEQ ID NO.3 institutes of the albumen
Show.
It should be appreciated that (i.e. not in the activated centre of albumen) on the premise of BPH6 protein actives are not influenceed, this area skill
Art personnel can carry out various one or several amino of substitutions, additions and/or deletions to the amino acid sequence shown in SEQ ID NO.3
Acid obtains the amino acid sequence with equal function.
In addition, it is contemplated that the degeneracy of codon, such as the condition of amino acid sequence can not changed in its code area
Under, or in its noncoding region under conditions of protein expression is not influenceed, the polynucleotide sequence for encoding above-mentioned albumen is repaiied
Change.Therefore, the present invention also includes the replacement carried out to the polynucleotide sequence for encoding above-mentioned albumen, addition and/or missing one
Or multiple nucleotides, with above-mentioned coding with the nucleotide sequence just as functional protein.
It is homologous or heterologous promoter sequence is operably connected with one for above-mentioned polynucleotide passage provided by the invention.
Present invention additionally comprises the Sense sequences based on the polynucleotides or antisense sequences, including contain the polynucleotides
The cloning vector or expression vector of sequence or its fragment, the host cell containing the carrier, containing the nucleotide sequence or
The plant cell of the conversion of its fragment and genetically modified plants.
Present invention also offers application of the gene in rice seed selection, the rice seed selection flies to improve rice to brown
The resistance of lice.
Present invention also offers the molecular labeling with brown planthopper resistant gene in rice Bph6 close linkages, the molecular labeling is
H or Y37；The molecular labeling is H or Y37；
Primer pair for amplifier molecule mark H is as follows：
Forward primer HF：AGAATTGCTGCATGCTGTTG；
Reverse primer HR：ATTCCAGCATCGATTGCTTC；
Primer pair for amplifier molecule mark Y37 is as follows：
Forward primer Y37F：TCGACCTACGGCTTTTCTGTA；
Reverse primer Y37R：TAGATTCCTTCGGTTCCCATT.
Present invention also offers application of the molecular labeling in seed selection brown planthopper resistant rice.
Present invention also offers brown planthopper resistant gene in rice Bph6 molecular detecting method, is treated by the primer pair amplifies
Oryza sativa genomic dna is examined, and detects amplified production：If amplifying 1654bp amplified fragments using primer HF and HR, or utilize
Primer Y37F and Y37R amplify 174bp amplified fragments, then indicate brown planthopper resistant gene in rice Bph6 presence.
Present invention also offers a kind of method for screening brown planthopper resistant rice, pass through primer pair amplifies rice base to be checked
Because of a group DNA, and detect amplified production：If amplifying 1654bp amplified fragments using primer HF and HR, or utilize primer Y37F
174bp amplified fragments are amplified with Y37R, then indicate the presence of rice varieties Brown Planthopper Resistance.
The present invention provides a kind of method for cultivating the plant with Brown Planthopper Resistance, including：
1) plant cell is converted with polynucleotides；The polynucleotides contain rice brown planthopper resistant Bph6 genes, its nucleosides
Acid sequence is as shown in SEQ ID NO.1 or SEQ ID NO.2；
2) it is plant by the Plant cell regeneration being converted；
3) cultivate the plant of regeneration and expressed above-mentioned polynucleotides.
The present invention also provides a kind of method for producing the plant with Brown Planthopper Resistance, and methods described includes having brown fly
Lice resistant gene Bph6 plant produces the progeny plant with Brown Planthopper Resistance with other plant hybridization.
Wherein described plant is monocotyledon.
Preferably, the plant is rice.
Those skilled in the art will be understood that can be used for according to sequence disclosed by the invention to design or produce molecular labeling
The seed selection work of brown planthopper resistant rice.
Clone obtains Bph6 genes to the present invention as follows：
1. create target group.Utilize brown planthopper resistant rice and common rice mixing breed, F1Generation selfing obtains F2Colony,
As brown planthopper resistant gene target group.
2. brown planthopper resistant is identified.Seedling stage group's method identifies the brown planthopper resistant performance of target group.From F2For being harvested on plant
Seed, every part of F220 seedlings (being referred to as 1 family) are sowed in seedling disk for the seed of plant harvest.The heart stage of 2 leaf 1, it is put into 2-4 ages
Brown paddy plant hopper nymph (10 heads/plant), record the victimization state of each family, every part of material 3 repeated experiments.According to insect resistance identification knot
Fruit, the division for having carried out pest-resistant rank to target group's strain.
3. brown planthopper resistant gene positions.With PCR (polymerase chain reaction) and polyacrylamide gel electricity
Swimming, and RFLP marks and the method for Southern hybridization, detect F2The separation feelings of the SSR and RFLP molecular labelings of each individual plant
Condition, with reference to the pest-resistant rank of corresponding each family, using JoinMap3.0 and MapQTL5.0 softwares, build the chromosome of rice the 12nd
Molecular markers linkage map, Bph6 is positioned between molecular labeling RM5742 and RM6997.
4. encrypt target zone molecular labeling and finely positioning.The paddy gene announced according to International Rice genome plan
Group sequence, the primer of the SSR marker of target zone and InDel marks where the 4th chromosome Bph6 of design, with PCR and polypropylene
Acrylamide gel electrophoresis method detection mark is in BC2Separation in the big colonies of F2, by screening obtain restructuring individual plant phenotype with
The relation of genotype, brown planthopper resistant gene Bph6 is positioned between molecular labeling H and Y37, with marking Y37 close linkages.
5. candidate gene determines.Amplification Bph6 containing brown planthopper resistant gene resistance parent's rice material is segmented by PCR method
Expect the genomic DNA of (Swarnalata) and splicing obtains the genome sequence of Bph6 places section, using RiceGAAS softwares
Predicted gene, and by being analyzed with Nipponbare and 9311 sequences, determine Bph6 candidate gene.
6. full length cDNA clone.Primer is designed according to the cDNA sequence of prediction, expanded from the cDNA of brown planthopper resistant rice
2900bp fragments, with this section of primers, cDNA 3 ' ends are obtained by RACE (cDNA ends rapid amplifying technology)
With 5 ' terminal sequences, the final full-length cDNA for obtaining Bph6.
However, it is understood by those of ordinary skill in the art that according to Bph6 disclosed by the invention nucleotide sequence, pass through design
Appropriate PCR primer, you can amplification obtains Bph6 genes from brown planthopper resistant rice genome.
7. genetic transformation Bph6 genes verify its function.According to the ORF sequences of Bph6 genes, expanded respectively with PCR method
The fragment for increasing the 2946bp for the ORF containing Bph6 genes is connected into the PCXUN carriers through XcmI digestions after adding A.Sequencing is tested
Demonstrate,prove it is errorless after, resulting vehicle is Bph6 gene genetic conversion carriers, and its electricity is transferred in Agrobacterium EHA105.
According to the ORF sequences of Bph6 genes, Blast analyses are carried out on NCBI, select most conservative 500bp to carry out RNAi
The structure of carrier.It is the piece that introne both sides are complementary 500bp conserved sequences to construct centre by the method for over-lap PCR
Section, is connected into the PCXUN carriers through XcmI digestions after the fragment is added into A.After sequence verification is errorless, resulting vehicle is Bph6 bases
The RNAi carrier of cause, its electricity is transferred in Agrobacterium EHA105.
The genetic transforming method mediated using Agrobacterium EHA105, normal japonica rice variety is imported by over-express vector
In Nipponbare, 32 plants of Bph6 positive plants are finally obtained.First insect resistance identification has been carried out with the plant in T1 generations.Seedling stage is using collection
Group's method identification, control rice Nipponbare is all dead, and the survival of transgenic positive plant, pest-resistant rank is 5-7 levels.With T2 generations
Homozygous Bph6 positive plants have carried out insect resistance identification.Seedling stage is all dead using group's method identification, control rice Nipponbare
Die, the survival of transgenic positive plant, pest-resistant rank is 3-5 levels.
The genetic transforming method mediated using Agrobacterium EHA105, normal japonica rice variety is imported by RNAi carrier
In the NIL of Nipponbare backgrounds, 4 plants of RNAi positive plants are finally obtained.With the RNAi positive plants that T2 generations are homozygous
Insect resistance identification is carried out.Seedling stage, control rice Nipponbare was all dead, and NIL plant is deposited using group's method identification
Living, RNAi transgenic positives plant is dead, and pest-resistant rank is 7-9 levels.Confirm that Bph6 genes have the function of brown planthopper resistant.Cause
This, brown planthopper resistant gene Bph6 can be in rice using that can also be applied in rice paddy seed, and cultivation has brown planthopper resistant
The rice varieties of energy.
Advantages of the present invention and effect：
1. the successful clone of a gene further demonstrate the reliability of map based cloning method cloning rice important gene, the party
Gene its definite functions, the effect of method clone is good.
2. the Bph6 genes that the present invention clones have obvious brown planthopper resistant performance, this is to comprehensive understanding rice to brown paddy plant hopper
The diversity of gene type is significant.
3. in addition to Bph14 genes and Bph26, Bph3 are cloned 2009 and 2014 respectively, in the world not yet gram
It is grand go out other brown planthopper resistant gene in rice, it is still unclear to the molecule mechanism of rice brown planthopper resistant.And what the present invention cloned
Bph6 genes can significantly improve resistance of the rice to brown paddy plant hopper, and this molecular mechanism research to rice brown planthopper resistant will have greatly
Impetus.
4.Bph6 greatly improves rice brown planthopper resistant performance, is educated Bph6 applied to rice by genetic transformation or hybridization
In kind, the brown planthopper resistant of rice varieties can be improved, so as to mitigate causing harm for brown paddy plant hopper, reach the purpose of volume increase and stable yields.
5. piercing sucking insect is the major class insect pest in agricultural production, Bph6 gene clonings and brown planthopper resistant function confirm,
Anti- piercing sucking insect research for other plant has important references effect.
Brief description of the drawings
Fig. 1 is the distribution frequency of Brown Planthopper Resistance value.
It is illustrated as genotype of the SSR marker RM6997 in F2 colonies；Black, white and gray bars represent respectively
Swarnalata, 9311 and heterozygosis marker genetype；The seedling (3 leaf phases or growth 11d) of 140 rice F2 strains presses every plant
10 brown paddy plant hoppers handle 9~10d.
Fig. 2 is Bph6 Primary Location results.
The chromosome left side is mark title, and numerical value is the genetic distance (cM) between mark, and QTL scanning results are in molecular labeling
There are a maximum LOD value 43.8, the brown planthopper resistant phenotypic number about 77.5% that the site is explained between RM6997 and RM5742.
Fig. 3 is Bph6 finely positioning results.
Wherein：A：Numerical tabular indicating note and Bph6 restructuring individual plant numbers, Bph6 and molecular labeling H and Y37 between molecular labeling
Between 18kb region；B：18.1kb region in contain 2 prediction genes；ORF1 gene is illustrated as, square frame is outer aobvious
Son, wherein black are CDS areas, and white is UTR areas, and horizontal line is introne.
Fig. 4 is the qualification result of transgenosis brown planthopper resistant rice.
Transfer-gen plant puts the result of 14 days after worm；OE is transgenosis overexpression plant, and RNAi is that Bph6 is repressed
Transfer-gen plant；It is phenotype above, here is pest-resistant rank.The transgenic line of Bph6 gene expressions has substantially to brown paddy plant hopper
Resistance, Bph6 genes are suppressed the transgenic line of expression to brown paddy plant hopper non-resistant.
Fig. 5 is the functional molecular marker H examples developed according to Bph6 genome sequences, and its expanding fragment length is
1654bp；Swarnalata is the pest-resistant parent for carrying brown planthopper resistant gene Bph6 in figure, and Yang No.6 rice (93-11) is sense worm water
Rice, the carrying brown planthopper resistant gene filtered out using functional molecular marker H from Swarnalata and Yang No.6 rice backcross progeny
Bph6 material (the material brown planthopper resistant).
Fig. 6 is that molecular marker assisted selection figure cultivates the brown planthopper resistant rice with Bph6 genes.
Seedling stage brown planthopper resistant identifies, worm sources be Biotypes of The Brown Planthopper Nilaparvata Lugens Stal I, II, III and this laboratory rearing bion P, S,
Y；9311 represent sense worm check variety Yang No.6 rice (93-11) in figure, and NIL-9311 represents Luo and raises No. 6 (Yang No.6 rice genetic backgrounds
Carry brown planthopper resistant gene Bph6).Perceptual receptor parent Yang No.6 rice is substantially dead after putting worm, and Luo raises No. 6 (Yang No.6 rice heredity
Background carries brown planthopper resistant gene Bph6) still survive, plant strain growth health.
Embodiment
Following examples further illustrate present disclosure, but should not be construed as limiting the invention.Without departing substantially from
In the case of of the invention spirit and essence, the modifications or substitutions made to the inventive method, step or condition belong to the present invention
Scope.
Unless otherwise specified, the conventional meanses that technological means used in embodiment is well known to those skilled in the art.
The positional cloning and linkage molecule marker development of the Bph6 genes of embodiment 1
1.Bph6 Primary Location results
Brown planthopper resistant parent Swarnalata (containing brown planthopper resistant gene Bph6) and brown paddy plant hopper perception rice varieties Yang No.6 rice
(93-11) hybridization constructs the F containing Bph62Colony, 93-11 and Swarnalata are all from Chinese Academy of Agricultural Sciences's crop science
Country of research institute crops preserving seed center, and with CTAB methods (Murray MG＆Thompson, 1980 Rapid
isolation of high-molecular-weight plant DNA.Nucleic Acids Res 8:4321-4325) carry
Take parent and F2The genomic DNA of each individual plant of colony.Each F2Individual plant obtains corresponding F by being selfed sowing2:3Family.In order to reflect
Determine F2The brown planthopper resistant phenotype of each individual plant in target group, employ seedling stage group's method and investigate F2:The each individual plant of 3 familys resists
Sex expression, with F2:3Family resistance rank represents F2The brown planthopper resistant phenotype of individual plant.To ensure parent and F2:3It is each in colony
Family growth is consistent, and all materials to be tested distinguish presoaking and germinating prior to seeding.Each each 60 seeds of family (kind) are seeded in
One long 58cm, wide 38cm, high 9cm, and fill in the bread box of 7cm thickness Nutrition Soils.Per box, each material sows 3 repetitions,
Wherein sowing parent and TN1 (perception control) each 3 repetitions at random.Thinning after sowing 7 days, eliminate sick and weak seedling.Treat that seedling grows to two
During one heart stage of leaf, 2-3 age brown paddy plant hopper nymphs, nylon gauze most on back cover are inoculated with the ratio of 8/seedling.As sense worm kind TN1
When (local No. 1 in platform) is all dead, with reference to (Huang Z et al, 2001 Identification and such as Huang
mapping of two brown planthopper resistance genes in
Rice.Theor.Appl.Genet.102,929-934) method 0,1,3,5,7 or 9 grade of resistance carried out to each individual plant commented
Valency (table 1), the resistance rank to each family of parent material and colony by the weighted average calculation family, and according to resistance
Rank speculates this individual plant genotype.
The anti-sense brown paddy plant hopper identification grade scale of table 1
Seedling stage group's method qualification result shows that Swarnalata and 9311 pest-resistant rank is respectively 2.9 and 8.7, and this shows
Swarnalata brown planthopper resistants and 9311 sense brown paddy plant hoppers.140 F2:3Pest-resistant order frequencies distribution of the family to brown paddy plant hopper is in continuous
Distribution, and have resistance rank performance excess of export parent's phenomenon of part individual plant.According to the pest-resistant rank to brown paddy plant hopper by F2:3Family is divided into
Pest-resistant, anti-sense separation and sense three kinds of phenotypes of worm, and corresponding F2The genotype of individual plant is then designated as RR (homozygous pest-resistant), Rr respectively
Three kinds of (heterozygosis is pest-resistant) and rr (homozygosis sense worm).The strain number ratio of resistance individual plant and perceptual individual plant is 108:32, chi-square analysis shows
Anti-, sense individual plant number meets 3:1 segregation ratio (χ c2=0.24<χ 20.05,1=3.84) (Fig. 1).It can be seen that in resistance parent
The distribution of resistance that single dominant gene controls each individual plant in F2 colonies in Swarnalata be present.According to Gramene websites
(http://www.gramene.org/) mark announced select on every chromosome necessarily according to more uniform genetic distance
Number SSR molecular marker.In addition, based on the last location area section of the gene, compare rice varieties 9311 and Nipponbare is corresponding
Genome sequence, utilize SSR research tool SSRIT (http://www.gramene.org/db/markers/ssrtool) come
SSR motifs are found, and primer is designed according to its flanking sequence, are alternate labels.Wherein, SSRIT arrange parameters are：Maximum motif
Length is 4 aggressiveness, and minimum repeat number is 5, searches for all SSR motifs.Select all to be more than 15 base (motif lengths × weight
Plural number) SSR motifs.Simultaneously according to rice varieties in public database 9311 and the corresponding genome sequence of Nipponbare, utilize
PowerBlast softwares, find genome sequence present in insertion deletion segment, utilize the softwares of Primer Premier 5.0
Develop InDel marks.
Method (Temnykh S et al, 2000.Mapping and of the analysis of SSR marker with reference to Temnykh
genome organization of microsatellite sequences in rice.Theor Appl Genet 100：
697-712).10 μ l reaction systems include：10mM Tris-HCl pH8.3,50mM KCl, 1.5mM MgCl2, 50 μM
DNTPs, 0.2 μM of primer, 0.5U Taq polymerase and 20ng DNA profilings.Amplified reaction is enterprising in PTC-100PCR instrument
OK：94℃2min；94 DEG C of 15sec, 55 DEG C of 30sec, 72 DEG C of 1.5min, 35 circulations；72℃5min.Amplified production is with 6%
Native PAGE glue separates, and is developed the color (Zhu et al, 2004.Identification and by silver staining
characterization of a new blast resistance gene located on rice chromosome
1through linkage and differential analyses.Phytipathology 94:515-519).Amplification
The lamp box that DNA bands are equipped with fluorescent lamp is observed.Result is recorded, has polymorphic primer in F between parent2Carried out in colony
Analysis, obtain colony's genotype data.
According to F2:3The pest-resistant rank of family, the DNA of 10 extremely pest-resistant individual plants and 10 extreme sense worm individual plants is selected respectively
Mixing builds anti-sense pond.Meanwhile using the primer for having polymorphism between parent screen respectively it is anti-sense pond and obtain it is anti-sense pond it
Between have the molecular labeling of polymorphism, it is chain that such polymorphism mark, which shows with resistance,.Then, according to where linked marker
Chromosome, select the primer screening F for having polymorphism on the chromosome between parent2Each individual plant of segregating population, PCR programs are same
On, obtain colony's genotype data.According to chain exchange rule, using software JoinMap 3.0 by colony's genotype data structure
Build the part genetic map of rice and obtain the genetic distance of each molecular labeling.Finally, with reference to F2The molecule of each individual plant of colony
Marker genetype data and the pest-resistant rank of corresponding Brown Planthopper Resistance identification, utilize MapQTL5.0 software composite interval mappings
Method, QTL site scanning is carried out to target chromosome.As a result show between the SSR marker RM6997 and RM5742 of the 4th chromosome
With the presence of the peak-peak that a LOD value is 43.8, the brown planthopper resistant phenotypic number about 77.5% that the site is explained is (such as Fig. 2 institutes
Show).It can be seen that the major gene resistance of control brown planthopper resistant is there may be at the site.
2.Bph6 finely positioning
Because physical distance is larger between RM6997 and RM5742.In order to find and the chain more close marks of Bph6, root
According to QTL positioning result, the present invention PCR (polymerase chain reaction) and polyacrylamide gel electrophoresis
Method, 4300 plants of BC2F2 colonies individual plants are screened with the SSR marker RM16994 and RM17008 of both sides, between acquisition two marks
The individual plant recombinated 41.
It is corresponding according to rice varieties 9311 and Nipponbare in SSR marker RM16994 and RM17008 section public database
Genome sequence, utilize SSR research tool SSRIT (http://www.gramene.org/db/markers/ssrtool) come
SSR motifs are found, and primer is designed according to its flanking sequence, are alternate labels.PowerBlast softwares are utilized simultaneously, find base
Because present in group sequence insertion deletion segment, utilize the software development InDel of Primer Premier 5.0 mark.Use these
SSR marker newly developed, InDel marks divide 41 individual plants recombinated between two marks of RM16994 and RM17008
Son mark encryption, build saturation linkage map, and combine restructuring individual plant insect resistance identification result, finally by Bph6 be positioned at H and
Between Y37 (Fig. 3).
3.H-Y37 the analysis of section candidate gene
It is compared according to positioning section between Nipponbare and 9311, selects conserved sequence to be carried out every 2-3Kb
Design of primers, expanded, be sequenced and spliced on Bph6 resistance parents DNA.Predictive genes and note are carried out with RiceGAAS,
Analysis equally is compared with ClustalW, as a result shows that the section contains two ORF, is respectively designated as ORF1 and ORF2 (figures
3A)。
Compare the gene of both predictions, find the ill-resistant protein and Nipponbare difference of the 1st gene code of insect-proof rice
It is larger., the Rice Resistance pierce-suck type elder brother similar to the infection processs of rice with pathogen that think that piercing sucking insect sucks rice at present
The mechanism of worm is possible to identical with anti-microbial pathogen.Therefore, the gene is defined as Bph6.
4.RACE obtains full-length cDNA
Using brown planthopper resistant parent's Swarnalata leaf sheath total serum IgE reverse transcription products as template, set according to gene prediction results
Primer is counted, amplifies one section of cDNA sequence of candidate gene.By the primers, TaKaRa companies 5 ' and 3 ' are used
Full RACE kits, obtain the end of candidate gene 5 ' and 3 ' end sequences, it is determined that the transcription initiation position of candidate gene
Point and termination site, and it is spliced into the full length cDNA sequence of the gene.Primer is recombined according to full length cDNA sequence, amplification obtains
Obtain Bph6 full-length cDNA, its nucleotide sequence (Fig. 3 B) as shown in sequence table SEQ ID NO.2.
5. brown planthopper resistant gene Bph6 linkage molecules mark
In resistance parent, it is about 18kb to mark the physical distance between H and Y37.Therefore, molecule in linkage map is utilized
Mark is use：
H labeled primers：
Forward primer sequence AGAATTGCTGCATGCTGTTG
Reverse primer sequences ATTCCAGCATCGATTGCTTC
Or Y37 labeled primers：
Forward primer sequence TCGACCTACGGCTTTTCTGTA
Reverse primer sequences TAGATTCCTTCGGTTCCCATT
Amplifying rice brown planthopper resistant kind or breeding material DNA, if 1654bp amplification can be amplified with primer H
Fragment, or 174bp amplified fragments can be amplified with primer Y37, indicate rice brown planthopper resistant major gene loci
Bph6 presence.Therefore, identify that the presence of Bph6 resistant genes has using above-mentioned molecule labelling method provided by the invention
Very high efficiency, the Brown Planthopper Resistance of rice plant can be predicted, accelerate BPH-resistant rice varieties breeding process.
The functional verification and application of the Bph6 genes of embodiment 2
1. the structure of genetic transformation carrier
(1) structure of Bph6 gene overexpressions carrier.Used carrier is pCXUN (by U.S. Ohio State
University kingdom beam professor provides), using XcmI digestion pCXUN carriers, will can directly connect after exogenous sequences plus A
Enter.
According to RACE result, ORF is directly expanded using PCR method, carrier is connected into after adding A.Sequence verification is errorless
Afterwards, resulting vehicle is Bph6 gene overexpression carriers, and its electricity is transferred in Agrobacterium EHA105.Picking monoclonal expands training
Support, enter performing PCR checking it is errorless after, add 50% isometric glycerine to mix, -70 DEG C save backup.
(2) Bph6 gene RNAis vector construction
(provided with carrier for pCXUN by U.S. Ohio State University kingdom beam professor), using XcmI enzymes
PCXUN carriers are cut, will can be directly connected into after exogenous sequences plus A.Blast analyses are carried out according to the cDNA full length sequences of acquisition,
The most conservative 500bp of selection is expanded.It is that introne both sides are complementary to construct centre using the method for over-lap PCR
The fragment of 500bp conserved sequences.Fragment is connected into PCXUN carriers through gel extraction and after adding A.After sequence verification is errorless, gained carries
Body is Bph6 gene RNAi carriers, and its electricity is transferred in Agrobacterium EHA105.Picking monoclonal expands culture, enters performing PCR and tests
Demonstrate,prove it is errorless after, add 50% isometric glycerine to mix, -70 DEG C save backup.
2. genetic transformation
Using Agrobacterium EHA105 mediation genetic transforming method (Hiei etc., 1994, Efficient
transformation of rice(Oryza sativa L.)mediated by Agrobacterium and sequence
analysis of the boundaries of the T-DNA.Plant Journal 6:271-282) by above-mentioned Bph6 bases
Because over-express vector imports the common rice kind Nipponbare of brown paddy plant hopper perception.Will be above-mentioned using same method
In the NIL of Bph6RNAi vector introduction common rice kind Nipponbare backgrounds.
3.Bph6 gene transgenic functional verifications
Bph6 gene overexpressions conversion carrier obtains 32 plants of positive transgenic plant.After harvesting seed, T is used2Turn for Bph6
Gene plant, insect resistance identification is carried out using seedling stage group's method.As shown in figure 3, positive transgenic strain OE1, OE2 is carried out
Brown planthopper resistant is identified.Qualification result is as shown in figure 3, it is dead to feel the whole strains of worm check variety Nipponbare after 7 days for access brown paddy plant hopper
Die, the NIL plant strain growth health containing brown planthopper resistant gene Bph6, on-bladed is aggrieved.Bph6 gene overexpressions convert
Carrier obtains positive transgenic plant OE1, OE2 also healthy growth, and on-bladed is aggrieved, and pest-resistant rank is 2-4 levels, it was demonstrated that Bph6 bases
Because having the function of brown planthopper resistant.Therefore, brown planthopper resistant gene Bph6 can be in rice using can also be in rice paddy seed
Using rice varieties of the cultivation with brown planthopper resistant performance.
Bph6 gene RNAis carrier obtains 4 plants of positive transgenic plant.To homozygous T2Brown fly has been carried out for transfer-gen plant
Lice Resistance Identification.For qualification result as shown in figure 4, accessing brown paddy plant hopper after 7 days, the whole strains of sense worm check variety Nipponbare are dead,
NIL Material growth health, on-bladed is aggrieved, and then whole strain is dead for RNAi material, it was demonstrated that Bph6 genes have anti-brown
The function of plant hopper.
The checking of the molecular labeling of embodiment 3
1st, material and method
1.1 material：Brown planthopper resistant parent Swarnalata (containing brown planthopper resistant gene Bph6), brown paddy plant hopper perception rice varieties
The F of Yang No.6 rice (93-11) and Swarnalata and Yang No.6 rice hybridization structure23Family.
Molecular labeling primer：H and Y37, its nucleotide sequence is respectively as shown in SEQ ID No.4-5.
1.2 method
CTAB extraction process extraction rice sample gene group DNA.Respectively with primer H and Y37 amplification sample DNA.10 μ l systems.
10 μ l reaction systems include：10 × PCR buffer solutions, 1.0 μ l；10mM dNTPs, 0.1 μ l；10 μM of primers, 0.4 μ l；5U/μl
Taq archaeal dna polymerases, 0.2 μ l and 50ng DNA profilings.Amplified reaction is carried out in Bioer PCR instruments：94℃4min；94℃
30s, 55 DEG C of 30s, 72 DEG C of 90s, 30 circulations；72℃5min.H amplified production is separated with 1% agarose gel, can after electrophoresis
With Direct Analysis.Y37 amplified production is separated with 8% Native PAGE glue, is read after being dyed after electrophoresis with silver nitrate argentation
Map analysis.
2nd, result：In aforementioned manners, to rice varieties Swarnalata, Yang No.6 rice, Swarnalata and rice 6 is raised respectively
Number hybridization structure 24 parts of F23Family is expanded.As a result show, in Swarnalata and the F of Yang No.6 rice hybridization structure23Family
In system, the F of corresponding 1654 fragment and 174bp fragments can be amplified respectively using H and Y37 molecular labeling primers23Family is to brown
Plant hopper shows insect resistace.And the Swarnalata and Yang No.6 rice hybridization structure of above-mentioned specific fragment F can not be expanded23
Family shows susceptibility (Fig. 5) to brown paddy plant hopper.
Thus illustrating, molecule labelling method provided by the invention can be filtered out accurately containing brown planthopper resistant gene Bph6,
So as to greatly improve breeding efficiency.
The molecular marker assisted selection of embodiment 4 carries the brown planthopper resistant rice of Bph6 genes
Molecular marker assisted selection is carried out using above-mentioned molecular labeling select the anti-brown winged of carrying Bph6 genes in this example
Lice rice Luo raises No. 6, and specific implementation is as follows：Brown planthopper resistant parent Swarnalata (containing brown planthopper resistant gene Bph6) and brown paddy plant hopper
Perceptual rice varieties Yang No.6 rice (93-11) hybridizes F1, it is returned with Yang No.6 rice, utilizes the molecular labeling chain with Bph6
(RM5742, RM6997) is to BC1F1Screened, filter out the BC of the Bph6 containing brown planthopper resistant gene1F1Returned with Yang No.6 rice
Hand over, obtain BC2F1；Using the molecular labeling (RM5742, RM6997) chain with Bph6 to BC2F1Screened, filtered out containing anti-
Brown paddy plant hopper gene Bph6 BC2F1It is returned with Yang No.6 rice, obtains BC3F1；Utilize the molecular labeling chain with Bph6
(RM5742, RM6997) is to BC3F1Screened, filter out the BC of the Bph6 containing brown planthopper resistant gene3F1Returned with Yang No.6 rice
Hand over, obtain BC4F1；, and genome-wide screening is carried out using molecular labeling, selection is only in brown planthopper resistant gene Bph6 sites with raising
Rice No. 6 has differences, and remaining site is replaced by the BC of Yang No.6 rice background4F1Carry out adding generation, utilize point chain with Bph6
Son mark (RM5742, RM6997) filters out the homozygous Yang No.6 rice/Swarnalata//in brown planthopper resistant gene Bph6 sites and raises rice
No. 6 BC4F2, adding generation is carried out, the material is with Yang No.6 rice indistinction in economical character phenotype, but it contains brown planthopper resistant base
Because of Bph6, this material is temporarily named as Luo and raises No. 6.The identification of seedling stage group's method is carried out using Wuhan field brown paddy plant hopper colony, is closely divided
The tiller phase is identified and maturity period identification confirms its brown planthopper resistant (see Fig. 1).Utilize Biotypes of The Brown Planthopper Nilaparvata Lugens Stal I, II, III and this reality simultaneously
Test room raising bion P, S, Y carry out seedling stage group's method identification, as a result display put after worm 7 days, compare perceptual kind TN1 with by
Body parent's Yang No.6 rice is substantially dead, and Luo is raised No. 6 (Yang No.6 rice genetic backgrounds carry brown planthopper resistant gene Bph6) and still survived,
Plant strain growth health (Fig. 6).At present, Luo raises No. 6 and has declared rice varieties power.
For any one molecular labeling of H and Y37, the banding pattern of individual plant is remembered when consistent with brown planthopper resistant parent Swarnalata
For 1,2 are designated as when consistent with Yang No.6 rice (93-11), while the i.e. heterozygosis banding pattern of banding pattern with two parents is designated as 3.Molecule mark
Note the selection result shows that BC4F1 only exists in brown planthopper resistant gene Bph6 sites (RM5742 and RM6997 sections) and Yang No.6 rice
Difference, remaining site are replaced by Yang No.6 rice genetic background.
Claims (9)
1. brown planthopper resistant gene in rice Bph6, it is characterised in that the nucleotide sequence of the gene is as shown in SEQ ID NO.1.
2. gene according to claim 1, it is characterised in that the cDNA sequence of the gene is as shown in SEQ ID NO.2.
3. the albumen of the gene code of claim 1 or 2, it is characterised in that the amino acid sequence of the albumen such as SEQ ID
Shown in NO.3.
4. the carrier containing the gene of claim 1 or 2.
5. application of the gene in rice seed selection described in claim 1 or 2, it is characterised in that the rice seed selection is raising
Resistance of the rice to brown paddy plant hopper.
6. with the molecular labelings of brown planthopper resistant gene in rice Bph6 close linkages, it is characterised in that the molecular labeling be H or
Y37；
Primer pair for amplifier molecule mark H is as follows：
Forward primer HF：AGAATTGCTGCATGCTGTTG；
Reverse primer HR：ATTCCAGCATCGATTGCTTC；
Primer pair for amplifier molecule mark Y37 is as follows：
Forward primer Y37F：TCGACCTACGGCTTTTCTGTA；
Reverse primer Y37R：TAGATTCCTTCGGTTCCCATT.
7. application of the molecular labeling in seed selection brown planthopper resistant rice described in claim 6.
8. brown planthopper resistant gene in rice Bph6 molecular detecting method, it is characterised in that pass through primer pair described in claim 6
Oryza sativa genomic dna to be checked is expanded, and detects amplified production：If amplifying 1654bp amplified fragments using primer HF and HR,
Or 174bp amplified fragments are amplified using primer Y37F and Y37R, then indicate brown planthopper resistant gene in rice Bph6 presence.
A kind of 9. method for screening brown planthopper resistant rice, it is characterised in that to be checked by primer pair amplifies described in claim 6
Oryza sativa genomic dna, and detect amplified production：If amplifying 1654bp amplified fragments using primer HF and HR, or utilize and draw
Thing Y37F and Y37R amplify 174bp amplified fragments, then indicate the presence of rice varieties Brown Planthopper Resistance.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510172218.XA CN106148353B (en) | 2015-04-13 | 2015-04-13 | Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling |
| PCT/CN2015/086207 WO2016165243A1 (en) | 2015-04-13 | 2015-08-06 | Rice gene bph6 resistant to brown planthopper and closely linked molecular marker thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510172218.XA CN106148353B (en) | 2015-04-13 | 2015-04-13 | Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106148353A CN106148353A (en) | 2016-11-23 |
| CN106148353B true CN106148353B (en) | 2018-02-23 |
Family
ID=57125661
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510172218.XA Active CN106148353B (en) | 2015-04-13 | 2015-04-13 | Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN106148353B (en) |
| WO (1) | WO2016165243A1 (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108504662B (en) * | 2018-05-24 | 2020-01-24 | 武汉大学 | Rice brown planthopper resistant gene Bph30 and closely linked molecular marker thereof |
| CN109055598B (en) * | 2018-09-28 | 2021-11-02 | 袁隆平农业高科技股份有限公司 | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof |
| CN109762929B (en) * | 2019-03-27 | 2022-07-15 | 江西省农业科学院水稻研究所 | Functional molecular marker, identification method and application of brown planthopper resistant gene Bph9 of rice |
| CN109913576A (en) * | 2019-04-15 | 2019-06-21 | 武汉禾泰青生物科技有限公司 | It is a kind of for detecting the primer pair and its application of brown planthopper resistant gene in rice Bph14 |
| CN110241179B (en) * | 2019-06-28 | 2023-04-11 | 南京农业大学 | Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper |
| CN110951748B (en) * | 2019-12-16 | 2021-10-22 | 武汉大学 | Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application |
| CN110862973B (en) * | 2019-12-16 | 2021-07-16 | 武汉大学 | Rice thioredoxin gene OsNDU, protein, vector, host cell, molecular marking method and application |
| CN111621589B (en) * | 2020-06-24 | 2022-08-23 | 南京农业大学 | Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof |
| CN111876519B (en) * | 2020-08-21 | 2022-01-21 | 中山大学 | Application of rice OsCslF6 gene in identification of rice resistance to rice planthopper |
| CN112266919B (en) * | 2020-11-05 | 2022-05-06 | 浙江大学 | Rice source insect-resistant related gene OsIDP1 and encoding product and application thereof |
| CN113186198A (en) * | 2021-04-12 | 2021-07-30 | 武汉大学 | Brown planthopper resistant gene Bph41 and encoding protein and application thereof |
| CN113322331B (en) * | 2021-05-28 | 2022-07-12 | 中山大学 | Method for evaluating potential applicability of insect-resistant rice variety based on specific injurious genotype of brown planthopper |
| CN118048475A (en) * | 2024-02-22 | 2024-05-17 | 云南农业大学 | Primer for detecting rice OsHXK3 gene specificity InDel marker and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667309A (en) * | 2012-09-05 | 2014-03-26 | 武汉大学 | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914531A (en) * | 2010-08-19 | 2010-12-15 | 武汉大学 | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof |
-
2015
- 2015-04-13 CN CN201510172218.XA patent/CN106148353B/en active Active
- 2015-08-06 WO PCT/CN2015/086207 patent/WO2016165243A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667309A (en) * | 2012-09-05 | 2014-03-26 | 武汉大学 | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| High-resolution mapping of the brown planthopper resistance gene Bph6 in rice and characterizing its resistance in the 9311 and Nipponbare near isogenic backgrounds;Yongfu Qiu等;《Theoretical and Applied Genetics》;20100803;第1601-1611页 * |
| 水稻抗褐飞虱基因及其育种应用研究进展;范峰峰等;《中国农业通报》;20141231;第30卷(第6期);摘要、第14页右栏最后一段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106148353A (en) | 2016-11-23 |
| WO2016165243A1 (en) | 2016-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106148353B (en) | Brown planthopper resistant gene in rice Bph6 and its close linkage molecular labeling | |
| CN103667309B (en) | Brown planthopper resistant gene in rice Bph9 and molecule marker thereof and application | |
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| CN104878091B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9978 | |
| US20140259233A1 (en) | Cadmium absorption regulatory gene, protein and cadmium absorption-inhibiting rice plant | |
| CN108239647A (en) | A kind of gene, molecular labeling and application for controlling rape plant type | |
| CN110144363B (en) | Insect-resistant herbicide tolerant corn transformation events | |
| WO2019223563A1 (en) | Rice brown planthopper resistance gene bph30 and molecular marker closely linked thereto | |
| CN104878092B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9953 | |
| CN107090464B (en) | Insect-resistant herbicide-resistant corn transformation event and creation method and detection method thereof | |
| WO2021121209A1 (en) | Rice brown-planthopper-resistant gene bph37, and protein, vector, host cell, molecular marker, method and use thereof | |
| CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
| Zhang et al. | Identification of stably expressed QTL for resistance to black shank disease in tobacco (Nicotiana tabacum L.) line Beinhart 1000-1 | |
| CN114807174A (en) | Genetic locus for reversely regulating and controlling rice blast germ resistance and application thereof | |
| CN107304422A (en) | Control the application of the OsSBR1 genes and its RNA interference fragments of resisting rice sheath blight | |
| CN110358861B (en) | Molecular marker R13I14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN110468229B (en) | Coseparation molecular marker Hxjy-1 of rice broad-spectrum high-resistance bacterial leaf blight gene Xa45(t) | |
| CN116445446A (en) | Wild cabbage glycosyltransferase BoUGT76C2 gene and application | |
| CN109706154B (en) | CsPR3 gene and application thereof in cucumber fusarium wilt resistance | |
| CN113652423B (en) | Method for auxiliary identification of drought resistance of wheat to be detected and special molecular marker thereof | |
| CN104878097B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9981 | |
| CN104846084B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9927 | |
| CN111254212B (en) | Rice blast resistance gene Pi68(t) close linkage molecular marker and application thereof | |
| CN110358862B (en) | Molecular marker Hxjy-14 closely linked with rice broad-spectrum high-resistance bacterial blight gene Xa45(t) | |
| CN114032323A (en) | Co-dominant SSR marker closely linked with black shank resistance gene of cigar and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |