CN110241179B - Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper - Google Patents
Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper Download PDFInfo
- Publication number
- CN110241179B CN110241179B CN201910582506.0A CN201910582506A CN110241179B CN 110241179 B CN110241179 B CN 110241179B CN 201910582506 A CN201910582506 A CN 201910582506A CN 110241179 B CN110241179 B CN 110241179B
- Authority
- CN
- China
- Prior art keywords
- cardinium
- tissue
- rice planthopper
- tissues
- hybridization solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for positioning the distribution of symbiotic bacteria Cardinium in different tissues of rice planthoppers, belonging to the field of agricultural biotechnology. The method comprises the steps of firstly dissecting and separating different tissues of the rice planthopper; then designing three sections of specific oligonucleotide probes with fluorescent labels according to the 16S rRNA sequence of Cardinium; and finally, hybridizing the Cardinium existing in the rice planthopper by using a specific probe, and quickly and accurately positioning the Cardinium in the rice planthopper tissues by scanning through a laser confocal microscope. The positioning method provided by the invention has high specificity, sensitivity, feasibility and effectiveness, and can save cost. The invention is beneficial to better research on the interaction relationship between the Cardinium and the host, and is also beneficial to research on strategies for suppressing pest populations and mechanisms for resisting virus propagation.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to symbiotic bacteria in different tissues of rice planthoppersCardiniumTo locate the distribution of (2).
Background
CardiniumIs a gram-negative endosymbiotic bacterium which is positioned in cells and can carry out maternal transmission. They are widely present in many arthropods, and some important agricultural pests such as rice planthopper, spider mites, bemisia tabaci and parasitic wasps are foundCardiniumIs present. They may regulate the reproduction and development of the host, including Cytoplasmic Incompatibility (CI), parthenogenesis induction (Feminization), feminization (Feminization) and emasculation (Male-killing). Wherein, byCardiniumThe most important reproductive phenotype induced is CI. CI is associated with symbiotic infection, when uninfected females and infected malesOffspring produced during mating cannot hatch normally. The occurrence of these phenotypes is mainly benefited byCardiniumWidespread in various tissues of insects.
WolbachiaIs another endophytic bacterium, also widely present in arthropods, and someWolbachiaStrains have been transfected into mosquitoes and fruit flies. One through the other in the hostWolbachiaThe positioning is carried out, the distribution range of the pests in host tissues is known, and the 100 percent vertical transmission rate of the pests is determined, so that the strategy for suppressing pest populations and the mechanism for resisting virus transmission are better researched. However,Cardiniumthe distribution in some important pest tissues is not well described.
Sogatella furciferaSogatella furcifera(Horv th) and Nilaparvata lugensNilaparvata lugens(St 229l) are two pests which can migrate and fly for long distances and cause serious harm to rice in Asian farming areas. The Sogatella furcifera can be naturally infectedCardiniumAnd inducing strong CI in the host; brown planthopper is not infected in natural stateCardiniumInfection can also be stabilized by artificial transfectionCardinium。
However, in two species of rice planthopperCardiniumThe distribution in the tissue has not been accurately localized. Therefore, there is a great need for a method for distribution of rice planthoppersCardiniumThe positioning is carried out, thereby being beneficial to better researching the interaction relation between the symbiotic bacteria and the insects.
Disclosure of Invention
The invention provides a method for culturing symbiotic bacteria in different tissues of rice planthopperCardiniumCan be visually understood by the methodCardiniumRelated action relationship with rice planthopper.
For symbiotic bacteria in different tissues of rice planthopperCardiniumThe method for positioning by distribution specifically comprises the following steps:
(1) Dissection and isolation of rice planthopper tissue: collecting adult rice planthopper, carefully dissecting planthopper tissues under a microscope, and separating the planthopper tissues into centrifuge tubes filled with 1 × PBS;
(2) Design of oligonucleotide probes: according toCardiniumThe 16S rRNA sequence of the probe is designed into three sections of specific oligonucleotide probes with fluorescent labels;
(3) Oligonucleotide probes and in rice planthopper tissuesCardiniumThe hybridization of (2): fixing the tissue dissected in the step (1) by using 4% paraformaldehyde, cleaning, placing in a hybridization solution for overnight, respectively staining cytoskeleton and cell nucleus by using phalloidin and DAPI after cleaning, cleaning again, and sealing by using an anti-fluorescence quencher;
(4) Observation under a laser confocal microscope: adjusting the excitation wavelength and the emission wavelength of the laser confocal microscope respectivelyCardiniumScanning cell skeleton and cell nucleus to obtain symbiotic bacteria in different tissues of rice planthopperCardiniumThe distribution of (2) is accurately positioned.
Further, the rice planthopper in (1) is sogatella furcifera or brown planthopper.
Further, the tissue in (1) is one or more of salivary gland, ovary, testis and intestinal tract.
Further, in the (2), the three segments of fluorescently labeled oligonucleotide probes with specificity are:
C162: 5’- ATCTTTCCAGCATGCGCT -3’ （SEQ ID NO.1）；
C587: 5’- CAATCGCAGTTCTAGCGTTA -3’ （SEQ ID NO.2）；
C997: 5’- GCACCTTGTATTCCGTCC -3’ （SEQ ID NO.3）；
SEQ ID NO. 1-3 were labeled with Cy5 at the 5' end of the oligonucleotide probe sequence.
Further, in the (3), the oligonucleotide probe is contacted with the tissue of rice planthopperCardiniumThe hybridization specifically comprises the following steps:
(1) 4% paraformaldehyde fixation: cleaning the dissected tissue with 1 × PBS for 2 times, removing residual liquid, adding about 1ml of 4% paraformaldehyde tissue, fixing for 30min, removing paraformaldehyde, and cleaning with 1 × PBS for 2-3 times;
(2) nucleic acid hybridization overnight in dark: adding three sections of specific oligonucleotide probes into the prepared nucleic acid hybridization solution, adding the oligonucleotide probes into a centrifuge tube with tissues, wherein the hybridization solution is just needed to be immersed in the tissues, and the operation process needs to be protected from light and be dark overnight in a water bath kettle at 46 ℃;
(3) and (3) cleaning the hybridization solution: washing off hybridization solution, respectively washing 2 XSSC (0.015% (w/v) DTT), 1 XSSC (0.015% (w/v) DTT) and 0.5 XSSC (0.015% (w/v) DTT) for 1 time, then washing 1 time by PBS, and placing the tissues at the bottom of a centrifuge tube;
(4) staining cytoskeleton: diluting phalloidin with 1 XPBS for 200 times, adding 700ml diluent into a centrifuge tube for dyeing for 1 hour, then washing with 1 XPBS for 3 times, and operating in dark place;
(5) staining cell nuclei: adding DAPI into the centrifuge tube, placing the centrifuge tube in the dark for 1 hour after the liquid submerges the tissue, washing the centrifuge tube for 3 times by using 1 XPBS, and operating in the dark;
(6) sealing a fluorescence quencher resisting sheet: the tissue was placed on a slide, the position adjusted, and an anti-fluorescence quencher seal was added.
Further, in the step (2), the method for preparing the hybridization solution adopts the following formula:
| nucleic acid hybridization solution composition | Dosage formulation |
| 50% deionized formamide | 5ml |
| 5×SSC | 3ml |
| Dextran sulfate 200mg/ml | 2.5g |
| 250ug/ml salmon sperm DNA | 0.003g |
| Dithiothreitol 0.1mol/l | 0.154g |
| 0.5×Denhardt’s solution | 5ml |
| 250ug/ml poly(A) | 0.003g |
Further, in the step (2), the dilution ratio of the probe to the hybridization solution is 1: 50-200, preferably, the dilution ratio of the probe and the hybridization solution is 1:100.
further, in the step (4), the excitation light wavelength and the emission wavelength are as follows:
Cadinium：Cy5，645～670 nm；
cell nucleus: DAPI, 359-461 nm;
cytoskeleton: FITC, 494-518 nm.
The invention dissects different tissues of the rice planthopper by adopting three sectionsCardiniumSpecific oligonucleotide probe, observed by laser confocal, for the presence of different tissues in rice planthopperCardiniumAnd (6) positioning.
The invention relates to a method for separating three rice planthoppersCardiniumDetection method (PCR qualitative detection of rice planthopper)CardiniumqPCR quantitative detection of rice planthopperCardiniumAnd electron microscopy of rice planthopperCardinium) Combined with one body, can quickly, qualitatively, quantitatively and intuitively treat the rice planthopper existing in various tissuesCardiniumAnd detecting and positioning.
At the same time, the invention avoids the use of immunohistochemical pairsCardiniumThe dyeing method can save a large amount of costThe application is.
The pair of the inventionCardiniumThe positioning method has high specificity, sensitivity, feasibility and effectiveness, can save cost and can intuitively perform positioning in a short timeCardiniumIs located.
The invention is also beneficial to visually observingCardiniumRelationship to host cells, which facilitates better studyCardiniumAnd the interaction relationship between the host, and also contributes to better research on strategies for suppressing pest populations and mechanisms for resisting virus spread.
Drawings
FIGS. 1a to 1d are each aCardiniumDistribution in the ducts of the ovary, testis, salivary glands and intestinal tract of sogatella furcifera.
FIGS. 2a to 2d are each aCardiniumDistribution in the duct of the egg of the brown planthopper, the spermary, the salivary gland and the intestinal tract.
Detailed Description
The following examples are further illustrative of the present invention and are not intended to be limiting thereof.
Example 1: for symbiotic bacteria in different tissues of sogatella furciferaCardiniumIs located.
Dissection and isolation of Sogatella furcifera tissue
20 mature Pediculus albus females and males were collected, and the planthopper to be dissected was placed in a clean culture dish, and tissues of salivary gland, ovary, testis, intestinal tract, etc. were carefully dissected with dissecting forceps under a microscope, and transferred to a test tube containing 1 XPBS.
Design of (di) oligonucleotide probes
According toCardiniumThe 16S rRNA sequence of (1) is designed into three sections of oligonucleotide probes with fluorescence labeling specificity, and Cy5 is used for labeling the 5' end of the probe sequence, namely SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
(III) oligonucleotide Probe and Pediculus albidusCardiniumBy hybridization of
Oligonucleotide probes and Pediculus sojae pratensisCardiniumOf (2)The method specifically comprises the following steps:
(1) 4% fixation with paraformaldehyde
Cleaning the dissected tissue with 1 × PBS for 2 times, removing residual liquid, adding about 1ml of 4% paraformaldehyde tissue, fixing for 30min, removing paraformaldehyde, and cleaning with 1 × PBS for 2-3 times;
(2) Nucleic acid hybridization overnight in darkness
First, a nucleic acid hybridization solution was prepared, and the specific formulation of the hybridization solution was as follows.
| Nucleic acid hybridization solution composition | Dosage formulation |
| 50% deionized formamide | 5ml |
| 5×SSC | 3ml |
| Dextran sulfate 200mg/ml | 2.5g |
| 250ug/ml salmon sperm DNA | 0.003g |
| Dithiothreitol 0.1mol/l | 0.154g |
| 0.5×Denhardt’s solution | 5ml |
| 250ug/ml poly(A) | 0.003g |
Adding three segments of designed specific oligonucleotide probes into the prepared nucleic acid hybridization solution, wherein the dilution ratio of the probes to the hybridization solution is 1:100. carefully adding the mixed liquid into a centrifuge tube with an organization, and enabling the hybridization liquid to submerge the tissue of the sogatella furcifera. The operation process is carried out in the dark, and the centrifuge tube is placed in a water bath kettle at 46 ℃ for overnight;
(3) Cleaning hybridization solution
Washing off the hybridization solution, respectively taking 2 XSSC (0.015% (w/v) DTT), 1 XSSC (0.015% (w/v) DTT) and 0.5 XSSC (0.015% (w/v) DTT) by using a pipette to wash the tissue of the Sogatella furcifera, washing 1 time respectively, and washing several times by using 1 XSSC until all residual hybridization solution is removed, and depositing clean tissue of the Sogatella furcifera at the bottom of the test tube. The whole process is carried out in dark.
(4) Staining cytoskeleton
The phalloidin was diluted 200-fold with 1 XPBS and 700ml of the dilution was added to the centrifuge tube for staining. The centrifuge tube was placed on a bed and shaken slowly for 1 hour. The residual liquid was removed and washed 3 times with 1 × PBS. The whole process is carried out in dark.
(5) Staining of cell nuclei
Adding DAPI into the centrifuge tube, and allowing the liquid to submerge the tissue. The centrifuge tubes were left in the dark at room temperature for 1 hour and then washed 3 times with PBS. The whole process is carried out under the condition of keeping out light.
(6) Anti-fluorescence quencher sealing sheet
Place the Sogatella furcifera tissue on a glass slide, adjust the position, add the anti-fluorescence quencher, cover the slide with a coverslip and seal with nail polish.
(IV) Observation under a confocal laser scanning microscope
Adjusting the wavelength of the exciting light of the laser confocalCardiniumThe cytoskeleton and the cell nucleus can be accurately positioned by scanning, as shown in figure 1, wherein figures 1a to 1d are respectivelyCardiniumDistribution in ovary duct, testis, salivary gland and intestinal tract of Sogatella furcifera is shown by arrowCardinium。
Excitation and emission wavelengths used:
Cadinium：Cy5，645～670 nm；
cell nucleus: DAPI, 359-461 nm;
cytoskeleton: FITC, 494-518 nm.
Example 2: for symbiotic bacteria in different tissues of brown planthopperCardiniumIs located.
Dissection and isolation of brown planthopper tissue
20 mature brown planthopper females and males were collected, planthoppers to be dissected were placed in a clean culture dish, salivary glands, ovaries, spermary, intestinal tracts, etc. were carefully dissected with dissecting forceps under a microscope, and they were transferred to test tubes containing PBS.
Design of (di) oligonucleotide probes
According toCardiniumThe 16S rRNA sequence of (1) is used for designing three sections of fluorescence labeled oligonucleotide probes with specificity, and Cy5 is used for labeling the 5' end of the probe sequence, namely SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3.
(III) oligonucleotide Probe and Nilaparvata lugensCardiniumBy hybridization of
Oligonucleotide probes and Nilaparvata lugensCardiniumThe hybridization specifically comprises the following steps:
(1) 4% fixation with paraformaldehyde
Washing the dissected tissue with 1 × PBS for 2 times, removing residual liquid, adding about 1ml of 4% paraformaldehyde tissue, fixing for 30min, removing paraformaldehyde, and washing with 1 × PBS for 2-3 times;
(2) Nucleic acid hybridization overnight in darkness
First, a nucleic acid hybridization solution was prepared, and the specific formulation of the hybridization solution was as follows.
| Nucleic acid hybridization solution composition | Dosage formulation |
| 50% deionized formamide | 5ml |
| 5×SSC | 3ml |
| Dextran sulfate 200mg/ml | 2.5g |
| 250ug/ml salmon sperm DNA | 0.003g |
| Dithiothreitol 0.1mol/l | 0.154g |
| 0.5×Denhardt’s solution | 5ml |
| 250ug/ml poly(A) | 0.003g |
Adding three sections of designed specific oligonucleotide probes into the prepared nucleic acid hybridization solution, wherein the dilution ratio of the probes to the hybridization solution is 1:100. carefully adding the mixed liquid into a centrifuge tube in which the brown planthopper tissues are stored, and enabling the hybridization liquid to submerge the tissues. The operation process is carried out in the dark, and the centrifuge tube is placed in a water bath kettle at 46 ℃ for overnight;
(3) Cleaning hybridization solution
Washing off the hybridization solution, respectively taking 2 XSSC (0.015% (w/v) DTT), 1 XSSC (0.015% (w/v) DTT) and 0.5 XSSC (0.015% (w/v) DTT) by using a pipette to wash the tissues of the brown planthopper for 1 time respectively, and then washing the tissues of the brown planthopper for a plurality of times by using 1 XSSC until all the hybridization solution is removed, and depositing clean tissues of the brown planthopper at the bottom of the test tube. The whole process is carried out in dark.
(4) Staining cytoskeleton
The phalloidin was diluted 200-fold with 1 XPBS and 700ml of the dilution was added to the centrifuge tube for staining. The centrifuge tube was placed on a bed and shaken slowly for 1 hour. The residual liquid was removed and washed 3 times with 1 × PBS. The whole process is carried out in dark.
(5) Staining of cell nuclei
Adding DAPI into the centrifuge tube, and making the liquid submerge the tissue. The centrifuge tubes were left in the dark at room temperature for 1 hour and then washed 3 times with 1 × PBS. The whole process is carried out in dark.
(6) Anti-fluorescence quencher sealing sheet
The brown planthopper tissues were placed on a glass slide, the position was adjusted, the anti-fluorescence quencher was added, the cover slip was covered and the slides were mounted with nail polish.
(IV) Observation under a confocal laser scanning microscope
Adjusting the wavelength of the exciting light of the laser confocalCardiniumThe cytoskeleton and the cell nucleus can be accurately positioned by scanning, as shown in fig. 2, fig. 2a to 2d areCardiniumThe distribution of the brown planthopper in the ovarian duct, spermary, salivary gland and intestinal tract is shown by the arrowCardinium。
Excitation and emission wavelengths used:
Cadinium：Cy5，645～670 nm；
cell nucleus: DAPI, 359-461 nm;
cytoskeleton: FITC 494-518 nm.
Sequence listing
<110> Nanjing university of agriculture
<120> method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atctttccag catgcgct 18
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caatcgcagt tctagcgtta 20
<210> 3
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gcaccttgta ttccgtcc 18
Claims (6)
1. The method for positioning the distribution of the symbiotic bacteria Cardinium in different tissues of the rice planthopper is characterized by comprising the following steps: (1) dissection and separation of rice planthopper tissue: collecting rice planthopper adults, dissecting planthopper tissues under a microscope, and separating the planthopper tissues into a centrifugal tube filled with 1 multiplied by PBS (phosphate buffer solution); the rice planthopper is a sogatella furcifera or a brown planthopper; the tissue is one or more of salivary gland, ovary, testis and intestinal tract; (2) design of oligonucleotide probes: designing three sections of specific oligonucleotide probes with fluorescent labels according to the 16S rRNA sequence of Cardinium; the three sections of fluorescently-labeled oligonucleotide probes with specificity are nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, and the 5' ends of the oligonucleotide probe sequences are labeled with Cy5 in the SEQ ID NO. 1-3; (3) Hybridization of the oligonucleotide probe to Cardinium in the Rice planthopper tissue: fixing the tissue dissected in the step (1) by using 4% paraformaldehyde, cleaning, putting the tissue into a hybridization solution overnight, wherein the hybridization solution comprises the oligonucleotide probe, staining cytoskeleton and cell nucleus by using phalloidin and DAPI respectively after cleaning, and sealing the tissue by using an anti-fluorescence quencher after cleaning again; (4) observation under a laser confocal microscope: the excitation wavelength and the emission wavelength of the laser confocal microscope are adjusted, and the Cardinium, the cytoskeleton and the cell nucleus are scanned respectively, so that the distribution of the symbiotic bacteria Cardinium in different tissues of the rice planthopper can be accurately positioned.
2. The method for mapping the distribution of the symbiotic bacteria Cardinium in different tissues of rice planthopper according to claim 1, wherein in the step (3), the hybridization of the oligonucleotide probe and the Cardinium in the tissues of rice planthopper comprises the following steps: (1) 4% paraformaldehyde fixation: cleaning the dissected tissue with 1 × PBS for 2 times, removing residual liquid, adding 1ml of 4% paraformaldehyde tissue, fixing for 30min, removing paraformaldehyde, and cleaning with 1 × PBS for 2-3 times; (2) nucleic acid hybridization overnight in dark: adding three sections of specific oligonucleotide probes into the prepared nucleic acid hybridization solution, adding the oligonucleotide probes into a centrifuge tube with tissues, wherein the hybridization solution is just needed to be immersed in the tissues, and the operation process needs to be protected from light and be dark overnight in a water bath kettle at 46 ℃; (3) washing the hybridization solution: washing off hybridization solution, respectively washing 2 XSSC containing 0.015% DTT, 1 XSSC containing 0.015% DTT and 0.5 XSSC containing 0.015% DTT for 1 time, and washing with PBS for 1 time to place the tissue at the bottom of a centrifuge tube; (4) staining cytoskeleton: diluting phalloidin by 1 XPBS for 200 times, adding 700ml of diluent into a centrifuge tube for dyeing for 1 hour, then washing for 3 times by 1 XPBS, and operating in a dark place; (5) staining nuclei: adding DAPI into the centrifuge tube, placing the centrifuge tube in the dark for 1 hour after the liquid submerges the tissue, washing the centrifuge tube for 3 times by using 1 XPBS, and operating in the dark; (6) sealing the anti-fluorescence quenching agent: the tissue was placed on a slide, the position adjusted, and an anti-fluorescence quencher seal was added.
3. The method for locating the distribution of the symbiotic bacteria Cardinium in different tissues of rice planthopper as claimed in claim 2, wherein in (2), the method for preparing the hybridization solution adopts the following formula: the nucleic acid hybridization solution was formulated in 50% deionized formamide 5ml5 XSSC 3ml200mg/ml dextran sulfate 2.5g250ug/ml salmon sperm DNA0.003g dithiothreitol 0.1mol/l0.154g0.5 XDenhardt's solution5ml250ug/ml poly (A) 0.003g.
4. The method for mapping distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper as claimed in claim 2, wherein in (2), dilution ratio of probe to hybridization solution is 1:50 to 200.
5. The method for locating the distribution of the symbiotic bacteria Cardinium in different tissues of rice planthopper as claimed in claim 2, wherein the dilution ratio of the probe to the hybridization solution in (2) is 1:100.
6. the method for localizing the distribution of the symbiotic bacteria Cardinium in the different tissues of rice planthoppers as claimed in claim 1, characterized in that in said step (4) the excitation wavelengths and emission wavelengths are: cadinium: cy5, 645-670 nm; cell nucleus: DAPI, 359-461 nm; cytoskeleton: FITC 494-518 nm.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910582506.0A CN110241179B (en) | 2019-06-28 | 2019-06-28 | Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910582506.0A CN110241179B (en) | 2019-06-28 | 2019-06-28 | Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110241179A CN110241179A (en) | 2019-09-17 |
| CN110241179B true CN110241179B (en) | 2023-04-11 |
Family
ID=67890498
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910582506.0A Active CN110241179B (en) | 2019-06-28 | 2019-06-28 | Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110241179B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254536A (en) * | 2017-07-10 | 2017-10-17 | 青岛农业大学 | A kind of quick detection Q Bemisia tabacis parachorium bacterium Cardinium primer and method |
| CN108179202A (en) * | 2017-12-06 | 2018-06-19 | 中国农业科学院棉花研究所 | A kind of fluorescence in-situ hybridization method of insect ovary endosymbiosis bacterium |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL106273A0 (en) * | 1992-07-17 | 1993-11-15 | Res Dev Foundation | Rapid detection of biopolymers in stained specimens |
| CN102559909A (en) * | 2012-02-15 | 2012-07-11 | 四川农业大学 | Fluorescence in-situ hybridization method for Rubus metaphase chromosomes |
| CN106148353B (en) * | 2015-04-13 | 2018-02-23 | 武汉大学 | Rice brown planthopper resistant gene Bph6 and closely linked molecular marker thereof |
| CN107541553B (en) * | 2017-09-08 | 2021-06-04 | 河南省农业科学院芝麻研究中心 | BAC markers for distinguishing sesame 13 pairs of chromosomes |
-
2019
- 2019-06-28 CN CN201910582506.0A patent/CN110241179B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107254536A (en) * | 2017-07-10 | 2017-10-17 | 青岛农业大学 | A kind of quick detection Q Bemisia tabacis parachorium bacterium Cardinium primer and method |
| CN108179202A (en) * | 2017-12-06 | 2018-06-19 | 中国农业科学院棉花研究所 | A kind of fluorescence in-situ hybridization method of insect ovary endosymbiosis bacterium |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110241179A (en) | 2019-09-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| O'Neill et al. | In vitro cultivation of Wolbachia pipientis in an Aedes albopictus cell line | |
| Pšenička et al. | Isolation and transplantation of sturgeon early-stage germ cells | |
| Jowett | Double in situ hybridization techniques in zebrafish | |
| Kliot et al. | Fluorescence in situ hybridizations (FISH) for the localization of viruses and endosymbiotic bacteria in plant and insect tissues | |
| US20130203055A1 (en) | Methods and kits for in situ detection of nucleotide sequences | |
| US10400275B2 (en) | Methods and kits for room temperature in situ detection of a target nucleic acid in a biological sample | |
| CA2789454A1 (en) | Method for acquiring genetically identical gamete from lethal fish haploid-derived germ cell via germ line chimera | |
| CN111909994B (en) | Application of CCDC157 gene and mutant gene thereof as molecular marker in diagnosis of male infertility diseases | |
| JPH02501442A (en) | Diagnosis of human papilloma types using nucleotide probes | |
| Wilke et al. | Preservation of Giardia cysts in stool samples for subsequent PCR analysis | |
| Barbosa-Solomieu et al. | Diagnosis of Ostreid herpesvirus 1 in fixed paraffin-embedded archival samples using PCR and in situ hybridisation | |
| Levin et al. | Three-dimensional imaging reveals that positions of cyst nematode feeding sites relative to xylem vessels differ between susceptible and resistant wheat | |
| WO2023284820A1 (en) | Use of tissue transparent method and histological method in combination for detecting bacteria in tumor | |
| CN110241179B (en) | Method for positioning distribution of symbiotic bacteria Cardinium in different tissues of rice planthopper | |
| CN114716540A (en) | Canine parvovirus monoclonal antibody and application thereof | |
| Pilgrim et al. | Tissue tropisms and transstadial transmission of a Rickettsia endosymbiont in the highland midge, Culicoides impunctatus (Diptera: Ceratopogonidae) | |
| Magajevski et al. | Detection of Leptospira spp. in the semen and urine of bulls serologically reactive to Leptospira interrogans serovar hardjo | |
| CN110283849B (en) | Method for obtaining novel brown planthopper strain stably infected with Cardinium through artificial transfection | |
| Solari | Structural analysis of meiotic chromosomes and synaptonemal complexes in higher vertebrates | |
| Doremus et al. | Quality over quantity: unraveling the contributions to cytoplasmic incompatibility caused by two coinfecting Cardinium symbionts | |
| Ali et al. | First report on the isolation of Chlamydia abortus from female dromedary camels with ovarian hydrobursitis | |
| Jeurissen et al. | Immunocytochemical techniques to investigate the pathogenesis of infectious micro-organisms and the concurrent immune response of the host | |
| Regenass et al. | Analysis of the Drosophila maternal effect mutant mat (3) 1 by pole cell transplantation experiments | |
| Ammar et al. | Assembly and accumulation sites of Maize mosaic virus (Rhabdoviridae) in plant host and insect vector using transmission electron and confocal laser scanning microscopy | |
| CN117887820B (en) | Method for simultaneously detecting human RNA, DNA and protein by in-situ fluorescence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |