CN109055598B

CN109055598B - Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof

Info

Publication number: CN109055598B
Application number: CN201811140942.4A
Authority: CN
Inventors: 杨远柱; 邓钊; 何光存; 郭建平; 王凯; 秦鹏; 符辰建; 刘开雨
Original assignee: Hunan Ava Seeds Co ltd; Hunan Longping Gaoke Seed Science Research Institute Co ltd; Yuan Longping High Tech Agriculture Co ltd
Current assignee: Hunan Ava Seeds Co ltd; Hunan Longping Gaoke Seed Science Research Institute Co ltd; Yuan Longping High Tech Agriculture Co ltd
Priority date: 2018-09-28
Filing date: 2018-09-28
Publication date: 2021-11-02
Anticipated expiration: 2038-09-28
Also published as: CN109055598A

Abstract

The invention provides a rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof, wherein the molecular marker comprises a nucleotide sequence with polymorphism T/C at position 188 shown in SEQ ID NO.1, and/or a nucleotide sequence with polymorphism 5 '-CGAAACAC-3'/5 '-TGCAGGG-3' at positions 4438-4445 shown in SEQ ID NO. 1. Specific amplification primers are designed aiming at the molecular markers, and the detection of the BPH6 genotype is carried out by utilizing PCR amplification. The molecular marker of BPH6 and the amplification primer thereof provided by the invention can be used for identifying the genotype of rice BPH6 and breeding brown planthopper-resistant rice resources, have the advantages of high identification accuracy, simple operation, low cost and the like, can shorten the breeding period of brown planthopper-resistant rice, and reduce the breeding cost.

Description

Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof

Technical Field

The invention relates to the fields of molecular biology and plant molecular breeding, in particular to a co-dominant molecular marker of a brown planthopper resistant gene BPH6 of rice and application thereof.

Background

Brown planthopper (BPH for short) belongs to homoptera planthopper family insects, and is a main pest of rice. The brown planthopper sucks the rice vascular bundle sheath juice through a needle-shaped mouth device, so that the rice plants become yellow, lodging and even withering. When the brown planthopper takes the rice, the brown planthopper spreads the rice straw-like bushy stunt and the odontoblast stunt, and simultaneously promotes the spread of rice sheath blight and sclerotinia scleotiorum. With the popularization of high-yield insect-resistant rice varieties and the change of rice planting modes and cultivation systems, brown planthoppers are increased frequently, the damage degree is increased, the brown planthoppers become the first insect pests in rice production in China and the world, and the serious threat to the grain production safety is caused. Practice shows that the breeding and popularization of rice varieties with insect resistance are the most economical and effective methods for controlling brown planthopper.

The traditional rice insect-resistant breeding method is characterized in that phenotype selection is carried out on plants through insect-resistant character identification, time and labor are wasted, the plants are easily influenced and limited by environmental conditions, errors are easily caused in identification results, and the selection efficiency is low. Molecular marker assisted selection is a modern breeding technology which utilizes a functional marker closely linked with a resistance gene or in the gene and combines genotype and phenotype selection to screen target traits in later generations. The method can greatly improve the breeding efficiency, shorten the breeding period and save a large amount of labor and material cost. The brown planthopper resistance gene BPH6 is derived from rice variety Swarnalata, has good resistance to various biotypes of brown planthoppers, and the gene sequence of the gene is applied for a patent at present (CN 106148353A). In the prior art, molecular markers of the brown planthopper resistance gene BPH6 are all linked markers, and the development of specific markers in the BPH6 gene has important significance for accurate identification of the gene and insect resistance and further improvement of brown planthopper resistance of rice.

Disclosure of Invention

In order to solve the problems in the prior art, the invention aims to provide a rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof.

The rice brown planthopper resistant gene BPH6 is located on the long arm of the rice No.4 chromosome, and a partial nucleotide sequence of the gene is shown as SEQ ID NO. 1. Through amplification, sequencing and sequence comparison analysis of a BPH6 coding region of a large number of known rice varieties respectively containing BPH6 insect-resistant alleles and insect-susceptible alleles, the inventor finds that an SNP locus (corresponding to the position 21397054 of a Nipponbare chromosome) exists at 188bp of a nucleotide sequence shown as SEQ ID No.1 in the BPH6 gene, wherein the allele of BPH6 anti-brown planthopper is T, and the allele of BPH6 susceptible to brown planthopper is C. In addition, a specific sequence (corresponding to the position of a Nipponbare chromosome of rice 21400441-21400448) exists in 4438 bp-4445 bp of a nucleotide sequence shown as SEQ ID NO.1 in the BPH6 gene, wherein the allelic nucleotide sequence of BPH6 for resisting brown planthopper is 5 '-CGAAACAC-3', and the allelic nucleotide sequence corresponding to brown planthopper susceptibility is 5 '-TGCAGGGG-3'.

The invention develops a molecular marker for efficiently and accurately identifying the BPH6 genotype aiming at the specific nucleotide sequences in the two BPH6 genes.

The invention provides a molecular marker of a brown planthopper resistant gene BPH6 of rice, which comprises a nucleotide sequence with polymorphism T/C at position 188 shown in SEQ ID NO.1 and/or a nucleotide sequence with polymorphism 5 '-CGAAACAC-3'/5 '-TGCAGGG-3' at positions 4438-4445 shown in SEQ ID NO. 1.

Further, the present invention provides a primer for amplifying the molecular marker.

Preferably, the nucleotide sequence of the primer is as follows:

SEQ ID NO.2:AGGGCCTCTGGCGCTCTAC；

SEQ ID NO.3:AATGTGAAAGTGCAATTAGAAGGT；

SEQ ID NO.4:ATAGTGAAGTTGAATCCGAAGG；

SEQ ID NO.5:AGTGACTCAGCCTTGTGTTTCG。

in addition, the invention also provides a detection kit for the brown planthopper resistance gene BPH6 of rice, which comprises the amplification primer disclosed by the invention.

Furthermore, the invention also provides application of the molecular marker or the amplification primer or the kit in identifying the genotype of the rice brown planthopper resistant gene BPH6, the rice brown planthopper resistant character or in molecular breeding of rice brown planthopper resistant varieties.

Specifically, the application comprises the following steps:

(1) extracting the genome DNA of the rice to be detected;

(2) carrying out PCR amplification by using the genomic DNA obtained in the step (1) as a template and adopting the amplification primer of the invention;

(3) judging the genotype of BPH6 according to the sequence characteristics of the amplified product;

(4) judging the brown planthopper resistant phenotype of the rice according to the genotype of BPH 6: the 188 th site shown as SEQ ID NO.1 is T, the phenotype of the brown planthopper resistance is shown, and the 188 th site shown as SEQ ID NO.1 is C, the phenotype of the brown planthopper susceptibility is shown; the nucleotide sequence of 4438-4445 shown as SEQ ID NO.1 is 5 '-CGAAACAC-3', and is of a brown planthopper resistant phenotype; the nucleotide sequence of 4438-4445 shown in SEQ ID NO.1 is 5 '-TGCAGGGG-3', and is a brown planthopper susceptible phenotype.

Preferably, the genotype of the BPH6 is judged according to the type of an amplification product band detected by electrophoresis.

More preferably, the criteria for determining the genotype of BPH6 are as follows: if the amplification product is a 283bp strip, the rice to be detected carries BPH6 brown planthopper resistant allele; if the amplification product is a 361bp strip, the rice to be detected carries BPH6 brown planthopper susceptible allele; if the amplification product is of two band types of 283bp and 361bp, the rice to be detected is rice with a heterozygote type of BPH6 brown planthopper resistant allele and brown planthopper susceptible allele.

Specifically, the PCR reaction conditions and the system of the molecular marker, the amplification primer or the kit of the BPH6 gene provided by the invention when used for identifying the genotype of the rice anti-brown planthopper gene BPH6, the rice anti-brown planthopper character or molecular breeding of rice anti-brown planthopper varieties are as follows:

the PCR reaction conditions are as follows: pre-denaturation at 94-98 ℃ for 3-10 minutes; denaturation at 94-98 ℃ for 10-30 seconds, annealing at 52-60 ℃ for 10-30 seconds, and extension at 72 ℃ for 30-60 seconds for 25-35 cycles; extending for 3-10 minutes at 72 ℃.

PCR reaction (10. mu.L): is recorded as: 10 XPCR reaction buffer 1 uL, 10mM dNTP0.8 uL, 4 primers (10 uM) are all 0.15 uL, 0.1 uL Taq DNA polymerase; mu.L of DNA template, double distilled water to make up the balance.

The invention has the beneficial effects that:

(1) the existing molecular markers of the BPH6 gene are all linked markers, and the probability of separation exchange or false negative of detection in filial generation is high, thereby influencing the accuracy of detection. The co-dominant molecular marker in the BPH6 gene developed by the invention can eliminate the influence of false negative, can accurately identify the homozygous or heterozygous genotype of the BPH6 gene, and realizes the high-efficiency screening of brown planthopper resistant rice resources;

(2) the amplification products of the molecular markers provided by the invention have larger size difference of different strips, the genotype of the rice material to be detected can be judged by agarose gel electrophoresis, the cost is low, enzyme digestion is not needed, and the detection procedure is convenient and quick;

(3) when the molecular marker provided by the invention is used for auxiliary breeding, accurate, simple and efficient detection of the progeny BPH6 genotype can be realized, and non-destructive detection of early rice growth can be realized, so that the molecular marker is suitable for large-scale screening of the BPH6 genotype and identification of the BPH6 allele in rice germplasm resources in commercial large-scale breeding.

Drawings

FIG. 1 is an alignment chart of the sequence of the coding region of the BPH6 gene of a known rice variety containing the insect-resistant or insect-susceptible BPH6 allele. Wherein, A is a nucleotide sequence with polymorphism T/C at 188 th site shown as SEQ ID NO.1, B is a nucleotide sequence with polymorphism 5 '-CGAAACAC-3'/5 '-TGCAGGGG-3' at 4438 th site to 4445 th site shown as SEQ ID NO.1, Luoyang6 is a rice variety known to contain BPH6 insect-resistant allele, and 9311, Nipponbare, DJ123, Huazhan and IR64 are rice varieties known to contain BPH6 insect-sensitive allele.

FIG. 2 is the electrophoresis chart of the detection of common parents for rice breeding in example 4, M: DL1000 DNA marker, wherein lanes 1-32 correspond to Loyan No. 6, 9311, F1, Huazhan, Yuzhenxiang, 638S, R1206, R608, CO2, R900, Fengyangzhan, Huahui 284, Chenghui 19, Huarun No.2, Hu 3728, Mf63, Hujing 5, 02428, Hujing 6, Yanjing 5507, HONGJING 35, Yujing 0618, Huizjing 602, Zhendao 819, Liaosalina 287, Jiangsu japonica 2, salina 1531, farmer rice 31, Fukunsiski, Zhejiang japonica 75, Gaoyou No.1 and Wanlianyou 385 in sequence.

Fig. 3 is an electrophoretogram detected for the F2 population in example 5, M: DL1000 DNA marker, lanes P1 and P2 are insect-resistant parent Lopa 6 and insect-susceptible parent 9311, lanes 1-25 are single plants of F2 group constructed by Lopa 6/9311, the genotype of each material is marked above the corresponding lane, S represents the type of insect-susceptible allele, R represents the type of insect-resistant allele, and H represents the heterozygous type.

FIG. 4 is the result of identifying the insect-resistant phenotype of part of the strain F2:3 in example 5, wherein R represents an insect-resistant phenotype and S represents a susceptible phenotype; the insect-resistant control Populus deltoides No. 6 and the insect-susceptible control 9311 are 3 repeats, B6-1-B6-7 represent 7F 2:3 strains, and each F2:3 strain is two repeats.

Detailed Description

Preferred embodiments of the present invention will be described in detail with reference to the following examples. It is to be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the present invention. Various modifications and alterations of this invention will become apparent to those skilled in the art without departing from the spirit and scope of this invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified; the rice material used is a material which can be obtained from commercial approaches or national germplasm banks or widely popularized and used by the technicians in the field.

Example 1 development of Co-dominant molecular marker of BPH6 Gene

The rice BPH6 gene is located on the long arm of the rice chromosome 4, the amplification and sequencing of a BPH6 coding region and upstream and downstream sequences of a plurality of known insect-resistant and susceptible rice varieties such as Lopula japonica 6(BPH6 introduction line), Huazhan, IR64 and the like are carried out, and sequence comparison analysis is carried out by adopting sequence analysis tools such as DNMAN software, NCBI database and the like, so that an SNP locus exists at 188bp of a nucleotide sequence shown as SEQ ID No.1 in the BPH6 gene, wherein the insect-resistant allele of BPH6 is T, and the corresponding insect-susceptible allele is C (shown as A in figure 1). In addition, a specific coding sequence exists in 4438 bp-4445 bp of a nucleotide sequence shown as SEQ ID NO.1 in the BPH6 gene, wherein the BPH6 insect-resistant allele nucleotide sequence is 5 '-CGAAACAC-3', and the corresponding susceptible allele nucleotide sequence is 5 '-TGCAGGGG-3' (shown as B in FIG. 1). The identification of the BPH6 allele can be realized by developing molecular markers aiming at specific nucleotide sequences in the two BPH6 genes.

Example 2 detection primer design for co-dominant molecular marker of BPH6 Gene

Detection primers were designed for the two BPH6 gene-specific molecular markers developed in example 1, and the principle of primer design was as follows.

Firstly, designing a specific primer for amplifying insect-resistant alleles, designing a reverse primer B6-RR at the 3 ' end of the primer by using a complementary sequence 5 ' -GTGTGTTTCG-3 ' of a BPH6 insect-resistant allele specific sequence 5 ' -CGAAACAC-3 ', and designing a forward primer B6-RF matched with the reverse primer at the upstream of the reverse primer, wherein the primers RR and RF can only specifically amplify BPH6 resistant alleles to generate a 283bp strip, and the BPH6 susceptible alleles have no strip during amplification;

then, a specific primer for amplifying the susceptible allele is designed, a C base which is specific to the susceptible allele in SNP at 188 bits of a gene coding region is taken as the 3 'end of the primer, a mismatched base is introduced into the second base at the 3' end of the primer to design a forward primer B6-SF, a reverse primer B6-SR which is matched with the forward primer is designed at the downstream of the forward primer, the SF and the SR can only specifically amplify the susceptible allele to obtain a 361bp band, and no band exists when the insect-resistant allele is amplified.

The specific primer sequence is shown in table 1, four primers are mixed to form a co-dominant molecular marker detection primer group of BPH6, and when an amplification product is only 283bp, the rice to be detected carries BPH6 insect-resistant allele which is insect-resistant phenotype; when the amplification product is only 361bp, the rice to be detected carries BPH6 insect-sensitive allele, and the phenotype of the insect is the insect-sensitive phenotype; when the amplified product has two banding patterns of 283bp and 361bp, the rice to be detected is BPH6 insect-resistant and insect-susceptible heterozygous genotype rice and shows an insect-resistant phenotype.

TABLE 1 BPH6 specific molecular marker primer sequences and related parameters

Example 3 establishment of specific molecular marker detection method for brown planthopper resistance gene BPH6 in rice

According to the detection primers of two pairs of molecular markers of BPH6 designed in example 2, a reaction program and a reaction system of PCR are designed, and the following reaction program and system are determined through continuous optimization:

The PCR reaction conditions are as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 seconds, annealing at 58 ℃ for 30 seconds, and extension at 72 ℃ for 45 seconds for 35 cycles; extension at 72 ℃ for 8 minutes.

Example 4 application of BPH6 specific molecular marker in detection of rice insect-resistant and insect-susceptible varieties

(1) Biological material

BPH6 donor material Lopa 6, insect-sensitive contrast material 9311 and F1 obtained from Lopa 6 hybrid 9311, and 29 breeding parent materials or commercial rice varieties are selected, and the method specifically comprises the following steps: huazhan, Yuzhenxiang, 638S, R1206, R608, CO2, R900, Fengyuazhan, Huahui 284, Chenghui 19, Huarun No.2, hui 3728, Mf63, Hujing 5, 02428, Hujing 6, Yanjing 5507, hot jing 35, Yujing 0618, Hujing 602, Zhendao 819, Liaojing 287, Jiangsu jing 2, Yandao 1531, farming 31, Fukuniski, Zhejiang jing 75, Hanliangyou No.1 and Shuliangyou385.

(2) Extraction of rice genome DNA and primer synthesis

Extracting the genome DNA of the rice material by adopting a CTAB method and synthesizing a primer sequence shown in a table 1, wherein the primer sequence specifically comprises the following steps:

B6-SF:AGGGCCTCTGGCGCTCTAC；

B6-SR:AATGTGAAAGTGCAATTAGAAGGT；

B6-RF:ATAGTGAAGTTGAATCCGAAGG；

B6-RR:AGTGACTCAGCCTTGTGTTTCG。

(3) PCR detection

The reaction system and reaction procedure for PCR are as described in example 3. The amplification products were electrophoresed in 2% agarose gel and the results were recorded by scanning with a gel imager.

(4) Analysis of results

The electrophoresis result of the PCR amplification product is shown in FIG. 2, a 283bp band is specifically amplified from the donor Lopa 6 material in lane 1 BPH6, a 361bp band is amplified from the insect-sensitive control material 9311 in lane 2, two 283bp and 361bp bands are amplified from the material in lane 3F 1, and a 361bp band which is consistent with the insect-sensitive control material 9311 is amplified from the parent material corresponding to lanes 4-32. In order to verify the accuracy of the PCR detection result, sequencing comparison is carried out on the molecular marker target regions corresponding to 6, 9311 and 29 parent materials. The result shows that the molecular marker detection result is consistent with the sequencing result, and the primer provided by the invention can accurately identify the genotype of the brown planthopper resistant gene BPH6 and can realize accurate and efficient screening of rice variety resources.

Example 5 detection of monogenic isolation of the Brown planthopper resistance Gene of Rice BPH6 in the F2 population and phenotypic correlation analysis

(1) Biological material

The insect-resistant parent Looyang No. 6 and insect-susceptible parent 9311, and 96 randomly selected F2 single plants in an F2 population constructed by two parent hybrids.

(2) Extraction and PCR detection of rice genome DNA

The primers, reaction procedures and system for the extraction of genomic DNA from rice and the detection by PCR were as described in example 4.

(3) F2:3 group part strain seedling stage insect-resistant identification

The method comprises the steps of developing an F2:3 population by using 96 selected F2 single strains, carrying out seedling stage insect resistance identification on 20 strains by adopting a standard seedling stage group method, wherein the BPH6 genotype of 10 strains is A (the 188 th position of a nucleotide sequence shown by SEQ ID NO.1 is T, the 4438 th to 4445 th positions are 5 '-CGAAACAC-3'), the BPH6 genotype of 10 strains is B (the 188 th position of the nucleotide sequence shown by SEQ ID NO.1 is C, the polymorphism of the 4438 th to 4445 th positions is 5 '-TGCAGGG-3'), and using an insect-resistant parent Populus deltoides 6 as an insect-resistant control and an insect-susceptible parent 9311 as an insect-sensitive control.

(4) Analysis of results

The electrophoresis results of the PCR amplification products of the insect-resistant parent Lopa 6 and the insect-susceptible parent 9311 and part of the F2 strains are shown in FIG. 3, lanes P1 and P2 are the insect-resistant parent Lopa 6 and the insect-susceptible parent 9311 respectively, lanes 1-25 are the randomly selected part of the F2 strains constructed by using the two parents, the genotypes of all the materials are marked below the corresponding lanes, S represents the type of the insect-susceptible allele, R represents the type of the insect-resistant allele, and H represents the heterozygous type. The results showed that 96F 2 lines were tested, the segregation ratio of 3 different genotypes was 23SS:49H:25RR, and the Chi-square test showed a Mendelian single-gene segregation ratio (χ) of 1:2:1²＝0.125＜χ² _0.055.99), the marker is a co-dominant marker, two different homozygote and heterozygote genotypes can be distinguished, and the detection sites show single gene segregation at the same time.

And (3) carrying out standard seedling-stage insect resistance identification on 20F 2:3 strains, wherein the resistance results and the corresponding genotype results are shown in Table 2, wherein R represents insect resistance, and S represents susceptible insects. The phenotype identification of part of the strain is shown in figure 4, wherein the resistance control populus deltoids No. 6 and the susceptible control 9311 in figure 4 are 3 repeats, each F2:3 strain is two repeats, each repeat is 16 strains, the mark R represents the resistance of the strain, and the mark S represents the susceptible. The result shows that the molecular marker can effectively screen rice plants containing BPH6 gene and having brown planthopper resistance phenotype, thereby accelerating the breeding of brown planthopper resistance of rice.

TABLE 2F 2 identification results of 3 lines of lines at seedling stage against brown planthopper

The BPH6 codominant molecular marker and the detection primer thereof provided by the invention can realize the efficient and accurate identification of the genotype of the brown planthopper resistant gene BPH6, can be used for screening and identifying rice resources, and can also be used for molecular genetic breeding of the brown planthopper resistant gene BPH6 of rice.

Although the invention has been described in detail above with reference to a general description and specific embodiments, it will be apparent to those skilled in the art that modifications or improvements may be made on the basis of the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> science research institute of species science research institute of south China, Hunan Longping high science and technology, Inc. of YuanLongping agricultural high science and technology, Inc. Hunan Longping high science and technology, Inc

<120> brown planthopper resistant gene BPH6 codominant molecular marker of rice and application thereof

<130> KHP181115157.0

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5777

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aacatccgtc tcgtgctcgc gctcgcgcag aagcccatct atccaagcat tccaattgct 60

gctgcttcca tcggtcggcc agaattgctg catgctgttg tcttaagtta tttggagcat 120

tcttcagttc gtctatctag cctgacttca tacttgcttc acctggctca gggcctctgg 180

cgctctgttc tatatatata ctcaggtacg tattagtaat aactaattat atttcttgta 240

acaatgcatc aacttaatta atttgcgtct cgctcgatca gtgttactta gtttatttgt 300

tcatcgatct ttgaaaaaaa gaagaagcag ttctactgat tatatatcaa aacatcaatt 360

gattatatat ggttgatgta attgttgtgt atatgtgtgt aggtggcgag tggaattgat 420

cggttgatac aatctgatac gatgggttag attaattgat tttctgacga ttctcctctt 480

cctgatcacc atgattaaat atgtacacct tctaattgca ctttcacatt ctcgaattat 540

ataagcatgt ctatttctgt gtttatttcc ttttatttga tcaattgatt tgagacgttg 600

atggcttaac gtgcgcacat aacatcaata ttagtcgtcc aaattcacga tatatttaag 660

tgtataaaag ctggaatata tcttggcttg gggagggggc ttattagcgc cagtgtgaaa 720

tggtttagct agcatatgaa tggcacataa ttgcttatct acatgaatcc agttttttct 780

tagtgaaata catggccagg ggtggtgtca cttatattca tgaactttaa aaatagcacg 840

tttagatccg taaacttggt ttaatatact acccccgatc caatcatctt ttgaccacta 900

acgtggcatg tcacgtaggc aacactcttg tgctcagtcc cctccacata tatcttcgca 960

cataacttgc cctgaccagt tcatttcaac ccatccccaa aaatatccct aaatcggcta 1020

gggcttcgac ggtgaggtta gcggaaggag gccgagaggt agcggctatg gcggcctcgg 1080

cggtgatatt agcggcagga ggcagcgctg tgtagcgggg ttagcggtgg cacagtgcgg 1140

ccggattagc tacgggagtc agcgcaatgg caattgctaa tcgggaccgc attttctata 1200

catacaagga gaagagtgag agggaagaac gatttgagga tttttttttt tgggtgggat 1260

tctagtgtct caatatagct aaaaggagat atatgcgatg tgttgtgatg tggagggggc 1320

tgagagcaaa tgtattgtct acgtggtcaa acacagtcaa aggatgttta gaccggggtg 1380

gtacgttaaa cgaagttcac agacttaaac gtgcaatttt caaattcaca tatctaagtg 1440

acaccaccac acaaatttag tgaccggcca tgtattttac tcttttttaa aaaaaactaa 1500

aagtcagctt agagcgtgcc tgcactacca ccaactcctt tcagttacta gtactagtag 1560

gactgcgcag ccttgtagtc taacggaccc aaaacttgtt ttgttaatta aaaaaaaaga 1620

tcttatttgt acactacact tatgttgcct cttcaagcta attttatcag taaccattta 1680

ttactcgttc tatccatttt tattttttta aagcacacat ctcattaatc cttcaaagcc 1740

acttgtaaat tctaaaattc atttggccgt aaccagtagt tgtttcatct gatccggaag 1800

atttcagatg ttaaacacca gccacagcca gcacacacta gtagctggta gcctcgcaga 1860

tgcacatcga ctaatttgtt gctccatata tatacatgta tacactagat cagggtatgc 1920

atttcgtatg ctttactttc tttaatcgat tgatccaaca ccagaattaa taaggtggcc 1980

tctcactttt ttcttaactg cttactccac cacaggggtt cgatggtcga gacgtcgctg 2040

gcgctagaaa tgacatactc tggtatctcc gatacagggc tgattataaa gtcatctatt 2100

ttgatggctg gtatggattt ggggcctccg cagtgcttcg atcggtagca caagtgcttc 2160

ggtcagagaa agctagtcca gaactaagct tcgacaggat aatttacata gattgctcat 2220

gctggaaaag tagaagggca atgcagagaa agattgcaga ggaactaaaa cttgacagtg 2280

aaacaatggc cctatttgat aagaaggatg aggatgatga cttccgtgga ccggaccaag 2340

gctctaggga cgtgatacac agtgtttcag caaccattta taaaaccttg atgggatcaa 2400

gattcataat catctttctt aatggaagtg atgacgagat ggatatgcca cgctttggca 2460

ttccaacctt tcaagaatat gacaacaata aaatgatatg gacattcagt agaaggttcc 2520

ccactgtgaa tagagaatac tcagatataa aagacaaact acgacacacc cacctttcca 2580

gtatattcaa caatggaggc aacgaattat caagttcaga gttttgtgca ctgctgcgcg 2640

aggaggctga taccataatt tctcgccatc catccatgac aggctttgac acagcaatgg 2700

ccatgaactg ttgcctgtat gagttatttc tgcgatataa tttccacaca gctactaaat 2760

ttggttgggt ttctcatgct tccaactact ggttatgtga tggaattata caagagaaca 2820

tagcaaaaag tattagcagt gcactacagc aagagataag atgggactgt gatgattctt 2880

cccttgacac tgcccttgaa gagttcatga aagagccccc ctttatggtt gttaaagatg 2940

acaatgtata tggagctggg caatatcact ggatttcaat cacatccaaa gatacagaag 3000

ttagcagcat gcagtctata cctgcagtga catcctcctt cttcctgaca tttgaaacag 3060

cggatgattc aaaaccaaaa gctttaccag ccagcatttt tagacattcc agcaacctta 3120

gagtgctagt tctctgctat tgtggctttg attttgcatc tcctcctttc ctcatatgcc 3180

atggcctaaa attccttgga ttggaccatt gtactaatga tagtacatgc gaaagggatc 3240

aacatgtgga ttggacagct ttatctagtc tatatgtgct ggatctacgt tacacagagt 3300

gggatgagat cacttctcaa gaaaaaatag cactcatgta taaccttcaa gagctaaaca 3360

tagtgggatt cagatgctgg caacactatg caaggagact acaaggacag ctaccttgcc 3420

tccgtaggct ccgagtggtc aaacctacgg atcaggcaga tatatcaaca gacattgcca 3480

actcctttgt ggagaagaca caactagaaa tacttgatct ctctggggac actagcatgg 3540

aaactattcc caacagcatg tcaaatgtgg atagcctatt ggtgcttatt gtagatggtt 3600

gtgataggtt gaaaaatgtt attgtgtctg atggtgtttt tccttcactc acatccttca 3660

gttttgatgg ctacggacca acataccatt gggcatcaac agttgagttg cctccaaaag 3720

aaatgcgtcc ttttgtagat aacaagagag atataaaaac ttgtaagatc tctttaaaag 3780

gctgcgcacg attggagaac ctattcttaa ggcagctacc caacctagtg gagctagacc 3840

tctctggaac tgcaataaag atacttgatt ttacaagtat ggtggtggaa gtctcatgtc 3900

tcaagcgact atttctgcta ggatgcaagc aactccatgc aataaaatgg gacaatagtg 3960

gttcaacgat aaagccggac ctagagttgt tgtgcgttga cacaaggtct agaagtaaat 4020

atcctcagtt atttgttgac aagaataaat cccccggttt cttgtcagtc catgctgtta 4080

ttgtggacgc gagaattgct cggtccttat acgctctaat agaaaagacc tcatatcatg 4140

ttgatatgaa tatccatgtc acctcttcga cggtatatag tgaagttgaa tccgaaggaa 4200

cctacagaga tagcattagc caattaaggg atcatgtgaa catgcagcaa caagaccttc 4260

gttcagcagg ccagtaccat gatgtccaac ttagcatggt tggcgatgtc ccaatgcagt 4320

cattccccct tcctccgaca acaatgttga gccgccatat cgagattgca caggggagcc 4380

acaacctgga gagcgagctg gatgatgatt caccgattcc tactttagct catctagcga 4440

aacacaaggc tgagtcactg catgtgcatg atctctcaac catcactcct ttgcccggag 4500

aacaatggcg ctgtctcaag tggtgtcgta tagagaggtg cccgaagata gaaattgtct 4560

tccctagata cgcatggaat ttcgaccgtc tggaaaccgc ctgggtgtcg gatctcttga 4620

tggcccgttg catctggagt aaaggaccta gccagtaccg tggttccttc caaaatctgc 4680

agcacctgca cctgcgcagc tgcccaaggc tccagttcgt gctcccggtg tgggtctcct 4740

ccttcccgga cctgaaaacc ctccacgtca tccactgcag caacctccac aacatcttcg 4800

tgctggagga cggagattac ccagagcaaa taaccgtcaa aggtgtagca ttcccgaagc 4860

taaccaccat ccacctgcac gacctcccga tgctgcggca gatttgcgac gtcgagttca 4920

agatggtggc tcccgcgctt gagaccatca agatcagggg atgctggggc ctgcgccggc 4980

tgccggccgt cgctgcggat ggaccgaagc cggccgtgga gatcgagaag gacgtgtggg 5040

acgcgctgga gtgggacggg gtggaagccg accaccaccc ttccctcttc caggcgccgg 5100

tgcactcgcg ctactacagg aagaagctgc ccaggggctc cgtcctcagg tatatgtacg 5160

gtgcatgcat cggaccatgt acctagctag ctgctccatc ttgatttatt tgcataatac 5220

ttgttctcag ttatttcatt tgtttgatct gtgcttaatc aatttgcttt ctctgtctac 5280

tgttatattt gttgcctagg tgaattgaat ccctgggctt gggcggccat gatttgggga 5340

ttgattggcg acgaatgatg gtgaatcagt gagatgcttc ttgcttgctt ctgttgggtg 5400

atttgtctcc ggtgatgttg cagcaagctt tgtggtgtga gctgtgtgac gggcacggac 5460

tgaccgtggc tcgatcttgt cctcgtatat ggccgagttg gccagagagc gagattgcca 5520

tggctctgaa ataataagcg gctttgtttg tgcgtggatg cacagaccag ctgattgagt 5580

gagtgtgtgt ttcttgaatt taattagcat tctgggtgtg gatgctcaga tgcatgtgcg 5640

tgtgtggctt gatatgatga tctgctttgc gtttgaaaca ataataagca gtagccattt 5700

gtgcctgcga gcatatgtat gtggctgctg cagtgtgact gtgtgagagt gcattgcttg 5760

tgtgtaactg aattctg 5777

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agggcctctg gcgctctac 19

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatgtgaaag tgcaattaga aggt 24

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atagtgaagt tgaatccgaa gg 22

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

agtgactcag ccttgtgttt cg 22

Claims

1. The molecular marker of the brown planthopper resistant gene BPH6 of the rice is characterized in that the sequence of the molecular marker is shown as SEQ ID NO.1, wherein the polymorphism at the 188 th site is T/C, and the polymorphism at the 4438 th site to the 4445 th site is 5 '-CGAAACAC-3'/5 '-TGCAGGGGG-3'.

2. The application of the molecular marker or the amplification primer thereof or the kit containing the amplification primer thereof in identifying the genotype of the brown planthopper resistant gene BPH6 of rice or the brown planthopper resistant character of rice.

3. The molecular marker of claim 1, or the amplification primer thereof, or the kit containing the amplification primer thereof, is used for molecular breeding of brown planthopper resistant varieties of rice.

4. Use according to claim 2 or 3, characterized in that it comprises the following steps:

(1) extracting the genome DNA of the rice to be detected;

(2) performing PCR amplification by using the genomic DNA obtained in the step (1) as a template and adopting amplification primers with sequences shown as SEQ ID NO.2-3 and SEQ ID NO. 4-5;

(4) judging the brown planthopper resistant phenotype of the rice according to the genotype of BPH 6: the 188 th site of the sequence shown as SEQ ID NO.1 is T, and the 4438 th to 4445 th nucleotide sequences shown as SEQ ID NO.1 are 5 '-CGAAACAC-3', so that the sequence is of a brown planthopper resistant phenotype; the 188 th site of the sequence shown as SEQ ID NO.1 is C, and the 4438 th to 4445 th site of the nucleotide sequence shown as SEQ ID NO.1 is 5 '-TGCAGGGG-3', so that the brown planthopper susceptible phenotype is shown.

5. The use of claim 4, wherein the determining the genotype of BPH6 is performed by detecting the type of the amplified product band by electrophoresis.

6. The use according to claim 5, wherein the criteria for determining the genotype of BPH6 are as follows: if the amplification product is a 283bp strip, the rice to be detected carries BPH6 brown planthopper resistant allele; if the amplification product is a 361bp strip, the rice to be detected carries BPH6 brown planthopper susceptible allele; if the amplification product is of two banding patterns of 283bp and 361bp, the rice to be detected is rice with heterozygosis of BPH6 brown planthopper resistant allele and brown planthopper susceptible allele.