CN108893550B - Development and application of SNP molecular marker related to resistance of corn stalk rot - Google Patents

Development and application of SNP molecular marker related to resistance of corn stalk rot Download PDF

Info

Publication number
CN108893550B
CN108893550B CN201810753521.2A CN201810753521A CN108893550B CN 108893550 B CN108893550 B CN 108893550B CN 201810753521 A CN201810753521 A CN 201810753521A CN 108893550 B CN108893550 B CN 108893550B
Authority
CN
China
Prior art keywords
disease
zmcct
corn
resistant
molecular marker
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810753521.2A
Other languages
Chinese (zh)
Other versions
CN108893550A (en
Inventor
赵久然
宋伟
苏爱国
王元东
邢锦丰
王帅帅
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Academy of Agriculture and Forestry Sciences
Original Assignee
Beijing Academy of Agriculture and Forestry Sciences
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Academy of Agriculture and Forestry Sciences filed Critical Beijing Academy of Agriculture and Forestry Sciences
Priority to CN201810753521.2A priority Critical patent/CN108893550B/en
Publication of CN108893550A publication Critical patent/CN108893550A/en
Application granted granted Critical
Publication of CN108893550B publication Critical patent/CN108893550B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/13—Plant traits

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides development and application of SNP molecular markers related to corn stalk rot disease-resistant genes. The invention carries out difference comparison analysis on DNA sequences of the corn fusarium stalk rot disease-resistant gene ZmCCT in a plurality of disease-resistant and disease-susceptible corn inbred lines, finds that a stable SNP locus exists among the anti-susceptible materials of the coding region of the gene, the polymorphism of the SNP locus is A/G, and the SNP molecular marker can be detected by primers shown in SEQ ID NO.1-3 through a KASP platform. The SNP molecular marker can be used for detecting the corn fusarium graminearum stem rot disease-resistant gene ZmCCT, identifying whether the corn to be detected has fusarium graminearum stem rot related genes, carrying out molecular marker assisted breeding and having good application prospect in the technical field of corn germplasm resource improvement and breeding.

Description

Development and application of SNP molecular marker related to resistance of corn stalk rot
Technical Field
The invention relates to the technical field of crop molecular marker assisted breeding, in particular to development and application of a corn ZmCCT gene and a corn fusarium graminearum stem rot resistance related SNP molecular marker.
Background
Corn stalk rot is a devastating soil-borne disease that occurs in major corn-growing areas of the world. From 1980, the disease occurs in each corn producing area in China in succession, the annual incidence rate is 10-20% in general, and the individual year and area can reach more than 50%; the yield is reduced by 25-30% generally, and even the crop is not harvested in severe cases. Stalk rot not only causes great yield reduction, but also seriously reduces the quality of corn and causes harvesting problems due to damaged stalks and lodging. Because the corn stalk rot has various pathogenic types and complicated pathogenic reasons, a comprehensive control strategy which mainly adopts an agricultural means for breeding disease-resistant varieties and takes other control means as assistance is adopted. The conventional breeding mode is adopted to breed the disease-resistant variety, so that the problems of low target character selection efficiency and long breeding period exist, and the requirement of the current corn production on the excellent variety cannot be met. The molecular marker is used as an auxiliary means of conventional breeding, and makes up for a plurality of defects in conventional disease-resistant breeding. Aiming at fusarium graminearum stem rot, 1145 is used as an antigen in a subject group of professor xuminghang of Chinese agriculture university, and a disease-resistant related gene ZmCCT is excavated, positioned and cloned. Research shows that ZmCCT response to pathogen infection is closely related to upstream 2.4kb position transposon TE 1. The ZmCCT allele without the TE1 insertion can quickly and instantly respond to the infection of pathogenic bacteria, thereby leading the plants to show resistance to the stem rot in the field. The ZmCCT allele containing the TE1 insertion is in a silent state when pathogenic bacteria invade, and finally shows infection. The molecular marker detected by PCR amplification agarose was developed by the predecessors based on the insertion or deletion of the TE1 sequence, but no co-dominant marker was developed for the disease-resistance-related gene ZmCCT. Around the gene, the SNP functional marker based on the LGC-KASP platform is developed, and the SNP functional marker has important significance for efficient molecular breeding of fusarium graminearum stem rot.
Disclosure of Invention
The first purpose of the invention is to provide an SNP molecular marker related to a corn stalk rot disease-resistant gene and a specific primer for amplifying the molecular marker.
The second purpose of the invention is to provide the application of the SNP molecular marker.
According to the published sequence information (LOCUS NC-024466) of the stem rot resistance related gene ZmCCT, the upstream sequence of the ZmCCT coding region has certain polymorphism, and the downstream is relatively conserved. Thus, amplification primers are designed in this region. The primer sequences are as follows:
CCT-Ex1F CCTGCACGAGTTCCAGTTCT
CCT-Ex1R GGCGTACCAAACGTACATGC
the PCR amplification of the target fragment was carried out using the genomic DNA of 1145, Jing 92, Jing 2416, Jing 17, Jing 27 and SK1098 as templates, respectively, and the amplified products were subjected to 1% agarose gel electrophoresis. The results showed that PCR amplification of the coding region yielded a fragment of approximately 800bp in length. Recovering and purifying the amplification product, connecting the amplification product to a T vector, and selecting a single clone to send to Beijing Yihui-Chi-Yuan biotechnology limited company for sequencing and identification.
Based on the sequencing results of the disease-resistant inbred line 1145, the susceptible inbred lines Jing 92, Jing 2416, Jing 17, Jing 27 and SK1098 in the coding region of the ZmCCT gene, CLUSTAL X1.83 is used for sequence comparison, and a base variation A/G is found in the coding region and stably exists in the disease-resistant inbred line 1145 and the 5 susceptible inbred lines. By utilizing the SNP locus, a codominant SNP molecular marker is designed based on an LGC-KASP platform and is used for detecting a corn stalk rot disease-resistant gene ZmCCT.
Specifically, the SNP molecular marker co-dominant with the corn stalk rot disease-resistant gene ZmCCT is positioned at the 68bp position of a sequence shown in SEQ ID No.4 in a corn ZmCCT gene coding region, and the polymorphism is A/G. For convenience of description, the present application designates this SNP molecular marker in the coding region of the zmcc gene of maize as CCT-C2.
The SNP molecular marker CCT-C2 is obtained by amplifying a primer with a nucleotide sequence shown in SEQ ID NO.1-3 and detecting the primer by a KASP platform.
The invention provides application of the SNP molecular marker in cultivating or screening a corn variety with a stem rot disease-resistant gene ZmCCT.
The invention provides application of the SNP molecular marker in identification of a corn stalk rot disease-resistant gene ZmCCT.
The invention provides application of the SNP molecular marker in distinguishing homozygous disease-resistant corn single plants from heterozygous disease-resistant corn single plants, wherein the disease resistance refers to stem rot resistance. Preferably, the disease resistance refers to resistance to fusarium graminearum stem rot.
The invention provides a specific primer for detecting the SNP molecular marker, and the nucleotide sequence of the specific primer is shown as SEQ ID NO. 1-3.
Furthermore, the invention provides application of the specific primer in maize molecular marker assisted breeding.
The invention provides application of the specific primer in cultivating or screening corn varieties with stem rot disease-resistant genes ZmCCT.
The invention provides application of the specific primer in identifying a corn stalk rot disease-resistant gene ZmCCT.
The corn stalk rot in the embodiment of the invention refers to stalk rot caused by fusarium graminearum.
The invention provides a kit containing a specific primer, wherein the nucleotide sequence of the specific primer is shown in SEQ ID NO. 1-3.
The invention provides a detection method of ZmCCT corn with stem rot disease-resistant gene, which takes the DNA of corn material to be identified as a template, and uses a specific primer shown in SEQ ID NO.1-3 to detect by using a KASP platform;
when the specific primer is nucleotide sequence as SEQ ID NO.1-3, if the 68bp site genotype of the sequence as SEQ ID NO.4 is A: A or A: G, the corn to be detected has stem rot disease-resistant gene ZmCCT.
The invention has the beneficial effects that: the invention discovers the codominant SNP molecular marker CCT-C2 cosegregating with the corn stalk rot disease-resistant related gene ZmCCT, which can be used for distinguishing corn single plants with homozygous stem rot resistance and heterozygous stem rot resistance in corn plants. The SNP molecular marker provided by the invention can be used for identifying whether the corn has the stem rot disease-resistant gene ZmCCT, carrying out molecular marker-assisted breeding and screening the corn material with the stem rot resistance, and can improve the accuracy of selection.
Drawings
FIG. 1 shows the base differences between ZmCCT gene coding regions in maize with and against stalk rot.
FIG. 2 is a typing map of SNP marker CCT-C2 on KASP platform.
Detailed Description
The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.
The corn germplasm resource used in the embodiment of the invention is from the corn research center of agriculture and forestry academy of sciences of Beijing. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1 acquisition of SNP molecular marker related to corn stalk rot disease-resistant gene ZmCCT
Taking a disease-resistant inbred line 1145, an infectious inbred line Jing 92, Jing 2416, Jing 17, Jing 27 and SK1098 as materials, respectively taking seedling-stage leaves, and extracting genome DNA by using a CTAB method. According to the published ZmCCT gene sequence information, an amplification primer is designed in a coding region. The primer sequences are as follows:
CCT-Ex1F CCTGCACGAGTTCCAGTTCT(SEQ ID NO.5)
CCT-Ex1R GGCGTACCAAACGTACATGC(SEQ ID NO.6)
the genomic DNA of 1145, Jing 92, Jing 2416, Jing 17, Jing 27 and SK1098 is used as a template, PCR amplification is carried out by using the primers, and the amplified product is subjected to 1% agarose gel electrophoresis detection. The results showed that a fragment of about 800bp in length was obtained by PCR amplification. Recovering and purifying the amplification product, connecting the amplification product to a T vector, and selecting a single clone to send to Beijing Yihui-Chi-Yuan biotechnology limited company for sequencing and identification.
Based on the sequencing results of the disease-resistant inbred line 1145, the susceptible inbred lines Jing 92, Jing 2416, Jing 17, Jing 27 and SK1098 in the coding region of the ZmCCT gene, CLUSTAL X1.83 is utilized to carry out sequence comparison, and a stable base variation A/G exists in the coding region. The coding region of the zmcc gene has this stable base variation in both the 5 susceptible and resistant inbred lines 1145, see figure 1.
Specifically, the SNP molecular marker related to the corn stalk rot disease-resistant gene provided by the invention is positioned at the 68bp site of the sequence shown in SEQ ID No.4 in the corn ZmCCT gene coding region, and the polymorphism is A/G.
According to the design principle of the KASP platform SNP marker primer, the application designs an amplification primer CCT-C2. The sequence information is as follows:
Primer AlleleFAM：CCACAGTACCACCACCCCG(SEQ ID NO.1)，
Primer AlleleHEX：CACCACAGTACCACCACCCCA(SEQ ID NO.2)，
Primer Common：CAGCGTGGCGTCCAGCTCAAA(SEQ ID NO.3)。
the SNP molecular marker is obtained by amplifying primers with nucleotide sequences shown as SEQ ID NO.1-3 and detecting by a KASP platform.
Example 2 application of the SNP marker of the invention in the disease-resistant improvement backcross transformation of fusarium graminearum stem rot
Disease-resistant inbred line 1145 is used as a donor parent, susceptible inbred lines Jing 92 and Jing 2416 are respectively used as recurrent parents, and disease-resistant related gene ZmCCT in 1145 is transferred into susceptible parents Jing 92 and Jing 2416 by a backcross transfer method to improve the resistance of the susceptible parents to fusarium graminearum stem rot.
In BC3F1 generation and BC3F2 generation of backcross transformation populations 1145/Jing 92 and 1145/Jing 2416, molecular marker assisted selection was performed on ZmCCT gene using the above KASP-SNP marker (CCT-C2 marker obtained in example 1). Inbred lines 1145, Jing 92, and Jing 2416 were used as anti-influenza controls. Through detection, the gene typing result of the SNP marker CCT-C2 on the detected single plant is as follows: the genotype of the disease-resistant inbred line 1145 is A, and the genotypes of the susceptible inbred lines Jing 92 and Jing 2416 are G and G.
In the BC3F1 generation population of 50 strains 1145/Jing 92, 22 strains have genotypes A: G, and 28 strains have genotypes G: G. In the BC3F1 generation population of 85 strain 1145/Jing 2416, 42 strains have genotype A: G and 43 strains have genotype G: G. G in the BCnF1 generation backcross population, wherein the single plant carries disease-resistant related gene ZmCCT, and can be combined with field agronomic characters and ear characters to determine whether to continue to enter next generation backcross or inbreeding; the genotype of the single plant is G, which is the same as that of the susceptible parent, and the single plant does not carry the disease-resistant related gene ZmCCT and is directly eliminated.
Because the KASP-SNP marker is a codominant marker, the homozygous disease-resistant and heterozygous disease-resistant single plants can be accurately distinguished. In the BC3F2 generation population of 76 strains 1145/Jing 92, 20 strains have genotypes A: A, 38 strains have genotypes A: G, and 18 strains have genotypes G: G. In the BC3F2 generation population of 93 strains 1145/Jing 2416, 23 strains have genotype A: A, 49 strains have genotype A: G, and 21 strains have genotype G: G. A single plant with the genotype of A: A carries the homozygous disease-resistant related gene ZmCCT, and can select an excellent disease-resistant ear row by combining with the field agronomic characters and ear characters.
Example 3 comparison with the prior art
The fragment length polymorphism marker TE1M is applied to disease-resistant improved backcross transformation of fusarium graminearum stem rot (the detection effect of the existing primers, reference: A transposon-directed epigenetic change in ZmCCT undersuits qualitative resistance to Gibberella stage in main ze, New Phytolist, 2017, doi: 10.1111/nph.14688). Disease-resistant inbred line 1145 is used as a donor parent, susceptible inbred lines Jing 92 and Jing 2416 are respectively used as recurrent parents, and disease-resistant related gene ZmCCT in 1145 is transferred into susceptible parents Jing 92 and Jing 2416 by a backcross transfer method to improve the resistance of the susceptible parents to fusarium graminearum stem rot.
In the backcross transformation population used in example 2 (BC 3F1 and BC3F2 of 1145/jing 92 and 1145/jing 2416), molecular marker-assisted selection was performed on the zmcc gene using the fragment length polymorphism marker TE 1M. Since this marker is a dominant marker developed based on transposon TE1 upstream of the zmcc gene, it is necessary to use the housekeeping gene PINS1 marker as a reference. And judging whether the quality of the DNA is problematic or not according to the normality or not of the amplification product of the PINS 1. Inbred lines 1145, Jing 92, and Jing 2416 were used as anti-influenza controls. Through detection, the PINS1 primer can amplify a fragment of about 500bp on all DNA to be detected, which indicates that the DNA quality and an amplification system have no problems. The amplified product fragment size of TE1M on the disease-resistant inbred line 1145 is about 430bp, and no amplified product exists on the susceptible inbred lines Jing 92 and Jing 2416.
When the TE1M primer is used for detecting 50 strains 1145/Jing 92 BC3F1 generation groups, about 430bp of amplified fragments are detected in 22 strains of individuals with the KASP marker genotype A: G, and no amplified products are detected in 28 strains of individuals with the KASP marker genotype G: G. When the BC3F1 generation population of 1145/Jing 2416 is detected by using the TE1M primer, 42 individuals with the genotype A: G of the KASP marker detect about 430bp of amplified fragments, and 43 individuals with the genotype G: G of the KASP marker do not have amplified products. This result is consistent with the detection result of KASP-SNP marker.
When the BC3F2 population of 76 strains 1145/Jing 92 was detected by using TE1M primer, about 430bp of amplified fragments were detected in 20 individuals with the KASP marker genotype A: A and 38 individuals with the KASP marker genotype A: G, and no amplified product was detected in 18 individuals with the KASP marker genotype G: G. In the BC3F2 generation population of 93 strains 1145/Jing 2416, about 430bp of amplified fragments were detected in 23 strains of individuals with the KASP marker genotype A: A and 49 strains of individuals with the KASP marker genotype A: G, and no amplified product was detected in 21 strains of individuals with the KASP marker genotype G: G. As can be seen, the TE1M primer is a dominant marker, and can not distinguish homozygous disease-resistant from heterozygous disease-resistant; meanwhile, the PINS1 primer needs to be amplified simultaneously because of the difference of the fragments. The KASP-SNP marker CCT-C2 is a codominant marker, so that homozygous disease-resistant and heterozygous disease-resistant single plants can be accurately distinguished.
Sequence listing
<110> agriculture and forestry academy of sciences of Beijing City
<120> development and application of SNP molecular marker related to corn stalk rot resistance
<130> KHP181114044.4
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ccacagtacc accaccccg 19
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caccacagta ccaccacccc a 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cagcgtggcg tccagctcaa a 21
<210> 4
<211> 81
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
agctggtgat gagaacgacg accagcctgc gtttcacccg tttgggacac cacagtacca 60
ccaccccaga aaagggaacg g 81
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cctgcacgag ttccagttct 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ggcgtaccaa acgtacatgc 20

Claims (7)

  1. SNP molecular marker in breeding or screening disease-resistant genes with stem rotZmCCTApplication of SNP molecular marker and corn stalk rot disease-resistant gene in corn varietyZmCCTCodominant, located in maizeZmCCTThe 68bp site of the sequence shown in SEQ ID NO.4 in the gene coding region has polymorphism A/G; the stalk rot is caused by fusarium graminearum.
  2. Identification of maize stalk rot disease-resistant gene by SNP molecular markerZmCCTThe SNP molecular marker and the corn stalk rot disease-resistant geneZmCCTCodominant, located in maizeZmCCTThe 68bp site of the sequence shown in SEQ ID NO.4 in the gene coding region has polymorphism A/G; the stalk rot is caused by fusarium graminearum.
  3. Application of SNP molecular marker in distinguishing homozygous disease-resistant corn single plants from heterozygous disease-resistant corn single plants, wherein the disease resistance refers to stem rot, and the SNP molecular marker and corn stem rot disease-resistant genesZmCCTCodominant, located in maizeZmCCTThe 68bp site of the sequence shown in SEQ ID NO.4 in the gene coding region has polymorphism A/G; the stalk rot is caused by fusarium graminearum.
  4. 4. The application of the specific primer in the maize molecular marker assisted breeding with stem rot resistance, wherein the nucleotide sequence of the specific primer is shown in SEQ ID NO. 1-3; the stalk rot is caused by fusarium graminearum.
  5. 5. Identification of corn stalk rot disease-resistant gene by specific primerZmCCTThe nucleotide sequence of the specific primer is shown as SEQ ID NO. 1-3; the stalk rot is caused by fusarium graminearum.
  6. 6. Specific primer in breeding or screening disease-resistant gene with stem rotZmCCTThe nucleotide sequence of the specific primer is shown in SEQ ID NO. 1-3; the stalk rot is caused by fusarium graminearum.
  7. 7. Disease-resistant gene with stem rotZmCCTThe method for detecting maize of (1), wherein the stalk rot is caused by fusarium graminearum, characterized in that the DNA of the maize material to be identified is used as a template, and the specific primers shown in SEQ ID nos. 1-3 are used to detect using KASP platform;
    when the specific primer is nucleotide sequence shown as SEQ ID NO.1-3, if the 68bp site genotype of the sequence shown as SEQ ID NO.4 is A: A or A: G, the corn to be detected has the stem rot disease-resistant geneZmCCT。
CN201810753521.2A 2018-07-10 2018-07-10 Development and application of SNP molecular marker related to resistance of corn stalk rot Active CN108893550B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810753521.2A CN108893550B (en) 2018-07-10 2018-07-10 Development and application of SNP molecular marker related to resistance of corn stalk rot

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810753521.2A CN108893550B (en) 2018-07-10 2018-07-10 Development and application of SNP molecular marker related to resistance of corn stalk rot

Publications (2)

Publication Number Publication Date
CN108893550A CN108893550A (en) 2018-11-27
CN108893550B true CN108893550B (en) 2021-08-10

Family

ID=64348819

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810753521.2A Active CN108893550B (en) 2018-07-10 2018-07-10 Development and application of SNP molecular marker related to resistance of corn stalk rot

Country Status (1)

Country Link
CN (1) CN108893550B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109486988B (en) * 2018-11-30 2022-03-25 中玉金标记（北京）生物技术股份有限公司 Method for high-throughput detection of corn stalk rot resistance genotyping and kit thereof
CN115997677B (en) * 2022-12-05 2024-09-27 北大荒垦丰种业股份有限公司 Breeding method for rapidly improving corn stem rot resistance
CN115961081B (en) * 2022-12-26 2023-09-12 四川农业大学 Molecular marker closely linked with corn stem rot resistance gene locus qFCR9 and application thereof
CN118406792A (en) * 2024-05-17 2024-07-30 山东省农业科学院 Auxiliary selection molecular marker for resisting corn stalk rot and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011072478A1 (en) * 2009-12-14 2011-06-23 中国农业大学 Major qtl of maize stalk rot resistance, molecular markers linked with the same and uses thereof
CN104087579B (en) * 2014-07-07 2016-04-27 合肥丰乐种业股份有限公司 One and the closely linked molecule marker of Corn Stalk Rot resistant gene, primer and application thereof
WO2017106731A1 (en) * 2015-12-18 2017-06-22 Monsanto Technology Llc Methods for producing corn plants with northern leaf blight resistance and compositions thereof
CN107354215A (en) * 2017-08-04 2017-11-17 中国农业大学 A kind of corn molecule auxiliary breeding means
CN107502661B (en) * 2017-08-29 2020-10-27 袁隆平农业高科技股份有限公司 SNP molecular marker combination related to corn stalk rot resistance and application thereof

Also Published As

Publication number Publication date
CN108893550A (en) 2018-11-27

Similar Documents

Publication Publication Date Title
CN103305510B (en) Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof
CN108893550B (en) Development and application of SNP molecular marker related to resistance of corn stalk rot
US11032986B2 (en) Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof
CN108165656B (en) Wheat molecular marker and application thereof in identification of wheat powdery mildew resistance
CN110551843B (en) Codominant marking primer capable of distinguishing tobacco spot wilt-resistant locus RTSW homozygous heterozygous genotype, distinguishing method and application thereof
CN110923352B (en) KASP marker of wheat powdery mildew resistance gene PmDTM and application thereof
CN109234431B (en) Molecular marker of corn stalk rot resistance QTL and application thereof
US8450558B2 (en) Loci associated charcoal rot drought complex tolerance in soybean
WO2020036950A1 (en) Molecular markers for blackleg resistance gene rlm1 in brassica napus, and methods of using the same
US11028453B2 (en) QTLs associated with and methods for identifying lodging resistance in soybean
BR112017026015B1 (en) METHODS FOR SELECTING A CORN PLANT WITH RESISTANCE TO STALK ROT CAUSED BY ANTHRACNOSIS AND METHOD FOR INTROGRESSING A QTL ALLELE ASSOCIATED WITH RESISTANCE TO STALK ROT CAUSED BY ANTHRACNOSIS INTO A CORN PLANT
CN102395687B (en) Genetic loci associated with fusarium ear mold resistance in maize
AU2014318041B2 (en) Molecular markers for blackleg resistance gene Rlm2 in Brassica napus and methods of using the same
US20140283212A1 (en) Markers linked to reniform nematode resistance
US10793918B2 (en) Molecular markers for blackleg resistance in canola and methods of using the same
US20210315177A1 (en) Molecular markers for blackleg resistance gene rlm7 in brassica napus, and methods of using the same
Wang et al. Identification of an AFLP marker and conversion to a SCAR marker to identify cytoplasmic male-sterile or normal cytoplasm in Welsh onion (Allium fistulosum L.)
CN115820895B (en) Molecular marker closely linked with chlorophyll content of corn and application thereof
CN118421830B (en) KASP molecular marker linked with Yizhang red shell wheat stripe rust resistance gene QYr.YZHK-2BL, primer combination and application
CN115896323B (en) Molecular marker closely linked with germination capacity of corn seeds and application thereof
CN115927704B (en) Molecular marker closely linked with length of corn stalk and application thereof
CN115820893A (en) Application of corn HRM molecular marker in corn genetic breeding
CN116004881A (en) Molecular marker highly closely linked with corn ear position and application thereof
AU2014386227A1 (en) Markers linked to reniform nematode resistance

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant