CN109055598A - Brown planthopper resistant gene in rice BPH6 codominant marker and its application - Google Patents
Brown planthopper resistant gene in rice BPH6 codominant marker and its application Download PDFInfo
- Publication number
- CN109055598A CN109055598A CN201811140942.4A CN201811140942A CN109055598A CN 109055598 A CN109055598 A CN 109055598A CN 201811140942 A CN201811140942 A CN 201811140942A CN 109055598 A CN109055598 A CN 109055598A
- Authority
- CN
- China
- Prior art keywords
- rice
- bph6
- seq
- brown planthopper
- planthopper resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention provides brown planthopper resistant gene in rice BPH6 codominant marker and its application, the molecular labeling is the nucleotide sequence for being T/C containing the 188th as shown in SEQ ID NO.1 polymorphism, and/or the nucleotide sequence for for the polymorphism containing the 4438th~4445 as shown in SEQ ID NO.1 being the-TGCAGGGG-3 ' of 5 '-CGAAACAC-3 '/5 '.Specificity amplification primer is designed for the molecular labeling, the detection of BPH6 genotype is carried out using PCR amplification.The molecular labeling and its amplimer of BPH6 provided by the invention can be used for identifying the genotype of rice BPH6, breeding brown planthopper resistant rice pest insects, have many advantages, such as to identify that accuracy is high, easy to operate, low in cost, the breeding cycle of brown planthopper resistant rice can be shortened, reduce breeding cost.
Description
Technical field
The present invention relates to molecular biology and plant molecular breeding fields, specifically, being related to brown planthopper resistant gene in rice
BPH6 codominant marker and its application.
Background technique
Brown paddy plant hopper (Nilaparvata lugens Stal, abbreviation BPH) belongs to Homoptera Delphacidae insect, is rice
Primary pest.Brown paddy plant hopper sucks Rice Vascular Bundle sheath juice by needle-shaped mouthpart, causes rice strain jaundice, lodging even withered.It is brown
Plant hopper propagates rice grass-like bushy stunt and tingia dwarf wilt in feeding, while also promoting rice sheath blight disease, culm rot
It propagates.As the popularization of high yield not insect-proof rice kind, and the change of Rice Cropping mode and cultivation system, brown paddy plant hopper occur
The frequency increases, and the extent of injury increases, and has become China and the in the world primary insect pest of Rice Production, makes safely to grain-production
At seriously threatening.Practice have shown that breeding is that prevention and treatment brown paddy plant hopper is the most economical, effective with the rice varieties with insect resistance capacity are promoted
Method.
Traditional rice breeding for pest resistance be by pest-resistant Characters Identification to plant carry out Phenotypic Selection, it is time-consuming and laborious and vulnerable to
The influence and limitation of environmental condition, qualification result are easy to cause error, and efficiency of selection is lower.Molecular marker assisted selection is a kind of
Using with resistant gene close linkage or gene internal functional label, combine genotype and Phenotypic Selection to Objective in offspring
The GENERALIZATION OF MODERN BREEDING TECHNIQUE that shape is screened.This method can not only greatly improve breeding efficiency, shorten breeding cycle, can also save
About a large amount of human and material resources costs.Resistance gene of brown planthopper BPH6 derives from rice varieties Swarnalata, to a variety of of brown paddy plant hopper
Bion has preferable resistance, the current patent applied for of gene order (CN106148353A).Needle in currently available technology
Molecular labeling to resistance gene of brown planthopper BPH6 is linked marker, and exploitation BPH6 gene internal specific label is for the gene
And pest-resistant character precise Identification and further improvement Rice Resistance Brown Planthopper Resistance be of great significance.
Summary of the invention
To solve problems of the prior art, the object of the present invention is to provide a kind of brown planthopper resistant gene in rice BPH6
Codominant marker and its application.
It is long-armed that brown planthopper resistant gene in rice BPH6 is located at Rice Chromosome 4, partial nucleotide sequence such as SEQ ID
Shown in NO.1.By to a large amount of known rice varieties for separately including the pest-resistant allele of BPH6 and feeling worm allele
The code area BPH6 expanded, be sequenced and sequence alignment analysis, inventor have found in BPH6 gene as shown in SEQ ID NO.1
There are a SNP site (corresponding rice OryzasativaLcv.Nipponbare chromosome location are 21397054) at the 188bp of nucleotide sequence, wherein
The equipotential of BPH6 brown planthopper resistant is T, and the susceptible equipotential of corresponding brown paddy plant hopper is C.Moreover, it has been found that such as SEQ ID in BPH6 gene
There are one section of specific sequence, (corresponding rice OryzasativaLcv.Nipponbare dyes position to 4438bp~4445bp of nucleotide sequence shown in NO.1
It is set to 21400441~21400448), wherein the equipotential nucleotides sequence of BPH6 brown planthopper resistant is classified as 5 '-CGAAACAC-3 ', corresponding
The susceptible equipotential nucleotides sequence of brown paddy plant hopper is classified as 5 '-TGCAGGGG-3 '.
The present invention for this at two the special nucleotide sequence exploitation of BPH6 gene internal efficiently, precise Identification BPH6 gene
The molecular labeling of type.
The present invention provides the molecular labeling of brown planthopper resistant gene in rice BPH6 a kind of, and the molecular labeling is to contain such as SEQ
188th polymorphism shown in ID NO.1 is the nucleotide sequence of T/C, and/or, for containing as shown in SEQ ID NO.1
4438th~4445 polymorphism is the nucleotide sequence of-TGCAGGGG-3 ' of 5 '-CGAAACAC-3 '/5 '.
Further, the present invention is provided to expand the primer of the molecular labeling.
Preferably, the nucleotide sequence of the primer is as follows:
SEQ ID NO.2:AGGGCCTCTGGCGCTCTAC；
SEQ ID NO.3:AATGTGAAAGTGCAATTAGAAGGT；
SEQ ID NO.4:ATAGTGAAGTTGAATCCGAAGG；
SEQ ID NO.5:AGTGACTCAGCCTTGTGTTTCG。
In addition, it includes institutes of the present invention the present invention also provides the detection kit of brown planthopper resistant gene in rice BPH6 a kind of
The amplimer stated.
Further, the present invention also provides the molecular labelings or the amplimer or the kit to exist
Identify the genotype of brown planthopper resistant gene in rice BPH6, rice brown planthopper resistant character or in rice brown planthopper resistant kind molecular breeding
In application.
Specifically, the application includes the following steps:
(1) genomic DNA of rice to be measured is extracted；
(2) genomic DNA obtained using step (1), using amplimer of the present invention, carries out PCR expansion as template
Increase；
(3) according to the sequence signature of amplified production, judge the genotype of BPH6；
(4) the brown planthopper resistant phenotype of rice is judged according to the genotype of BPH6: the 188th as shown in SEQ ID NO.1
It is then brown planthopper resistant phenotype for T, it is then brown paddy plant hopper susceptible phenotype that the 188th, which is C, as shown in SEQ ID NO.1；Such as SEQ
4438th~4445 nucleotides sequence shown in ID NO.1 is classified as 5 '-CGAAACAC-3 ', then is brown planthopper resistant phenotype；Such as
4438th~4445 nucleotides sequence shown in SEQ ID NO.1 is classified as 5 '-TGCAGGGG-3 ', then is the susceptible table of brown paddy plant hopper
Type.
Preferably, the genotype for judging BPH6 is is judged according to electrophoresis detection amplified product band type.
It is furthermore preferred that the standard of the genotype for judging BPH6 is as follows: if amplified production is 283bp band, water to be measured
Rice carries BPH6 brown planthopper resistant allele；If amplified production is 361bp band, rice carrying BPH6 brown paddy plant hopper to be measured is susceptible etc.
Position gene；As amplified production be two kinds of banding patterns of 283bp and 361bp, rice to be measured be BPH6 brown planthopper resistant allele and it is brown fly
Lice susceptible allele heterozygous rice.
Specifically, molecular labeling, amplimer or the kit of BPH6 gene provided by the invention are for identifying rice
Genotype, rice brown planthopper resistant character or the PCR in rice brown planthopper resistant kind molecular breeding of brown planthopper resistant gene BPH6
Reaction condition and system are as follows:
PCR reaction condition are as follows: 94 DEG C~98 DEG C initial denaturation 3~10 minutes；94 DEG C~98 DEG C be denaturalized 10~30 seconds, 52 DEG C~
60 DEG C are annealed 10~30 seconds, and 72 DEG C extend 30~60 seconds, and totally 25~35 recycle；72 DEG C extend 3~10 minutes.
PCR reaction system (10 μ L): it is denoted as: 10 × PCR reaction buffer, 1 μ L, 10mM dNTP, 0.8 μ L, 4 primers
(10 μM) are 0.15 μ L, 0.1 μ L Taq archaeal dna polymerase；2 μ L DNA profilings, distilled water supply surplus.
The beneficial effects of the present invention are:
(1) the existing molecular labeling of BPH6 gene is linked marker, and the vacation yin of separation exchange or detection occurs in filial generation
Property probability it is higher, influence detection accuracy.Codominant marker in the BPH6 gene that the present invention develops, can exclude vacation
The homozygosis or heterozygous genotypes of precise Identification BPH6 gene are capable of in negative influence, realize the efficient of brown planthopper resistant rice pest insects
Screening；
(2) the different stripe sizes of the amplified production of molecular labeling provided by the invention differ greatly, and can pass through agarose
Gel electrophoresis determines the genotype of rice material to be measured, low in cost, be not necessarily to digestion, and detection program is convenient and efficient；
(3) when carrying out assistant breeding using molecular labeling provided by the invention, it can be realized the standard of filial generation BPH6 genotype
Really, simply, efficient detection, while realizing the non-damaged data of paddy growth early stage, it is right in extensive breeding to be suitable for being commercialized
A large amount of screenings of BPH6 genotype and the identification to BPH6 allelotype in Rice Germplasm Resources.
Detailed description of the invention
Fig. 1 is the known BPH6 coding sequence ratio comprising pest-resistant or sense worm BPH6 allele rice varieties
To figure.Wherein, A is the nucleotide sequence that the 188th polymorphism is T/C as shown in SEQ ID NO.1, and B is such as SEQ ID
4438th~4445 polymorphism shown in NO.1 is the nucleotide sequence of-TGCAGGGG-3 ' of 5 '-CGAAACAC-3 '/5 ',
Wherein, Luoyang6 is the known rice varieties containing the pest-resistant allele of BPH6,9311, Nipponbare, DJ123,
Huazhan, IR64 are the known rice varieties that worm allele is felt containing BPH6.
Fig. 2 is the detection electrophoretogram of rice breeding Commonly used parents in embodiment 4, M:DL1000 DNA marker, wherein swimming
Road 1-32 be corresponding in turn to for Luo raise No. 6,9311, F1, China account for, beautiful needle perfume, 638S, R1206, R608, CO2, R900, Feng Yuzhan,
Magnificent extensive 284, at extensive 19, China Resources 2, Mianhui 3728, Mf63, Shanghai round-grained rice 5,02428, Shanghai round-grained rice 6, poplar round-grained rice 5507, hot round-grained rice 35, more round-grained rice
0618, emblem round-grained rice 602, town rice 819, distant salt 287, Jiangsu round-grained rice 2, salt rice 1531, land reclamation and cultivation 31, Fukuniski, Zhejiang round-grained rice 75, drought two excellent 1
Number, Anhui two excellent 385.
Fig. 3 is the electrophoretogram in embodiment 5 to F2 crowd surveillance, M:DL1000 DNA marker, swimming lane P1, P2 difference
No. 6 and sense worm parent 9311 are raised for pest-resistant parent's Luo, swimming lane 1-25 is the F2 group single plant that 6/9311 building is raised using Luo, each material
For the mark of genotype belonging to expecting with above corresponding swimming lane, S represents sense worm allelic gene type, and R represents pest-resistant allelic gene type, H
Represent hybrid type.
Fig. 4 is the pest-resistant phenotypic evaluation of part F2:3 strain in embodiment 5 as a result, wherein R represents pest-resistant phenotype, and S is represented
Feel worm phenotype；Pest-resistant control Luo poplar No. 6 and sense worm control 9311 are 3 repetitions, and B6-1~B6-7 represents 7 F2:3 strains,
Each F2:3 strain is two repetitions.
Specific embodiment
The preferred embodiment of the present invention is described in detail below in conjunction with embodiment.It will be appreciated that following real
Providing merely to play the purpose of explanation for example is applied, is not used to limit the scope of the present invention.The skill of this field
Art personnel without departing from the spirit and purpose of the present invention, can carry out various modifications and replace to the present invention.
Experimental method used in following embodiments is conventional method unless otherwise specified.
The materials, reagents and the like used in the following examples is commercially available unless otherwise specified；Used
Rice material is commercially or the national genebank material that obtains or be widely used to promote for those skilled in the art.
The exploitation of 1 BPH6 gene codominant marker of embodiment
It is long-armed that rice BPH6 gene is located at Rice Chromosome 4, by accounting for Luo poplar 6 (BPH6 introgressive line), China, IR64 etc.
Multiple known pest-resistant and sense worm rice varieties carry out the amplification and sequencing of the code area BPH6 and its upstream and downstream sequence, use
The sequence analysis tools such as DNAMAN software and ncbi database carry out sequence alignment analysis, such as SEQ ID in discovery BPH6 gene
There are a SNP sites at the 188bp of nucleotide sequence shown in NO.1, and wherein the pest-resistant equipotential of BPH6 is T, and corresponding sense worm equipotential is
C (as shown in figure 1 shown in A).Moreover, it has been found that in BPH6 gene the nucleotide sequence as shown in SEQ ID NO.1 4438bp~
There are one section of specific coding sequences by 4445bp, and wherein the pest-resistant equipotential nucleotides sequence of BPH6 is classified as 5 '-CGAAACAC-3 ', corresponding
Sense worm equipotential nucleotides sequence is classified as 5 '-TGCAGGGG-3 ' (as shown in figure 1 shown in B).For this at two BPH6 gene internal it is special
Nucleotide sequence develops molecular labeling, and the identification of BPH6 allele may be implemented.
The detection primer of 2 BPH6 gene codominant marker of embodiment designs
Detection primer, design of primers principle are designed for two BPH6 gene specific molecular labelings that embodiment 1 is developed
It is as follows.
The design specific primer that expands pest-resistant allele first, with the pest-resistant equipotential distinguished sequence of BPH6 5 '-
3 ' end design reverse primer B6-RRs of the complementary series 5 '-GTGTTTCG-3 ' of CGAAACAC-3 ' as primer, then at its upstream
Design paired forward primer B6-RF, primer RR and RF can only specific amplification BPH6 resistance allele, generate one
283bp band, and BPH6 feels worm equipotential in amplification without band；
Then, the specific primer of design amplification sense worm allele, to feel in the SNP of gene coding region 188
The distinctive C base of worm equipotential is the end of primer 3 ', and holds the second bit base to introduce a base mismatch design forward direction in primer 3 ' and draw
Object B6-SF, and can only specific amplification sense worm equipotential base designing paired reverse primer B6-SR, SF and SR downstream
Because obtaining a 361bp band, and without band when expanding pest-resistant allele.
Specific primer sequence is as shown in table 1, and the codominant marker detection that four primers are used in mixed way composition BPH6 is drawn
Object group, when amplified production only has 283bp band, rice to be measured carries the pest-resistant allele of BPH6, is pest-resistant phenotype；Work as amplification
When product only has 361bp band, rice to be measured carries BPH6 and feels worm allele, to feel worm phenotype；When amplified production has 283bp
When with two kinds of banding patterns of 361bp, rice to be measured is BPH6 pest-resistant and sense worm heterozygous genotypes rice and shows as pest-resistant phenotype.
1 BPH6 specific molecular marker primer sequence of table and relevant parameter
The foundation of 3 brown planthopper resistant gene in rice BPH6 specific molecular marker detection method of embodiment
The BPH6 two designed according to embodiment 2 designs the response procedures and reactant of PCR to the detection primer of molecular labeling
System determines following response procedures and system by continuing to optimize:
PCR reaction system (10 μ L): it is denoted as: 10 × PCR reaction buffer, 1 μ L, 10mM dNTP0.8 μ L, 4 primers (10
μM) it is 0.15 μ L, 0.1 μ L Taq archaeal dna polymerase；2 μ L DNA profilings, distilled water supply surplus.
PCR reaction condition are as follows: 95 DEG C initial denaturation 5 minutes；95 DEG C are denaturalized 30 seconds, and 58 DEG C are annealed 30 seconds, and 72 DEG C extend 45 seconds,
Totally 35 circulations；72 DEG C extend 8 minutes.
Embodiment 4BPH6 specific molecular marker detection rice it is pest-resistant and sense worm kind in application
(1) biomaterial
BPH6 donor material Luo raises No. 6, feels worm control material 9311 and Luo raises No. 6 miscellaneous 9311 F1 obtained, and choose
29 parts of breeding parent materials or commercially available rice varieties, specifically include: China accounts for, beautiful needle perfume, 638S, R1206, R608, CO2, R900,
Feng Yuzhan, China is extensive 284, at extensive 19, China Resources 2, Mianhui 3728, Mf63, Shanghai round-grained rice 5,02428, Shanghai round-grained rice 6, poplar round-grained rice 5507, hot round-grained rice
35, get over round-grained rice 0618, emblem round-grained rice 602, town rice 819, distant salt 287, Jiangsu round-grained rice 2, salt rice 1531, land reclamation and cultivation 31, Fukuniski, Zhejiang round-grained rice 75,
Non-irrigated two excellent No. 1, Anhui two excellent 385.
(2) oryza sativa genomic dna extracts and primer synthesizes
Using CTAB method extract above-mentioned rice material genomic DNA and synthesis table 1 shown in primer sequence, specifically:
B6-SF:AGGGCCTCTGGCGCTCTAC；
B6-SR:AATGTGAAAGTGCAATTAGAAGGT；
B6-RF:ATAGTGAAGTTGAATCCGAAGG；
B6-RR:AGTGACTCAGCCTTGTGTTTCG。
(3) PCR is detected
The reaction system and response procedures of PCR is as described in Example 3.Amplified production electrophoresis in 2% Ago-Gel is used
Gel imager scanning record result.
(4) interpretation of result
The electrophoresis result of pcr amplification product is as shown in Fig. 2, 1 swimming lane BPH6 donor Luo is raised No. 6 material-specifics and amplified
The band of 283bp, 2 swimming lane sense worm control materials 9311 amplify the band of 361bp, 3 swimming lane F1 materials amplify 283bp and
Two strip-type of 361bp, the corresponding parent material of 4-32 swimming lane amplify the item with the sense consistent 361bp of worm control material 9311
Band.In order to verify the accuracy for the result that PCR is detected, Luo is raised into the corresponding molecular labeling target of 6,9311 and 29 parent materials
Area has carried out sequencing and has compared.The result shows that Markers for Detection result is consistent with sequencing result, it was demonstrated that primer provided by the invention
Be capable of the genotype of precise Identification brown planthopper resistant gene BPH6, it can be achieved that the variety resources of rice of precise and high efficiency screening.
Detection and phenotype correlation analysis of the 5 brown planthopper resistant gene in rice BPH6 of embodiment in the single-gene separation of F2 group
(1) biomaterial
Pest-resistant parent's Luo raises No. 6 and sense worm parent 9311, and the random choosing in the F2 group of two parents building
The 96 F2 single plants taken.
(2) extraction of oryza sativa genomic dna and PCR detection
The primer of the extraction of oryza sativa genomic dna and PCR detection, response procedures and system are as described in Example 4.
(3) F2:3 population segment strain seedling stage insect resistance identification
Develop F2:3 group with 96 F2 single plants of selection, using standard seedling stage group method to wherein 20 strains, wherein
The BPH6 genotype of 10 strains be A (the 188th of nucleotide sequence shown in SEQ ID NO.1 is T, the 4438th~4445
For 5 '-CGAAACAC-3 '), the BPH6 genotype of 10 strains is (the 188 of nucleotide sequence shown in SEQ ID NO.1 B
Position is C, and the 4438th~4445 polymorphism is 5 '-TGCAGGGG-3 ') identification of seedling stage insect resistace is carried out, with pest-resistant parent's Luo
Poplar No. 6 are pest-resistant control, and sense worm parent 9311 is sense worm control.
(4) interpretation of result
Pest-resistant parent's Luo raises No. 6 and feels the electrophoresis result of the pcr amplification product of worm parent 9311 and part F2 strain such as
Shown in Fig. 3, swimming lane P1, P2 are respectively that pest-resistant parent's Luo raises No. 6 and sense worm parent 9311, and swimming lane 1-25 is to be constructed using two parents
The part F2 strain randomly selected, for the affiliated genotype mark of each material below corresponding swimming lane, S represents sense worm allele class
Type, R represent pest-resistant allelic gene type, and H represents hybrid type.The result shows that being detected to 96 F2 strains, 3 kinds of differences
The segregation ratio of genotype is 23SS:49H:25RR, and Mendel's single-gene segregation ratio (χ of 1:2:1 is met through Chi-square Test2=
0.125 < χ2 0.05=5.99) it, therefore, should be labeled as codominant marker, it can be by two kinds of different homozygotes and heterozygote gene
Type distinguishes, and detection site shows as single-gene separation simultaneously.
Standard seedling stage insect resistance identification is carried out to 20 parts of F2:3 strains, resistance result and corresponding genotype results are as shown in table 2,
Wherein, R is represented pest-resistant, and S represents sense worm.Pest-resistant control Luo poplar No. 6 and sense in phenotypic evaluation situation such as Fig. 4, Fig. 4 of part strain
Worm control 9311 is 3 repetitions, remaining each F2:3 strain is two repetitions, and 16 plants of each repetition marks R and represents the strain
Pest-resistant, S represents sense worm.The result shows that molecular labeling of the invention can effectively filter out gene containing BPH6, have resist it is brown fly
The rice plant of lice phenotype, to accelerate the breeding of rice brown planthopper resistant.
2 F2:3 strain seedling stage brown planthopper resistant qualification result of table
BPH6 codominant marker provided by the invention and its detection primer, can be realized brown planthopper resistant gene BPH6's
Efficient, the precise Identification of genotype, can be used for the screening and identification of rice pest insects, it can also be used to brown planthopper resistant gene in rice BPH6
Molecular genetic breeding.
Although above the present invention is described in detail with a general description of the specific embodiments, at this
On the basis of invention, it can be modified or is improved, this will be apparent to those skilled in the art.Therefore,
These modifications or improvements without departing from theon the basis of the spirit of the present invention are fallen within the scope of the claimed invention.
Sequence table
<110>grand Co., Ltd of the flat high-tech Zhong Ye research institute lake in Yuanlongping Agricultural Hi-Tech Co., Ltd. Hunan
South Asia Hua Zhongye research institute
<120>brown planthopper resistant gene in rice BPH6 codominant marker and its application
<130> KHP181115157.0
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 5777
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 1
aacatccgtc tcgtgctcgc gctcgcgcag aagcccatct atccaagcat tccaattgct 60
gctgcttcca tcggtcggcc agaattgctg catgctgttg tcttaagtta tttggagcat 120
tcttcagttc gtctatctag cctgacttca tacttgcttc acctggctca gggcctctgg 180
cgctctgttc tatatatata ctcaggtacg tattagtaat aactaattat atttcttgta 240
acaatgcatc aacttaatta atttgcgtct cgctcgatca gtgttactta gtttatttgt 300
tcatcgatct ttgaaaaaaa gaagaagcag ttctactgat tatatatcaa aacatcaatt 360
gattatatat ggttgatgta attgttgtgt atatgtgtgt aggtggcgag tggaattgat 420
cggttgatac aatctgatac gatgggttag attaattgat tttctgacga ttctcctctt 480
cctgatcacc atgattaaat atgtacacct tctaattgca ctttcacatt ctcgaattat 540
ataagcatgt ctatttctgt gtttatttcc ttttatttga tcaattgatt tgagacgttg 600
atggcttaac gtgcgcacat aacatcaata ttagtcgtcc aaattcacga tatatttaag 660
tgtataaaag ctggaatata tcttggcttg gggagggggc ttattagcgc cagtgtgaaa 720
tggtttagct agcatatgaa tggcacataa ttgcttatct acatgaatcc agttttttct 780
tagtgaaata catggccagg ggtggtgtca cttatattca tgaactttaa aaatagcacg 840
tttagatccg taaacttggt ttaatatact acccccgatc caatcatctt ttgaccacta 900
acgtggcatg tcacgtaggc aacactcttg tgctcagtcc cctccacata tatcttcgca 960
cataacttgc cctgaccagt tcatttcaac ccatccccaa aaatatccct aaatcggcta 1020
gggcttcgac ggtgaggtta gcggaaggag gccgagaggt agcggctatg gcggcctcgg 1080
cggtgatatt agcggcagga ggcagcgctg tgtagcgggg ttagcggtgg cacagtgcgg 1140
ccggattagc tacgggagtc agcgcaatgg caattgctaa tcgggaccgc attttctata 1200
catacaagga gaagagtgag agggaagaac gatttgagga tttttttttt tgggtgggat 1260
tctagtgtct caatatagct aaaaggagat atatgcgatg tgttgtgatg tggagggggc 1320
tgagagcaaa tgtattgtct acgtggtcaa acacagtcaa aggatgttta gaccggggtg 1380
gtacgttaaa cgaagttcac agacttaaac gtgcaatttt caaattcaca tatctaagtg 1440
acaccaccac acaaatttag tgaccggcca tgtattttac tcttttttaa aaaaaactaa 1500
aagtcagctt agagcgtgcc tgcactacca ccaactcctt tcagttacta gtactagtag 1560
gactgcgcag ccttgtagtc taacggaccc aaaacttgtt ttgttaatta aaaaaaaaga 1620
tcttatttgt acactacact tatgttgcct cttcaagcta attttatcag taaccattta 1680
ttactcgttc tatccatttt tattttttta aagcacacat ctcattaatc cttcaaagcc 1740
acttgtaaat tctaaaattc atttggccgt aaccagtagt tgtttcatct gatccggaag 1800
atttcagatg ttaaacacca gccacagcca gcacacacta gtagctggta gcctcgcaga 1860
tgcacatcga ctaatttgtt gctccatata tatacatgta tacactagat cagggtatgc 1920
atttcgtatg ctttactttc tttaatcgat tgatccaaca ccagaattaa taaggtggcc 1980
tctcactttt ttcttaactg cttactccac cacaggggtt cgatggtcga gacgtcgctg 2040
gcgctagaaa tgacatactc tggtatctcc gatacagggc tgattataaa gtcatctatt 2100
ttgatggctg gtatggattt ggggcctccg cagtgcttcg atcggtagca caagtgcttc 2160
ggtcagagaa agctagtcca gaactaagct tcgacaggat aatttacata gattgctcat 2220
gctggaaaag tagaagggca atgcagagaa agattgcaga ggaactaaaa cttgacagtg 2280
aaacaatggc cctatttgat aagaaggatg aggatgatga cttccgtgga ccggaccaag 2340
gctctaggga cgtgatacac agtgtttcag caaccattta taaaaccttg atgggatcaa 2400
gattcataat catctttctt aatggaagtg atgacgagat ggatatgcca cgctttggca 2460
ttccaacctt tcaagaatat gacaacaata aaatgatatg gacattcagt agaaggttcc 2520
ccactgtgaa tagagaatac tcagatataa aagacaaact acgacacacc cacctttcca 2580
gtatattcaa caatggaggc aacgaattat caagttcaga gttttgtgca ctgctgcgcg 2640
aggaggctga taccataatt tctcgccatc catccatgac aggctttgac acagcaatgg 2700
ccatgaactg ttgcctgtat gagttatttc tgcgatataa tttccacaca gctactaaat 2760
ttggttgggt ttctcatgct tccaactact ggttatgtga tggaattata caagagaaca 2820
tagcaaaaag tattagcagt gcactacagc aagagataag atgggactgt gatgattctt 2880
cccttgacac tgcccttgaa gagttcatga aagagccccc ctttatggtt gttaaagatg 2940
acaatgtata tggagctggg caatatcact ggatttcaat cacatccaaa gatacagaag 3000
ttagcagcat gcagtctata cctgcagtga catcctcctt cttcctgaca tttgaaacag 3060
cggatgattc aaaaccaaaa gctttaccag ccagcatttt tagacattcc agcaacctta 3120
gagtgctagt tctctgctat tgtggctttg attttgcatc tcctcctttc ctcatatgcc 3180
atggcctaaa attccttgga ttggaccatt gtactaatga tagtacatgc gaaagggatc 3240
aacatgtgga ttggacagct ttatctagtc tatatgtgct ggatctacgt tacacagagt 3300
gggatgagat cacttctcaa gaaaaaatag cactcatgta taaccttcaa gagctaaaca 3360
tagtgggatt cagatgctgg caacactatg caaggagact acaaggacag ctaccttgcc 3420
tccgtaggct ccgagtggtc aaacctacgg atcaggcaga tatatcaaca gacattgcca 3480
actcctttgt ggagaagaca caactagaaa tacttgatct ctctggggac actagcatgg 3540
aaactattcc caacagcatg tcaaatgtgg atagcctatt ggtgcttatt gtagatggtt 3600
gtgataggtt gaaaaatgtt attgtgtctg atggtgtttt tccttcactc acatccttca 3660
gttttgatgg ctacggacca acataccatt gggcatcaac agttgagttg cctccaaaag 3720
aaatgcgtcc ttttgtagat aacaagagag atataaaaac ttgtaagatc tctttaaaag 3780
gctgcgcacg attggagaac ctattcttaa ggcagctacc caacctagtg gagctagacc 3840
tctctggaac tgcaataaag atacttgatt ttacaagtat ggtggtggaa gtctcatgtc 3900
tcaagcgact atttctgcta ggatgcaagc aactccatgc aataaaatgg gacaatagtg 3960
gttcaacgat aaagccggac ctagagttgt tgtgcgttga cacaaggtct agaagtaaat 4020
atcctcagtt atttgttgac aagaataaat cccccggttt cttgtcagtc catgctgtta 4080
ttgtggacgc gagaattgct cggtccttat acgctctaat agaaaagacc tcatatcatg 4140
ttgatatgaa tatccatgtc acctcttcga cggtatatag tgaagttgaa tccgaaggaa 4200
cctacagaga tagcattagc caattaaggg atcatgtgaa catgcagcaa caagaccttc 4260
gttcagcagg ccagtaccat gatgtccaac ttagcatggt tggcgatgtc ccaatgcagt 4320
cattccccct tcctccgaca acaatgttga gccgccatat cgagattgca caggggagcc 4380
acaacctgga gagcgagctg gatgatgatt caccgattcc tactttagct catctagcga 4440
aacacaaggc tgagtcactg catgtgcatg atctctcaac catcactcct ttgcccggag 4500
aacaatggcg ctgtctcaag tggtgtcgta tagagaggtg cccgaagata gaaattgtct 4560
tccctagata cgcatggaat ttcgaccgtc tggaaaccgc ctgggtgtcg gatctcttga 4620
tggcccgttg catctggagt aaaggaccta gccagtaccg tggttccttc caaaatctgc 4680
agcacctgca cctgcgcagc tgcccaaggc tccagttcgt gctcccggtg tgggtctcct 4740
ccttcccgga cctgaaaacc ctccacgtca tccactgcag caacctccac aacatcttcg 4800
tgctggagga cggagattac ccagagcaaa taaccgtcaa aggtgtagca ttcccgaagc 4860
taaccaccat ccacctgcac gacctcccga tgctgcggca gatttgcgac gtcgagttca 4920
agatggtggc tcccgcgctt gagaccatca agatcagggg atgctggggc ctgcgccggc 4980
tgccggccgt cgctgcggat ggaccgaagc cggccgtgga gatcgagaag gacgtgtggg 5040
acgcgctgga gtgggacggg gtggaagccg accaccaccc ttccctcttc caggcgccgg 5100
tgcactcgcg ctactacagg aagaagctgc ccaggggctc cgtcctcagg tatatgtacg 5160
gtgcatgcat cggaccatgt acctagctag ctgctccatc ttgatttatt tgcataatac 5220
ttgttctcag ttatttcatt tgtttgatct gtgcttaatc aatttgcttt ctctgtctac 5280
tgttatattt gttgcctagg tgaattgaat ccctgggctt gggcggccat gatttgggga 5340
ttgattggcg acgaatgatg gtgaatcagt gagatgcttc ttgcttgctt ctgttgggtg 5400
atttgtctcc ggtgatgttg cagcaagctt tgtggtgtga gctgtgtgac gggcacggac 5460
tgaccgtggc tcgatcttgt cctcgtatat ggccgagttg gccagagagc gagattgcca 5520
tggctctgaa ataataagcg gctttgtttg tgcgtggatg cacagaccag ctgattgagt 5580
gagtgtgtgt ttcttgaatt taattagcat tctgggtgtg gatgctcaga tgcatgtgcg 5640
tgtgtggctt gatatgatga tctgctttgc gtttgaaaca ataataagca gtagccattt 5700
gtgcctgcga gcatatgtat gtggctgctg cagtgtgact gtgtgagagt gcattgcttg 5760
tgtgtaactg aattctg 5777
<210> 2
<211> 19
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 2
agggcctctg gcgctctac 19
<210> 3
<211> 24
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 3
aatgtgaaag tgcaattaga aggt 24
<210> 4
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 4
atagtgaagt tgaatccgaa gg 22
<210> 5
<211> 22
<212> DNA
<213>artificial sequence (Artificial Sequence)
<400> 5
agtgactcag ccttgtgttt cg 22
Claims (9)
1. the molecular labeling of brown planthopper resistant gene in rice BPH6, which is characterized in that the molecular labeling is to contain such as SEQ ID
188th polymorphism shown in NO.1 is the nucleotide sequence of T/C, and/or, to contain as shown in SEQ ID NO.1 the
4438~4445 polymorphisms are the nucleotide sequence of-TGCAGGGG-3 ' of 5 '-CGAAACAC-3 '/5 '.
2. the amplimer of molecular labeling described in claim 1.
3. amplimer according to claim 2, which is characterized in that its nucleotide sequence is as follows:
SEQ ID NO.2:AGGGCCTCTGGCGCTCTAC；
SEQ ID NO.3:AATGTGAAAGTGCAATTAGAAGGT；
SEQ ID NO.4:ATAGTGAAGTTGAATCCGAAGG；
SEQ ID NO.5:AGTGACTCAGCCTTGTGTTTCG。
4. a kind of detection kit of brown planthopper resistant gene in rice BPH6, which is characterized in that comprising described in claim 2 or 3
Amplimer.
5. molecular labeling described in claim 1 or amplimer described in claim 2 or 3 or examination as claimed in claim 4
Application of the agent box in the genotype or rice brown planthopper resistant character of identification brown planthopper resistant gene in rice BPH6.
6. molecular labeling described in claim 1 or amplimer described in claim 2 or 3 or examination as claimed in claim 4
Application of the agent box in rice brown planthopper resistant kind molecular breeding.
7. application according to claim 5 or 6, which comprises the steps of:
(1) genomic DNA of rice to be measured is extracted；
(2) genomic DNA obtained using step (1), using amplimer as claimed in claim 2 or claim 3, is carried out as template
PCR amplification；
(3) according to the sequence signature of amplified production, judge the genotype of BPH6；
(4) the brown planthopper resistant phenotype of rice is judged according to the genotype of BPH6: as shown in SEQ ID NO.1 the 188th for T,
It is then brown planthopper resistant phenotype, it is then brown paddy plant hopper susceptible phenotype that the 188th, which is C, as shown in SEQ ID NO.1；Such as SEQ ID
4438th~4445 nucleotides sequence shown in NO.1 is classified as 5 '-CGAAACAC-3 ', then is brown planthopper resistant phenotype；Such as SEQ
4438th~4445 nucleotides sequence shown in ID NO.1 is classified as 5 '-TGCAGGGG-3 ', then is brown paddy plant hopper susceptible phenotype.
8. application according to claim 7, which is characterized in that the genotype for judging BPH6 is expands according to electrophoresis detection
Volume increase object type of strip is judged.
9. application according to claim 7 or 8, which is characterized in that the standard of the genotype of the judgement BPH6 is as follows: such as
Amplified production is 283bp band, and rice to be measured carries BPH6 brown planthopper resistant allele；If amplified production is 361bp band, to
It surveys rice and carries BPH6 brown paddy plant hopper susceptible allele；If amplified production is two kinds of banding patterns of 283bp and 361bp, rice to be measured is
BPH6 brown planthopper resistant allele and brown paddy plant hopper susceptible allele heterozygous rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811140942.4A CN109055598B (en) | 2018-09-28 | 2018-09-28 | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811140942.4A CN109055598B (en) | 2018-09-28 | 2018-09-28 | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN109055598A true CN109055598A (en) | 2018-12-21 |
| CN109055598B CN109055598B (en) | 2021-11-02 |
Family
ID=64766407
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811140942.4A Active CN109055598B (en) | 2018-09-28 | 2018-09-28 | Rice brown planthopper resistant gene BPH6 codominant molecular marker and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN109055598B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110846432A (en) * | 2019-11-27 | 2020-02-28 | 广西壮族自治区农业科学院 | Codominant fluorescent molecular marker and detection method of brown planthopper resistant gene Bph3 |
| CN110951748A (en) * | 2019-12-16 | 2020-04-03 | 武汉大学 | Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application |
| CN111621589A (en) * | 2020-06-24 | 2020-09-04 | 南京农业大学 | Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof |
| CN114438242A (en) * | 2022-01-06 | 2022-05-06 | 武汉大学深圳研究院 | SNP marker for identifying brown planthopper resistant gene Bph43 of rice and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914531A (en) * | 2010-08-19 | 2010-12-15 | 武汉大学 | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof |
| CN106148353A (en) * | 2015-04-13 | 2016-11-23 | 武汉大学 | Brown planthopper resistant gene in rice Bph6 and closely linked molecular marker thereof |
-
2018
- 2018-09-28 CN CN201811140942.4A patent/CN109055598B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101914531A (en) * | 2010-08-19 | 2010-12-15 | 武汉大学 | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof |
| CN106148353A (en) * | 2015-04-13 | 2016-11-23 | 武汉大学 | Brown planthopper resistant gene in rice Bph6 and closely linked molecular marker thereof |
Non-Patent Citations (1)
| Title |
|---|
| ACCESSION：KX818198: "Oryza sativa cultivar Swarnalata BPH6 gene, complete cds", 《GENBANK》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110846432A (en) * | 2019-11-27 | 2020-02-28 | 广西壮族自治区农业科学院 | Codominant fluorescent molecular marker and detection method of brown planthopper resistant gene Bph3 |
| CN110951748A (en) * | 2019-12-16 | 2020-04-03 | 武汉大学 | Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application |
| CN110951748B (en) * | 2019-12-16 | 2021-10-22 | 武汉大学 | Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application |
| CN111621589A (en) * | 2020-06-24 | 2020-09-04 | 南京农业大学 | Molecular marker of brown planthopper resistant gene qBPH6 of rice and application thereof |
| CN114438242A (en) * | 2022-01-06 | 2022-05-06 | 武汉大学深圳研究院 | SNP marker for identifying brown planthopper resistant gene Bph43 of rice and application thereof |
| CN114438242B (en) * | 2022-01-06 | 2024-04-19 | 武汉大学深圳研究院 | SNP marker for identifying brown planthopper resistant gene Bph43 of rice and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN109055598B (en) | 2021-11-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109055598A (en) | Brown planthopper resistant gene in rice BPH6 codominant marker and its application | |
| CN103305510B (en) | Rice blast resistance gene Pi9 gene specificity molecular marker Pi9SNP as well as preparation and application thereof | |
| CN101687901B (en) | Corn polymorphisms and methods of genotyping | |
| CN104073487B (en) | The molecule marker of rice blast resistant gene Pi2 and application thereof | |
| CN109468315A (en) | Rice is resistance to flood gene Sub1 codominant marker and application | |
| CN106011134B (en) | The anti-clubroot CRb genes of Chinese cabbage isolate molecular labeling TCR540, primer and application | |
| CN105907884B (en) | Rice blast resistant gene Pita specific molecular marker primer and application | |
| CN108411028A (en) | Special SNP codominant markers primer and application in Rice Salt gene SKC1 genes | |
| CN104152450B (en) | The InDel molecular labelings isolated with cucumber powdery mildew resistance main effect gene | |
| Zaïm et al. | Combining QTL analysis and genomic predictions for four durum wheat populations under drought conditions | |
| CN109628627A (en) | The SNP marker development and application of broad-spectrum rice-blast resistant gene of paddy rice Pigm | |
| CN106755434B (en) | The molecular labeling of rice grain length gene qGL3 a kind of and its application | |
| CN108165656A (en) | Wheat molecular marker and its application in wheat powdery mildew resistance is identified | |
| CN109924121B (en) | Method for improving rice blast resistance of rice | |
| CN110042171A (en) | Identify the method and related molecular marker of Yield Traits of Wheat | |
| CN108998564A (en) | InDel molecular marked compound, detection method and the application of blast resistant gene Pid3 | |
| CN105441457A (en) | Gene qTGW2-1 related with thousand kernel weight of rice under low nitrogen conditions, and molecular marking method thereof | |
| CN107937397A (en) | SNP marker and its preparation method and application with tomato male sterility gene close linkage | |
| CN107447026A (en) | A kind of specific molecular marker primer of brown planthopper resistant gene in rice BPH3 genotype identifications and its application | |
| CN107488731A (en) | Special SNP codominant markers primer and application in brown planthopper resistant gene in rice BPH9 genes | |
| CN109554494A (en) | The general codominant marker and its detection method of rice brown planthopper resistant BPH9 multiple allele and application | |
| CN106755355A (en) | A kind of molecular labeling TaSnRK2.3B related to thousand grain weight of wheat and stalk soluble sugar content and its application | |
| CN107988337A (en) | A kind of labeling method and its application of rice blast resistant rice identification method and gene | |
| CN105176994B (en) | Rice blast resistance gene Pi9 specific Function molecular labeling Pi9FNP and method and application | |
| CN111334597B (en) | SNP (Single nucleotide polymorphism) site and KASP (Kaempferi protein) marker for detecting powdery mildew resistance of watermelon and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |