CN110951748A

CN110951748A - Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application

Info

Publication number: CN110951748A
Application number: CN201911291214.8A
Authority: CN
Inventors: 何光存; 周聪; 杜波; 陈荣智; 祝莉莉
Original assignee: Wuhan University WHU
Current assignee: YUAN LONGPING HIGH-TECH AGRICULTURE Co.,Ltd.; Wuhan University WHU
Priority date: 2019-12-16
Filing date: 2019-12-16
Publication date: 2020-04-03
Anticipated expiration: 2039-12-16
Also published as: WO2021121209A1; CN110951748B

Abstract

The invention discloses a brown planthopper resistant gene Bph37 of rice, a protein, a vector, a host cell, a molecular marker, a method and application. The nucleotide sequence of the brown planthopper resistant gene Bph37 of the rice is shown as SEQ ID No.1, and the cDNA sequence thereof is shown as SEQ ID No. 2. The molecular marker 156-35 can be used for screening rice containing the brown planthopper resistant gene Bph37 of the rice. Through genetic transformation, the gene Bph37 is transferred into a common rice variety, so that the resistance of the rice to the brown planthopper can be improved, the harm caused by the brown planthopper is reduced, and the purposes of increasing and stabilizing yield are achieved.

Description

Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application

Technical Field

The invention belongs to the field of plant genetic engineering, and particularly relates to a brown planthopper resistant gene Bph37 of rice, a protein, a vector, a host cell, a molecular marker, a method and application.

Background

Rice is an important food crop, and is staple food for more than half of the world. As the fine genetic map and physical map of rice genome are completed, the transgenic technology is relatively easy and has collinearity with other gramineous crop genome, so that the rice genome is regarded as a model plant. With the completion of genome sequencing of various organisms including rice, humans began to enter the post-genome era. The comprehensive development of functional genome research has become the leading field of life science. Therefore, the research of the functional gene of the rice has great significance for the development of social economy and biological research.

The problem of food safety is a challenge for people all over the world. 50. The dwarfing breeding in the 60 th generation and the two technological revolution of the hybrid rice cultivation in the 70 th generation greatly improve the rice yield. The popularization of dwarf high-yield rice leads to the serious damage of plant hoppers. Especially, the frequency and the scale of the outbreak of the planthopper in the whole Asian rice production area entering the 21 st century have the tendency of gradually expanding, and the outbreak of the planthopper is the biggest threat in rice production at present. The brown planthopper occurs 3.87 million mu times per year in China, 120 million tons of paddy rice are still lost despite full-force prevention, 35.8 million yuan of RMB accounts for about 30 percent of the total loss of rice diseases and insect pests, and the brown planthopper is the first-grade pest in rice production.

At present, brown planthoppers become the first large insect pests in rice production in China, and have serious threats to the current food safety in China. For a long time, the control of brown planthoppers has mainly relied on the application of chemical insecticides. Since outbreaks of brown planthopper occur frequently in the maturing and filling stage of rice, the rice plants grow vigorously, and the operation of applying the insecticide to the base of the rice plants is very difficult. In fact, due to the fact that the chemical insecticide is applied in large quantities in successive years, the drug resistance of the brown planthopper is increased by times, and the prevention and control effect of the chemical insecticide is limited. Meanwhile, the chemical insecticide is used for preventing and controlling the brown planthopper, so that the production cost of farmers is increased, and the chemical insecticide also causes environmental and ecological problems such as poisoning of non-target organisms, pollution to the environment and grains and the like.

The cultivation of the anti-brown planthopper rice variety by using the anti-brown planthopper gene is the most economic and effective method in the comprehensive prevention and control of brown planthopper. The research results of the International Rice Research Institute (IRRI) and the rice production practice in southeast asia show that even rice varieties with only moderate resistance level can sufficiently control the brown planthopper population below the level causing harm, so that the actual harm and yield loss to rice are avoided. Therefore, the mining of the brown planthopper resistance gene of the rice and the application of the gene in a rice breeding project are fundamental measures for preventing and treating the brown planthopper of the rice.

The research of brown planthopper resistant gene of rice begins in the early 70 th century. Thirty or more major anti-pest genes for brown planthopper resistance in Rice plants have been identified and located in the resources of ordinary cultivated Rice and wild Rice (see Hu et al, 2018.Identification and fine mapping of Bph33, a new brown plant resistance gene in Rice (Oryza sativa L.). Rice 2018,11: 55). 8 genes (Bph14, Bph26, Bph3, Bph29, Bph9, Bph18, Bph32 and Bph6) have been cloned, and these genes were obtained by using the map-based cloning method (Du et al, 2009; Tamura et al 2014; Liu et al 2014; Wang et al 2015b; Zhao et al 2016; Ji et al 2016; Ren et al 2016; Guo et al 2018).

Genome-wide association analysis (GWAS) was first applied to genetic analysis of human diseases. In recent years, with the rapid development of genome technology, especially the improvement of sequencing technology means, whole genome sequencing of many animals and plants has been completed, and GWAS becomes a powerful tool for researching complex traits of crops. Compared with the traditional map-based clone discovery gene, the correlation analysis method has the advantages of no need of constructing a special mapping population, time saving, realization of fine positioning and the like. Meanwhile, GWAS breaks through the limitation that the map-based cloning method is generally suitable for smaller genome species, and only needs the SNPs markers and phenotypic traits of the whole genome. In recent years, GWAS analysis methods have also been developed rapidly. Research results of scientists and international colleagues in China show that the GWAS method discovers target genes in aspects of crop morphological characters, physiological characters, yield-related characters and the like. For example, LOC _ Os01g62780, LOC _ Os11g08410, NAL1(Yano et al 2016, Genome-side association study using Genome-Genome sequencing along information in rice site, Nature Genetics,48: 927-.

Disclosure of Invention

The invention aims to provide a brown planthopper resistant gene Bph37 of rice, a protein, a carrier, a molecular marker, a method and application. The invention utilizes a GWAS method to identify the brown planthopper resistant gene Bph37 of rice. The function of the gene is verified by genetically transforming the Bph37 gene to ensure that the susceptible rice has a brown planthopper resistant phenotype.

In order to achieve the purpose, the technical scheme of the invention is as follows:

in a first aspect, the invention provides a brown planthopper resistant gene Bph37 of rice, which is characterized in that: the nucleotide sequence of the gene is shown in SEQ ID NO. 1. The gene has a full length of 1279bp, 1 intron and 2 exons, CDS is respectively segment 1-116bp and 523-1279bp, and cDNA has a full length of 873 bp.

Preferably, the cDNA sequence of the gene is shown in SEQ ID NO.2, and 291 amino acids are coded.

In a second aspect, the invention provides a protein encoded by the brown planthopper resistant gene Bph37 of rice, which is characterized in that: the amino acid sequence of the protein is shown as SEQ ID NO. 3.

It is understood that the amino acid sequence shown in SEQ ID NO.3 can be variously substituted, added and/or deleted by one or several amino acids by those skilled in the art to obtain an amino acid sequence having equivalent functions without affecting the activity of the BPH37 protein (i.e., without being in the active center of the protein).

In addition, the polynucleotide sequence encoding the protein may be modified, for example, in its coding region, without altering the amino acid sequence, or in its non-coding region, without affecting the expression of the protein, taking into account the degeneracy of the codon. Therefore, the present invention also includes the substitution, addition and/or deletion of one or more nucleotides of the polynucleotide sequence encoding the protein, and the nucleotide sequence encoding the protein with the same function.

The present invention provides the above-described polynucleotide fragment operably linked to a homologous or heterologous promoter sequence.

In a third aspect, the invention provides a vector containing the brown planthopper resistant gene Bph37 of rice. The vector includes a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof.

The invention also includes, based on the sense or antisense sequence of the polynucleotide, cloning or expression vectors containing the polynucleotide sequence or a fragment thereof, host cells containing the vectors, transformed plant cells and transgenic plants containing the nucleotide sequence or a fragment thereof.

In a fourth aspect, the present invention provides a host cell containing the brown planthopper resistance gene Bph37 of rice, which is characterized in that: the host cell is a plant cell transformed with the nucleotide sequence or a fragment thereof.

In a fifth aspect, the invention provides a transgenic plant transformed with the nucleotide sequence containing the brown planthopper resistance gene Bph37 of rice or a fragment thereof.

In a sixth aspect, the invention provides a molecular marker of the brown planthopper resistant gene Bph37 of rice, which is characterized in that: the molecular marker is 156-35, and the primer pairs for amplifying the molecular marker 156-35 are as follows:

forward primers 156-35F: TTGCTCATGGGTGTGCAGAAG, the sequence of which is shown in SEQ ID NO. 4;

reverse primer 156-35R: TTGGGGGTGTCAAAGCCTAC, the sequence of which is shown in SEQ ID NO. 5.

In a seventh aspect, the invention provides a molecular detection method of the brown planthopper resistant gene Bph37 of rice, which is characterized in that: amplifying the genomic DNA of the rice to be detected by the primer pair, and detecting an amplification product: if 825bp of amplified fragment is amplified by using the primers 156-35F and 156-35R, the existence of the brown planthopper resistant gene Bph37 of the rice is marked.

In an eighth aspect, the present invention provides a method for screening brown planthopper-resistant rice, which is characterized in that: amplifying the genomic DNA of the rice to be detected by the primer pair, and detecting an amplification product: if 825bp of amplified fragment is amplified by using the primers 156-35F and 156-35R, the existence of brown planthopper resistance of the rice variety is marked.

In a ninth aspect, the invention provides application of the molecular marker of the brown planthopper resistant gene Bph37 in breeding brown planthopper resistant rice.

Meanwhile, the scheme of the invention also covers a method for cultivating the plant with the resistance to the brown planthopper, which comprises the following steps:

1) transforming a plant cell with the polynucleotide; the polynucleotide contains a rice brown planthopper resistant Bph37 gene, and the nucleotide sequence of the polynucleotide is shown in SEQ ID NO.1 or SEQ ID NO. 2;

2) regenerating the transformed plant cell into a plant;

3) culturing the regenerated plant and expressing the polynucleotide.

Also encompassed within the scope of the present invention are methods of producing plants that are resistant to brown planthopper comprising crossing a plant having the brown planthopper resistance gene Bph37 with other plants to produce progeny plants that are resistant to brown planthopper. Wherein the plant is a monocot; preferably, the plant is rice.

It will be appreciated by those skilled in the art that the design or generation of molecular markers based on the disclosed sequences can be used for the breeding of brown planthopper-resistant rice.

The Bph37 gene is obtained by cloning through the following steps:

(1) collecting the natural population of the rice. 1520 parts of rice variety of 74 countries, 12 types, all over the world, was used as a brown planthopper resistant gene mapping population.

(2) And (4) identifying brown planthopper resistance. And (3) identifying the brown planthopper resistance of the positioned population by the weight gain rate of the brown planthopper. Approximately 8 seeds per portion of material were sown in a plastic cup (10X 15 cm). And in the 5-leaf stage, weighing the initial weight of the newly emerged female insects by using a ten-thousandth electronic balance, then putting the initially weighed female insects into a wax bag (2 multiplied by 2cm) made of a sealing film, fixing the initially weighed female insects on a leaf sheath, weighing the weight of the brown planthopper after 48 hours, calculating the weight gain rate, and repeating the experiment for 12 times on each material. The average value after removing the extreme values of the weight gain rate was taken as the resistance value of each rice variety to brown planthopper.

(3) And (3) carrying out brown planthopper resistant gene localization on rice. Significant association sites were detected for chromosomes 6 from 0.81 to 1.57M using a mixed linear model of EMMAX software.

(4) And (5) determining a candidate gene. NBS-LRR gene, LOC _ Os06g03500, was selected as a candidate gene based on the gene function annotation of the candidate gene in the Nippon nitrile reference genome in the interval 0.81-1.57 Mb.

(5) And selecting materials for resisting brown planthopper. 1520 material lots were divided into haplotype A and haplotype B based on the peak SNP of the associated region. The resistance of the material of haplotype B to brown planthopper is obviously higher than that of the material of haplotype A. SE382 in haplotype B was selected as the material for amplification of LOC _ Os06g 03500.

(6) Full-length cDNA clones. Designing a primer according to a predicted cDNA sequence, amplifying a 310bp fragment from the cDNA of brown planthopper resistant rice SE382, designing the primer according to the fragment sequence, obtaining the 3 'end and 5' end sequences of the cDNA by RACE (rapid amplification of cDNA ends), and finally obtaining the full-length cDNA of Bph 37.

However, it will be understood by those skilled in the art that the Bph37 gene can be amplified from the brown planthopper-resistant rice genome by designing appropriate PCR primers based on the nucleotide sequence of Bph37 disclosed in the present invention.

(7) The Bph37 gene is genetically transformed to verify the function of the gene. According to the ORF sequence of the Bph37 gene, a 873bp fragment containing the ORF of the Bph37 gene was amplified by PCR and ligated into XcmI-digested pCXUN vector after addition of A. After sequencing verification, the obtained vector is a Bph37 gene genetic transformation vector, and the vector is transferred into agrobacterium EHA 105.

An agrobacterium EHA105 mediated genetic transformation method is adopted to introduce the over-expression vector into a normal japonica rice variety Nipponbare, and finally 20 strains of Bph37 positive plants are obtained. The insect resistance identification is carried out by using plants of T1 generation. And (3) identifying the seedling stage by adopting a seedling stage group method, wherein all the Nipponbare died in contrast to rice, the transgenic positive plant survives, and the insect-resistant grade is 1-5. The Bph37 gene is proved to have the function of resisting brown planthopper. Therefore, the brown planthopper resistant gene Bph37 of the rice can be applied to the rice and can also be applied to rice seeds to cultivate rice varieties with brown planthopper resistant performance.

The invention has the advantages and effects that:

(1) the invention successfully clones the brown planthopper resistant gene Bph37 of rice by utilizing GWAS.

(2) The Bph37 gene cloned by the invention has obvious brown planthopper resistance, which is of great significance for comprehensively understanding the diversity of brown planthopper resistance gene types of rice.

(3) The Bph37 improves the brown planthopper resistance of rice, and the Bph37 is applied to rice breeding through genetic transformation or hybridization to improve the brown planthopper resistance of rice varieties, so that the harm of the brown planthopper is reduced, and the purposes of increasing yield and stabilizing yield are achieved.

(4) The piercing-sucking insects are a large class of insect pests in agricultural production, and Bph37 gene cloning and brown planthopper resistance functions prove that the piercing-sucking insects have an important reference effect on the anti-piercing-sucking insect research of other plants.

Drawings

FIG. 1 shows the geographical distribution of 1520 rice varieties.

In the figure: the distribution of 1520 rice varieties in 74 countries worldwide is illustrated; the size of the pie chart is proportional to The number of rice varieties from this country; the area of the sectors of different colors in each pie chart is proportional to the rice type The number of varieties.

FIG. 2 shows the results of identifying the rice variety 1520 against Nilaparvata lugens.

In the figure: the graph shows the weight gain rate histogram of the rice variety 1520 h eaten by brown planthopper; in the figure, the abscissa WGR represents the weight gain rate of the brown planthopper, and the ordinate represents the number of rice varieties; the insect source is brown planthopper biotype I.

Figure 3 shows GWAS results.

In the figure: illustrated is a manhattan plot of whole genome association analysis; each dot represents a SNP marker and a brown planthopper resistance ₁₀The correlation degree of the sex is higher, the smaller the p value (-log10(p) is larger), and the correlation degree with the resistance of the brown planthopper is higher; log (p) exceeds a threshold value 8 is considered a significant association site; chromosome 6 0.8-1.57Mb is the region of highest degree of association of the whole genome ₁₀log (p) far above threshold 8; the model used was a mixed linear model of the EMMAX software.

FIG. 4 is the result of haplotype A and haplotype B resistance to Nilaparvata lugens.

In the figure: 1520 parts of rice material were divided into two haplotypes according to the different forms of peakSNP, haplotype A brown fly The louse Weight Gain Ratio (WGR) is significantly higher than haplotype B, i.e. haplotype B is more resistant to brown planthopper.

FIG. 5 shows the identification result of the transgenic rice against brown planthopper.

In the figure: fruiting 7 days after the transgenic plants are released with insects; TN1 is local No.1 in the station, is sensitive to brown planthopper, 156-13 Is a Bph37 transgenic negative plant, 156-17, 156-15 and 156-32 are Bph37 transgenic positive plants. Transfer of Bph37 Gene The gene positive strains have obvious resistance to brown planthopper.

FIG. 6 is an example of a functional molecular marker 156-35 developed from the genomic sequence of Bph37, with an amplified fragment length of 825 bp.

In the figure: SE382 is an insect-resistant parent carrying a brown planthopper-resistant gene Bph37 of rice, Yangdao No. 6 (93-11) is a susceptible insect ₂Rice, F2-1 to F2-11 are insect-susceptible rice in an F population constructed by crossing SE382 with Yangyang rice No. 6, and F2-12 to F2-22 are ₂SE382 and Yangyang rice No. 6 are crossed to construct insect-resistant rice in F population.

Detailed Description

The invention is further described in detail below with reference to the figures and specific examples.

Example 1 cloning of Bph37 Gene and molecular marker development

1.GWAS

1520 rice varieties, covering 12 types, were obtained from the institute of crop science, academy of agricultural sciences, china, and located in 74 countries worldwide (fig. 1). The resistance of 1520 rice varieties to brown planthopper was determined by measuring the weight of the female adults of brown planthopper before and after feeding. 8 seeds of each test rice variety were sown and grown in a plastic cup (9X 15 cm). Resistance tests were performed on five-leaf stage rice plants. Freshly emerged brown planthopper biotype I female adults were collected and weighed on an electronic balance (Shimadzu; type: AUW 120D). Selecting brown planthopper with initial weight of 1.80-2.70 mg for experiment. Each brown planthopper was placed in a 2X 2cm film bag made of a sealing film and then fixed on a rice plant 1 cm from the soil. The brown planthopper takes the leaf sheath for 48 hours, and then the body weight is measured again to obtain the body weight for 48 hours, thereby obtaining the body Weight Gain Rate (WGR) of the brown planthopper. For each rice variety, the resistance level was indicated by the rate of weight gain of 12 brown planthoppers. The level of resistance to brown planthopper exhibited a left-biased distribution in 1520 rice varieties (FIG. 2), i.e., the pest-susceptible variety was much more numerous than the pest-resistant variety. The 3K rice genome data has been published (Li, Z, et al, 2014The 3,000rice genome project, GigaScience 3, 7). Whole genome SNPs data with minor allele frequency more than 0.01 and deletion rate less than 0.2 are extracted by plink software. As the population structure is obvious, the first 7 main components (Q) are used as fixed effects, and the bag-Nichols genetic matrix (K) between each individual is used as random effects to correct the population structure. GWAS analysis was performed using a mixed linear model in EMMAX software. The whole genome significance threshold was evaluated using the formula P ═ 0.05/N (N is the number of SNPs). Significance p-value threshold of about 1.0 × 10^-8。

2. Determination of candidate genes

A remarkably related SNPs cluster exists in chromosome 6, 0.8-1.57Mb (figure 3), and the region is shown to contain a brown planthopper resistant gene of rice and serves as a candidate region. NBS-LRR gene, LOC _ Os06g03500 in the candidate region was used as a candidate gene according to Nipponbare reference genome gene function annotation information (http:// rice. plant. msu. edu /). 1520 material lots were divided into haplotype A and haplotype B based on the peak SNP of the associated region. The resistance of the material of haplotype B to brown planthopper is obviously higher than that of the material of haplotype A. SE382 in haplotype B was selected as the material for amplification of LOC _ Os06g 03500.

RACE obtaining Bph37 full-length cDNA

The brown planthopper resistant parent SE382 leaf sheath total RNA reverse transcription product is used as a template, a primer is designed according to a gene prediction result, and a section of cDNA sequence of a candidate gene is amplified. Through the sequence design primer, 5 'and 3' FullRACE kits of TaKaRa are used to obtain the 5 'end and 3' end sequences of the candidate gene, determine the transcription initiation site and termination site of the candidate gene, and splice the full-length cDNA sequence of the gene. And (3) re-synthesizing a primer according to the full-length cDNA sequence, and amplifying to obtain the full-length cDNA of Bph37, wherein the nucleotide sequence of the full-length cDNA is shown as the sequence table SEQ ID NO. 2.

4. Molecular marker of brown planthopper resistant gene Bph37 of rice

Compared with the sensitive material, the 474bp deletion exists in the Bph37 intron region. In the resistant parent, the length of the marker 156-35 amplified fragment is 825 bp; in the susceptible parent, the marker 156-35 amplified fragment is 1299bp in length. Thus, molecular labeling was performed using:

156-35 labeled primer:

a forward primer sequence TTGCTCATGGGTGTGCAGAAG, shown as SEQ ID NO. 4;

a reverse primer sequence TTGGGGGTGTCAAAGCCTAC, shown as SEQ ID NO. 5;

the DNA of the rice brown planthopper resistant variety or breeding material is amplified, if primers 156-35 are used, an amplified segment of 825bp can be amplified, and the existence of a brown planthopper resistant gene Bph37 of rice is marked. Therefore, the molecular marking method provided by the invention has very high efficiency in identifying the existence of the Bph37 resistance gene, can predict the brown planthopper resistance of rice plants, and accelerates the breeding process of brown planthopper-resistant rice varieties.

Example 2 functional verification and application of Bph37 Gene

1. Construction of genetic transformation vectors

And (3) constructing a Bph37 gene overexpression vector. The vector used was pCXUN (provided by professor Wangganggu of Ohio State University, USA), and pCXUN vector was digested with XcmI, and the foreign fragment was added with A and ligated directly.

According to the result of RACE, ORF is directly amplified by adopting a PCR method, and is connected with the vector after A is added. After sequencing verification, the obtained vector is the Bph37 gene overexpression vector, and the vector is transferred into agrobacterium tumefaciens EHA 105. Selecting monoclonal for amplification culture, performing PCR verification, adding equal volume of 50% glycerol, mixing, and storing at-70 deg.C.

2. Genetic transformation

The above-mentioned Bph37 gene overexpression vector was introduced into Nipponbare, a brown planthopper-sensitive, general rice variety, by the Agrobacterium EHA 105-mediated genetic transformation method (Hiei et al, 1994, efficiency transformation of rice (Oryza sativa L.), mediated by Agrobacterium and sequence analysis of the DNA. planta journal 6: 271-282).

Verification of transgenic function of Bph37 Gene

The Bph37 gene over-expression transformation vector obtains 20 positive transgenic plants. After harvesting the seeds, using T₁The Bph37 transgenic plant is used for insect resistance identification by adopting a seedling stage group method. As shown in FIG. 6, the transgenic negative lines 156-13 and the transgenic positive lines 156-17, 156-15 and 156-32 were identified for the resistance to brown planthopper. The identification result is shown in fig. 6, after 7 days of inoculation of brown planthopper, the whole plant of the pest-susceptible control variety TN1 died, the transgenic negative plant withered, the transgenic positive plant grew healthily, no leaf damage, and the pest-resistant grade was 2-4, confirming that the gene Bph37 has the function of resisting brown planthopper. Therefore, the brown planthopper resistant gene Bph37 of the rice can be applied to the rice and can also be applied to rice seeds to cultivate rice varieties with brown planthopper resistant performance.

Example 3 validation of molecular markers

1. Materials and methods

1.1 materials: brown planthopper resistant parent SE382 (containing rice brown planthopper resistant gene Bph37), brown planthopper sensitive rice variety Yangdao No. 6 (93-11) and F constructed by hybridization of SE382 and Yangdao No. 6₂And (5) strain.

Molecular marker primer: 156-35, and the nucleotide sequences are respectively shown as SEQ ID No. 4-5.

1.2 methods

Extracting the genome DNA of the rice sample by a CTAB extraction method. Sample DNA was amplified using primers 156-35. 10 μ l system. A10. mu.l reaction system included: 2 XEs Taq MasterMix (Dye), 5.0. mu.l; ddH₂O, 3.7 μ l; 10. mu.M primer, 0.4. mu.l; and 50ng of DNA template. The amplification reaction was performed on a BioerPCR instrument: 3min at 94 ℃; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 60 s; 5min at 72 ℃. 156-35, the amplified products were separated on 1% agarose gel and analyzed directly after electrophoresis.

2. As a result: using the above method, 22 parts of F constructed by the hybridization of the rice varieties SE382, Yanggao No. 6, SE382 and Yanggao No. 6 respectively₂And (5) amplifying the strains. The result shows that the strains capable of amplifying the corresponding 825bp fragments by using the 156-35 molecular marker primers all show insect resistance to brown planthopper. Strains that did not produce the specific fragments showed pest sensitivity to brown planthopper (FIG. 6).

Therefore, the molecular marking method provided by the invention can accurately screen the gene Bph37 containing the brown planthopper resistance gene of rice, thereby greatly improving the breeding efficiency.

Sequence listing

<110> Wuhan university

<120> brown planthopper resistant gene Bph37 of rice, protein, vector, host cell, molecular marker, method and application

<160>5

<170>SIPOSequenceListing 1.0

<210>1

<211>1279

<212>DNA

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>1

atggcggaga cggtgctgag catggcgagg tccatgctgg ggagcgccat cagcgcggcg 60

gcggcggccg ccggcgaaga gatgagcttg ctcatgggtg tgcagaagga gatatggtgc 120

gtgcgtgtgt ctacccactc cccaattaat ttgtactagt ttcttctact tccttctgtt 180

taattacgct tcgtttagtt ccaaaataat ttttcaaact tccaactttt tcatcccatc 240

aaaattttca tacacacaca aactttcaat ttttccgtca catcgtttca atttcaatca 300

aacttacaat tttggtatga actaaacaca gccttagcag gagaggtagc taggacctag 360

ctaggcatgt agaggtagaa aagtacgccg agtcacaata cccttaataa ttcttctaat 420

ctgaattagt aaaataagaa tttagacttc cagagcaaaa tcagttattc catatgctca 480

agagtgctaa attttgtttt acctctgttt tttttttggc aggttcatga atgatgagct 540

aaaaacaatg caagcgttcc taatagctgc tgaaacattg aagaagaagg acctgctgct 600

gaaggtgtgg gctgagcaag taaggagctt gtcctacgac attgaagatt gtcttgaaga 660

gttcatggtc catgtgagaa accaaagcct cttgcagcaa ctgatgaatc tcaaagatcg 720

ccaccgaatt gctgtcaaga ttcgcaacct caaatcaaga cttgaagaag tgagcagcag 780

aaacacacgt tacaactcga tcaagatgga ggcgaacaac accttcgatg agatcgagtc 840

catggaggat gttcggaatc attctcgtag caacatcgac gaagcaaagc ttgtaggctt 900

tgacaccccc aaaaaggagt tacttgacaa gataaacatg gatgccaatg atgatgacca 960

ctgtcgggtg ctttgtgtgg ttggcatggg aggattgggt aagactactc tggtaaggaa 1020

gatctttgaa agtaaggaag acatcataaa taattttcca catcgtgctt ggatcgttgt 1080

gtcacagtca ttttcgatga tagagatgct caaagatatg attagccaac ttctaggtca 1140

tgaatcattg aaaagatttg aagggaagcc gatccgagca cacgaccttg gtacgcacct 1200

acgagatgga ctgaaagaat tgaggtactt tgttgttttt gatgactttg tggaacacag 1260

atcactggga atggattag 1279

<210>2

<211>873

<212>DNA

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>2

atggcggaga cggtgctgag catggcgagg tccatgctgg ggagcgccat cagcgcggcg 60

gcggcggccg ccggcgaaga gatgagcttg ctcatgggtg tgcagaagga gatatggttc 120

atgaatgatg agctaaaaac aatgcaagcg ttcctaatag ctgctgaaac attgaagaag 180

aaggacctgc tgctgaaggt gtgggctgag caagtaagga gcttgtccta cgacattgaa 240

gattgtcttg aagagttcat ggtccatgtg agaaaccaaa gcctcttgca gcaactgatg 300

aatctcaaag atcgccaccg aattgctgtc aagattcgca acctcaaatc aagacttgaa 360

gaagtgagca gcagaaacac acgttacaac tcgatcaaga tggaggcgaa caacaccttc 420

gatgagatcg agtccatgga ggatgttcgg aatcattctc gtagcaacat cgacgaagca 480

aagcttgtag gctttgacac ccccaaaaag gagttacttg acaagataaa catggatgcc 540

aatgatgatg accactgtcg ggtgctttgt gtggttggca tgggaggatt gggtaagact 600

actctggtaa ggaagatctt tgaaagtaag gaagacatca taaataattt tccacatcgt 660

gcttggatcg ttgtgtcaca gtcattttcg atgatagaga tgctcaaaga tatgattagc 720

caacttctag gtcatgaatc attgaaaaga tttgaaggga agccgatccg agcacacgac 780

cttggtacgc acctacgaga tggactgaaa gaattgaggt actttgttgt ttttgatgac 840

tttgtggaac acagatcact gggaatggat tag 873

<210>3

<211>290

<212>PRT

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>3

Met Ala Glu Thr Val Leu Ser Met Ala Arg Ser Met Leu Gly Ser Ala

1 5 10 15

Ile Ser Ala Ala Ala Ala Ala Ala Gly Glu Glu Met Ser Leu Leu Met

20 25 30

Gly Val Gln Lys Glu Ile Trp Phe Met Asn Asp Glu Leu Lys Thr Met

35 40 45

Gln Ala Phe Leu Ile Ala Ala Glu Thr Leu Lys Lys Lys Asp Leu Leu

50 55 60

Leu Lys Val Trp Ala Glu Gln Val Arg Ser Leu Ser Tyr Asp Ile Glu

65 70 75 80

Asp Cys Leu Glu Glu Phe Met Val His Val Arg Asn Gln Ser Leu Leu

85 9095

Gln Gln Leu Met Asn Leu Lys Asp Arg His Arg Ile Ala Val Lys Ile

100 105 110

Arg Asn Leu Lys Ser Arg Leu Glu Glu Val Ser Ser Arg Asn Thr Arg

115 120 125

Tyr Asn Ser Ile Lys Met Glu Ala Asn Asn Thr Phe Asp Glu Ile Glu

130 135 140

Ser Met Glu Asp Val Arg Asn His Ser Arg Ser Asn Ile Asp Glu Ala

145 150 155 160

Lys Leu Val Gly Phe Asp Thr Pro Lys Lys Glu Leu Leu Asp Lys Ile

165 170 175

Asn Met Asp Ala Asn Asp Asp Asp His Cys Arg Val Leu Cys Val Val

180 185 190

Gly Met Gly Gly Leu Gly Lys Thr Thr Leu Val Arg Lys Ile Phe Glu

195 200 205

Ser Lys Glu Asp Ile Ile Asn Asn Phe Pro His Arg Ala Trp Ile Val

210 215 220

Val Ser Gln Ser Phe Ser Met Ile Glu Met Leu Lys Asp Met Ile Ser

225 230 235 240

Gln Leu Leu Gly His Glu Ser Leu Lys Arg Phe Glu Gly Lys Pro Ile

245 250 255

Arg Ala His Asp Leu Gly Thr His Leu Arg Asp Gly Leu Lys Glu Leu

260 265 270

Arg Tyr Phe Val Val Phe Asp Asp Phe Val Glu His Arg Ser Leu Gly

275 280 285

Met Asp

290

<210>4

<211>21

<212>DNA

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>4

ttgctcatgg gtgtgcagaa g 21

<210>5

<211>20

<212>DNA

<213>2 Ambystoma laterale x Ambystoma jeffersonianum

<400>5

ttgggggtgt caaagcctac 20

Claims

1. A brown planthopper resistant gene Bph37 of rice is characterized in that: the nucleotide sequence of the gene is shown in SEQ ID NO. 1.

2. The rice brown planthopper resistance gene Bph37 as claimed in claim 1, wherein: the cDNA sequence of the gene is shown in SEQ ID NO. 2.

3. A protein encoded by the rice brown planthopper resistance gene Bph37 according to claim 1 or 2, wherein: the amino acid sequence of the protein is shown as SEQ ID NO. 3.

4. A vector comprising the brown planthopper resistance gene Bph37 of rice according to claim 1 or 2, wherein: the vector includes a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof.

5. A host cell comprising the rice brown planthopper resistance gene Bph37 according to claim 1 or 2, wherein: the host cell is a plant cell transformed with the nucleotide sequence or a fragment thereof.

6. A transgenic plant transformed with the nucleotide sequence containing the brown planthopper resistance gene Bph37 of rice according to claim 1 or 2 or a fragment thereof.

7. A molecular marker of the rice brown planthopper resistance gene Bph37 as claimed in claim 1 or 2, wherein: the molecular marker is 156-35, and the primer pairs for amplifying the molecular marker 156-35 are as follows:

forward primers 156-35F: the sequence is shown as SEQ ID NO. 4;

the sequence of the reverse primer 156-35R is shown in SEQ ID NO. 5.

8. A molecular detection method of the brown planthopper resistance gene Bph37 in the rice according to claim 1 or 2, which comprises the following steps: amplifying the genomic DNA of the rice to be detected by the primer pair as set forth in claim 7, and detecting the amplified product: if 825bp of amplified fragment is amplified by using the primers 156-35F and 156-35R, the existence of the brown planthopper resistant gene Bph37 of the rice is marked.

9. A method for screening brown planthopper-resistant rice is characterized by comprising the following steps: amplifying the genomic DNA of the rice to be detected by the primer pair as set forth in claim 7, and detecting the amplified product: if 825bp of amplified fragment is amplified by using the primers 156-35F and 156-35R, the existence of brown planthopper resistance of the rice variety is marked.

10. The application of the molecular marker of the brown planthopper resistant gene Bph37 of the rice as claimed in claim 7 in breeding brown planthopper resistant rice.