CN104263737B - Brown planthopper resistant gene in rice Bph28 and its application - Google Patents
Brown planthopper resistant gene in rice Bph28 and its application Download PDFInfo
- Publication number
- CN104263737B CN104263737B CN201410441422.2A CN201410441422A CN104263737B CN 104263737 B CN104263737 B CN 104263737B CN 201410441422 A CN201410441422 A CN 201410441422A CN 104263737 B CN104263737 B CN 104263737B
- Authority
- CN
- China
- Prior art keywords
- gene
- rice
- bph28
- brown planthopper
- planthopper resistant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of brown planthopper resistant gene in rice Bph28 and its applications, with nucleotide sequence shown in Seq.ID.No.1.The method that the present invention uses bioinformatic analysis and candidate gene cloning and sequencing, is separated to brown planthopper resistant gene in rice Bph28, by genetic transformation Bph28, so that brown planthopper resistant phenotype occurs in sense worm rice, it was confirmed that the function of the gene.
Description
Technical field
The present invention relates to molecular biology and agriculture field, be specifically related to a kind of brown planthopper resistant gene in rice Bph28 and
It is applied.
Background technique
Rice is one of most important cereal crops in the whole world, more than half population of the whole world is using it as staple food；Meanwhile rice
As model plant, completion had been sequenced in two subspecies genome sequences of round-grained rice Xian already.When entering Post genome to rice research
In generation, carrying out functional gene research already becomes the hot spot of life science.Therefore, parsing paddy gene function is to life science
Research and socio-economic development are of great significance.
Ensuring Food Safety is one of the significant challenge that the whole world faces.Pest and disease damage is the main of threat rice high yield stable yields
Factor.Brown paddy plant hopper is one of China and many Asian countries's rice main diseases and insect pests, adult and nymph with piercing and sucking rice juice,
Cause rice strain paralysis lodging, be commonly called as " emit and wear ", leads to Severe Reduction or lose to receive.It unites according to Chinese agriculture Technique Popularizing service centre
Meter, from 1971 to 2010 more than 30 years, the planthopper occurring area biggish time has 1987,1991,1997,1998,
2002-2010 years, totally 14 times；Wherein national big generation in 1987,1997,2005,2006 and 2007, hazard area
Up to 50% or more of the rice gross area, heavy losses are caused to China's Rice Production.The use of a large amount of insecticides, is not only paddy
Pesticide residue increases, and polluted-water, jeopardizes people's health and ecological safety.
It cultivates Resistant and is acknowledged as the prevention and treatment most economical effective method of pest and disease damage.Therefore, it studies and utilizes Rice Resistance
Brown paddy plant hopper gene is the important measures of Brown Planthopper prevention and treatment.
Pathak etc. identified a collection of brown planthopper resistant resource material in 1967.Nineteen sixty-eight anti-plant hopper breeding and gene are fixed
Position plan comes into effect.Athwal etc. (1971) carries out genetic analyses to more than 100 pest-resistant cultivars, find Mudgo, CO22 and
MTU15 is controlled by the same dominant gene, is named as Bph1.And ASD7 is controlled the resistance of brown paddy plant hopper by a recessive gene,
It is named as bph2.Bph1 and bph2 close linkage, between them without discovery recombination.Lakshinarayana etc. (1977) is right
28 kinds have carried out genetic research, and discovery wherein contains Bph1 for 9, and 16 kinds contain bph2, have a kind while including
Bph1 and bph2 gene, remaining 2 kinds contain new gene.Identified in Rathu Heenati one it is new dominant
Anti insect gene is named as Bph3.A new recessive gene is identified in Babawee, is named as bph4.Sidhu etc.
(1978) genetic analysis is carried out to 20 pest-resistant cultivars, discovery there are 7 kinds to contain Bph3, there are 10 kinds to contain bph4, remains
Under 3 kinds contain Bph3 and bph4 simultaneously.
Khush etc. (1985) carries out genetic analysis to ARC10550.The kind shows as pest-resistant (bion 4) in South Asia,
But sense worm is shown as to bion 1,2,3 in East Asia and Southeast Asia.Containing a new recessive anti insect gene in ARC10550,
It is named as bph5.
Kabir etc. (1988) carries out genetic analysis to the kind of 17 parts of brown planthopper resistant bions 4.It was found that 7 parts of materials is anti-
Property is controlled by single dominant gene, and the dominant gene in cultivar Swarnalata is named as Bph6.Remaining 10 kinds
Resistance is controlled by single recessive gene.The recessive anti insect gene and bph5 equipotential for wherein having 8 kinds to contain, are left in two kinds
Recessive anti insect gene and bph5 not equipotential, the recessive anti insect gene in T12 is named as bph7.
It is reported that the insect resistace of Thailand kind Col.5andCol.11 and Burma kind Chin Saba are all by single recessive anti-
The control of worm gene, and the anti insect gene equipotential in three kinds.Nemoto etc. (1989) is by Thailand's kind
Recessive anti insect gene in Col.5andCol.11 and Burma kind Chin Saba is named as bph8.In cultivar
An individual dominant anti insect gene, these alleles are had found in Kaharmana, Balamawee and Pokkali.
Dominant anti insect gene in Kaharmana, Balamawee and Pokkali is named as Bph9.
Bph1 and bph2 are navigated to the 4th chromosome of rice using three-body method by Ikeda etc. (1983).Later, Cha etc.
(2008) finely positioning to Bph1 is completed, by the assignment of genes gene mapping between No. 12 chromosome STS label pBPH4 and pBPH14
120kB within the scope of.Sun Lihong etc. (2006) equally bph2 is positioned to RM7102 on the 12nd chromosome using SSR marker and
Between RM463, genetic distance is respectively 7.6cM and 7.2cM.
Ikeda etc. (1981) is located in Bph3 and bph4 on No. 10 chromosomes with trisomy mapping.Subsequent Huang Chaofeng
Molecule positioning is carried out to brown planthopper resistant gene in rice Bph3 using the RH × seven thread soft F2 mapping population accounted for, by the Bph3 assignment of genes gene mapping
On the 4th chromosome long arm between PSM323 and PSM194 two label.But Jairin etc. (JairinJ., K.Phengrat,
S.Teangdeerith,et al.Mapping of a broad-spectrum brown planthopper resistance
Gene, Bph3, on rice chromosome6.Molecular breeding, 2007,19 (1): 35-44.) respectively with
The F2 group of IR71033-121-15/KDML105, the BC3F2 group of Rathu Heenati/KDML105 building and PTB33/
The BC1F2 group of RD6 building is research material, and Bph3 is positioned between the 6th chromosome RM589-RM588 using SSR marker,
Genetic distance is 0.8cM and 0.6cM respectively.(JairinJ., S.Teangdeerith, P.Leelagud, the et such as Jairin
al.Detection of brown planthopper resistance genes from different rice
Mapping populations in the same genomic location.Sci.Asia, 2007,33:347-352) it uses
The BC3F3 group of Rathu Heenati/KDML105 by Bph3 be located in No. 6 chromosome SSR marker RM19291 and RM8072 it
Between 190kB region.Wan Jianmin etc. is miscellaneous using rice pest-resistant cultivar Rathu Heenati (♀) and sense worm kind 02428 (♂)
Hand over the genotype and F of each single plant of F2 obtained2:3The resistance rank of the brown planthopper resistant of each family carries out genetic linkage analysis, obtains
Pest-resistant cultivar Rathu Heenati brown planthopper resistant key-gene Bph3, be located at the 4th chromosome molecular labeling A4 and
Between RM16533 (ten thousand build people etc., the molecule labelling method of rice varieties brown planthopper resistant key-gene Bph3, patent authorization number:
ZL200810243722.4)。
With going deep into for research, present reported brown planthopper resistant dominant gene has 17, and recessive gene has 17.These
Gene distribution is on 2,3,4,6,8,10, No. 12 chromosomes of rice, wherein located on 3,4,6, No. 12 chromosomes multiple
Brown planthopper resistant major gene resistance all only located a brown planthopper resistant gene in 2,8, No. 10 chromosomes, so far not 1,5,7,
9, brown planthopper resistant major gene resistance is detected on No. 11 chromosomes.
The brown planthopper resistant gene positioned at present is more, but only Bph14 is cloned.Du etc. (DuB., W.Zhang,
B.Liu,et al.Identification and characterization of Bph14,a gene conferring
resistance to brown planthopper in rice.Proceedings of the National Academy
Of Sciences, 2009,106 (52): 22163-22168.) with the method acquisition Bph14 of map based cloning, by complementary real
It tests and demonstrates the function of the gene with RNAi interference, and functional analysis has been carried out to the gene.Result of study shows that Bph14 is encoded
One albumen comprising 1323 amino acid, the albumen include a CC-NB-LRR structural domain.(include to 21 rice varieties
10 rice varieties, 7 japonica rice varieties and 4 wild rice varieties) in Bph14 gene and its allele coding amino
Acid sequence is compared, the results showed that, CC and NB domain conservation is good, and Bph14 albumen lacks only in LRR structural domain
54 amino acid remained by two amino acid are lost.Bph14 is expressed in the vascular tissue of the root of rice, leaf sheath and blade, sub- thin
Born of the same parents' positioning result shows that Bph14 albumen is primarily present in cytoplasm.
Summary of the invention
The purpose of the present invention is to provide a kind of brown planthopper resistant gene in rice Bph28, with shown in Seq.ID.No.1
Nucleotide sequence.
Another object of the present invention is to provide a kind of brown planthopper resistant gene Bph28 in rice breeding and brown planthopper resistant breeding
Application.
The method that the present invention uses bioinformatic analysis and candidate gene cloning and sequencing, is separated to rice brown planthopper resistant base
Because of Bph28, by genetic transformation Bph28, so that there is brown planthopper resistant phenotype in sense worm rice, it was confirmed that the function of the gene.
The nucleotide sequence of Bph28 gene of the present invention is as shown in Seq.ID.No.1, full length gene 2518bp, has 1
Exon, CDS sequence section are 1745-2329bp, overall length 585Bp, encode 194 amino acid, protein sequence is such as
Shown in Seq.ID.No.2, which is novel agnoprotein matter, and section 1~29 is signal peptide, and section 116~134 is low complexity
Structural domain, section 124~180 are SCOP:d1gkna2 structural domain.
It should be appreciated that those skilled in the art can be to Seq.ID.No.3 under the premise of not influencing Bph28 protein active
Shown amino acid sequence, which carries out various substitutions and replacement, adds or lacks one or several amino acid acquisitions, has same function
Amino acid sequence.
In addition, in the degeneracy for considering codon, such as in codified region, in the condition for not changing amino acid sequence
Under, or under conditions of its noncoding region does not influence protein expression, modify to the gene order for encoding above-mentioned albumen.Cause
This, the invention also includes the gene orders to coding albumen to carry out various substitutions and replacement, adds or lack one or several ammonia
Base acid obtains the amino acid sequence with same function.The invention also includes Sense sequences or antisense sequences based on gene,
Including cloning vector or expression vector containing the nucleotide or its gene order, the host cell containing the miscellaneous body contains
There are the nucleotide sequence or the gene-transformed plant cell and genetically modified plants.
It will be appreciated by those skilled in the art that disclosed sequence is available come the molecular labeling for designing or generating according to the present invention
In brown planthopper resistant rice breeding breeding.
The present invention obtains as follows and verifies Bph28 gene:
1, Bph28 constant gene segment C bioinformatic analysis and candidate gene are cloned
Utilize (JairinJ., S.Teangdeerith, P.Leelagud, et the al.Detection of such as Jairin
brown planthopper resistance genes from different rice mapping populations in
The same genomic location.Sci.Asia, 2007,33:347-352) with Rathu Heenati/KDML105's
BC3F3The section that group positions Bph3, the region of the 190kB between No. 6 chromosome SSR markers RM19291 and RM8072.
Bph3 finely positioning section DNA sequence dna has been downloaded from http://rice.plantbiology.msu.edu/, and has been utilized
The online predictive genes software Fgenes of http://linux1.softberry.com/berry.phtml predicts the section base
Cause predicts a gene more than 30 altogether.According to (JairinJ., S.Teangdeerith, P.Leelagud, et such as Jairin
al.Detection of brown planthopper resistance genes from different rice
Mapping populations in the same genomic location.Sci.Asia, 2007,33:347-352)
Report eliminates the candidate gene of its prediction, by remaining gene, designs its exon primer, PCR amplification Ptb33, it is bright extensive 63,
TN1, recycles amplified fragments, discovery LOC_Os06g03240 in Ptb33, bright extensive 63, there are DNA sequence dna differences by TN1.It utilizes
Http:// blast.ncbi.nlm.nih.gov/Blast.cgi? PROGRAM=blastp&PAGE_TYPE=
BlastSe arch&LINK_LOC=blasthome carries out one that 3DEE_A in sequence alignment of protein, with the library pdb has 21%
Cause property, active site consistency are 36%.Therefore, using three-dimensional protein 3DEE_A as template, http is utilized: //
The homologous modeling of swissmodel.expasy.org/interactive#alignment, the LOC_Os06g03240 albumen of Ptb33
Matter sequence can be modeled as three-dimensional structure.Therefore the LOC_Os06g03240 of Ptb33 is classified as to the candidate gene of brown planthopper resistant, and
Fix tentatively entitled " Bph28 ".
2, full length DNA sequence and cDNA sequence clone
According to bioinformatic analysis as a result, being utilized respectively Primer Premier6 design primer, from anti-plant hopper rice
The full length DNA sequence and cDNA sequence of LOC_Os06g03240 are cloned and obtained in Ptb33.
However, it is understood by those of ordinary skill in the art that the nucleotide sequence of the Bph28 announced according to the present invention, by proper
When PCR primer design, can expand from brown planthopper resistant rice genome to Bph28 gene, such as: primer pair 5 '
AGCGACCCTCAATGAACGGACTCTA3 ', 5 ' ACGACTAAAACACGAATGACGGACC3 ' are expanded using Long fragment PCR,
The full length DNA sequence of brown planthopper resistant rice or broad-leaved wild rice genome LOC_Os06g03240 can be obtained.Or it utilizes
5 ' ATGGCAGCGATGATCGG3 ', 5 ' CTAATAGGTACAGACGTCGT3 ' are expanded using RT-PCR, can be obtained and be resisted brown fly
The full length cDNA sequence of lice rice or broad-leaved wild rice genome LOC_Os06g03240.
3, genetic transformation Bph28 gene verifies its function
First with the total serum IgE of one-step method reverse transcription Ptb33, primer 5 ' is recycled
CCAAGCTTATGGCAGCGATGATCGG3 ' and 5 ' CGAGCTCCTAATAGGTACAGACGTCGT3 ' amplifications simultaneously obtain Bph28 base
The segment of 591bp is connected into plant expression vector PHB, using agriculture bar with HindIII and SacI double digestion by the full-length cDNA of cause
The hereditary development of evil in febrile disease method that bacterium EHA105 is mediated imports sun plant expression vector PHB in normal rice variety Kasalath, most
16 plants of Bph28 positive plant are obtained afterwards.Seedling stage group's method Resistance Identification has been carried out with T2 generation homozygous Bph28 positive plant, it is right
All dead according to Kasalath and TN1, transgenic positive plant survival, brown planthopper resistant rank is 3~5 grades；Plant resistance identification,
Bph28 positive plant and control Kasalath after earing, access 3~4 age brown paddy plant hoppers by 50~80 brown paddy plant hoppers of each tiller,
It is dead that Kasalath is compareed after 20 days, the survival of transgenic positive plant is repeated 5 times；Also with the feeding of honeydew method detection brown paddy plant hopper
Behavior, brown paddy plant hopper significantly reduces in the feeding of Bph28 positive plant compared on control Kasalath, suitable with feeding on Ptb33, weight
10 plants multiple, every plant is repeated 3 times.Therefore, brown planthopper resistant gene Bph28 can be applied in rice breeding, be cultivated brown winged with resisting
The rice varieties of lice performance.
Advantages of the present invention and effect:
Gene Bph28 of the present invention encodes a novel protein, has apparent brown planthopper resistant performance, this is to Study On Rice
Brown planthopper resistant mechanism is significant.
Bph28 gene significantly improves rice brown planthopper resistant performance, is applied to Bph28 by genetic transformation or hybridization
In rice breeding, the brown planthopper resistant of rice varieties can be improved, to mitigate causing harm for brown paddy plant hopper, reach the mesh of rice stable yields
's.
Gene Bph28 of the present invention encodes a novel protein and brown planthopper resistant performance was proved that this was to other already
The anti-sucking pest research of plant has important references value.
Detailed description of the invention
Fig. 1: transgenosis used carrier pHB.
Fig. 2: transgenic positive plant identification.M is the standard molecular weight of DL2000, and PHB is the plasmid of building, Kasalath
For transgene receptor plant, T is identified with SNP primer0For transgenic plant (1-6).
Fig. 3: turn the qualification result of the anti-plant hopper rice of Bph28 gene.A: strain insect resistance identification, control Kasalath are obviously dead
It dies, and transgenic plant N6518 is still survived；B: the identification of seedling stage group's method compares Kasalath, negative control N65-7-4 (3-
5) and TN1 is obviously dead, and transgenosis N65-2-5 (2-6) and N65-7-1 (1-8) are still survived.
Fig. 4: transgenic plant honeydew, which is considerably less than, compares Kasalath and TN1, suitable with brown planthopper resistant kind Ptb33.
Fig. 5: using molecular labeling SP1 with PTB33 filial generation Molecular Detection result.
Fig. 6: the holding for carrying a brown planthopper resistant gene Bph28 is the strain qualification result of 195B and TN1.195B is
JB9020/PTB33//Lu perfume (or spice) 90B filial generation utilizes molecular labeling and Resistance Identification, and the carrying one selected resists brown
The holding system of plant hopper gene Bph28, TN1 are brown paddy plant hopper sense worm kind.
Specific embodiment
If not specified, conventional means that technological means used in embodiment is well known to those skilled in the art.
Embodiment 1:
(1) Bph28 candidate gene is cloned and is determined
Utilize (JairinJ., S.Teangdeerith, P.Leelagud, et the al.Detection of such as Jairin
brown planthopper resistance genes from different rice mapping populations in
The same genomic location.Sci.Asia, 2007,33:347-352) with Rathu Heenati/KDML105's
The section that BC3F3 group positions Bph3, the region of the 190kB between No. 6 chromosome SSR markers RM19291 and RM8072.
Bph3 finely positioning section DNA sequence dna has been downloaded from http://rice.plantbiology.msu.edu/, and has been utilized
The online predictive genes software Fgenes of http://linux1.softberry.com/berry.phtml predicts the section base
Cause predicts a gene more than 30 altogether.According to (JairinJ., S.Teangdeerith, P.Leelagud, et such as Jairin
al.Detection of brown planthopper resistance genes from different rice
Mapping populations in the same genomic location.Sci.Asia, 2007,33:347-352)
Report, eliminate itself it is predicted that candidate gene remaining gene is designed into its exon primer using Primer Premier6,
PCR amplification Ptb33, bright extensive 63, TN1, (method is shown in " Primer Premier6.0Manual " by recycling amplified fragments
PREMIER Biosoft International and " molecular cloning " fourth edition).PCR reacts 50 μ l:DNA template of total system, 2 μ
L, 10 × buffer5 μ l, 10mMdNTP2 μ l, 10 μM of primers each 3 μ l, high-fidelity Taq enzyme 1U.Response procedures: 94 DEG C of initial denaturation
4min；Then 35 circulations, are denaturalized 95 DEG C of 20s, 58 DEG C of 40s, 72 DEG C of 30s；72 DEG C of extension 7min again.It is recycled using agar gel
Kit recycling amplified fragments simultaneously purify, and biotech firm is sent to be sequenced.Find that LOC_Os06g03240 exists by sequence alignment
Ptb33, bright extensive 63, there are DNA sequence dna differences by TN1.Do you utilize http://blast.ncbi.nlm.nih.gov/Blast.cgi?
PROGRAM=blastp&PAGE_TYPE=BlastSe arch&LINK_LOC=blasthome carries out protein sequence ratio
It is right, there is 21% consistency with 3DEE_A in the library pdb, active site consistency is 36%.Therefore, with three-dimensional protein 3DEE_A
For template, using the homologous modeling of http://swissmodel.expasy.org/interactive#alignment, Ptb33's
LOC_Os06g03240 protein sequence can be modeled as three-dimensional structure.And utilize online software https: //
Www.predictprotein.org/home predicts position of the protein of LOC_Os06g03240 gene coding on subcellular
It sets.Therefore the LOC_Os06g03240 of Ptb33 is classified as to the candidate gene of brown planthopper resistant, and fix tentatively entitled " Bph28 ".
(2) functional verification and application of Bph28 gene
1, the building of genetic transformation carrier
Firstly, extracting Ptb33 blade total serum IgE using total RNA extraction reagent box, (step is shown in that total serum IgE extracts kit uses
Illustrating) (method is shown in that reverse transcription reagent box uses for the total serum IgE of another footwork kit reverse transcription water resistant brown plant-hopper kind Ptb33
Illustrate)；Then, 5 ' CCAAGCTTATGGCAGCGATGATCGG3 ' of primer and 5 ' is utilized
CGAGCTCCTAATAGGTACAGACGTCGT3 ', wherein preceding primer includes the connector of HindIII, rear primer includes connecing for SacI
Head；Expand the reverse transcription cDNA of water resistant brown plant-hopper kind Ptb33.PCR reacts 50 μ l:cDNA template of total system, 2 μ l, 10 ×
Buffer5 μ l, 10mMdNTP2 μ l, 10 μM of primers each 3 μ l, high-fidelity Taq enzyme 1U.Response procedures: 94 DEG C of 4min of initial denaturation；So
35 circulations afterwards, are denaturalized 95 DEG C of 20s, 58 DEG C of 40s, 72 DEG C of 30s；72 DEG C of extension 7min again.Utilize agar gel QIAquick Gel Extraction Kit
Recycling amplified fragments simultaneously purify, and segment is connected pMD19-T plasmid (see pMD19-T plasmid operation instructions), 16 DEG C of connections
10 μ l connection liquid are added in 100 μ l competent cell DN5 а, ice bath 30min, 42 DEG C of heat shock 45s, then ice bath 1min by 12h,
890 μ lSOC culture mediums, 37 DEG C of activation 60min are added；It is smeared on the LB plating medium containing X-Gal, IPIG, Amp equal
It is even, and overnight incubation.White colony is selected, PCR detection is positive, and biotech firm is sent to be sequenced.Correct unit cell bacterium colony is sequenced to expand
It is numerous, and carry out plasmid recycling with plasmid QIAquick Gel Extraction Kit (method is shown in plasmid QIAquick Gel Extraction Kit).Utilize the fast enzyme of HindIII and SacI
Plasmid is recycled in digestion and plant over-express vector is pHB (Vector map is as shown in Figure 1).Endonuclease reaction system is 50 μ l, plasmid
Or the 10 fast enzyme of μ l, HindIII and SacI each 2U, 10 × LBuffer5 μ l of carrier, 37 DEG C of digestion 1h. agarose electrophoresis after mixing,
And with Ago-Gel DNA QIAquick Gel Extraction Kit recovery purifying (see Ago-Gel DNA QIAquick Gel Extraction Kit operation instruction).Connection is anti-
Answer: 1 μ l of cDNA segment, carrier pHB0.5 μ l, 2U T4Ligase, 5 × Buffer2 μ l, 10 μ l of total volume, 4 DEG C of connections are overnight.
Connection product and competent cell DN5 а mix conversion (step is same as above).PCR detects positive monoclonal, expands culture, pure
Change plasmid, convert Agrobacterium EHA105 with heat shock method, then PCR detects positive monoclonal, and 500 μ l is taken to contain pHB+ candidate
The Agrobacterium bacterium solution of Bph28cDNA adds 50% isometric glycerol to mix, -70 DEG C of preservations.
2, genetic transformation
Using Agrobacterium EHA105 mediate genetic transforming method (Hei etc., 1994, Efficient
transformation of rice(OryzasativaL.)mediated by Agrobacterium and sequence
Analysis of the boundaries of the T-DNA.Plant Journal, 6:271-282) candidate will be contained
Bph28cDNA conversion carrier pours into sense brown paddy plant hopper rice varieties Kasalath respectively, while being compared using empty carrier pHB.
3, the result and application of Bph28 gene expression
Positive tissue-cultured seedling T0 16 plants (Fig. 4 exposition testing result) of generation is obtained, more than 10 strains, transgenosis greenhouse are compareed
Interior plantation selects homozygous lines (each 10 strain) to do insect resistance identification after harvesting T1 generation respectively, by seedling stage group's method identification (figure
5), the insect resistance identification (Fig. 5) of maturity period plant, transgenic plant are significantly better than Brown Planthopper Resistance (setting is repeated 6 times altogether)
Kasalath and TN1 is compareed, the resistance rank in transgenic paddy rice seedling stage between 3~5, still deposit after control is dead by the maturity period
It is living, and can be normal solid.Meanwhile being detected using honeydew amount, it was confirmed that brown paddy plant hopper honeydew in transgenic plant is reduced, i.e. feeding
Amount is reduced.Therefore, the Bph28 cloned can make rice generate resistance to the feeding of brown paddy plant hopper.
(3) molecular marker assisted selection has the brown planthopper resistant rice of Bph28 gene
According to the cDNA sequence of Bph28 gene, multipair SNP primer and multipair InDel primer are devised, uses and draws in this example
Object is used as molecular labeling to 5 ' CGAACAACTCCACGCTGT3 ', 5 ' GTGACGATGATGCTGTAGAG3 ', anti-to select to have
The rice of worm function, amplified fragments are that 199bp. extracts pest-resistant cultivar Ptb33, sense worm kind and its hybridization, backcross progeny
The genomic DNA of plant passes through the side of agarose gel electrophoresis after the primer PCR amplification of Bph28 gene order design
Method carries out Molecular Detection, person's (segment that amplified production is 199bp) consistent with insect-proof rice PCR banding pattern in filial generation plant,
The plant (Fig. 5) containing Bph28 gene as chosen.The insect resistace of these single plants passes through maturity period identification confirmation (figure
6), then by selfing and economical character selection, brown planthopper resistant rice can be cultivated.
The above is the preferred embodiment of the present invention, it is noted that those skilled in the art are come
It says, without departing from the principles of the present invention, can also make several improvements and retouch, these improvements and modifications are also answered
It is considered as protection scope of the present invention.
Claims (4)
1. a kind of brown planthopper resistant gene in rice Bph28, which is characterized in that it is nucleotide sequence shown in SEQ ID NO.1.
2. a kind of carrier, which is characterized in that contain brown planthopper resistant gene in rice Bph28 described in claim 1.
3. a kind of brown planthopper resistant albumen, which is characterized in that its amino acid sequence is shown in SEQ ID NO.3.
4. a kind of application for cultivating brown planthopper resistant rice using brown planthopper resistant gene Bph28 described in claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410441422.2A CN104263737B (en) | 2014-08-30 | 2014-08-30 | Brown planthopper resistant gene in rice Bph28 and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410441422.2A CN104263737B (en) | 2014-08-30 | 2014-08-30 | Brown planthopper resistant gene in rice Bph28 and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104263737A CN104263737A (en) | 2015-01-07 |
| CN104263737B true CN104263737B (en) | 2019-08-06 |
Family
ID=52155318
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410441422.2A Active CN104263737B (en) | 2014-08-30 | 2014-08-30 | Brown planthopper resistant gene in rice Bph28 and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104263737B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104762411B (en) * | 2015-04-30 | 2016-02-10 | 广西大学 | The molecule marker primer of brown planthopper resistant gene Bph28 (t) and marking method thereof and application |
| CN105695428B (en) * | 2016-03-17 | 2018-10-26 | 武汉大学 | Rice cytoplasmic kinase gene OsBHL1 and its coding albumen and application |
| CN108504662B (en) * | 2018-05-24 | 2020-01-24 | 武汉大学 | Rice brown planthopper resistant gene Bph30 and closely linked molecular marker thereof |
| CN113846073B (en) * | 2021-09-03 | 2023-03-24 | 广东省农业科学院植物保护研究所 | Nilaparvata lugens NlLIPH gene and application thereof |
| CN113804869B (en) * | 2021-09-29 | 2023-09-05 | 中国科学院重庆绿色智能技术研究院 | Application of nanopore in electrochemical detection of plant resistance gene expression polypeptide and detection method |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418349A (en) * | 2008-12-12 | 2009-04-29 | 南京农业大学 | Molecular marker method of rice variety brown planthopper resistance main gene Bph3 |
| CN101463354A (en) * | 2009-01-06 | 2009-06-24 | 武汉大学 | Brown planthopper resistant gene in rice and use thereof |
| CN101914531A (en) * | 2010-08-19 | 2010-12-15 | 武汉大学 | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof |
| WO2011079445A1 (en) * | 2009-12-30 | 2011-07-07 | Wuhan University | Molecular markers for rice brown planthopper resistance gene and their application |
| CN103509791A (en) * | 2013-07-31 | 2014-01-15 | 江西省农业科学院水稻研究所 | Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof |
| CN103667309A (en) * | 2012-09-05 | 2014-03-26 | 武汉大学 | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2002345250A1 (en) * | 2001-06-22 | 2003-01-08 | Syngenta Participations Ag | Plant disease resistance genes |
-
2014
- 2014-08-30 CN CN201410441422.2A patent/CN104263737B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101418349A (en) * | 2008-12-12 | 2009-04-29 | 南京农业大学 | Molecular marker method of rice variety brown planthopper resistance main gene Bph3 |
| CN101463354A (en) * | 2009-01-06 | 2009-06-24 | 武汉大学 | Brown planthopper resistant gene in rice and use thereof |
| WO2011079445A1 (en) * | 2009-12-30 | 2011-07-07 | Wuhan University | Molecular markers for rice brown planthopper resistance gene and their application |
| CN101914531A (en) * | 2010-08-19 | 2010-12-15 | 武汉大学 | Molecular marker of major gene Bph6 resistant to brown planthopper and application thereof |
| CN103667309A (en) * | 2012-09-05 | 2014-03-26 | 武汉大学 | Brown planthopper resistant rice gene Bph9 as well as molecular marker and application thereof |
| CN103509791A (en) * | 2013-07-31 | 2014-01-15 | 江西省农业科学院水稻研究所 | Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof |
Non-Patent Citations (4)
| Title |
|---|
| hypothetical protein [Oryza sativa Japonica Group];GenBank: BAD68353.1;《GenBank》;20080216;全文 * |
| Oryza sativa Japonica Group genomic DNA, chromosome 6, PAC clone:P0542E10;GenBank: AP003456.3;《GenBank》;20080216;全文 * |
| 水稻抗褐飞虱基因Bph18(t)的STS标记开发及有效性验证;梁云涛等;《中国水稻科学》;20100531(第03期);244-250 * |
| 水稻褐飞虱抗性基因的鉴定及利用现状;鄂志国等;《植物保护学报》;20080615(第03期);279-284 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104263737A (en) | 2015-01-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hasan et al. | Recent advancements in molecular marker-assisted selection and applications in plant breeding programmes | |
| Jiang et al. | Mapping QTL for seed germinability under low temperature using a new high-density genetic map of rice | |
| Kumar et al. | Current knowledge in lentil genomics and its application for crop improvement | |
| CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
| CN104263737B (en) | Brown planthopper resistant gene in rice Bph28 and its application | |
| CN104878091B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9978 | |
| US11032986B2 (en) | Methods of creating drought tolerant corn plants using markers linked to cold shock domain-containing proteins and compositions thereof | |
| CN111902547A (en) | Method for identifying, selecting and generating disease resistant crops | |
| WO2019223563A1 (en) | Rice brown planthopper resistance gene bph30 and molecular marker closely linked thereto | |
| He et al. | Genetic, physical and comparative mapping of the powdery mildew resistance gene Pm21 originating from Dasypyrum villosum | |
| CN109628480A (en) | Corn Parthenogenesis haploid induced gene ZmPLA1E and its application | |
| WO2015143972A1 (en) | Rice panicle traits regulatory gene pt2 and application thereof | |
| CN108291234A (en) | Multiple sporinite forms gene | |
| Wei et al. | Introgressing subgenome components from Brassica rapa and B. carinata to B. juncea for broadening its genetic base and exploring intersubgenomic heterosis | |
| WO2021121209A1 (en) | Rice brown-planthopper-resistant gene bph37, and protein, vector, host cell, molecular marker, method and use thereof | |
| CN109715811A (en) | Include wheat G type cytoplasmic male sterilty restoring gene, the plant of molecular marker and application thereof | |
| CN109312357A (en) | The nucleus encoding male infertility of enzyme mutant is aoxidized by Cytochrome P450 | |
| Soler-Garzón et al. | Genome-wide association mapping of bc-1 and bc-u reveals candidate genes and new adjustments to the host-pathogen interaction for resistance to Bean common mosaic necrosis virus in common bean | |
| CN105949291B (en) | Rice MIS1 albumen and its encoding gene and application | |
| Yang et al. | Development and evaluation of chromosome segment substitution lines carrying overlapping chromosome segments of the whole wild rice genome | |
| Brar et al. | Biotechnological approaches for increasing productivity and sustainability of rice production | |
| CN106399287B (en) | A kind of rice MIT1 gene, its encode albumen and application | |
| CN108064302A (en) | QTL associated with the resisting breakage of Canola and the method for identifying resisting breakage | |
| JP5769341B2 (en) | Genes controlling the flowering / closing properties of plants and their use | |
| He et al. | Maize Improvement Based on Modern Breeding Strategies: Progress and Perspective |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |