WO2021121209A1 - Rice brown-planthopper-resistant gene bph37, and protein, vector, host cell, molecular marker, method and use thereof - Google Patents

Abstract

Provided are a rice brown-planthopper-resistant gene Bph37, and a protein, a vector, a host cell, a molecular marker, a method and the use thereof. The rice brown-planthopper-resistant gene Bph37 has a nucleotide sequence as shown in SEQ ID NO. 1 and a cDNA sequence as shown in SEQ ID NO. 2. Rice containing the rice brown-planthopper-resistant gene Bph37 can be screened by means of using a molecular marker 156-35. The gene Bph37 is transferred to a common rice variety through genetic transformation, which can improve the resistance of the rice to brown planthoppers, so as to reduce the harm caused by the brown planthoppers and achieve the purposes of increasing the yield and stabilizing the yield.

Description

Rice brown planthopper resistance gene Bph37, protein, vector, host cell, molecular marker, method and application Technical field

The invention belongs to the field of plant genetic engineering, and specifically relates to a rice brown planthopper resistance gene Bph37, protein, vector, host cell, molecular marker, method and application.

Background technique

Rice is an important food crop, and more than half of the world's people eat it as their staple food. As the rice genome has been refined genetic map and physical map, its transgenic technology is relatively easy, and it has collinearity with other grass crop genomes, so it is regarded as a model plant. With the completion of the sequencing of the genomes of a variety of organisms, including rice, humans have begun to enter the post-genome era. The full development of functional genomics research has become a frontier field of life sciences. Therefore, the research on rice functional genes is of great significance to socio-economic development and biological research.

Food security is a challenge facing people all over the world. The two technological revolutions of dwarf breeding in the 1950s and 1960s and hybrid rice breeding in the 1970s have greatly increased rice production. The promotion of dwarfing and high-yielding rice caused planthopper damage to become serious. Especially in the 21st century, the frequency and scale of planthopper outbreaks in the entire Asian rice-producing areas have gradually expanded, and they have become the biggest threat to rice production. my country’s annual brown planthopper occurrence area is 387 million acres. Despite the full prevention and control, it still loses 1.2 million tons of rice, which is 3.58 billion yuan, accounting for about 30% of the total loss of rice pests and diseases. It is the number one pest in rice production.

At present, the brown planthopper has become the largest pest in my country's rice production, and has poses a serious threat to my country's current food security. For a long time, the control of brown planthoppers mainly relied on the application of chemical pesticides. Because brown planthopper outbreaks mostly occur during rice maturity and filling stage, rice plants are growing vigorously at this time, and it is very difficult to apply pesticides to the base of rice plants. In fact, due to the continuous application of large quantities of chemical insecticides, the resistance of brown planthoppers has doubled, and the effect of chemical control is limited. At the same time, the use of chemical insecticides to control brown planthoppers increases the production cost of farmers. On the other hand, chemical insecticides also cause environmental and ecological problems such as poisoning and killing non-target organisms and polluting the environment and food.

Breeding insect-resistant rice varieties with brown planthopper resistance genes is the most economical and effective method in the comprehensive control of brown planthoppers. The research results of the International Rice Research Institute (IRRI) and the practice of rice production in Southeast Asia have proved that even rice varieties with only moderate resistance levels are sufficient to control the population of brown planthoppers below the level that causes damage, and will not cause actual damage to rice. Harm and yield loss. Therefore, mining rice brown planthopper resistance genes and applying them in rice breeding projects is a fundamental measure to prevent rice brown planthoppers.

The research on rice brown planthopper resistance genes began in the early 1970s. So far, more than 30 major insect resistance genes for rice brown planthopper resistance have been identified and located in common cultivated rice and wild rice resources (see Hu et al., 2018. Identification and fine mapping of Bph33, a new brown planthopper resistance gene in rice(Oryza sativa L.).Rice 2018,11:55). Eight genes (Bph14, Bph26, Bph3, Bph29, Bph9, Bph18, Bph32, and Bph6) have been cloned. These genes are all obtained by map-based cloning (Du et al., 2009; Tamura et al. 2014; Liu et al. al. 2014; Wang et al. 2015b; Zhao et al. 2016; Ji et al. 2016; Ren et al. 2016; Guo et al. 2018).

Genome-wide association study (GWAS) was first applied to the genetic analysis of human diseases. In recent years, with the rapid development of genome technology, especially the improvement of sequencing technology, the whole genome sequencing of many plants and animals has been completed. GWAS has become a powerful tool for studying the complex traits of crops. Compared with the traditional map-based cloning to discover genes, the association analysis method has the advantages of not needing to construct a special mapping population, saving time, and achieving fine positioning. At the same time, GWAS breaks through the limitations of map-based cloning that is generally suitable for smaller genome species, and only requires genome-wide SNPs markers and phenotypic traits. In recent years, GWAS analysis methods have also developed rapidly. The research results of Chinese scientists and international colleagues show that the GWAS method has unearthed target genes in crop morphological traits, physiological traits, and yield-related traits. For example, the gene LOC_Os01g62780 that controls the days of heading in rice, the gene LOC_Os11g08410 that controls the height and ear length of rice, and the tiller number gene NAL1 (Yano et al. 2016, Genome-wide association study using whole-genome sequencing rapidly identifying new genes influencing agronomic Genetics, 48: 927-934), which controls the rice grain type gene OsSPL13 (Si et al. 2016, OsSPL13 controls grain size in cultivated rice. Nature Genetics, 48:447-456).

Summary of the invention

The purpose of the present invention is to provide a rice brown planthopper resistance gene Bph37, protein, carrier, molecular marker, method and application. The invention uses the GWAS method to identify the rice brown planthopper resistance gene Bph37. By genetically transforming the Bph37 gene, the susceptible rice showed a phenotype resistant to brown planthopper, confirming the function of this gene.

In order to achieve the above objective, the technical solution of the present invention is as follows:

In the first aspect, the present invention provides a rice brown planthopper resistance gene Bph37, which is characterized in that the nucleotide sequence of the gene is shown in SEQ ID NO.1. The gene has a full length of 1279 bp, with 1 intron and 2 exons. Its CDS is segment 1-116 bp and 523-1279 bp, respectively, and the full-length cDNA is 873 bp.

As a preferred solution, the cDNA sequence of the gene is shown in SEQ ID NO. 2, which encodes 291 amino acids.

In the second aspect, the present invention provides a protein encoded by the rice brown planthopper resistance gene Bph37, characterized in that the amino acid sequence of the protein is shown in SEQ ID NO.3.

It should be understood that without affecting the activity of the BPH37 protein (that is, not in the active center of the protein), those skilled in the art can make various substitutions, additions and/or deletions of one or more of the amino acid sequences shown in SEQ ID NO.3. Amino acids obtain an amino acid sequence with the same function.

In addition, considering the degeneracy of codons, for example, in its coding region, without changing the amino acid sequence, or in its non-coding region without affecting protein expression, the polynucleotide encoding the above-mentioned protein The sequence is modified. Therefore, the present invention also includes the substitution, addition and/or deletion of one or more nucleotides to the polynucleotide sequence encoding the above-mentioned protein, and the nucleotide sequence having the same function as the above-mentioned encoding protein.

The above-mentioned polynucleotide fragment provided by the present invention is operably linked to a homologous or heterologous promoter sequence.

In the third aspect, the present invention provides a vector containing the above-mentioned rice brown planthopper resistance gene Bph37. The vector includes a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof.

The solution of the present invention also includes a sense sequence or an antisense sequence based on the polynucleotide, including a cloning vector or expression vector containing the polynucleotide sequence or a fragment thereof, a host cell containing the vector, and the nucleoside Transformed plant cells and transgenic plants of acid sequences or fragments thereof.

In a fourth aspect, the present invention provides a host cell containing the above-mentioned rice brown planthopper resistance gene Bph37, characterized in that: the host cell is a plant cell transformed with the nucleotide sequence or a fragment thereof.

In the fifth aspect, the present invention provides a transgenic plant transformed with a nucleotide sequence containing the rice brown planthopper resistance gene Bph37 or a fragment thereof as described above.

In a sixth aspect, the present invention provides a molecular marker of the rice brown planthopper resistance gene Bph37, characterized in that: the molecular marker is 156-35, and the primer pairs used to amplify the molecular marker 156-35 are as follows:

Forward primer 156-35F: TTGCTCATGGGTGTGCAGAAG, its sequence is shown in SEQ ID NO.4;

Reverse primer 156-35R: TTGGGGGTGTCAAAGCCTAC, its sequence is shown in SEQ ID NO.5.

In the seventh aspect, the present invention provides a molecular detection method for the rice brown planthopper resistance gene Bph37, which is characterized in that the genomic DNA of the rice to be tested is amplified by the primer pair, and the amplified product is detected: if primers 156-35F and The 825bp amplified fragment from 156-35R indicates the existence of the rice brown planthopper resistance gene Bph37.

In an eighth aspect, the present invention provides a method for screening brown planthopper-resistant rice, which is characterized in that the genomic DNA of the rice to be tested is amplified by the above-mentioned primer pair, and the amplified product is detected: if the primers 156-35F and 156-35R are used for amplification The 825bp amplified fragment indicates the existence of resistance to brown planthopper in rice varieties.

In a ninth aspect, the present invention provides an application of the above-mentioned molecular marker of the rice brown planthopper resistance gene Bph37 in the breeding of brown planthopper-resistant rice.

At the same time, the scheme of the present invention also covers a method for cultivating plants with brown planthopper resistance, which includes the following steps:

1) Transform plant cells with a polynucleotide; the polynucleotide contains the rice brown planthopper resistance Bph37 gene, and its nucleotide sequence is shown in SEQ ID NO. 1 or SEQ ID NO. 2;

2) Regenerate the transformed plant cells into plants;

3) Cultivating the regenerated plant and expressing the above-mentioned polynucleotide.

The solution of the present invention also covers a method for producing plants with brown planthopper resistance, the method comprising crossing plants with the brown planthopper resistance gene Bph37 with other plants to produce offspring plants with brown planthopper resistance. Wherein the plant is a monocotyledonous plant; preferably, the plant is rice.

Those skilled in the art should be able to understand that the design or production of molecular markers based on the sequences disclosed in the present invention can be used in the breeding of brown planthopper-resistant rice.

In the present invention, the Bph37 gene is cloned through the following steps:

(1) Collect natural populations of rice. 1520 rice varieties from 74 countries and 12 types are used as a genetic mapping group for rice brown planthopper resistance.

(2) Identification of resistance to brown planthopper. The weight gain rate of brown planthopper was used to identify the anti-brown planthopper performance of the localized population. Approximately 8 seeds per material are sown in a plastic cup (10×15 cm). At the five-leaf stage, weigh the initial weight of a newly emerging female with a 1/10,000 electronic balance, then put it into a wax bag (2×2cm) made of sealing film, and fix it on the leaf sheath, weigh the brown planthopper after 48 hours Weight, calculate the weight gain rate, repeat the experiment 12 times for each material. The average value after removing the extreme value of weight gain rate was used as the resistance value of each rice variety to brown planthopper.

(3) Mapping of rice brown planthopper resistance genes. Using the mixed linear model of EMMAX software, it is detected that there are significant association sites on chromosome 6 0.81-1.57M.

(4) Confirmation of candidate genes. According to the gene function annotations of candidate genes in the 0.81-1.57Mb interval of Nipponbare reference genome, the NBS-LRR gene, namely LOC_Os06g03500, was selected as the candidate gene.

(5) Selection of anti-brown planthopper materials. According to the peak SNP of the relevant area, 1520 materials are divided into haplotype A and haplotype B. The resistance of haplotype B materials to brown planthopper is significantly higher than that of haplotype A materials. SE382 in haplotype B was selected as the material for amplification of LOC_Os06g03500.

(6) Full-length cDNA clone. Primers were designed according to the predicted cDNA sequence, and a 310bp fragment was amplified from the cDNA of brown planthopper resistant rice SE382. The primers were designed with this sequence, and the 3'end and 5'end sequences of the cDNA were obtained by RACE (rapid amplification of cDNA ends). Finally, the full-length cDNA of Bph37 was obtained.

However, those skilled in the art should understand that the Bph37 gene can be amplified from the brown planthopper-resistant rice genome by designing appropriate PCR primers according to the nucleotide sequence of Bph37 disclosed in the present invention.

(7) Genetic transformation of Bph37 gene to verify its function. According to the ORF sequence of the Bph37 gene, PCR was used to amplify the 873bp fragment containing the ORF of the Bph37 gene. After adding A, it was connected to the pCXUN vector digested with XcmI. After the sequencing verification is correct, the obtained vector is the Bph37 gene genetic transformation vector, which is transferred into Agrobacterium EHA105.

Using the genetic transformation method mediated by Agrobacterium EHA105, the overexpression vector was introduced into the normal japonica rice variety Nipponbare, and finally 20 Bph37-positive plants were obtained. First, T1 generation plants were used for pest resistance identification. The seedling stage was identified by the seedling group method, the control rice Nipponbare all died, the transgenic positive plants survived, and the insect resistance level was 1-5. It is confirmed that Bph37 gene has the function of resisting brown planthopper. Therefore, the rice brown planthopper resistance gene Bph37 can be used in rice or in rice seeds to cultivate rice varieties with resistance to brown planthopper.

Advantages and effects of the present invention:

(1) The present invention successfully cloned rice brown planthopper resistance gene Bph37 by using GWAS.

(2) The Bph37 gene cloned in the present invention has obvious resistance to brown planthopper, which is of great significance for comprehensive understanding of the diversity of rice brown planthopper resistance gene types.

(3) Bph37 improves the resistance of rice to brown planthoppers. Applying Bph37 to rice breeding through genetic transformation or hybridization can improve the resistance of rice varieties to brown planthoppers, thereby reducing the damage of brown planthoppers, and achieving the purpose of increasing and stabilizing production.

(4) Piercing-sucking insects are a major type of insect pests in agricultural production. The Bph37 gene cloning and brown planthopper resistance proved that it has an important reference for the research on piercing-sucking insects of other plants.

Description of the drawings

Figure 1 shows the geographical distribution of 1520 rice varieties.

Picture: The picture shows the distribution of 1520 rice varieties in 74 countries around the world; the size of the pie chart is correct Compared with the number of rice varieties from this country; in each pie chart, the area of the different colored sectors is proportional to The number of different types of rice varieties.

Figure 2 shows the identification results of 1520 rice varieties for resistance to brown planthopper.

In the figure: the figure shows the histogram of the weight gain rate of brown planthopper feeding on 1520 rice varieties for 48 hours; the abscissa WGR in the figure represents the weight gain rate of brown planthoppers, the ordinate represents the number of rice varieties; the insect source is the brown planthopper biotype I.

Figure 3 shows the GWAS results.

Figure: The figure shows the Manhattan graph of genome-wide association analysis; each point represents a SNP marker and The degree of association of brown planthopper resistance, the smaller the p-value (the _{greater the -log 10} (p)), the higher the degree of association with brown planthopper resistance; -The site with log ₁₀ (p) exceeding the threshold of 8 is considered to be a significant associated site; chromosome 6 0.8-1.57Mb is full The region with the highest degree of genome association, -log ₁₀ (p) far exceeds the threshold 8; the model used is EMMAX software Mixed linear model.

Figure 4 shows the resistance results of haplotypes A and B to Nilaparvata lugens.

Picture: According to the different forms of peakSNP, 1520 rice materials are divided into two haplotypes, haplotypes The brown planthopper weight gain rate (WGR) of type A is significantly higher than that of haplotype B, that is, haplotype B is more resistant to brown planthopper.

Figure 5 shows the results of identification of resistance to brown planthopper in transgenic rice.

In the picture: the results of 7 days after the transgenic plant was released; TN1 is Taichung local No. 1, which is susceptible to brown planthopper Sex, 156-13 are Bph37 transgenic negative plants, 156-17, 156-15, 156-32 are Bph37 transgenic plants Positive plants. The transgenic positive lines of Bph37 gene all have obvious resistance to brown planthopper.

Figure 6 is an example of functional molecular markers 156-35 developed based on the Bph37 genome sequence, and the amplified fragment length is 825bp.

In the picture: SE382 is the insect-resistant parent carrying the rice brown planthopper resistance gene Bph37, Yangdao No. 6 (93-11) It is susceptible rice, F2-1 to F2-11 are susceptible water _{in F 2 population constructed by crossing SE382 with Yangdao No. 6} Rice, F2-12 to F2-22 are insect-resistant rice _{in the F 2} population constructed by crossing SE382 with Yangdao No. 6.

Detailed ways

The present invention will be further described in detail below with reference to the drawings and specific embodiments.

Example 1 Cloning of Bph37 gene and development of molecular markers

1.GWAS

From the Institute of Crop Science of the Chinese Academy of Agricultural Sciences, 1520 rice varieties were obtained, covering 12 types, located in 74 countries around the world (Figure 1). The resistance of 1520 rice varieties was tested by measuring the body weight of the female adults of the brown planthopper before and after feeding. Eight seeds of each experimental rice variety were sown and grown in a plastic cup (9×15 cm). The resistance test was conducted on rice plants at the five-leaf stage. The newly emerged female adults of the biotype I of the brown planthopper were collected and weighed with an electronic balance (Shimadzu; type: AUW120D). The brown planthopper with an initial body weight of 1.80～2.70 mg was selected for the experiment. Each brown planthopper was put into a 2×2 cm film bag made of parafilm, and then fixed on a rice plant 1 cm from the soil. The brown planthopper feeds on the leaf sheath for 48 hours, and then measures the body weight again to obtain the 48-hour body weight, thereby obtaining the weight gain rate (WGR) of the brown planthopper. For each rice variety, the weight gain rate of 12 brown planthoppers was used to indicate the resistance level. The resistance levels of 1520 rice varieties to brown planthoppers showed a left-skewed distribution (Figure 2), that is, more susceptible varieties than insect-resistant varieties. The 3K rice genome data has been published (Li, Z. et al., 2014 The 3,000 rice genomes project. GigaScience 3, 7). Use plink software to extract genome-wide SNPs data with minor allele frequencies greater than 0.01 and deletion rates less than 0.2. Because the population structure is relatively obvious, the first 7 principal components (Q) are used as fixed effects, and the balding-Nichols kinship matrix (K) between each individual is used as a random effect to modify the population structure. Use the mixed linear model in EMMAX software for GWAS analysis. Use the formula P=0.05/N (N is the number of SNPs) to evaluate the significance threshold of the whole genome. The significance p-value threshold is about 1.0×10 ^-8 .

2. Identify candidate genes

There is a cluster of significantly associated SNPs on chromosome 6 0.8-1.57Mb (Figure 3), indicating that this region contains the rice brown planthopper resistance gene as a candidate region. According to the Nipponbare reference genome gene function annotation information (http://rice.plantbiology.msu.edu/), the NBS-LRR gene in the candidate region, LOC_Os06g03500 is the candidate gene. According to the peak SNP of the relevant area, 1520 materials are divided into haplotype A and haplotype B. The resistance of haplotype B materials to brown planthopper is significantly higher than that of haplotype A materials. SE382 in haplotype B was selected as the material for amplification of LOC_Os06g03500.

3. RACE obtains the full-length cDNA of Bph37

Using the total RNA reverse transcription product of the brown planthopper resistant parent SE382 leaf sheath as a template, primers were designed according to the gene prediction results to amplify a cDNA sequence of the candidate gene. Design primers based on this sequence and use TaKaRa's 5'and 3'Full RACE kits to obtain the 5'end and 3'end sequences of the candidate gene, determine the transcription start site and termination site of the candidate gene, and splice them Get the full-length cDNA sequence of the gene. The primers were re-synthesized according to the full-length cDNA sequence and amplified to obtain the full-length cDNA of Bph37. Its nucleotide sequence is shown in SEQ ID NO. 2 of the sequence list.

4. Molecular marker of rice brown planthopper resistance gene Bph37

Compared with inductive materials, there is a 474bp deletion in the intron region of Bph37. In the resistant parent, the length of the marker 156-35 amplified fragment is 825 bp; in the susceptible parent, the length of the marker 156-35 amplified fragment is 1299 bp. Therefore, molecular markers are used:

156-35 labeled primer:

The forward primer sequence TTGCTCATGGGTGTGCAGAAG is shown in SEQ ID NO.4;

The reverse primer sequence TTGGGGGTGTCAAAGCCTAC is shown in SEQ ID NO.5;

Amplify the rice brown planthopper resistant varieties or breeding material DNA, if primers 156-35 can be used to amplify the 825bp amplified fragment, which marks the existence of the rice brown planthopper resistant gene Bph37. Therefore, the use of the above-mentioned molecular marker method provided by the present invention to identify the existence of the Bph37 resistance gene has a very high efficiency, can predict the brown planthopper resistance of rice plants, and accelerate the breeding process of brown planthopper-resistant rice varieties.

Example 2 Functional verification and application of Bph37 gene

1. Construction of genetic transformation vector

Construction of Bph37 gene overexpression vector. The vector used is pCXUN (provided by Professor Wang Guoliang from Ohio State University, USA). The pCXUN vector is digested with XcmI, and the exogenous fragment can be directly connected after adding A.

According to the results of RACE, the ORF was directly amplified by PCR, and then connected to the vector after adding A. After the sequencing was verified, the vector obtained was the Bph37 gene overexpression vector, which was transferred into Agrobacterium EHA105. Pick a single clone to expand the culture, and after the PCR verification is correct, add an equal volume of 50% glycerol to mix, and store at -70°C for use.

2. Genetic transformation

A genetic transformation method mediated by Agrobacterium EHA105 (Hiei et al., 1994, Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal 6:271-282) will The above-mentioned Bph37 gene over-expression vector is introduced into Nipponbare, a common rice variety susceptible to brown planthopper.

3. Bph37 gene transgene function verification

Bph37 gene overexpression transformation vector obtained 20 positive transgenic plants. After the seeds were harvested, _{Bph37 transgenic plants of the T 1} generation were used for pest resistance identification using the seedling group method. As shown in Figure 6, the transgenic negative strain 156-13 and the transgenic positive strain 156-17, 156-15 and 156-32 were identified for resistance to brown planthopper. The identification results are shown in Figure 6. 7 days after the brown planthopper was inserted, the susceptible control variety TN1 all died, the transgenic negative plants withered, and the transgenic positive plants grew healthy without damage to the leaves. The insect resistance level was 2-4, which confirmed Bph37 The gene has the function of resisting brown planthopper. Therefore, the rice brown planthopper resistance gene Bph37 can be used in rice or rice seeds to cultivate rice varieties with resistance to brown planthopper.

Example 3 Verification of Molecular Markers

1. Materials and methods

1.1 Materials: Brown planthopper resistant parent SE382 (containing rice brown planthopper resistance gene Bph37), brown planthopper susceptible rice variety Yangdao No. 6 (93-11) and F ₂ strain constructed by crossing SE382 and Yangdao No. 6.

Molecular marker primers: 156-35, the nucleotide sequences of which are shown in SEQ ID No. 4-5, respectively.

1.2 method

The genomic DNA of rice samples was extracted by CTAB extraction method. Amplify the sample DNA with primers 156-35. 10μl system. The 10μl reaction system includes: 2×Es Taq MasterMix (Dye), 5.0μl; ddH ₂ O, 3.7μl; 10μM primer, 0.4μl; and 50ng DNA template. The amplification reaction was carried out on the Bioer PCR instrument: 94°C for 3 min; 94°C for 30s, 55°C for 30s, 72°C for 60s, 30 cycles; 72°C for 5 minutes. The amplified products of 156-35 are separated with 1% agarose gel and can be directly analyzed after electrophoresis.

_{2. Results: Using the above method, 22 F 2} strains constructed by crossing rice varieties SE382, Yangdao No. 6, SE382 and Yangdao No. 6 were amplified. The results showed that the strains that can amplify the corresponding 825bp fragment by using the 156-35 molecular marker primers all showed resistance to the brown planthopper. The strains that could not expand the above-mentioned specific fragments all showed susceptibility to the brown planthopper (Figure 6).

This shows that the molecular marker method provided by the present invention can accurately screen out the rice brown planthopper resistance gene Bph37, thereby greatly improving the breeding efficiency.

Claims (10)

1. A rice brown planthopper resistance gene Bph37, characterized in that: the nucleotide sequence of the gene is shown in SEQ ID NO.1.
2. The rice brown planthopper resistance gene Bph37 according to claim 1, wherein the cDNA sequence of the gene is shown in SEQ ID NO.2.
3. A protein encoded by the rice brown planthopper resistance gene Bph37 according to claim 1 or 2, characterized in that the amino acid sequence of the protein is shown in SEQ ID NO.3.
4. A vector containing the rice brown planthopper resistance gene Bph37 of claim 1 or 2, wherein the vector comprises a cloning vector or an expression vector containing the polynucleotide sequence or a fragment thereof.
5. A host cell containing the rice brown planthopper resistance gene Bph37 according to claim 1 or 2, characterized in that: the host cell is a plant cell transformed with the nucleotide sequence or a fragment thereof.
6. A transgenic plant containing the nucleotide sequence of the rice brown planthopper resistance gene Bph37 or a fragment thereof as described in claim 1 or 2.
7. A molecular marker for the rice brown planthopper resistance gene Bph37 according to claim 1 or 2, characterized in that: the molecular marker is 156-35, and the primer pairs used to amplify the molecular marker 156-35 are as follows:

   Forward primer 156-35F: its sequence is shown in SEQ ID NO.4;

   Reverse primer 156-35R, its sequence is shown in SEQ ID NO.5.
8. A method for molecular detection of rice brown planthopper resistance gene Bph37 according to claim 1 or 2, characterized in that the genomic DNA of rice to be tested is amplified by the primer pair described in claim 7, and the amplified product is detected: if primers are used The 825bp amplified fragments from 156-35F and 156-35R indicate the presence of the rice brown planthopper resistance gene Bph37.
9. A method for screening brown planthopper-resistant rice, characterized in that the genomic DNA of the rice to be tested is amplified by the primer pair described in claim 7, and the amplified product is detected: if primers 156-35F and 156-35R are used to amplify 825bp The amplified fragments indicate the existence of brown planthopper resistance in rice varieties.
10. An application of the molecular marker of the rice brown planthopper resistance gene Bph37 according to claim 7 in the breeding of brown planthopper resistant rice.

Images