CN114807162B - Method for improving photosynthetic efficiency and yield of rice - Google Patents
Method for improving photosynthetic efficiency and yield of rice Download PDFInfo
- Publication number
- CN114807162B CN114807162B CN202210285896.7A CN202210285896A CN114807162B CN 114807162 B CN114807162 B CN 114807162B CN 202210285896 A CN202210285896 A CN 202210285896A CN 114807162 B CN114807162 B CN 114807162B
- Authority
- CN
- China
- Prior art keywords
- hpy1
- rice
- gene
- yield
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8262—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield involving plant development
- C12N15/8269—Photosynthesis
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Abstract
The invention provides a method for improving photosynthetic efficiency and yield of rice, which comprises the following steps: the HPY1 gene is over expressed in rice, wherein the nucleotide sequence of the HPY1 gene is shown as SEQ ID NO. 2. The invention discovers through the in vivo differential expression of HPY1 gene in rice: after the HPY1 is over-expressed in the body of the excellent rice variety Huanghua, the photosynthetic efficiency of the rice in the booting stage is remarkably high Yu Huanghua, which shows that the HPY1 is closely related to the photosynthesis of the rice; the biomass in the mature period is obviously larger than that of Huanghua, which shows that HPY1 is closely related to the biomass of rice, and the yield of rice can be improved by improving the expression quantity of HPY 1. Therefore, the HPY1 gene provides powerful means and tools for breeding rice high-yield and high-light-efficiency new varieties by using molecular marker assisted breeding and genetic engineering methods, and has great application potential.
Description
Technical Field
The invention relates to the technical field of improving plant yield, in particular to a method for improving photosynthetic efficiency and yield of rice.
Background
With the continuous development of science and technology, the living standard of human beings is continuously improved. However, with the continuous growth of population, the environmental conditions are increasingly severe, and the grain safety problem is still prominent. Rice is one of three grain crops in the world, and is one of the core elements for solving the gap of grains. Therefore, the rice yield is increased, and the method is important for ensuring the grain safety. There are several ways to increase rice yield, and it is one of the important ways to increase rice yield by digging dominant genes related to yield traits.
Therefore, there is a need to develop a new method for improving photosynthetic efficiency and yield of rice.
Disclosure of Invention
The invention aims to provide a method for improving photosynthetic efficiency and yield of rice, which successfully clones a novel high-yield and high-light-efficiency gene HPY1 (High photosynthesis and yield 1), and the gene participates in regulating and controlling photosynthetic efficiency and biomass of the rice, so that the yield of the rice is increased, and the method can be widely applied to cultivation of novel varieties of the high-yield rice. The photosynthetic efficiency, biomass and yield of rice can be improved by increasing the expression level of HPY 1.
In order to achieve the above purpose, the present invention provides the following technical solutions:
in a first aspect of the present invention, there is provided a method for improving photosynthetic efficiency and yield of rice, the method comprising:
the HPY1 gene is over expressed in rice, wherein the nucleotide sequence of the HPY1 gene is shown as SEQ ID NO. 2.
Further, the overexpression of the HPY1 gene in rice comprises:
inserting an HPY1 gene into a basic vector to construct a recombinant vector containing HPY 1;
recombinant vectors containing HPY1 are transformed into crop tissues or cells.
Further, the base vector comprises a crop modification vector comprising one of a binary agrobacterium vector comprising one of pCAMBIA1301, pCAMBIA2301 and pH7WG2D and a vector useful for crop microprojectile bombardment.
Further, the transformation method includes one of microinjection, agrobacterium-mediated genetic transformation, via Ti plasmid, ri plasmid, or viral vector.
Further, the over-expression of the HPY1 gene in rice bodies specifically comprises:
obtaining a gene fragment with a nucleotide sequence shown as SEQ ID NO. 2;
inserting the gene fragment into an expression vector pCAMBIA1301-35SN containing a strong promoter through recombination reaction, and screening positive clones by using a marker gene on the expression vector to obtain a recombinant expression vector HPY1-OE;
transferring the recombinant expression vector HPY1-OE into EHA105 agrobacterium, and screening by utilizing the characteristics of the expression vector and the agrobacterium to obtain a positive agrobacterium strain which can be used for infecting rice tissues;
infecting rice yellow-Huazhan callus by the positive agrobacterium strain, and performing dark culture on a screening culture medium of hygromycin to obtain positive transgenic callus;
differentiation, rooting and transplanting culture are carried out on the positive callus to obtain T 0 Generating transgenic plants;
t with improved photosynthetic efficiency and yield of rice is obtained by conventional molecular marker detection and rice cultivation method 1 And (5) replacing plants.
In a second aspect of the present invention, there is provided a high yield, high light efficiency gene HPY1, said high yield, high light efficiency gene HPY1 having a nucleotide sequence as shown in SEQ ID NO. 2.
In a third aspect of the invention, there is provided an HPY1 protein, the nucleotide sequence of which is shown in SEQ ID NO. 2.
In a fourth aspect of the invention, there is provided a recombinant vector comprising said high-yield, high-light-efficiency gene HPY 1.
Further, the recombinant vector comprises a recombinant expression vector HPY1-OE.
In a fifth aspect of the invention, a transformant, transgenic line comprising the recombinant vector is provided.
In a sixth aspect of the invention, the application of the high-yield and high-light-efficiency gene HPY1, the recombinant vector, the transformant and the transgenic line in cultivation for improving photosynthetic efficiency and yield of rice is provided.
One or more technical solutions in the embodiments of the present invention at least have the following technical effects or advantages:
the invention provides a method for improving photosynthetic efficiency and yield of rice, which regulates and controls photosynthetic efficiency and biomass of the rice by a method of over-expressing HPY1, and shows that the gene can be used as a marker for improving photosynthetic efficiency and biomass of the rice to be applied to breeding of crops with high yield and high light efficiency of the rice. Therefore, the HPY1 gene provides powerful means and tools for breeding rice high-yield and high-light-efficiency new varieties by using molecular marker assisted breeding and genetic engineering methods, and has great application potential.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments will be briefly described below, and it is obvious that the drawings in the following description are some embodiments of the present invention, and other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is a diagram of the HPY1 gene structure, containing an HTH-3 type DNA binding domain;
FIG. 2 is a model structure of the HPY1 gene in overexpressed rice material;
FIG. 3 is a graph showing photosynthetic efficiency behavior of HPY1 overexpressing materials during booting; wherein a is the Rubisco enzyme activity performance of the HPY1 overexpressing material and b is the net photosynthetic rate performance of the HPY1 overexpressing material;
FIG. 4 is grain and yield performance of HPY1 overexpressing material at maturity; wherein a is a plant and yield map of the HPY1 overexpressing material, b is a biomass representation of the HPY1 overexpressing material, c is a net photosynthetic rate representation of the HPY1 overexpressing material, d is a single plant yield representation of the HPY1 overexpressing material, and e is a daily yield representation of the HPY1 overexpressing material.
Detailed Description
The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.
Throughout the specification, unless specifically indicated otherwise, the terms used herein should be understood as meaning as commonly used in the art. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification will control.
Unless specifically indicated otherwise, the various raw materials, reagents, instruments, equipment, etc., used in the present invention are commercially available or may be obtained by existing methods.
The rice in the following examples was cultivated according to the normal management method: firstly, fresh rice seeds need to be soaked for germination acceleration, the seeds can be sowed in a prepared seedling bed after being exposed and white, and 4 leaves of the seedlings can be transplanted to a field in a one-heart period.
The technical scheme of the embodiment of the application aims to solve the technical problems, and the overall thought is as follows:
the prior-stage radiation mutagenesis of 9311 in the laboratory is carried out to obtain a mutant material M50 with strong stalk, high light efficiency and high biomass. The material has obvious grain change, utilizes the high-light-efficiency variety Huanghua to hybridize and backcross to construct near-isogenic line, and compared with Huanghua, the near-isogenic line has 32.7 percent of photosynthetic efficiency, 41.4 percent of biomass and 20.3 percent of yield. In order to clone the high-yield high-light-efficiency gene, M50 is hybridized with Huanghua to construct a positioning population, a novel high-yield high-light-efficiency gene HPY1 (High photosynthesis and yield 1) is successfully cloned by taking the dry weight of a single plant as the property, and the gene participates in regulating and controlling the photosynthetic efficiency and biomass of rice, so that the yield of the rice is increased, and the method can be widely applied to cultivation of novel varieties of high-yield rice. Using cDNA of rice mutant material M50 as template, using primer shown in SEQ ID NO.5-6 to make PCR amplification so as to obtain gene fragment whose nucleotide sequence is shown in SEQ ID NO. 2; in other embodiments, the gene fragment with the nucleotide sequence shown in SEQ ID NO.2 can be directly synthesized, and cDNA of the rice mutant material M50 is not required to be used as a template.
The invention discovers through the in vivo differential expression of HPY1 gene in rice: after the HPY1 is over-expressed in the body of the excellent rice variety Huanghua, the photosynthetic efficiency of the rice in the booting stage is remarkably high Yu Huanghua, which shows that the HPY1 is closely related to the photosynthesis of the rice; the biomass in the mature period is obviously larger than that of Huanghua, which shows that HPY1 is closely related to the biomass of rice; increasing the expression level of HPY1 can increase the yield of rice. The functional domain of HPY1 is highly conserved in other important food crops (wheat, corn, etc.), indicating that the gene may have similar molecular mechanisms in terms of the regulation of yield of other crops. HPY1 may thus also attempt to be applied to yield enhancement of other crops.
Thus, according to an exemplary embodiment of the present invention, there is provided a high-yield, high-light-efficiency gene HPY1, which high-yield, high-light-efficiency gene HPY1 has a nucleotide sequence as shown in SEQ ID NO. 2.
The high-yield and high-light-efficiency gene HPY1 has the following characteristics:
(1) The nucleotide sequence is a genome base sequence shown as SEQ ID NO.1
(2) The nucleotide sequence is a transcription sequence shown as SEQ ID NO. 2;
the nucleotide sequence shown in SEQ ID No.1 consists of 1912 bases and includes an exon, an intron and a 3' UTR.
The nucleotide sequence shown in SEQ ID NO.3 is a cDNA coding sequence.
According to another exemplary embodiment of the present invention, there is provided an HPY1 protein, a protein involved in regulation of photosynthetic efficiency and biomass of rice, wherein a tag as shown in Table 1 may be attached to the amino-terminus or the carboxyl-terminus of the protein sequence for facilitating research and utilization of the HPY1 protein. The amino acid sequence of the HPY1 protein is shown as SEQ ID NO. 4.
TABLE 1 tags and amino acid sequences thereof
| Label (Label) | Residues | Sequence(s) |
| Poly-Arg | 5-6 (usually 5) | RRRRR |
| Poly-His | 2-10 (usually 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tagⅡ | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
HPY1 is a gene capable of remarkably increasing photosynthetic efficiency and biomass of rice, so that the yield of the rice is increased, and the method has important significance in cultivation of high-yield and high-light-efficiency varieties of the rice.
According to still another exemplary embodiment of the present invention, there is provided a method for improving photosynthetic efficiency and yield of rice, the method comprising:
the HPY1 gene is over expressed in rice, wherein the nucleotide sequence of the HPY1 gene is shown as SEQ ID NO. 2.
In the above technical scheme, the overexpression of the HPY1 gene in rice bodies comprises:
inserting an HPY1 gene into a basic vector to construct a recombinant vector containing HPY 1;
recombinant vectors containing HPY1 are transformed into crop tissues or cells.
The basic carrier comprises a crop transformation carrier, the crop transformation carrier comprises one of a binary agrobacterium carrier and a carrier which can be used for crop microprojectile bombardment, and the binary agrobacterium carrier comprises one of pCAMBIA1301, pCAMBIA2301 and pH7WG 2D; the transformation method includes one of microinjection, agrobacterium-mediated genetic transformation, via Ti plasmid, ri plasmid, or viral vector.
In order to achieve the purpose of improving crop yield by utilizing the HPY1 gene, any promoter which is helpful for changing the expression of the HPY1 gene, such as a cauliflower mosaic virus (CAMV) 35S promoter, a Ubiquitin (Ubiquitin) gene promoter (pUbi) and the like, can be added before the gene start site when constructing a vector, and in addition, the purpose of differential expression can be achieved by adding an enhancer. Whatever the way it is, it is necessary to ensure the correctness of the coding sequence in order to obtain the correct HPY1 protein structure.
Those containing marker genes such as: the vectors of GUS gene, GFP gene, hygromycin resistance gene, herbicide resistance gene and the like construct a recombinant vector, so that the method is more beneficial to experimental operation and later crop screening and selection.
As a specific embodiment, the overexpression of the HPY1 gene in rice plants specifically comprises:
obtaining a gene fragment with a nucleotide sequence shown as SEQ ID NO. 2; specifically, the gene fragment with the nucleotide sequence shown as SEQ ID NO.2 can be directly synthesized;
inserting the gene fragment into an expression vector pCAMBIA1301-35SN containing a strong promoter through recombination reaction, and screening positive clones by using a marker gene on the expression vector to obtain a recombinant expression vector HPY1-OE;
transferring the recombinant expression vector HPY1-OE into EHA105 agrobacterium, and screening by utilizing the characteristics of the expression vector and the agrobacterium to obtain a positive agrobacterium strain which can be used for infecting rice tissues;
infecting rice yellow-Huazhan callus by the positive agrobacterium strain, and performing dark culture on a screening culture medium of hygromycin to obtain positive transgenic callus;
differentiation, rooting and transplanting culture are carried out on the positive callus to obtain T 0 Generating transgenic plants;
t with improved photosynthetic efficiency and yield of rice is obtained by conventional molecular marker detection and rice cultivation method 1 And (5) replacing plants.
The high-yield and high-light-efficiency gene HPY1, the recombinant vector, the transformant and the transgenic line can be applied to cultivation for improving photosynthetic efficiency and yield of rice.
A method for improving photosynthetic efficiency and yield of rice according to the present application will be described in detail with reference to examples and experimental data.
Example 1
1. Acquisition of full-Length fragment of HPY1 Gene
The rice cDNA is used as a template, a primer pair HPY1-F/R is designed, corresponding recombination sequences are added at the 5' ends of the primer pair HPY1-F/R, the primer sequences are shown in a table 2, PCR amplification is carried out, sequencing analysis is carried out on the products, and the nucleotide sequence of the amplified gene fragment is shown as SEQ ID NO. 2. In other embodiments, the gene fragment having the nucleotide sequence shown in SEQ ID NO.2 may be synthesized directly.
TABLE 2 primer sequences
2. Construction of HPY1 Gene overexpression vector
The gene fragment with the nucleotide sequence shown as SEQ ID NO.2 is inserted into an expression vector pCAMBIA1301-35SN (which can be purchased from vast plasmid platform, product number P0380) containing a strong promoter through recombination reaction, and positive clones are screened by using a marker gene on the vector, so as to obtain the recombinant expression vector HPY1-OE.
3. Acquisition of transgenic plants overexpressing the HPY1 Gene
The constructed HPY1-OE vector can be transferred into EHA105 agrobacterium (Agrobacterium tumefaciens) by an electrotransformation or heat shock method, and positive agrobacterium strains which can be used for infecting rice tissues are obtained by screening the vector and the agrobacterium self-characteristics.
Infecting rice yellow Huazhan callus by using a recombinant agrobacterium strain containing recombinant plasmid HPY1-OE, and performing dark culture on a screening culture medium containing 50mg/L hygromycin to obtain positive transgenic callus. Differentiation, rooting and transplanting of positive callus to obtain T 0 And (5) replacing transgenic plants. T is obtained by conventional molecular marker detection and rice cultivation method 1 And (5) replacing plants.
4. Yield detection of HPY1 gene over-expressed plants
(1) The expression level of the HPY1 gene was detected by qRT-PCR:
the 35S promoter is used as a plant strong promoter, so that the expression content of the target gene in a plant body can be improved. Total RNA from HPY1 over-expressed plants and wild type plants was obtained using conventional RNA extraction methods, and the corresponding cDNA was obtained using reverse transcription kit (purchased from Invitrogen). Detecting the expression level of HPY1 by qRT-PCR using a primer pair HPY 1-RT-F/R; PCR products of primer Actin-RT-F/R are used as internal references; the primer sequences are shown in Table 3.
TABLE 3 primer sequences
| Primer name | Primer sequence (5 '-3') |
| HPY1-RT-F | GGAGGGAAGGGAGAAGAAAGT(SEQ ID NO.7) |
| HPY1-RT-R | GCCGCCATACTTGACGATC(SEQ ID NO.8) |
| Actin-RT-F | GGAAGTACAGTGTCTGGATTGGAG(SEQ ID NO.9) |
| Actin-RT-R | TCTTGGCTTAGCATTCTTGGGT(SEQ ID NO.10) |
(2) Photosynthetic efficiency, biomass and individual yield statistics of transgenic plants:
soaking seeds, accelerating germination and transplanting the over-expression transgenic material and the wild type seeds of the yellow flower. Photosynthetic efficiency measurement was performed on the overexpressed transgenic material and the wild-type material (HHZ) during the seedling stage and booting stage, respectively. And after the material spike part is developed and mature, respectively harvesting the material. And then, examining the over-expression transgenic material and the wild type material, and counting the biomass, thousand seed weight, fruiting rate and single plant yield.
The photosynthetic efficiency of the HPY1 over-expression material in the booting stage is shown in a figure 3, which shows that HPY1 remarkably improves the activity of the Rubisco enzyme so as to improve the photosynthetic efficiency.
The grain and yield performance of the HPY1 over-expression material in the mature period is shown in figure 4, which shows that HPY1 improves biomass by improving photosynthetic efficiency, thereby improving rice yield.
Finally, it is also noted that the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus.
While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.
It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.
Sequence listing
<110> Wuhan university
<120> a method for improving photosynthetic efficiency and yield of rice
<160> 10
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1914
<212> DNA
<213> Rice (Oryza sativa)
<400> 1
atggagaaga aaaccaaaaa gaagaaccct agcaagaggg ggagaaaaag aggaggaaga 60
ggggagggaa gggagaagaa agtggaggag atcagcagca gcagcagcag ccgcggccgc 120
ggccgccgga ggatggcgcc ggtgaagaag tccaagaaag ggaagcgcaa gtccaaggac 180
tccggcaagc tcaagatcgt caagtatggc ggcggcgccc ctcccctccc ccccgagctc 240
cgcggcctcg acaccgagtg gtggtacacc ttcctccaca agcactccga gctaggtatc 300
gcttgttcct tcccaagatt tggtgcggtc gacgattctt taggttgatt gattgtttcg 360
gcgtgatatt ccaatcttgc aattccaatc taggtctgag cgcgccgtca gatgaggggg 420
aggcgttcag gtatttcttc aggacgtcga ggaggacgtt cgactacatc tgctcgattg 480
tgagggagga tttgatctct aggccgccgt cagggctgat caacatcgag gggaggctgc 540
tcagtgtgga gaagcaggtg gcgattgcca tgaggaggct ggcgtcgggc gattcgcagg 600
tgtcggtggg ggcggctttt ggtgtcgggc agtccaccgc ctcgcaggtg acttggaggt 660
tcatcgagtc gatggaagag cgggctcggc atcatctggt gtggcccggg caggagagga 720
tggagcagat caaggcgagg ttcgaggccg agtccggtct gccgaattgt tgcggcgcca 780
tcgatgcgac ccacattatc atgacgcttc ctgctgtcga gtcgtctgag gattggtgcg 840
acccggcgaa gaattacagc atgttcctgc aggggattgt tgatgatgag atgaggttta 900
ttgatattgt cactggttgg cctggcagca tgatgttttc gcggttgctg aagtgctctg 960
ggtttttcaa gcactgcgat gctgggactc gcttggatgg ccctgtcatg gtttcagcag 1020
agaatggaga aatcagggag tacattgttg gtaacaattg ttatccttta ctcccatggc 1080
ttatgactcc ctatgaaggg gagagtctgt ctgctccaat ggccagcttt aatgctaggc 1140
agaaggctgc aagaacgctt ggaccaagag cactgtcacg gctgaagggc tcctggagga 1200
tcttaaacaa agtcatgtgg aggcctgata agaacaagtt gccgagcata attcttgtct 1260
gctgtttgct tcacaatata atcatagact gtgaagacga actgcttcca gatgtacaac 1320
ttccagatca ccatgatact ggttatagtg aagagaagtg cgagcaagtg gatcctaatg 1380
gcaagataat gagagatgtc attacaggat atcttcaaat ctaagaagct tcccattgaa 1440
cttagctaag ctgactggca gtactctgga gttgcaagaa ggcatctctg ttcttatgtt 1500
tttctcctca gttgtccttg ttgtaatcag acctgctggt ctccattcgg taaagattag 1560
caatgaaata attcagttag gaattagcta gctcaggagc aaactatctc ttccttgagt 1620
taaggaaaaa atgttaatgt gttcatggtg atgacaatct ccatcatttt gaggtacaag 1680
atatatcagt ggtcaattgc tttgaatgaa ggaaatcgcc tttaaggaga gtagctattc 1740
aactttgttt tataaatgtt tagatttgca taatatagta aaactcatgc tcgcatgtta 1800
ttaaagcata tccaagaaaa atagtaacct atatatgaca tgttgagttg agtgaactag 1860
tcttggatgt acatcatctc attttcattt tattgcaagg ctattgtttt ctaa 1914
<210> 2
<211> 1816
<212> DNA
<213> Rice (Oryza sativa)
<400> 2
atggagaaga aaaccaaaaa gaagaaccct agcaagaggg ggagaaaaag aggaggaaga 60
ggggagggaa gggagaagaa agtggaggag atcagcagca gcagcagcag ccgcggccgc 120
ggccgccgga ggatggcgcc ggtgaagaag tccaagaaag ggaagcgcaa gtccaaggac 180
tccggcaagc tcaagatcgt caagtatggc ggcggcgccc ctcccctccc ccccgagctc 240
cgcggcctcg acaccgagtg gtggtacacc ttcctccaca agcactccga gctaggtctg 300
agcgcgccgt cagatgaggg ggaggcgttc aggtatttct tcaggacgtc gaggaggacg 360
ttcgactaca tctgctcgat tgtgagggag gatttgatct ctaggccgcc gtcagggctg 420
atcaacatcg aggggaggct gctcagtgtg gagaagcagg tggcgattgc catgaggagg 480
ctggcgtcgg gcgattcgca ggtgtcggtg ggggcggctt ttggtgtcgg gcagtccacc 540
gcctcgcagg tgacttggag gttcatcgag tcgatggaag agcgggctcg gcatcatctg 600
gtgtggcccg ggcaggagag gatggagcag atcaaggcga ggttcgaggc cgagtccggt 660
ctgccgaatt gttgcggcgc catcgatgcg acccacatta tcatgacgct tcctgctgtc 720
gagtcgtctg aggattggtg cgacccggcg aagaattaca gcatgttcct gcaggggatt 780
gttgatgatg agatgaggtt tattgatatt gtcactggtt ggcctggcag catgatgttt 840
tcgcggttgc tgaagtgctc tgggtttttc aagcactgcg atgctgggac tcgcttggat 900
ggccctgtca tggtttcagc agagaatgga gaaatcaggg agtacattgt tggtaacaat 960
tgttatcctt tactcccatg gcttatgact ccctatgaag gggagagtct gtctgctcca 1020
atggccagct ttaatgctag gcagaaggct gcaagaacgc ttggaccaag agcactgtca 1080
cggctgaagg gctcctggag gatcttaaac aaagtcatgt ggaggcctga taagaacaag 1140
ttgccgagca taattcttgt ctgctgtttg cttcacaata taatcataga ctgtgaagac 1200
gaactgcttc cagatgtaca acttccagat caccatgata ctggttatag tgaagagaag 1260
tgcgagcaag tggatcctaa tggcaagata atgagagatg tcattacagg atatcttcaa 1320
atctaagaag cttcccattg aacttagcta agctgactgg cagtactctg gagttgcaag 1380
aaggcatctc tgttcttatg tttttctcct cagttgtcct tgttgtaatc agacctgctg 1440
gtctccattc ggtaaagatt agcaatgaaa taattcagtt aggaattagc tagctcagga 1500
gcaaactatc tcttccttga gttaaggaaa aaatgttaat gtgttcatgg tgatgacaat 1560
ctccatcatt ttgaggtaca agatatatca gtggtcaatt gctttgaatg aaggaaatcg 1620
cctttaagga gagtagctat tcaactttgt tttataaatg tttagatttg cataatatag 1680
taaaactcat gctcgcatgt tattaaagca tatccaagaa aaatagtaac ctatatatga 1740
catgttgagt tgagtgaact agtcttggat gtacatcatc tcattttcat tttattgcaa 1800
ggctattgtt ttctaa 1816
<210> 3
<211> 1326
<212> DNA
<213> Rice (Oryza sativa)
<400> 3
atggagaaga aaaccaaaaa gaagaaccct agcaagaggg ggagaaaaag aggaggaaga 60
ggggagggaa gggagaagaa agtggaggag atcagcagca gcagcagcag ccgcggccgc 120
ggccgccgga ggatggcgcc ggtgaagaag tccaagaaag ggaagcgcaa gtccaaggac 180
tccggcaagc tcaagatcgt caagtatggc ggcggcgccc ctcccctccc ccccgagctc 240
cgcggcctcg acaccgagtg gtggtacacc ttcctccaca agcactccga gctaggtctg 300
agcgcgccgt cagatgaggg ggaggcgttc aggtatttct tcaggacgtc gaggaggacg 360
ttcgactaca tctgctcgat tgtgagggag gatttgatct ctaggccgcc gtcagggctg 420
atcaacatcg aggggaggct gctcagtgtg gagaagcagg tggcgattgc catgaggagg 480
ctggcgtcgg gcgattcgca ggtgtcggtg ggggcggctt ttggtgtcgg gcagtccacc 540
gcctcgcagg tgacttggag gttcatcgag tcgatggaag agcgggctcg gcatcatctg 600
gtgtggcccg ggcaggagag gatggagcag atcaaggcga ggttcgaggc cgagtccggt 660
ctgccgaatt gttgcggcgc catcgatgcg acccacatta tcatgacgct tcctgctgtc 720
gagtcgtctg aggattggtg cgacccggcg aagaattaca gcatgttcct gcaggggatt 780
gttgatgatg agatgaggtt tattgatatt gtcactggtt ggcctggcag catgatgttt 840
tcgcggttgc tgaagtgctc tgggtttttc aagcactgcg atgctgggac tcgcttggat 900
ggccctgtca tggtttcagc agagaatgga gaaatcaggg agtacattgt tggtaacaat 960
tgttatcctt tactcccatg gcttatgact ccctatgaag gggagagtct gtctgctcca 1020
atggccagct ttaatgctag gcagaaggct gcaagaacgc ttggaccaag agcactgtca 1080
cggctgaagg gctcctggag gatcttaaac aaagtcatgt ggaggcctga taagaacaag 1140
ttgccgagca taattcttgt ctgctgtttg cttcacaata taatcataga ctgtgaagac 1200
gaactgcttc cagatgtaca acttccagat caccatgata ctggttatag tgaagagaag 1260
tgcgagcaag tggatcctaa tggcaagata atgagagatg tcattacagg atatcttcaa 1320
atctaa 1326
<210> 4
<211> 441
<212> PRT
<213> Rice (Oryza sativa)
<400> 4
Met Glu Lys Lys Thr Lys Lys Lys Asn Pro Ser Lys Arg Gly Arg Lys
1 5 10 15
Arg Gly Gly Arg Gly Glu Gly Arg Glu Lys Lys Val Glu Glu Ile Ser
20 25 30
Ser Ser Ser Ser Ser Arg Gly Arg Gly Arg Arg Arg Met Ala Pro Val
35 40 45
Lys Lys Ser Lys Lys Gly Lys Arg Lys Ser Lys Asp Ser Gly Lys Leu
50 55 60
Lys Ile Val Lys Tyr Gly Gly Gly Ala Pro Pro Leu Pro Pro Glu Leu
65 70 75 80
Arg Gly Leu Asp Thr Glu Trp Trp Tyr Thr Phe Leu His Lys His Ser
85 90 95
Glu Leu Gly Leu Ser Ala Pro Ser Asp Glu Gly Glu Ala Phe Arg Tyr
100 105 110
Phe Phe Arg Thr Ser Arg Arg Thr Phe Asp Tyr Ile Cys Ser Ile Val
115 120 125
Arg Glu Asp Leu Ile Ser Arg Pro Pro Ser Gly Leu Ile Asn Ile Glu
130 135 140
Gly Arg Leu Leu Ser Val Glu Lys Gln Val Ala Ile Ala Met Arg Arg
145 150 155 160
Leu Ala Ser Gly Asp Ser Gln Val Ser Val Gly Ala Ala Phe Gly Val
165 170 175
Gly Gln Ser Thr Ala Ser Gln Val Thr Trp Arg Phe Ile Glu Ser Met
180 185 190
Glu Glu Arg Ala Arg His His Leu Val Trp Pro Gly Gln Glu Arg Met
195 200 205
Glu Gln Ile Lys Ala Arg Phe Glu Ala Glu Ser Gly Leu Pro Asn Cys
210 215 220
Cys Gly Ala Ile Asp Ala Thr His Ile Ile Met Thr Leu Pro Ala Val
225 230 235 240
Glu Ser Ser Glu Asp Trp Cys Asp Pro Ala Lys Asn Tyr Ser Met Phe
245 250 255
Leu Gln Gly Ile Val Asp Asp Glu Met Arg Phe Ile Asp Ile Val Thr
260 265 270
Gly Trp Pro Gly Ser Met Met Phe Ser Arg Leu Leu Lys Cys Ser Gly
275 280 285
Phe Phe Lys His Cys Asp Ala Gly Thr Arg Leu Asp Gly Pro Val Met
290 295 300
Val Ser Ala Glu Asn Gly Glu Ile Arg Glu Tyr Ile Val Gly Asn Asn
305 310 315 320
Cys Tyr Pro Leu Leu Pro Trp Leu Met Thr Pro Tyr Glu Gly Glu Ser
325 330 335
Leu Ser Ala Pro Met Ala Ser Phe Asn Ala Arg Gln Lys Ala Ala Arg
340 345 350
Thr Leu Gly Pro Arg Ala Leu Ser Arg Leu Lys Gly Ser Trp Arg Ile
355 360 365
Leu Asn Lys Val Met Trp Arg Pro Asp Lys Asn Lys Leu Pro Ser Ile
370 375 380
Ile Leu Val Cys Cys Leu Leu His Asn Ile Ile Ile Asp Cys Glu Asp
385 390 395 400
Glu Leu Leu Pro Asp Val Gln Leu Pro Asp His His Asp Thr Gly Tyr
405 410 415
Ser Glu Glu Lys Cys Glu Gln Val Asp Pro Asn Gly Lys Ile Met Arg
420 425 430
Asp Val Ile Thr Gly Tyr Leu Gln Ile
435 440
<210> 5
<211> 42
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
caggtcgact ctagaggatc catggagaag aaaaccaaaa ag 42
<210> 6
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
gatgagtttc tgctcggatc cttagatttg aagatatcct gta 43
<210> 7
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
ggagggaagg gagaagaaag t 21
<210> 8
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
gccgccatac ttgacgatc 19
<210> 9
<211> 24
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
ggaagtacag tgtctggatt ggag 24
<210> 10
<211> 22
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
tcttggctta gcattcttgg gt 22
Claims (8)
1. A method for increasing photosynthetic efficiency and yield in rice comprising:
the HPY1 gene is over expressed in rice, wherein the nucleotide sequence of the HPY1 gene is shown as SEQ ID NO. 2.
2. The method for improving photosynthetic efficiency and yield of rice of claim 1 wherein the overexpression of HPY1 gene in rice comprises:
inserting an HPY1 gene into a basic vector to construct a recombinant vector containing HPY 1;
recombinant vectors containing HPY1 are transformed into crop tissues or cells.
3. A method of increasing photosynthetic efficiency and yield of rice as claimed in claim 2 wherein the base vector comprises a crop modification vector comprising one of a binary agrobacterium vector comprising one of pCAMBIA1301, pCAMBIA2301 and pH7WG2D and a vector useful for crop microprojectile bombardment; the transformation method includes one of microinjection, agrobacterium-mediated genetic transformation, via Ti plasmid, ri plasmid, or viral vector.
4. The method for improving photosynthetic efficiency and yield of paddy rice according to claim 1, wherein the overexpression of HPY1 gene in paddy rice comprises:
obtaining a gene fragment with a nucleotide sequence shown as SEQ ID NO. 2;
inserting the gene fragment into an expression vector pCAMBIA1301-35SN containing a strong promoter through recombination reaction, and screening positive clones by using a marker gene on the expression vector to obtain a recombinant expression vector HPY1-OE;
transferring the recombinant expression vector HPY1-OE into EHA105 agrobacterium, and screening by utilizing the characteristics of the expression vector and the agrobacterium to obtain a positive agrobacterium strain which can be used for infecting rice tissues;
infecting rice yellow-Huazhan callus by the positive agrobacterium strain, and performing dark culture on a screening culture medium of hygromycin to obtain positive transgenic callus;
differentiation, rooting and transplanting culture are carried out on the positive callus to obtain T 0 Generating transgenic plants;
t with improved photosynthetic efficiency and yield of rice is obtained by conventional molecular marker detection and rice cultivation method 1 And (5) replacing plants.
5. A gene HPY1, characterized in that said gene HPY1 has a nucleotide sequence as shown in SEQ ID No. 2.
6. The HPY1 protein is characterized in that the nucleotide sequence of the HPY1 protein is shown as SEQ ID NO. 2.
7. A recombinant vector comprising the gene HPY1 of claim 5.
8. Use of the recombinant vector of claim 7 and gene HPY1 of claim 5 in cultivation to increase photosynthetic efficiency and yield of rice.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210285896.7A CN114807162B (en) | 2022-03-22 | 2022-03-22 | Method for improving photosynthetic efficiency and yield of rice |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210285896.7A CN114807162B (en) | 2022-03-22 | 2022-03-22 | Method for improving photosynthetic efficiency and yield of rice |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114807162A CN114807162A (en) | 2022-07-29 |
| CN114807162B true CN114807162B (en) | 2023-07-18 |
Family
ID=82530322
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210285896.7A Active CN114807162B (en) | 2022-03-22 | 2022-03-22 | Method for improving photosynthetic efficiency and yield of rice |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114807162B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110894220B (en) * | 2018-09-12 | 2022-03-22 | 中国科学院遗传与发育生物学研究所 | Application of seed-related protein in regulating and controlling plant seed size |
| CN111434679B (en) * | 2019-01-10 | 2022-03-22 | 中国科学院遗传与发育生物学研究所 | Application of plant type related protein in regulation and control of plant type |
| CN112812163B (en) * | 2021-03-05 | 2022-08-30 | 贵州大学 | Application of transcription factor in rice breeding and rice breeding method |
-
2022
- 2022-03-22 CN CN202210285896.7A patent/CN114807162B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114807162A (en) | 2022-07-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111778265B (en) | Mutant gene, mutant, expression vector and application of zearalenone oxidase | |
| CN110951748B (en) | Rice brown planthopper resistant gene Bph37, protein, vector, host cell, molecular marker, method and application | |
| CN112795588B (en) | Application of OsSGD1 protein in regulation of rice grain size | |
| CN108795943B (en) | Plant specific expression promoter POssalt2 and application thereof | |
| CN103172715B (en) | Plant epidermal hair controlling gene and application thereof | |
| CN114369147A (en) | Application of BFNE gene in tomato plant type improvement and biological yield improvement | |
| CN110819602B (en) | Application of rice tRNA isopentenyl transferase gene OsIPT9 in resisting brown planthopper | |
| CN107325161B (en) | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof | |
| CN109943579B (en) | Lilium regale LrCCoAOMT gene and application thereof | |
| CN109628484B (en) | Method for enhancing development of lateral roots of plants and increasing total surface area of root systems of plants | |
| CN110684088B (en) | Protein ZmbZIPa3 and application of coding gene thereof in regulating and controlling plant growth and development and stress tolerance | |
| CN108864265B (en) | Application of protein TabZIP60 in regulation and control of plant root system development | |
| CN114807162B (en) | Method for improving photosynthetic efficiency and yield of rice | |
| CN109207485A (en) | Application of the OsAPS1 gene in improvement Rice Resistance characteristic of disease | |
| CN108359670A (en) | Improve microRNA genes and its application of arsenic stress rice tolerance | |
| CN108841861B (en) | Application of protein TaNADH-GoGAT in regulation and control of plant root system development | |
| CN114276426A (en) | Protein and biological material related to rice yield and application of protein and biological material in rice yield improvement | |
| CN105802994A (en) | RNAi (RNA interfere) plant expression vector and application thereof | |
| CN105732785B (en) | Application of protein GhDHN1 in regulation and control of plant stress resistance | |
| CN116789785B (en) | High-yield and high-light-efficiency gene FarL a of long stamen wild rice and application thereof | |
| CN112175054B (en) | Method for regulating rice plant type | |
| CN111303260B (en) | Plant stress resistance related protein OsC3HC4, coding gene and application | |
| CN109536515B (en) | Glycine protein-rich gene of soybean plant and application thereof | |
| US20230365985A1 (en) | PROTEINS AND BIOLOGICAL MATERIALS RELATED TO RICE (Oryza sativa L.) YIELD, AND USE THEREOF IN RICE YIELD INCREASE | |
| CN114276425B (en) | OsDREB1C and application of coding gene thereof in improving rice photosynthetic efficiency |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |